proteinsSTRUCTURE O FUNCTION O BIOINFORMATICS

STRUCTURE NOTE

Crystal structure and fluorescence studiesreveal the role of helical dimeric interface ofStaphylococcal FabG1 in positivecooperativity for NADPHDebajyoti Dutta, Sudipta Bhattacharyya, and Amit Kumar Das*

Department of Biotechnology, Indian Institute of Technology Kharagpur, Kharagpur 721032, West Bengal, India

Key words: dimerization axis; fluorescence resonance energy transfer; hypsochromic shift; positive cooperativity; Staphylococcus

aureus; tryptophan fluorescence.

INTRODUCTION

Staphylococcus aureus is one of the leading causes of

nosocomial infection along with several life threatening

diseases like meningitis, osteomyelitis, pneumonia, toxic

shock syndrome and so forth. Staphylococcus alters its

cell membrane composition in due course of its infection

to avoid the effect of the deleterious molecules generated

by the host1 and become resistant to several antibiotics

because of its membrane lipid homeostasis.2,3 This

unambiguously indicates the importance of the fatty acid

synthesis in this Gram-positive coccus. The sole source of

fatty acid in staphylococcus is governed by the type II

fatty acid synthesis pathway and thus the understanding

the FASII is in demand to combat the Staphylococcal

infection.4 More recently, the essentiality of type II fatty

acid synthesis (FAS-II) has been validated for S. aureus.5

FAS-II, prevalent among prokaryotes, is carried out by a set

of enzymes. The four enzymes of the elongation pathway are

b-Ketoacyl-ACP synthase (FabH), b-Ketoacyl-ACP reductase

(FabG), b-Hydroxyacyl-ACP dehydratase (FabA/FabZ), and

enoyl-ACP reductase (FabI). In second step of FAS-II, FabG

reduces b-Ketoacyl-ACP to b-hydroxy-ACP in expense of

NADPH oxidation. The genome of S. aureus encodes two

fabG genes annotated as SafabG1 (SAOUHSC_01199) and

SafabG2 (SAOUHSC_01257). The gene SafabG1 specifically

exists in an operon containing enzymes required for FAS-II

pathway. SaFabG1 is a 25.44 kDa protein and can be catego-

rized as low-molecular weight FabG.6 Moreover, SaFabG1

belongs to the classical SDR family.7

FabG exists as dimer or tetramer in solution although

their quaternary state sometimes depends on their con-

centrations.8,9 Escherichia coli FabG,10,11 Plasmodium

falciparum FabG,12 and Brassica napus FabG13 are tet-

ramer in solution. These enzymes exhibit negative homo-

tropic cooperativity for NADPH. Mechanism of negative

cooperativity of FabG tetramers are explored and

explained.11,12 In contrast, Mycobacterium tuberculosis

FabG1 exists as dimer in solution.8 With intriguing odd-

ity, this enzyme exhibits positive homotropic cooperativ-

ity for NADPH.14 Hence, it is apparent that the multi-

meric state of FabG directs their responsiveness towards

NADPH. To answer the question that why dimeric FabG

exhibits positive homotropic cooperativity we have cho-

sen SaFabG1 that exists as dimer in solution.

In the present study, SaFabG1:NADPH complex struc-

ture is determined to identify the key interactions

between SaFabG1 and NADPH. Tryptophan fluorescence

enabled us to understand the way NADPH interacts with

SaFabG1. Using crystal structure of SaFabG1:NADPH

Additional Supporting Information may be found in the online version of this

article.

Grant sponsors: Department of Biotechnology, Government of India, Department

of Science and Technology, Government of India, IIT Kharagpur, India.

*Correspondence to: Amit Kumar Das, Department of Biotechnology, Indian

Institute of Technology Kharagpur, Kharagpur 721302, West Bengal, India.

E-mail: amitk@hijli.iitkgp.ernet.in

Received 1 November 2011; Revised 8 December 2011; Accepted 16 December

2011

Published online 9 January 2012 in Wiley Online Library (wileyonlinelibrary.

com). DOI: 10.1002/prot.24024

1250 PROTEINS VVC 2012 WILEY PERIODICALS, INC.

complex complemented with tryptophan fluorescence

results, we have identified the dimerization axis and have

explained that how the dimerization axis affects NADPH

binding. Both crystal structure and fluorescence data

bring forth the role of a4 and a5 helices in NADPH

mediated cooperative response.

MATERIALS AND METHODS

Cloning overexpression and purification ofSaFabG1

SaFabG1 was amplified by PCR using S. aureus

NCTC8325 genomic DNA as the template with the

primer pair 50 CGCGGATCCATGACTAAGAGTGCTT-

TAGTAAC 30 (BamHI site) and 50 CCCAAGCTTTTA-

CATGTACATTCCACCATTTAC 30 (HindIII site). The

amplified product was cloned into the BamHI and Hin-

dIII sites of the expression vector pQE30 (Qiagen) with

additional six consecutive histidine residues to the N-ter-

minus of the desired protein. The recombinant vector

was then transformed into chemically competent E. coli

M15 (pREP4) cells and subsequently selected on ampicil-

lin (100 lg/mL) and kanamycin (25 lg/mL) plates. The

positive clones were verified using DNA sequencing.

For overexpression, E. coli cells anchoring pQE30-

SafabG1 construct was grown at 378C in 2 L LB media

with antibiotics until the OD600 reaches to 0.6. Cells were

induced with 100 lM IPTG and further incubated for 4 h.

Cells were harvested at 8000 rpm for 10 min. All the sub-

sequent steps were carried out at 48C. Harvested cells were

resuspended with resuspension buffer (10 mM Tris-HCl

pH 7.9, 300 mM NaCl and 10 mM imidazole) supple-

mented with protease inhibitor cocktail (0.1 mM each leu-

peptin, pepstatin, and aprotinin and 0.02 mM phenyl-

methylsulfonyl fluoride). E. coli cells were lysed using

ultrasonication and centrifuged at 14,000 rev/min for 30

min. Supernatant was collected and loaded onto Ni-

Sepharose high performance affinity matrix (GE Health-

care Biosciences) preequilibrated with resuspension buffer.

After loading the supernatant, the column was extensively

washed with resuspension buffer. Buffer A (10 mM Tris

HCl pH 7.9, 300 mM NaCl, and 50 mM Imidazole) was

subsequently passed through the column to remove any

nonspecifically bound contaminant. The protein was

finally eluted with elution buffer (10 mM Tris-HCl, pH

7.9, 300 mM NaCl, and 300 mM Imidazole). Eluted pro-

tein was subjected to gel filtration chromatography using

superdex 200 prep-grade matrix in a 16/70 column (GE

Healthcare Biosciences) on an AKTAprime Plus system

(GE Healthcare Biosciences) preequilibrated with buffer B

(10 mM Tris-HCl, pH 7.9, 150 mM NaCl). Each fraction

of 2 mL was collected at a flow rate 1 mL/min. The frac-

tions containing the desired protein were pooled together

and kept for further use. Protein purity was checked using

12% SDS-PAGE and the protein concentration was meas-

ured by Bradford estimation. The molecular weight of

SaFabG1 was determined using gel filtration chromatogra-

phy (Supporting Information Fig. S1).

Crystallization and structure determination

SaFabG1 protein, purified from the gel filtration chro-

matography, was concentrated to 30 mg/mL using a 10

kDa cutoff Vivaspin 20 concentrator (GE Healthcare).

SaFabG1 was incubated with NADPH in 1:5 molar ratio at

278C for 1 h. Preliminary screening for crystallization con-

ditions was performed using Crystal Screen, Crystal Screen

2 and Index solutions (Hampton Research, USA) using 96

well plate by sitting drop vapor diffusion method mixing 2

lL of protein solution with 2 lL of well solution. Two

conditions obtained from this initial screening were (i)

0.2M MgCl2, 0.1M Na-HEPES pH 7.5, 30% (v/v) PEG400

and (ii) 4M sodium formate. Both conditions were fine

screened in hanging drop vapor diffusion method mixing

2 lL of protein with 2 lL of well solution. Crystal from

the condition 0.2M MgCl2, 0.1M Na-HEPES Na pH 7.5,

40% (v/v) PEG400 (Fluka) diffracted up to 2.5 A. Full set

of diffraction data of holoSaFabG1 was collected using the

home source Rigaku MicroMax 007HF CuKa rotating an-

ode X-ray generator and Rigaku Raxis IV11 image plate

detector. Diffraction data were processed with XDS15 and

scaled with SCALA16 at H32 space group.

Structure of SaFabG1 was determined by molecular

replacement using S. aureus apoSaFabG1 structure (PDB

3OSU) in MOLREP.17 Iterative refinement and model

building was carried out by Refmac518 and Coot,19

respectively. Final model was validated with Procheck20

and SFcheck from CCP4 interface.21 Structure factor and

the coordinates of SaFabG1:NADPH complex was sub-

mitted to the PDB with PDB ID 3SJ7. Data collection

and refinement statistics are summarized in Table I. The

Models were visualized and analyzed by Pymol (http://

www.pymol.org) and PDBePISA,22 respectively.

Fluorescence titration of NADPH withSaFabG1

Fluorescence measurements were performed using Flu-

oromax-3 (Jobin Yvon) spectrofluorimeter. The excitation

wavelength was kept to 290 nm and the emission spectra

were scanned from 300 to 500 nm. Integration time of

0.5 s was used and the excitation monochromators were

set to 1.5 and 2 nM, respectively. SaFabG1 concentration

was kept 7.69 lM. NADPH concentration was varied

from 0 to 110 lM in total reaction volume of 1 mL.

SaFabG1 was incubated with different concentration of

NADPH in buffer F (10 mM Tris-HCl, pH 7.5, 150 mM

NaCl). Spectra were taken by subtracting the scan from

appropriate buffer blanks. NADPH fluorescence intensity,

minimum fluorescence intensity, and the highest

fluorescence intensity were designated as F, Fmin,

Revealing the Secret of SaFabG1 Positive Cooperativity

PROTEINS 1251

and Fmax, respectively. Data obtained from the

experiment were fitted to the Hill equation of the

form, F ¼ Fmin þ ðFmax � FminÞ ½c�nK 0þ½c�n

� �where [c] is

NADPH concentration and K0 is a constant comprising

of interaction factors and dissociation constant. Hill

constant is denoted by n. For LB plot ‘‘D Relative

Fluorescence’’ was calculated from F�Fmin

Fmax�Fmin

� �, and (D

Relative fluorescence)21 versus [NADPH]21 was plotted

to obtain the Lineweaver Burk plot. To obtain the num-

ber of NADPH binding site, logarithmic Hill plot of

logy

1�y

� �versus logð½c�Þ was carried out to fit the data

with the equation

logy

1� y

� �¼ n logð½c�Þ þ logðK 0Þ

Here y denotes the (F/Fmax) and the value of n is equiv-

alent to the number of binding site within 10–90% satura-

tion of the active site. Equilibrium constants obtained

from the fluorescence data are summarized in Table II.

Kinetic experiments

Initial rates of SaFabG1 reaction using both acetoacetyl-

CoA and NADPH as substrates were measured by moni-

toring the decrease of NADPH concentration at 340 nm at

278C in EvolutionTM 300 UV–Visible spectrophotometer

(Thermo Fisher scientific). All reactions were performed

in 50 mM Na-HEPES buffer pH 7.4 keeping the protein

concentration 16.52 lM in total reaction volume 500 lL.Apparent Km values for both b-acetoacetyl-CoA and

NADPH were determined by varying the one substrate

concentration while maintaining the other substrate con-

centration at a fixed saturating level. NADPH concentra-

tion was varied from 0.01 to 0.4 mM with fixed AcAcCoA

concentration at 0.72 mM and AcAcCoA concentration

was varied from 0.02 to 0.62 mM with fixed NADPH con-

centration at 0.5 mM. Data were fitted to the equation

y ¼ Vmax½S�nK 0 þ ½S�n

Here y denotes the OD340 and [S] denote the concen-

trations of the varying substrate. Lineweaver Burk plot

was carried out by plotting (OD340)21 versus [Sub-

strate]21. Kinetic parameters are summarized in Table II.

RESULTS

Overall crystal structure of SaFabG1:NADPH complex

Crystal of SaFabG1:NADPH binary complex belongs

to the space group H32 with two monomers in asymmet-

ric unit. Each monomer is perfectly superimposable and

consists of dinucleotide binding b-a-b Rossmann-fold

[Fig. 1(a)]. The overall structure of SaFabG1 consists of

seven centrally placed b strands (b3-b2-b1-b4-b5-b6-b7) flanked by six a helices namely a1, a2, a3, a4, a5,and a6. The crystallographic dimer is formed by the

interactions between the helices a4 and a5 [Fig. 1(b)].

Crystal packing reveals that SaFabG1 dimer of one asym-

metric unit makes contact with SaFabG1 dimer of

another asymmetric unit to form a tetrameric assembly

(Supporting Information Fig. S1). The tetramer has three

mutually perpendicular 2-fold axes designated as P, Q, and

R (Supporting Information Fig. S1). P-axis passes perpen-

dicularly through a series of hydrophobic beta core regions

separating two sets of parallel beta sheets of each

monomer. Q-axis consists of all hydrophobic interactions

Table IData Collection, Processing, and Refinement Parameters

Data collection parameters

Wavelength (�)1.54

Space group H32Resolution range (�) 19.85–2.50 (2.64–2.50)No. of observations (Total) 209,144 (30,160)No. of reflections (unique) 18,945 (2724)Completeness (%) 99.5 (99.2)Rmerge

a (%) 8.7 (79.2)I/r(I) 27.0 (3.4)Redundancy 11.0 (11.1)Unit cell parameters (�) a 5 b 5 126.48, c 5 176.95

a 5 b 5 908 g 5 1208No. of monomers in asymmetricunit (Z)

2

Refinement statisticsRwork

b (%) 18.0Rfree

b (%) 25.3No. of protein atoms 3562No. of ligand atoms 128No. of solvent atoms 93R.m.s.d bond length (�) 0.016R.m.s.d bond angles (8) 1.696

Ramachandran PlotMost favored region (%) 89.2Allowed region (%) 9.9Generously allowed region (%) 0.9Outlier region (%) 0.0

Values in parenthesis are for the highest resolution shells.aRmerge ¼

PIðhÞ � IðhÞf gj j=P IðhÞj j, where I (h) is observed intensity and {I(h)}

is the mean intensity of reflection h over all measurement of I (h).bRwork ¼

PFobsj j � Fcalcj jj j=P Fobsj j, where Fobs and Fcalc are observed and calcu-

lated structure factors, Rfree is the same as Rwork but 5% of the total reflections cho-

sen and omitted from refinement.

Table IIKinetic Parameters of NADPH and AcAcCoA Interactions with SaFabG1

Parameters Value with standard error

K0 (lM) 53.93 � 2.1a

n 2.09 � 0.10a

appKNADPH (lM) 38.31 � 2.33appKAcAcCoA (lM) 228.13 � 21.73kcat-NADPH (s21) 17.13 � 0.52kcat-AcAcCoA (s21) 17.30 � 1.56

aValues are measured from fluorescence data.

D. Dutta et al.

1252 PROTEINS

Figure 1Crystal structure of SaFabG1:NADPH complex: (a) Cartoon representation of SaFabG1 monomer without NADPH. (b) Cartoon representation of

SaFabG1 dimer in asymmetric unit. The dimerization axis is along Q-axis. Two monomers are shown in different colors. Distances between

nicotinamide moiety and Trp104 are shown. (c) Multiple sequence alignment of different low-molecular weight FabG (LMwFabG): catalytic

residues Asn111, Ser139, Tyr152, and Lys156 are indicated as asterisk. The primary structures of a4 (101–124) and a5 (149–171) within

Q-axis interface are underlined by black bar (sequence alignment was performed using ClustalW: www.ebi.ac.uk/Tools/msa/clustalw2/, and structure

sequence alignment was performed using ESPript: http://espript.ibcp.fr/ESPript/ESPript/). (d, e) The Q-axis interface consists of a4-a40 and a5-a50

are showing major hydrophobic interactions. (f) Interactions between NADPH and PEG400 molecules with SaFabG1 are shown. Difference density

(Fo-Fc) map is contoured at 1.7r. Adenosine moiety is surrounded by the loops b4-a4 loop and b3-a3 loop. The ribose phosphate interacts with

the residues of b2-a2 loop and b1-a1 loop. Diphosphate of NADPH is secured by the b1-a1 loop. Tyr152 and Lys156 interact with nicotinamide

ribose to orient the C4 carbon of the nicotinamide ring towards substrate. Ser139 stabilize the substrate and a hydride is transferred from C4 to b-keto group of fattyacyl chain. PEG400 mimics dodeca fattyacyl chain and sits near the active site.

Revealing the Secret of SaFabG1 Positive Cooperativity

PROTEINS 1253

making a four helix bundle-like structure with a4-a40,a5-a50. Dimeric interaction along Q-axis is also preferred

over P-axis because of the larger hydrophobic surface area

(1559.4 over 1491.5 A2) and lower calculated free-energy

(222.4 kcal/mol over 219.2 kcal/mol). Our structure-

based sequence alignment [Fig. 1(c)] indicates that the

positions of the hydrophobic residues Trp104, Val107,

Ile108, Leu112, Val115, Phe116 of a4 and Ala150, Ala154,

Ala157, Val159, Gly158, Ile160, Gly161, Leu162 of a5 are

conserved and responsible for strong hydrophobic interac-

tions between the two SaFabG1 monomers. Detailed

hydrophobic interacting residues are shown in Figure

1(d,e). In contrast, R-axis counts very less number of

interactions, mostly due to C-terminal regions.

The coenzyme NADPH is bound in syn- conformation

surrounded by the a4 and a5 helices and the loops join-

ing b1-a1, b2-a2, b3-a3, b4-a4, b5-a0, and b6-a@ [Fig.

1(f)]. The adenosine moiety of NADPH is located near

the a4 helix and interacts with Asn60 of the loop b3-a3via C6 amino group of the adenosine ring. Adenosine

ribose phosphate of NADPH is stabilized by the residues

of the loops b1-a1 and b2-a2. N-terminus of a1 helix

containing SDR motif ‘‘TGXXXGXG’’ interacts with the

adenosine ribose and pyrophosphate moieties of

NADPH. The second ribose ring adjacent to the nicotina-

mide ring sits exactly between the loops joining b5 to a5and b4 to a4. Loop joining b4 to a4 is called loop I and

the same joining the b5 to a5 is called loop II. Among

the catalytic tetrad (Asn111, Ser139, Tyr152, and Lys156),

loop I restricts the movement of Tyr152 and loop II

restricts the movement of Lys156 to catalytic conforma-

tions.6 Both Tyr152 and Lys156 participate in hydrogen

bonding with nicotinamide ribose to stabilize the nico-

tinamide moiety.10 The amide group of the nicotinamide

ring is also involved in hydrogen bonding network with

the lid portion (residues 183–211) housing a@ helix.SaFabG1 is crystallized in presence of 40% PEG400. Weak

densities of PEG400 are found in three places in the asym-

metric unit where the two PEG molecules span along with

the path towards the active site. PEG400 that resembles with

dodecyl chain of fatty acid, which demonstrates possible

interactions of the substrates with FabG (Supporting infor-

mation Table SI). PEG400 situated near chain B is in more

stretched conformation than that of PEG400 near chain A

[Fig. 1(f)]. PEG is located within the 3.9 A distance from C4

atom of nicotinamide from where the hydride is transferred

to the b-keto group of the growing fatty acyl chain. A bridg-

ing water molecule is also found between conserved Gln149

and O4 of PEG. For the first time we have reported a sub-

strate mimicking molecule at the active site.

Determination of the dimerization axis fromNADPH fluorescence titration

SaFabG1 exists as dimer in solution (Supporting Infor-

mation Fig. S2). To determine the exact dimerization axis

we have taken advantage of the single tryptophan

(Trp104) in the structure. The experiment exploits the

phenomenon of FRET. Since, the bound NADPH and

the intrinsic tryptophan are within the Forster distance

(19 A); hence, bound NADPH absorbs the tryptophan

fluorescence at 345 nm and results in the fluorescence

emission at 445 nm.23 Additionally, we have noted a

subtle hypsochromic shift in Trp104 fluorescence peak

with increasing concentration of NADPH [Fig. 2(a)].

This shift is attributed to the changing microenvironment

of tryptophan from polar to nonpolar environment [Fig.

2(a)]. The fluorophore indole ring of Trp104 is present

on the surface of the protein. Thus, the steady change of

its microenvironment with steady increase of NADPH

concentration does not reflect any arbitrary SaFabG1-

SaFabG1 interactions in solution, rather a dimeric

SaFabG1 interaction. In case of dimerization along P- or

R-axis, the tryptophan is always exposed to the solvent.

Only the dimeric interface along Q-axis provides a shelter

to the tryptophan reflecting its hydrophobic microenvir-

onment change.

Trp104 is located on a4 helix facing the hydrophobic

Q-axis interface and some hydrophobic interacting dis-

tance from Phe1160 of a40. Further movement of Trp104

with increasing NADPH concentration corroborates the

direct effect of NADPH on Trp104-housed in a4 helix. It

follows that a4 helix opens outwards direction pushing

Trp104 more towards the interface upon NADPH bind-

ing. Thus, SaFabG1 forms a Q-axis dimer in solution.

Moreover, fluorescence study shows that NADPH asso-

ciation is positive cooperative [Fig. 2(b)] with the ap-

proximate 2 (2.09 � 0.10) NADPH binding sites [Fig.

2(c)]. The positive cooperativity can best be explained by

the series of following phenomena. NADPH, while sits

on one monomer of SaFabG1, a little adjustment of the

a4 helix occurs, which in turn induces the a4 of the sec-

ond monomer to create room for NADPH. This is also

true for the a5-a50 interactions. The observation is con-

sistent with the fact that the positive cooperativity for

NADPH stems from the Q-axis interface.

Kinetic characterization of SaFabG1

SaFabG1 is also kinetically characterized to verify its co-

operative nature with respect to both substrates AcAcCoA

and NADPH. The apparent KNADPH is 40.11 � 3.42 lM,

which is close to the values reported for the P. falciperum

FabG,24 M. tuberculosis FabG18; although KAcAcCoA 0.24

� 0.02 mM is very close to the B. napus FabG.13 In both

cases SaFabG1 is positive cooperative in nature [Fig.

3(a,b)].

DISCUSSIONS

Both the NADPH fluorescence data and kinetic data

are in agreement with two NADPH binding sites in

D. Dutta et al.

1254 PROTEINS

SaFabG1 dimer where each binding site positively regu-

lates the other binding site. The positive cooperativity of

SaFabG1 for NADPH is irrespective of the presence of

AcAcCoA as substrate. This is also the case of M. tuber-

culosis FabG1.14 Both the proteins, SaFabG1 and

MtFabG1 exist as dimer in solution and exert positive

homotropic cooperativity for NADPH.

To explain the positive cooperativity of dimeric FabGs

we have used the single tryptophan present in SaFabG1

structure. Crystal structure reveals that the tryptophan

resides on the surface of the a4 helix and the helix is an

integral part of the Q-axis. Fluorescence spectroscopic

analysis has demonstrated a subtle change in tryptophan

microenvironment on NADPH binding. This indicates

Figure 2(a) Fluorescence resonance energy transfer (FRET) between Trp104 and NADPH affects the environment of the Trp104 arrows are showing the

hypsochromic shift in Trp104 fluorescence. (b) Sigmoidal curve of the dependence of fluorescence on NADPH concentration infer the cooperative

binding of NADPH with SaFabG1. Inset represents Lineweaver-Burk plot showing positive cooperative binding of NADPH. (c) The logarithmic Hill

plot between 10 and 90% active site saturation. [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.]

Revealing the Secret of SaFabG1 Positive Cooperativity

PROTEINS 1255

that SaFabG1 dimerizes along Q-axis. Movement of the

a4 helix and a5 helix facilitate the movement of the

same of the second monomer. These sequential move-

ments result in positive cooperativity. Our observation

also suggests that FabG is cooperative for AcAcCoA in

presence of NADPH and become noncooperative in ab-

sence of NADPH.14 This indicates that NADPH is the

sole factor for cooperativity.

While SaFabG1 dimer displays positive homotropic

cooperativity for NADPH, FabG tetramer displays negative

homotropic cooperativity for NADPH.12,13 It follows that

cooperative nature of FabG stems from the number of

monomers in the multimer. The physiological significance

is probably to maintain the cellular fatty acid pool. Orga-

nism like mycobacterium endeavors to keep up the supply

of long chain fatty acids, which is the primary component

of its cell envelop. Concentration of FabG, which complies

with the concentration dependent multimerization, might

be a controlling point of the fatty acid pool.

ACKNOWLEDGMENTS

The authors gratefully acknowledge Department of

Biotechnology, Government of India for setting up the

Macromolecular Crystallography facility at IIT Kharag-

pur. Dr. Baisakhee Saha is duly acknowledged for her as-

sistance in fluorescence study.

REFERENCES

1. Peschel A, Jack RW, Otto M, Collins LV, Staubitz P, Nicholson G,

Kalbacher H, Nieuwenhuizen WF, Jung G, Tarkowski A, van Kessel

KP, van Strijp JA. Staphylococcus aureus resistance to human defen-

sins and evasion of neutrophil killing via the novel virulence factor

MprF is based on modification of membrane lipids with L-lysine.

J Exp Med 2001;193:1067–1076.

2. Zhang YM, Rock CO. Membrane lipid homeostasis in bacteria. Nat

Rev Microbiol 2008;6:222–233.

3. Nishi H, Komatsuzawa H, Fujiwara T, McCallum N, Sugai M.

Reduced content of lysylphosphatidylglycerol in the cytoplasmic

membrane affects susceptibility to moenomycin, as well as vanco-

mycin, gentamicin, and antimicrobial peptides, in Staphylococcus

aureus. Antimicrob Agents Chemother 2004;48:4800–4807.

4. McNamara PJ, Syverson RE, Milligan-Myhre K, Frolova O,

Schroeder S, Kidder J, Hoang T, Proctor RA. Surfactants, aromatic

and isoprenoid compounds, and fatty acid biosynthesis inhibitors

suppress Staphylococcus aureus production of toxic shock syndrome

toxin 1. Antimicrob Agents Chemother 2009;53:1898–1906.

5. Balemans W, Lounis N, Gilissen R, Guillemont J, Simmen K,

Andries K, Koul A. Essentiality of FASII pathway for Staphylococcus

aureus. Nature 2010;463:E3–E4.

6. Dutta D, Bhattacharyya S, Mukherjee S, Saha B, Das AK. Crystal

structure of FabG4 from Mycobacterium tuberculosis reveals the im-

portance of C-terminal residues in ketoreductase activity. J Struct

Biol 2011;174:147–155.

7. Jornvall H, Persson B, Krook M, Atrian S, Gonzalez-Duarte R, Jeff-

ery J, Ghosh D. Short-chain dehydrogenases/reductases (SDR). Bio-

chemistry 1995;18:6003–6013.

8. Marrakchi H, Ducasse S, Labesse G, Montrozier H, Margeat E,

Emorine L, Charpentier X, Daffe M, Quemard A. MabA (FabG1), a

Mycobacterium tuberculosis protein involved in the long-chain fatty

acid elongation system FAS-II. Microbiology 2002;148:951–960.

Figure 3Kinetic analysis of SaFabG1: (a) Variation of OD340 with different concentration of NADPH shows that NADPH interaction with SaFabG1 is

sigmoidal and cooperative. Inset represents the interaction is positive cooperative. (b) Variation of OD340 with different concentration of AcAcCoA.

An AcAcCoA interaction with SaFabG1 is also cooperative in presence of NADPH. Inset represents the positive cooperative interaction. [Color

figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.]

D. Dutta et al.

1256 PROTEINS

9. Miller DJ, Zhang YM, Rock CO, White SW. Structure of RhlG, an

essential beta-ketoacyl reductase in the rhamnolipid biosynthetic path-

way of Pseudomonas aeruginosa. J Biol Chem 2006;281:18025–18032.

10. Price AC, Zhang YM, Rock CO, White SW. Structure of beta-ketoacyl-

[acyl carrier protein] reductase from Escherichia coli: negative coopera-

tivity and its structural basis. Biochemistry 2001;40:12772–12781.

11. Price AC, Zhang YM, Rock CO, White SW. Cofactor-induced con-

formational rearrangements establish a catalytically competent

active site and a proton relay conduit in FabG. Structure

2004;12:417–428.

12. Karmodiya K, Surolia N. Analyses of co-operative transitions in

Plasmodium falciparum beta-ketoacyl acyl carrier protein reductase

upon co-factor and acyl carrier protein binding. FEBS J

2006;273:4093–4103.

13. Sheldon PS, Kekwick RG, Smith CG, Sidebottom C, Slabas AR. 3-

Oxoacyl-[ACP] reductase from oilseed rape (Brassica napus). Bio-

chim Biophys Acta 1992;1120:151–159.

14. Silva RG, Rosado LA, Santos DS, Basso LA. Mycobacterium tubercu-

losis beta-ketoacyl-ACP reductase: alpha-secondary kinetic isotope

effects and kinetic and equilibrium mechanisms of substrate bind-

ing. Arch Biochem Biophys 2008;471:1–10.

15. Kabsch W. Automatic processing of rotation diffraction data from

crystals of initially unknown symmetry and cell constants. J Appl

Cryst 1993;26:795–800.

16. Evans PR. Data collection and processing. In: Sawyer L, Isaacs N,

Bailey S, editors. Proceedings of the CCP4 study weekend. Warring-

ton: Daresbury Laboratory; 1993. pp 114–122.

17. Vagin A, Teplyakov A. MOLREP: an automated program for molec-

ular replacement. J Appl Cryst 1997;30:1022–1025.

18. Murshudov GN, Vagin AA, Dodson EJ. Refinement of macromolec-

ular structures by the maximum-likelihood method. Acta Cryst D

1997;53:240–255.

19. Emsley P, Cowtan K. Coot: model-building tools for molecular

graphics. Acta Cryst D 2004;60:2126–2132.

20. Laskowski RA, MacArthur MW, Moss DS, Thornton JM. PRO-

CHECK: a program to check the stereochemical quality of protein

structures. J Appl Cryst 1993;26:283–291.

21. CCP4, Collaborative computational project number 4. Acta Cryst D

1994;50:760–763.

22. Krissinel E, Henrick K. Inference of macromolecular assemblies

from crystalline state. J Mol Biol 2007;3:774–797.

23. Lakowicz JR. Principles of fluorescence spectroscopy. New York:

Plenum; 1999.

24. Wickramasinghe SR, Inglis KA, Urch JE, Muller S, van Aalten DM,

Fairlamb AH. Kinetic, inhibition and structural studies on 3-

oxoacyl-ACP reductase from Plasmodium falciparum, a key enzyme

in fatty acid biosynthesis. Biochem J 2006;393:447–457.

Revealing the Secret of SaFabG1 Positive Cooperativity

PROTEINS 1257