Critical role of the miR‐200 family in regulating differentiation and proliferation of neurons

,1 ,1 ,

*Developmental Toxicology Division, CSIR-Indian Institute of Toxicology Research, Lucknow,

Uttar Pradesh, India

†Academy of Scientific and Innovative Research (AcSIR), New Delhi, India

‡Department of Biochemistry, JamiaHamdard University, New Delhi, India

AbstractThe generation of differentiated and functional neurons is acomplex process, which requires coordinated expression ofseveral proteins and microRNAs (miRNAs). The present studyusing nerve growth factor (NGF)-differentiated PC12 cells led tothe identification of miR-200, miR-221/222 and miR-34 familiesas major up-regulated miRNAs in fully differentiated neurons.Similar to PC12 cells, induction of miR-200 family wasobserved in differentiating neural stem cells, demonstrating adirect role of miR-200 family in neuronal differentiation. Over-expression of miR-200 induced neurite formation in PC12 cellsand regulated neuronal markers in favour of differentiation.However, inhibition of miR-200 induced proliferation of PC12cells. In differentiating PC12 cells and neural stem cells, an

inverse relationship was observed between expression ofreprogramming transcription factors (SOX2, KLF4, NANOG,OCT4 and PAX6) and miR-200. Over-expression of miR-200 inPC12 cells significantly down-regulated mRNA and proteinlevels of SOX2 and KLF4. Moreover, we observed two phasesof dramatic down-regulation of miR-200 expression in devel-oping rat brains correlating with periods of neuronal prolifera-tion. In conclusion, our results indicate that increasedexpression of the miR-200 family promotes neuronal differen-tiation, while decreased expression of the miR-200 familypromotes neuronal proliferation by targeting SOX2 and KLF4.Keywords: microRNA, miR-200, neural stem cells,neurogenesis, PC12, senescence.J. Neurochem. (2015) 133, 640–652.

Growth arrest at G1 (gap 1) phase of cell cycle (Scottet al. 1982) and down-regulation of reprogramming tran-scription factors (SOX2, OCT4, NANOG, KLF4 andPAX6) prompt proliferating cells to enter in the differen-tiation state (Chambers and Tomlinson 2009). Small RNAmolecules known as microRNAs (miRNAs) are emergingas new master-regulators of gene expression capable ofacting in both redundant (one mRNA can be targeted bymany miRNA) and ambiguous (one miRNA can targetmany mRNA) manners (Li et al. 2013). The presence anda role of miRNAs have been demonstrated in almost everycellular process and tissue (Bartel 2009), the brain beingone of the most highly miRNA-enriched tissues (Saba andSchratt 2010). A global profiling study done in differenttissues of primates has shown higher divergence ofmiRNAs among different tissues than between differentprimates as a result of the presence of several brain-specific miRNAs (Dannemann et al. 2012). Dicer (miRNAmaturation enzyme) knock out studies have shown thatexpression of mature miRNAs is essential for proper

differentiation and survival of differentiated neuronal cells(Kawase-Koga et al. 2010) and that reduced differentiationas a result of dicer loss is reversible (Andersson et al. 2010).

Received July 12, 2014; revised manuscript received February 20, 2015;accepted February 20, 2015.Address correspondence and reprint requests to Sanjay Yadav,

Developmental Toxicology Division, CSIR-Indian Institute of Toxicol-ogy Research, Mahatma Gandhi Marg, PO Box-80, Lucknow, UP, India.E-mail: [email protected] authors contributed equally to this work.Abbreviations used: 30UTR, 30untranslated region; BD, birthday;

BrdU, bromodeoxyuridine; DAPI, 40,6-diamidino-2-phenylindole; DF,differentiated fully; dNTP, deoxyribonucleotide triphosphate; dTTP,Deoxythymidine triphosphate; DTT, dithiothreitol; EGF, epidermalgrowth factor; FBS, foetal bovine serum; GD, gestation day; HPRT,hypoxanthine-guanine, phosphoribosyltransferase; ICIRD, in-cell infrared detection; ICW, in-cell western; IR, infra red; miRNA, microRNA;mRNA, messengerRNA; NFL, neurofilament; NGF, nerve growthfactor; NSC, neural stem cell; NTC, non-targeting control; PCR,polymerase chain reaction; PLL, poly-L-lysine; RQ, relative quantifica-tion; RT, reverse transcription; TFs, transcription factors; TLDA, taqmanlow density array; UD, undifferentiated.

640 © 2015 International Society for Neurochemistry, J. Neurochem. (2015) 133, 640--652

JOURNAL OF NEUROCHEMISTRY | 2015 | 133 | 640–652 doi: 10.1111/jnc.13089

Identification of alterations in several miRNAs during braindevelopment has indicated the role of miRNAs at multiplesteps of neuronal development (Fiore et al. 2011). Northernblot studies have led to the identification of miR-125b (a lin-4ortholog), miR-218, miR-100 and miR-135 as major miRNAsup-regulated during differentiation in P19 and NT2/D1 cells(Sempere et al. 2004). Other studies using different models ofneuronal differentiation have independently identified theroles of miR-34a, miR-124, miR-125, miR-221, miR-375,miR-7, miR-214, miR-200, miR-9/9* in controlling neuronaldifferentiation and neurogenesis (Choi et al. 2008; Ko et al.2008; Cheng et al. 2009; Le et al. 2009; Abdelmohsen et al.2010; Chen et al. 2010; Aranha et al. 2011).The development of cellular models of neuronal differ-

entiation has helped to unravel the mechanisms of neuronaldifferentiation and identification of neuronal differentiationregulators (Abemayor and Sidell 1989). PC12, a neuroen-docrine cell line derived from pheochromocytoma of ratadrenal medulla (Greene and Tischler 1976), is one ofmost widely used cellular models of neuronal differentia-tion. In PC12 cells, differentiation, proliferation andsurvival of cells can be studied independently (Vaudryet al. 2002). Na€ıve PC12 cells grow in suspension, butwhen they are adhered and exposed with nerve growthfactor (NGF), new neurites are generated, which makesthem similar to mature neuron both physically andfunctionally (Zhou et al. 2006). Initiation of differentiationis similar between neural stem cells (NSCs) and PC12cells, as initiation of differentiation in both cells requiresthe formation of new neurites. In PC12 cells, NGF altersthe expression of several transcription factors (Greene andAngelastro 2005) and transcription repressor (REST/NRSF), which can further modulate expression of severalhundred genes (Greene and Angelastro 2005). NGFmediated posttranscriptional regulation of neuronal marker(neurofilament, NFL) and several other genes werereported even before the discovery of miRNAs (Federoffet al. 1988; Ikenaka et al. 1990).In the present study, we carried out global miRNA

profiling of undifferentiated and fully differentiated PC12cells and identified a dramatic increase in miR-200, miR-221/222 and miR-34 families. Further studies were carried out todiscover the role of the miR-200 family in neuronaldifferentiation and compare its regulation between differen-tiation of PC12 and NSCs. In vivo studies were also carriedout to validate the role of the miR-200 family observed incellular models.

Materials and methods

Chemicals

Taqman low density array (TLDA), individual miRNA assays,reverse transcription (RT) kit, pre-amplification master mixture,Taqman universal master mixture, miRVana and other reagents

required for real-time PCR, were procured from Applied Biosys-tems, Foster City, CA, USA. Antibodies against b-actin (A2228),dicer (D0571), GW182 (G5922), and bromodeoxyuridine (BrdU)(B8434) were procured from Sigma-Aldrich, Saint Louis, MO,USA. Anti-GAPDH (sc365062) was procured from Santa CruzBiotechnology, Santa Cruz, CA, USA. Anti-NFL pan was procuredfrom Biomol International (Farmingdale, NY, USA, NA1297).Antibodies for SOX2 (ab97959) and KLF4 (ab106629) wereprocured from Abcam, Cambridge, MA, USA. Secondary antibod-ies with IR labelling for 700 and 800 nm channel were obtainedfrom LI-COR Biosciences, Lincoln City, NE, USA. All the cellculture medium and required reagents, including NGF for cellculture were procured from Invitrogen-Life Technologies, Califor-nia, USA. PC12 cells and NSCs were procured from Europeancollection of cell culture (EUACC), Salisbury, UK; Sigma-Aldrich,and Stem Cell Technologies, Vancouver, BC, Canada, respectively.All the required medium for NSCs culture were also procured fromStem Cell Technologies Vancouver, BC, Canada. The siRNAagainst dicer (ON-TARGET plus SMART pool dicer siRNA),miRNA mimics (miRIDIAN mimic) and inhibitor (miRIDIANhairpin inhibitor) was obtained from Dharmacon, Pittsburgh, PA,USA. For non-targeting control (NTC) transfections, ON-TARGETplus control siRNA, that mimic the negative control and hairpininhibitor negative control were used as per requirement. Transfec-tions were carried out using the Neon Transfection System of LifeTechnologies. All other regular chemicals were procured fromSigma-Aldrich.

Culture of PC12 and NSCs and their differentiation

PC12 cells were grown in F-12 Nutrient mixture (Ham) supple-mented with 2.5% foetal bovine serum, 12.5% horse serum, 1%antibiotic and antimycotic solution. Cells were kept in 5% CO2–95% atmosphere with high humidity at 37°C. NSCs were procuredfrom Stem Cell Technologies, and grown in NeuroCult NS-A basalmedium (rat) in the presence of proliferation supplement providedby Stem Cell Technologies and epidermal growth factor (20 ng/mL)and b-fibroblast growth factor (10 ng/mL). Before differentiation,both the cell types were seeded on poly-L-lysine (PLL) (0.01%solution)-coated surface. For differentiation, PC12 cells wereexposed with 50 ng/mL NGF (dissolved in an F-12 nutrientmixture-containing 5% foetal bovine serum) for 8 days. Everyalternate day, media of differentiating PC12 cells were replaced withfresh media-containing 50 ng/mL NGF. For NSCs differentiation,they were seeded on the PLL-coated surface and transferred inneurobasal medium-containing N2 and B27 supplements. Forquantifying neuronal differentiation, neurite length was measuredwith phase contrast microscope using NisElement BR software ofNikon, Melville, NY, USA.

Cell counting, cell viability and transfection of cells

Whenever needed, PC12 cells were transfected using Neon Trans-fection System with following settings for Neon 100 lL tip:voltage: 1400; pulse width: 20 ms; pulses: 2 and 2.5 9 106 cells perreaction using re-suspension buffer R provided by manufacturer.Before transfection, cells were washed with phosphate buffer saline(PBS), and after transfection cells were immediately transferred inmedium conditioned at 37°C in cell culture incubator. Trypan blue-stained cells were counted using Countess automated cell counter.

© 2015 International Society for Neurochemistry, J. Neurochem. (2015) 133, 640--652

miR-200 regulates neuronal differentiation 641

Before counting, equal volumes of Trypan blue dye (0.4% w/v) wasadded in cells and the mixture was immediately loaded to cellcounting chamber slides. Cell viability was measured by PrestoBluecell viability reagent of Life Technologies. Briefly, 1/10th volume ofPrestoBlue reagent was added to cells growing in plates. Afterincubating cells for 1–4 h, fluorescence was measured at 560 nm(excitation) and 590 nm (emission). For both cell counting and cellviability experiments, cells were counted after 12 h of transfectionand equal number of cells in each well of 48-well plates were seededfor analysis at 24, 48 and 96 h. For PrestoBlue experiments, anadditional group (0 h) was added in experiments to normalize thepossible variations in the number of cells seeded in different groups.For 0 h, Prestoblue reagent was added at the time of cell seeding andobserved activity was used for normalization at 24, 48 and 96 h.

Isolation of total RNA and real-time PCR

The total RNA which also contained small RNAs was isolated bymirVana miRNA isolation kit from cells and rat brain as describedby the manufacturer. Wistar rats were obtained from the animalfacility of CSIR-Indian Institute of Toxicology Research, Lucknow.Animals were provided water and commercial pellet diet ad libitumand housed in a temperature controlled room with 12/12 h light anddark cycle. Animals were used in accordance with the policy laid bythe Animal Care Committee of CSIR-IITR, Lucknow. For globalprofiling of miRNAs in PC12 cells, TLDA (rodent) Pool A and B(v3) of Life Technologies were used. Pool A and Pool B contains384 Taqman miRNA assays per card and enables assay of 373miRNAs unique for rat. Details of primers present on TLDA pool Aand pool B plates are provided in Figure S1 and S2 respectively. RTand preamplification were carried out using MegaplexTM RT Primers(Rodent Pool Set v3.0) and MegaplexTM PreAmp Primers (RodentPool Set v3.0) and miRNA RT kit of Life Technologies, Carlsbad,CA, USA. RT, pre-amplification and real-time PCR were carried outas described in our earlier paper (Yadav et al. 2011). In brief, thereaction mixture contained 1X megaplex RT primers, 2.6 mMdNTPs with deoxythymidine triphosphate (dTTP), 75 units ofMultiScribe Reverse Transcriptase, 1X RT buffer, 3 mM MgCl2, 2units of RNAse inhibitor and 100 ng total RNA with the finalvolume of 7.5 lL. For RT, 40 cycles of 16°C for 2 min, 42°C for1 min and 50°C for 1 s were carried out. Finally, incubation at 85°Cdenatured the reaction mixtures. Pre-amplification were carried outusing 12.5 lL of preamp master mixture mixed with 2.5 lL preampprimers and 2.5 lL RT product with total volume of 25 lL. Pre-amplification cycling conditions were 10 min at 95°C, 2 min at55°C, 2 min at 72°C and 12 cycles of 15 s at 95°C and 4 min at60°C. The reaction was terminated by incubating the reactionmixture at 99.9°C for 10 min, which denatured the reaction mixture.For running TLDA plates, 450 lL of the Taqman universal PCRmaster mixture was mixed with 9 lL of the four times diluted pre-amplification product in a total volume of 900 lL. After adding100 lL in each port of TLDA plates, plates were sealed, spend andloaded on thermal cycler. Relative quantification was done by meansof �ΔΔCt method using global normalization method. The expres-sion of individual miRNAs was carried out using individual TaqmanmiRNA assays of Life Technologies. Real-time PCR of dicer(DCR1), SOX2, OCT4, KLF4, PAX6, NANOG, NFL-M andhypoxanthine-guanine phosphoribosyltransferase (HPRT) were car-ried out in RT prepared with high capacity cDNA kit of ABI, Foster

City, CA, USA. The RT reaction mixture contains 1X RT buffer,8 mM dNTP mix, 1X RT random primers and 1 lL each ofMultiScribe reverse transcriptase and RNAse inhibitor in a totalvolume of 20 lL which also includes 1 lg total RNA. The thermalcycling conditions used for RT were 10 min at 25°C, 120 min at37°C and 5 s at 85°C. In brief, the reaction mixture contained 1XSYBR Green or Taqman master mixture, 1 lL cDNA, 0.50 lm offorward and reverse primers (RP) in a total volume of 20 lL.Sequences of forward primers (FP), RP and probe for Taqman assayused in real-time PCR are:

PAX6:(FP) 50-GCCCTCACAAACACCTACAG-30; Probe 50-CGCCTATGCCCAGCTTCACCA-30; (RP) 50-TCATAACTCCGCCCATTCAC-30; SOX2: (FP) 50-GAGAAGTTTGGAGCCCGAG-30;Probe 50-CGGGCGAAGTGCAATTGGGATG-30,(RP) 50-GATCTGGCGGAGAATAGTTGG-30; HPRT: (FP) 50-GGTGAAAAGGACCTCTCGAAG-30; Probe 50-TGGATACAGGCCAGACTTTGTTGGATT-30, (RP) 50-GCTTTTCCACTTTCGCTGATG-30; OCT4:(FP) 50-AGAACATGTGTAAGCTGCGG-30; Probe 50-TTTCTCTTCCGGGCCTGCACC-30, (RP) 50-TCACACGGTTCTCAATGCTAG-30; NANOG: (FP) 50-TTCTGAACCTGAGCTATAAGCAG-30; Probe 50-AGAATGAAGTGCAAGAGGTGGCAGA-30, (RP) 50-CAATGGATGCTGGGATACTCC-30; KLF4: (FP): 50-ACTTGTGACTATGCAGGCTG-30; Probe: TTCGCAGGTGTGCCTTGAGATGA, (RP): ACAGTGGTAAGGTTTCTCGC; NFL-M: (FP) 50-AAGGCAGTGGGAGGGAAGAG-30; (RP) 50-TTCATCTGCTGGGCTCAAGTC-30; Dicer (DCR1): (FP): GTGCAATTTGGTGGTTCGTTT; (RP): TCGTGCCCGTCCTTTAGACT.

In silico analysis

TargetScan web portal (http://www.targetscan.org) was used forscanning 30untranslated region (30-UTR) of different genes andidentification of probable miRNA sites. Biological processestargeted by miRNAs were identified using the GO process analysistool of MetaCore platform of Thomson Reuters, London, UK, adata mining and pathway analysis platform. Potential target genesof miR-200, miR-34 and miR-221/222 families were identifiedfrom TargetScan portal and fetched on the GO process analysistool, which arranges the biological processes according to theirsignificance, showing the most significance on top of the list.Comparison analysis of miR-200, miR-221 and miR-34 miRNAfamilies potential target genes were done using compare experi-ment workflow tool of MetaCore platform. It considers mappingsof the intersections of the selected experiments and identified theset of genes that are common to all the selected experiments, orsimilar in some of these experiments or unique to a givenexperiment (in this case experiment means targets of one family ofmiRNAs).

Immunoblotting

The total cell lysates were prepared with Cell Lytic M cell lysisreagent of Sigma-Aldrich, St Louis, MO, USA and supplementedwith a protease inhibitor cocktail and DTT. Immunoblotting wasperformed as described in our earlier paper (Yadav et al. 2006). Inbrief, protein samples were subjected to sodium dodecyl sulfate–polyacrylamide gel electrophoresis (8% acrylamide stacking gel and12 or 15% acrylamide separating gel). After electrophoresis,proteins were transferred to polyvinylidene difluoride membranewith low background and incubated in blocking solution of LI-COR


642 A. Pandey et al.

http://www.targetscan.org

Biosciences for 1 h at 24°C. The membranes were incubatedovernight at 4°C with primary antibody and transferred to 24°C for1 h. Infra Red (IR) dye conjugated secondary antibody were used at1 : 5000 dilution for protein detection. After 5-6 washings of 5 mineach, membranes were scanned, using the LI-COR ODYSSEY CLxmachine of LI-COR, Biosciences, Lincoln City, NE, USA.

Immunocytochemistry, in-cell western and BrdU labelling and

in-cell infra red detection (BrdU-ICIRD)

For immunocytochemistry of transfected PC12 cells, seeding of thecells was done in PLL-coated chamber slides (20 000/well of fourwell slides) and exposed with NGF for 4 days. After washing withPBS, cells were fixed with 3.7% paraformaledyde. After 20 min offixation, they were again washed with PBS and exposed to 0.5%H2O2 in methanol for 1 h. After washing with PBS, cells wereincubated in blocking solution-containing 0.2% Triton X-100 in0.1% bovine serum albumin for 1 h. After blocking, cells wereincubated with 10 antibody (1 : 200 dilution for 2 h at 24°C)followed by washing with PBS and transferred to 20 antibody(1 : 2500 dilution for 2 h at 24°C) labelled with Alexa fluor-488.After final washing with PBS, 40,6-diamidino-2-phenylindole(DAPI) (nuclear stain) with antifade was added to cells and imageswere taken using fluorescent microscope. In-cell western (ICW) wascarried out using an ICW kit of LI-COR Biosciences as described bythe manufacturer. Briefly, 20 000 cells were seeded in each well of48-well plates and after 4 days of NGF exposure, cells were washedwith PBS and fixed with 3.7% paraformaldehyde for 20 min. Afterfixation, cells were washed three times with 1X PBS-containing0.1% triton X-100 for permealization. Blocking was done byincubating in Odyssey blocking buffer for 1.5 h at 24°C. 10 antibodyagainst pan-NFL was diluted in blocking buffer (1 : 200) and addedto cells and plate were gently shaked for 3 h. After 3 h of incubationplates were washed with PBS-containing 0.1% tween-20 for threetimes. Similarly, 20 antibody raised against rabbit and labelled withIRDye 800CW was diluted in Odyssey blocking buffer at 1 : 800dilution. 20 antibody solution also contained mixture of Sapphire700stain (1 : 1000) and DRAQ5 stain (1 : 10 000), which acts as thenormalization dye. Above mixture was then added to cells and gentlyshaked for 1 h at 24°C in the dark. Finally cells were washed withPBS-containing 0.1% Tween-20 for three times by gently shaking.Before scanning on LI-COR, Odyssey CLx machine, plates weredried by inverting it on tissue paper. After imaging at both (700 and800 nm) channels, analysis was done using Image Studio 2.1.1.0.software of LI-COR, Lincoln, Nebraska, USA. For BrdU-ICIRDassay, PC12 cells were transfected with miRNA inhibitors or NTCand after 12 h of transfection, an equal number (20 000/well) of cellsare plated in 48-well plates. After 12 h of seeding the cells, BrdU(10 mM) was added in plates containing the cells. After 96 h, platesare processed as mentioned above for ICW. However, duringanalysis, data were not normalized with the fluorescence ofSapphire700 and DRAQ5 stain provided by LI-COR, Lincoln,Nebraska, USA.

Statistical analysis

All the experiments were carried out in triplicate, except TLDAarrays, which were run in duplicate. The student’s t-test wasemployed to calculate the statistical significance. p < 0.05 instudent’s t-test was considered as significant.

Results

Dicer knock down impaired NGF induced differentiation of

PC12 cells

Transfection of PC12 cells with siRNA of dicer genesignificantly down-regulated mRNA and protein levels ofdicer (Fig. 1a and b). Four-day exposure to NGF of PC12cells in which dicer expression was reduced (dicer knockdown cells), resulted in increased neurite number, andreduced neurite length compared to the control (NTCtransfected) PC12 cells exposed to NGF for 4 days(Fig. 1c–e). Immunostaining with P-bodies marker(GW182) showed increased immunoreactivity of GW182 indicer knock down PC12 cells when compared to NTC-transfected PC12 cells (Fig. 1f and g). Counter staining withDAPI, a nuclear stain has shown the presence of multipleDAPI-stained bodies in dicer knock down PC12 cells(Fig. 1f).

Global profiling of miRNAs in undifferentiated and fully

differentiated PC12 cells

Volcano plot analysis of TLDA array (considering two foldsas minimum change and p ≤ 0.05) of undifferentiated and8 days NGF differentiated PC12 cells have shown inductionin miRNA expression as a predominant phenomenon indifferentiated neurons (Fig. 2a and b). NGF induced differ-entiation of PC12 cells for 8 days significantly induced (≥ 5folds and p ≤ 0.05) the expression of 19 miRNAs, whileonly three miRNAs were significantly down-regulated(Fig. 2b). Out of 19 up-regulated miRNAs in differentiatedPC12 cells, seven miRNAs belong to three families ofmiRNAs i.e. miR-200 (miR-200a and miR-200b), miR-221/222 (miR-221 and miR-222) and miR-34 (miR-34a, miR-34b-3p, miR-34c) (Fig. 2b). Box plot analysis of TLDAarrays has shown a significant decrease in the mean andmedian of Ct values of 8 days NGF differentiated PC12 cellswhen compared to undifferentiated PC12 cells (Fig. 2c).

In silico mapping of cellular processes targeted by top three

up-regulated miRNA families

Using TargetScan web portal, all the potential targets of miR-200, miR-221/222 and miR-34 families were identified andfetched on GO process analysis option of MetaCore platform(Fig. 3). In silico mapping has shown anatomical structuredevelopment and nervous system development as top twosignificantly targeted processes for the above three miRNAfamilies (Fig. 3a). Top twenty significant cellular processesidentified for miR-200, miR-221/222 and mir-34 families alsoinclude neuronal differentiation, neurogenesis, generation ofneurons and cell differentiation (Fig. 3a). Comparison ofpotential targets of miR-200, miR-221/222 and miR-34family led to the identification of 8 genes, which werecommon between miR-200, miR-221/222 and miR-34 fam-ilies (Fig. 3b). Interestingly, comparative analysis has shown



that miR-200 and miR-221/222 families share a large number(84) of common target genes between them (Fig. 3b).

Similarity in expression of miR-200 family and transcriptionfactors between differentiating PC12 and NSCs

Both PC12 cells and NSCs were differentiated for 8 days toachieve fully differentiated and mature neurons (Fig. 4a andb).However, NGF acts discontinuously in a time-dependentmanner(Chung et al. 2010), so expression of identifiedmiRNAs and transcription factors (SOX2, KLF4, OCT4,NANOG, PAX6) was studied at different stages of

differentiation (undifferentiated, 2, 4 and 8 day differenti-ated) in PC12 and NSCs (Fig. 4c and d). In PC12 cells, allthe studied transcription factors were expressed, while inNSCs, NANOG and PAX6 were not amplified at any stageof differentiation (Fig. 4c and d). In PC12 cells, expressionof all studied transcription factors decreased significantly atthe 2nd day of NGF induced differentiation (Fig. 4c).Expression of OCT4 and SOX2 was decreased further onexposure of NGF for 4 and 8 days and became almostundetectable (Fig. 4c). In PC12 cells, KLF4 expressionincreased between the 2nd and 8th day of NGF exposure,

(a) (b)

(c) (d)

(e)

(g)

(f)

I II III

IV V VI

Fig. 1 Effect of dicer knock down on NGF induced differentiation of

PC12 cells: (a) Real-time PCR of dicer in cells transfected with non-targeting control (NTC) or dicer siRNA; (b) western blot of dicer in cellstransfected with NTC or dicer siRNA; (c) Representative phase

contrast images of cells transfected with dicer siRNA or NTC andexposed with NGF (50 ng/mL) for 4 days; (d) average number ofneurites per cell of dicer siRNA or NTC-transfected cells.In each group,

the number of neurites were counted from 10 randomly selectedimages; (e) average length of neurites (in lm) of dicer siRNA or NTC-transfected cells;neurites size was measured in 10 randomly selected

images,which displayed neurites longer than cell size; (f) fluorescence

images of cells transfected with dicer siRNA (I to III) or NTC (IV to VI)and exposed with NGF (50 ng/mL) for 4 days. Green fluorescence ofAlexa Fluor 488 labelled 20 antibody shows reactivity with GW182,

while blue fluorescence shows 40,6-diamidino-2-phenylindole (DAPI)(nuclear stain) staining; (g) mean intensity of green fluorescence ofNTC and dicer siRNA-transfected cells. Length of neurites and number

of neurites per cells were counted using NIS-elements BR software ofNikon. All the experiments were performed in triplicate and (*p < 0.05).(NTC: non-targeting control; *p ≤ 0.05).



but total amount was less in comparison to undifferentiatedcells (Fig. 4c). Similar to PC12 cells, in NSCs theexpression of all amplified transcription factors decreaseddramatically on the 2nd day of differentiation. However,expression of KLF4 and SOX2 recovered by the 8th day ofdifferentiation in NSCs (Fig. 4d). Overall, initiation ofneuronal differentiation significantly down-regulated theexpression of transcription factors, though some recoverywas observed by the 8th day of differentiation in both PC12and NSCs (Fig. 4c and d). In contrast to transcriptionfactors, expression of miR-200a and miR-200b increasedsignificantly when PC12 cells were exposed with NGF(Fig. 4c). Expression of miR-200b increased consistentlyupon NGF exposure, while expression of miR-200a wasmaximum on the 4th day of differentiation (Fig. 4c). InNSCs the fold increase in miR-200a and miR-200b was lessthan PC12 cells, but increase in expression of miR-200aand miR-200b was observed throughout the differentiationof NSCs (Fig. 4d).

Expression of miR-200b regulates expression of SOX2 and

KLF4 in PC12 cells

Analysis of SOX2, KLF4, OCT4, NANOG and PAX6 geneson TargetScan web portal have shown the presence ofconserved binding sites of miR-200b on 30-UTR of SOX2and KLF4 genes (Fig. 5a and b). Transfection of PC12 cellswith miR-200b mimics significantly decreased the mRNAand protein levels of SOX2 and KLF4 as detected by real-time PCR and western blotting (Fig. 5c–e). However,transfection of miR-200a mimics did not produce anysignificant alterations in mRNA and protein levels ofSOX2 and KLF4 (Fig. 5c–e).

Transfection of miR-200b mimic induced differentiation in

PC12 cells

PC12 cells were transfected with mimics of miR-200a ormiR-200b or NTC or exposed with NGF and neuriteformation was studied by immunocytochemistry andICW using NFL, a marker of neuronal differentiation

(a) (b) (c)

Fig. 2 Global expression profiling of miRNAs in NGF differentiatedPC12 cells: (a) Volcano plot analysis of global miRNAprofile of

undifferentiated and 8 day NGF (50 ng/mL) differentiated cells; miR-NAs are distributed in two plates termed Pool A and B as described in

methodology (b) list of miRNAs which are significantly (p ≤ 0.05) up-regulated or down-regulated ≥ 5 folds in differentiated cells; (c) Box

plot analysis of global miRNA profile of undifferentiated and fullydifferentiated cells.(UD, undifferentiated; DF, differentiated fully).



(Fig. 6a–c). Similar to NGF exposure, transfection withmiR-200b mimics induced formation of new neurites inPC12 cells. However, these are substantially smaller thanneurites formed in NGF exposed cells (Fig. 6a). Transfec-tion of miR-200a mimics also induced formation of newneurites in PC12 cells, but these are even smaller thanneurites formed in cells transfected with miR-200b mimics(Fig. 6a). ICW have shown increased NFL levels in PC12cells transfected with mimics of miR-200a or miR-200b orexposed with NGF (Fig. 6b and c). The maximum increasein levels of the NFL was observed when PC12 cells wereexposed with NGF followed by cells transfected withmimics of miR-200b and miR-200a respectively (Fig. 6band c). Individually, miR-200b produced a more pro-nounced effect on neurite formation and NFL inductionwhen compared to miR-200a (Fig. 6b and c). Real-timePCR of NFL-M (medium chain), major contributor of NFLstructure, has also shown similar results to ICW andimmunocytochemistry (Fig. 6d). Similar to immunocyto-chemistry and ICW results, analysis of phase contrastimages of PC12 cells transfected with mimics of miR-200has also shown generation of more neurites in cellstransfected with miR-200b when compared to cells trans-fected with miR-200a (Fig. 6e and f). Moreover, neuritesformed in PC12 cells transfected with miR-200b mimicsare longer than neurites formed in miR-200a mimic-transfected cells (Fig. 6e and g).

Biphasic decrease in expression of miR-200a and miR-200bin developing rat brain

Real-time PCR of miR-200a and miR-200b was carried outin total RNA isolated from the brain of rats aged, gestation

day 15 (GD15), birthday or 1, or 3, or 6, or 12 or 15 weeks(Fig. 7a). Analysis of real-time PCR results has shownbiphasic down-regulation in their expression in developingrat brain (Fig. 7a). The maximum expression of miR-200aand miR-200b was observed at GD15, while at 6 weeks itbecame undetectable (Fig. 7a). First dramatic decrease inexpression of miR-200a and miR-200b was observedbetween GD15 and 1 week, while a second dramaticdecrease was observed between 3rd and 6th week of ratage (Fig. 7a).

Inhibition of miR-200a/b induced proliferation in PC12 cells

Dramatic down-regulation observed in miR-200a/b expres-sion during proliferation phases of rat brain developmentprompted us to investigate correlation between inhibitionof miR-200 and neuronal proliferation. The effect of miR-200a or miR-200b on proliferation of PC12 cells wasstudied using PrestoBlue cell viability assay, Trypan bluecounting and BrdU labelling. After 12 h of transfection,cells were counted and equal number of cells was seededfor all groups in a culture plate as described in the methodsection for all three assays. After 48 h of seeding of thecells, significant increase in cell viability was observedin PC12 cells transfected with inhibitors of miR-200b (Fig. 7b and c). After 96 h of seeding the cells,transfection of both miR-200a and miR-200b inhibitorssignificantly increased the viability of PC12 cellswhen compared to NTC transfected cells (Fig. 7b and c).Transfection of miR-200a or miR-200b inhibitorsalso showed significantly increased BrdU labellingwhen compared to NTC transfected PC12 cells (Fig. 7dand e).

(a)

(b)

Fig. 3 In silico pathway analysis of targets

of miR-200, miR-221 and miR-34 familiesidentified by TargetScan portal: (a) Mostsignificant biological processes targeted by

miR-200, miR-221 and miR-34 miRNAfamilies, identified by using the GOprocess platform; (b) comparison analysis

of targets of miR-200, miR-221 and miR-34families using the compare experimentworkflow tool of MetaCore platform. It

considers mappings of the intersections ofthe selected experiments and identified theset of genes that are common to all theselected experiments, or similar in some of

these experiments, or unique to a givenexperiment (in this case experiment meanstargets of one family of miRNAs).



Discussion

Using cellular models of neuronal differentiation, we haveidentified the role of the miR-200 family in neuronaldevelopment. In our initial studies, we found that dicerknock down impairs or attenuates NGF induced differenti-ation of PC12 cells by modulating length and number ofneurites. The observation of multiple nuclei in dicer knockdown and NGF exposed PC12 cells indicates the initiation ofpremature senescence. Dicer knock down has already beenreported to induce premature senescence in adipose cells(Mori et al. 2012), in addition to inducing immunoreactivityfor GW182, a marker for P-bodies or stress bodies formation.

Overall, dicer knock down studies indicate that formation ofmature miRNAs is essential for proper differentiation ofneurons and survival of differentiated neurons.The volcano and box plot analysis has shown an overall

increase in miRNA expression of differentiated neurons,suggesting an increase in the expression of miRNAs as afavourable change during neuronal differentiation. Increasedtranscription of mRNAs during neuronal differentiation canbe directly associated with the requirement of several newproteins in neurite formation (Maurer et al. 2004; Hoffroggeet al. 2006). However, increased miRNA transcriptionobserved in our study can be explained by (i) miRNAs andtheir target mRNAs share genomic locations (Lee et al.

(a)

(b)

(c)

(d)

Fig. 4 Similarities in regulation of miR-200 family and transcriptionfactors in differentiating PC12 and neural stem cells (NSCs): (a) Phase

contrast images of PC12 cells exposed with NGF for 0 (poly-L-lysine,PLL-adhered), or 2, or 4 or 8 days; (b) phase contrast images of NSCsexposed with N2 and B27 supplement for 0 day (PLL-adhered but not

exposed with supplements), or 2, or 4 or 8 day; (c) Expression of miR-200a and miR-200b and transcription factors at different stages of

PC12 cells differentiation (d) Expression of miR-200a and miR-200band transcription factors at different stages of NSCs differentiation.(RQ: relative quantification; *p < 0.05).



2004); (ii) miRNAs are induced to fine-tune the rate ofprotein synthesis. Induction of 19 miRNAs (≥ 5 folds) inNGF differentiated PC12 cells along with several miRNAsreported earlier (miR-124, mir-9, miR-302, miR-125b, miR-221/222, miR-10, miR-26b and miR-34a) in different modelsof neuronal development indicates the involvement ofmultiple miRNAs in neuronal development (Hohjoh andFukushima 2007; Makeyev et al. 2007; Ko et al. 2008; Yuet al. 2008; Le et al. 2009; Terasawa et al. 2009; Agostiniet al. 2011a,b; Aranha et al. 2011; Meseguer et al. 2011;Dill et al. 2012).Among the identified up-regulated miRNAs, seven miR-

NAs constituted three conserved families i.e. miR-200 (miR-200a and miR-200b), miR-221/222 (miR-221 and miR-222)and miR-34 (miR-34b-3p, miR-34c and miR-34a). In silicoanalysis suggests the role of the above three identifiedmiRNA families in several of the cellular processes directlyor indirectly related to brain development. Identification ofseveral common targets between miR-200 and miR-221/222families indicates the involvement of these miRNAs in

targeting same cellular processes. Similar to our findings,Terasawa et al. (2009) have also observed induction of miR-221/222 in NGF differentiated PC12 cells and predicted theirrole in cell survival. Hamada et al. (2012) have alsoidentified miR-221 as one of the major miRNAs up-regulatedin NGF differentiated PC12 cells and identified Foxo3a andApaf-1 (two genes which regulate apoptosis) as targets ofmiR-221. It is well established that NGF induced differen-tiation of PC12 cells into mature neurons requires at least8 days of NGF exposure (Skaper et al. 1983). However,earlier studies were conducted with only up to 48 h of NGFexposure, which could be the reason for the differencesobserved in our findings with the earlier reports (Terasawaet al. 2009; Hamada et al. 2012). Dramatically increasedexpression of miR-221/222 at initial phase (24–48 h) of NGFinduced PC12 cell differentiation indicates that miR-221/222can also be involved in regulation of proteins related to cellcycle arrest, which is a prerequisite for neuronal differenti-ation. A similar regulation pattern of miR-200 observedbetween different differentiation stages (undifferentiated, 2, 4

(a)

(b)

(c) (d) (e)

Fig. 5 MiR-200b targets and down-regulates expression of SOX2 and

KLF4: MiRNA binding sites on 30untranslated region (30-UTR) of SOX2(a) and KLF4 (b); (c) Real-time PCR of SOX2 and KLF4 in cellstransfected with mimics of miR-200a or miR-200b; (d) western blotting

of SOX2 and KLF4 in total cell lysates of cells prepared from cells

transfected with non-targeting control (NTC) (lane 1) or mimics of miR-

200a (lane 2) or mimics of miR-200b(lane 3); (e) Densitometry ofwestern blots of SOX2 and KLF4 carried out by Image J software(RQ:relative quantification; *p ≤ 0.05).



and 8 days) of PC12 cells and NSCs indicates the suitabilityof PC12 cells as an alternative option for NSCs for neuronaldifferentiation studies.An inverse relationship has been observed in regulation of

miR-200 and transcription factors (SOX2, KLF4, NANOG,OCT4 and PAX6) at different stages of differentiation inPC12 and NSCs. Screening of 30-UTR of above transcriptionfactors has shown the presence of binding sites for miR-200bin SOX2 and KLF4 genes. Significant down-regulation

observed in SOX2 and KLF4 mRNA and protein in PC12cells transfected with miR-200b mimics confirmed the role ofmiR-200b in the regulation of SOX2 and KLF4 in differen-tiating neurons. The role of the miR-200 family in theregulation of OCT4 and SOX2 has also been reported duringmesenchymal to epithelial transition, inducing pluripotentstem cell generation (Wang et al. 2013). Initiation of neuriteformation and up-regulation of the NFL, a marker ofneuronal differentiation in PC12 cells, transfected with

(a)

(b)

(c) (d)

(e)

(f)

(g)

Fig. 6 Transfection of miR-200 family initiated neurite formation andinduced expression of neuronal markers in PC12 cells: (a) Immunocy-tochemistry with anti-pan neurofilament (NFL) in cells exposed with

NGF (50 ng/mL 9 4 days) or transfected with mimics of miR-200a ormiR-200b or non-targeting control (NTC); blue signal shows fluores-cence from 40,6-diamidino-2-phenylindole (DAPI), while green shows

immunoreactivity with pan-NFL. (b) In cell western (ICW) with anti-panNFL in cells exposed with NGF (4 days) or transfected with mimics ofmiR-200a or miR-200b or NTC; Green signal shows immunoreactivity

with pan-NFL, while red signal shown florescence from DRAQ5/Sapphire700, which is endogenous control for cell number; (c)quantification of ICW results; (d) real-time PCR of NFL-M in cells

exposed with NGF (50 ng/mL 9 4 days) or transfected with mimics ofmiR-200a or miR-200b or NTC; (e) Representative phase contrastimages of cells exposed to NGF (50 ng/mL 9 4 days) or transfected

with mimics of miR-200a or miR-200b or NTC; (f) average number ofneurites per cell in cells exposed to NGF (50 ng/mL 9 4 days) ortransfected with mimics of miR-200a or miR-200b or NTC. In each

group, the number of neurites were counted from 10 randomly selectedimages; (g) average length of neurites (in lm) in cells exposed to NGF(50 ng/mL 9 4 days) or transfected with mimics of miR-200a or miR-

200b or NTC. Neurites size was measured in 10 randomly selectedimages, which displayed neurites longer than cell size; (RQ: relativequantification; *p ≤ 0.05).



miR-200 mimics demonstrated a direct role of the miR-200family in inducing neuronal differentiation. Over-expressionof both miR-200a and miR-200b-induced neurite formation,but miR-200b produced greater effects than miR-200a ininducing neuronal differentiation. As 30-UTR of NFL-Mdoes not possess a binding site for miR-200a/b, directregulation of NFL-M by miR-200a/b is ruled out. However,as reported (Dannemann et al. 2012), miR-200a/b can down-regulate some transcription factors or other genes, which caninitiate neuronal differentiation and induce NFL.We studied the expression of miR-200a and miR-200b in

the brain of developing rat to identify the correlation betweenexpressions of these miRNAs with proliferation phases ofbrain. Studies in developing rat brain have shown maximum

expression of miR-200a and miR-200b at GD15, after whichexpression of these miRNAs decreased dramatically betweenGD15 to 1st postnatal week and between 3rd to 6th postnatalweeks. Studies by Bandeira et al. (2009), using a novelmethod of cell counting, identified postnatal day (PND) 2 to25 as first phase of neuron addition; interestingly, it coincideswith the first phase of down-regulation of miR-200a andmiR-200b observed in our study. Counting neuronal densi-ties and non-neuronal/neuronal ratios indicated that most ofthe brain structures possess the maximum number of neuronsbetween PND40 and PND60 (Bandeira et al. 2009). Thisfurther coincides with the second phase of decrease observedin miR-200a and miR-200b expression in our study.The inverse relationship observed between miR-200a/b

(a)

(b)

(d)

(c) (e)

Fig. 7 Inverse correlation between expression of miR-200 miRNAsand neuronal proliferation: (a) Real-time PCR of miR-200a and miR-

200b in RNA isolated from the brain of rats aged, gestational day 15(GD15), birthday (BD), 1, 3, 6, 12 or 15 weeks (W). Relativequantification (RQ) was done considering expression of miR-200a

and miR-200b at BD as 1. U6 snRNA was used as normalizationcontrol in real-time PCR; (b) PrestoBlue cell viability assay in PC12cells transfected with inhibitors of miR-200a, or miR-200b, or

non-targeting control (NTC); (c) Trypan blue labelling and automatedcounting of PC12 cells, transfected with inhibitors of miR-200a or miR-

200b or NTC; (d) In cell bromodeoxyuridine (BrdU) labelling of PC12cells transfected with NTC, or inhibitors of miR-200a, or miR-200b orNTC; (e) quantification of In cell BrdU labelling results; (RFU: relative

fluorescence units; *p ≤ 0.05, groups compared for p value areindicated by open bracket lines).



expression and neuronal proliferation suggests that down-regulation of these miRNAs plays a role in the regulation ofcell fate determining TFs. Significantly increased prolifera-tion rate of PC12 cells, transfected with inhibitors of miR-200b and miR-200a, confirms an inverse relationshipbetween the expression of the miR-200 family and neuronalproliferation. Peng et al., (2012) have recently shown therole of the miR-200 family in the generation and survival ofventral neuronal populations in the murine midbrain/hind-brain region by directly targeting SOX2 and the cell-cycleregulator.In summary, our study demonstrates that the expression of

mature miRNAs is essential for proper neuronal differenti-ation. We have identified miR-200, miR-221/222 and miR-34 as three major miRNA families up-regulated in fullydifferentiated PC12 cells. The expression of the miR-200family initiates neuronal differentiation by down-regulatingSOX2 and KLF4 genes. In conclusion, our study shows thatup-regulation of miR-200 promotes neuronal differentiation,while down-regulation of miR-200 favours neuronal prolif-eration.

Acknowledgments and conflict of interestdisclosure

Ankita Pandey and Abhishek Jauhari are grateful to CSIR, NewDelhi and UGC, New Delhi respectively for providing ResearchFellowship. Financial support for carrying out research work wasobtained from InDepth (CSIR network project) and GAP221(Funded by DBT, New Delhi). The technical assistance of Mr.B.S Pandey and Mr. Puneet Khare is also gratefully acknowledged.The authors declare no conflicts of interest.

All experiments were conducted in compliance with the ARRIVEguidelines.

Supporting information

Additional supporting information may be found in the onlineversion of this article at the publisher's web-site:

Figure S1 and S2. Details of primers present in Taqman LowDensity Array (TLDA) pool A (S1) and pool B (S2) plate.

References

Abdelmohsen K., Hutchison E. R., Lee E. K. et al. (2010) miR-375inhibits differentiation of neurites by lowering HuD levels. Mol.Cell. Biol. 30, 4197–4210.

Abemayor E. and Sidell N. (1989) Human neuroblastoma cell lines asmodels for the in vitro study of neoplastic and neuronal celldifferentiation. Environ. Health Perspect. 80, 3–15.

Agostini M., Tucci P., Killick R. et al. (2011a) Neuronal differentiationby TAp73 is mediated by microRNA-34a regulation ofsynaptic protein targets. Proc. Natl Acad. Sci. USA 108,21093–21098.

Agostini M., Tucci P., Steinert J. R. et al. (2011b) microRNA-34aregulates neurite outgrowth, spinal morphology, and function.Proc. Natl Acad. Sci. USA 108, 21099–21104.

Andersson T., Rahman S., Sansom S. N., Alsio J. M., Kaneda M., SmithJ., O’Carroll D., Tarakhovsky A. and Livesey F. J. (2010)Reversible block of mouse neural stem cell differentiation in theabsence of dicer and microRNAs. PLoS ONE 5, e13453.

Aranha M. M., Santos D. M., Sola S., Steer C. J. and Rodrigues C. M.(2011) miR-34a regulates mouse neural stem cell differentiation.PLoS ONE 6, e21396.

Bandeira F., Lent R. and Herculano-Houzel S. (2009) Changing numbersof neuronal and non-neuronal cells underlie postnatal brain growthin the rat. Proc. Natl Acad. Sci. USA 106, 14108–14113.

Bartel D. P. (2009) MicroRNAs: target recognition and regulatoryfunctions. Cell 136, 215–233.

Chambers I. and Tomlinson S. R. (2009) The transcriptional foundationof pluripotency. Development 136, 2311–2322.

Chen H., Shalom-Feuerstein R., Riley J. et al. (2010) miR-7 and miR-214 are specifically expressed during neuroblastomadifferentiation, cortical development and embryonic stem cellsdifferentiation, and control neurite outgrowth in vitro. Biochem.Biophys. Res. Commun. 394, 921–927.

Cheng L. C., Pastrana E., Tavazoie M. and Doetsch F. (2009) miR-124regulates adult neurogenesis in the subventricular zone stem cellniche. Nat. Neurosci. 12, 399–408.

Choi P. S., Zakhary L., Choi W. Y. et al. (2008) Members of the miRNA-200 family regulate olfactory neurogenesis. Neuron 57, 41–55.

Chung J., Kubota H., Ozaki Y., Uda S. and Kuroda S. (2010) Timing-dependent actions of NGF required for cell differentiation. PLoSONE 5, e9011.

Dannemann M., Prufer K., Lizano E., Nickel B., Burbano H. A. andKelso J. (2012) Transcription factors are targeted by differentiallyexpressed miRNAs in primates. Genome Biol. Evol. 4, 552–564.

Dill H., Linder B., Fehr A. and Fischer U. (2012) Intronic miR-26bcontrols neuronal differentiation by repressing its host transcript,ctdsp2. Genes Dev. 26, 25–30.

Federoff H. J., Grabczyk E. and Fishman M. C. (1988) Dual regulationof GAP-43 gene expression by nerve growth factor andglucocorticoids. J. Biol. Chem. 263, 19290–19295.

Fiore R., Khudayberdiev S., Saba R. and Schratt G. (2011) MicroRNAfunction in the nervous system. Prog. Mol. Biol. Transl. Sci. 102,47–100.

Greene L. A. and Angelastro J. M. (2005) You can’t go home again:transcriptionally driven alteration of cell signaling by NGF.Neurochem. Res. 30, 1347–1352.

Greene L. A. and Tischler A. S. (1976) Establishment of a noradrenergicclonal line of rat adrenal pheochromocytoma cells which respondto nerve growth factor. Proc. Natl Acad. Sci. USA 73, 2424–2428.

Hamada N., Fujita Y., Kojima T., Kitamoto A., Akao Y., Nozawa Y. andIto M. (2012) MicroRNA expression profiling of NGF-treatedPC12 cells revealed a critical role for miR-221 in neuronaldifferentiation. Neurochem. Int. 60, 743–750.

Hoffrogge R., Mikkat S., Scharf C. et al. (2006) 2-DE proteome analysisof a proliferating and differentiating human neuronal stem cell line(ReNcell VM). Proteomics 6, 1833–1847.

Hohjoh H. and Fukushima T. (2007) Marked change in microRNAexpression during neuronal differentiation of humanteratocarcinoma NTera2D1 and mouse embryonal carcinoma P19cells. Biochem. Biophys. Res. Commun. 362, 360–367.

Ikenaka K., Nakahira K., Takayama C., Wada K., Hatanaka H. andMikoshibaK. (1990)Nerve growth factor rapidly induces expressionof the68-kDaneurofilament genebyposttranscriptionalmodificationin PC12 h-R cells. J. Biol. Chem. 265, 19782–19785.

Kawase-Koga Y., Low R., Otaegi G., Pollock A., Deng H., EisenhaberF., Maurer-Stroh S. and Sun T. (2010) RNAase-III enzyme Dicermaintains signaling pathways for differentiation and survival inmouse cortical neural stem cells. J. Cell Sci. 123, 586–594.



Ko M. H., Kim S., Hwang do W., Ko H. Y., Kim Y. H. and Lee D. S.(2008) Bioimaging of the unbalanced expression of microRNA9and microRNA9* during the neuronal differentiation of P19 cells.FEBS J. 275, 2605–2616.

Le M. T., Xie H., Zhou B. et al. (2009) MicroRNA-125b promotesneuronal differentiation in human cells by repressing multipletargets. Mol. Cell. Biol. 29, 5290–5305.

Lee Y., Kim M., Han J., Yeom K. H., Lee S., Baek S. H. and Kim V. N.(2004) MicroRNA genes are transcribed by RNA polymerase II.EMBO J. 23, 4051–4060.

Li N., You X., Chen T. et al. (2013) Global profiling of miRNAs and thehairpin precursors: insights into miRNA processing and novelmiRNA discovery. Nucleic Acids Res. 41, 3619–3634.

Makeyev E. V., Zhang J., Carrasco M. A. and Maniatis T. (2007) TheMicroRNA miR-124 promotes neuronal differentiation bytriggering brain-specific alternative pre-mRNA splicing. Mol.Cell 27, 435–448.

Maurer M. H., Feldmann R. E., Jr, Futterer C. D., Butlin J. andKuschinsky W. (2004) Comprehensive proteome expressionprofiling of undifferentiated versus differentiated neural stemcells from adult rat hippocampus. Neurochem. Res. 29, 1129–1144.

Meseguer S., Mudduluru G., Escamilla J. M., Allgayer H. and BarettinoD. (2011) MicroRNAs-10a and -10b contribute to retinoic acid-induced differentiation of neuroblastoma cells and target thealternative splicing regulatory factor SFRS1 (SF2/ASF). J. Biol.Chem. 286, 4150–4164.

Mori M. A., Raghavan P., Thomou T. et al. (2012) Role of microRNAprocessing in adipose tissue in stress defense and longevity. CellMetab. 16, 336–347.

Peng C., Li N., Ng Y. K., et al. (2012) A unilateral negative feedbackloop between miR-200 microRNAs and Sox2/E2F3 controls neuralprogenitor cell-cycle exit and differentiation. The Journal ofneuroscience : the official journal of the Society for Neuroscience32, 13292–13308.

Saba R. and Schratt G. M. (2010) MicroRNAs in neuronal development,function and dysfunction. Brain Res. 1338, 3–13.

Scott R. E., Florine D. L., Wille J. J., Jr and Yun K. (1982) Coupling ofgrowth arrest and differentiation at a distinct state in the G1 phaseof the cell cycle: GD. Proc. Natl Acad. Sci. USA 79, 845–849.

Sempere L. F., Freemantle S., Pitha-Rowe I., Moss E., Dmitrovsky E.and Ambros V. (2004) Expression profiling of mammalianmicroRNAs uncovers a subset of brain-expressed microRNAswith possible roles in murine and human neuronal differentiation.Genome Biol. 5, R13.

Skaper S. D., Selak I. and Varon S. (1983) Serum vulnerability andtime-dependent stabilization of neurites induced by nerve growthfactor in PC12 pheochromocytoma cells. J. Neurosci. Res. 10,303–315.

Terasawa K., Ichimura A., Sato F., Shimizu K. and Tsujimoto G. (2009)Sustained activation of ERK1/2 by NGF induces microRNA-221and 222 in PC12 cells. FEBS J. 276, 3269–3276.

Vaudry D., Stork P. J., Lazarovici P. and Eiden L. E. (2002) Signalingpathways for PC12 cell differentiation: making the rightconnections. Science 296, 1648–1649.

Wang G., Guo X., Hong W. et al. (2013) Critical regulation of miR-200/ZEB2 pathway in Oct4/Sox2-induced mesenchymal-to-epithelialtransition and induced pluripotent stem cell generation. Proc. NatlAcad. Sci. USA 110, 2858–2863.

Yadav S., Johri A., Dhawan A., Seth P. K. and Parmar D. (2006)Regional specificity in delta methrin-induced cytochromeP450 expression in rat brain. Toxicol. Appl. Pharmacol. 217,15–24.

Yadav S., Pandey A., Shukla A., Talwelkar S. S., Kumar A., Pant A. B.and Parmar D. (2011) miR-497 and miR-302b regulate ethanol-induced neuronal cell death through BCL2 protein and cyclin D2.J. Biol. Chem. 286, 37347–37357.

Yu J. Y., Chung K. H., Deo M., Thompson R. C. and Turner D. L.(2008) MicroRNA miR-124 regulates neurite outgrowth duringneuronal differentiation. Exp. Cell Res. 314, 2618–2633.

Zhou T., Xu B., Que H., Lin Q., Lv S. and Liu S. (2006) Neuronsderived from PC12 cells have the potential to develop synapseswith primary neurons from rat cortex. Acta Neurobiol. Exp. (Wars)66, 105–112.



Critical role of the miR‐200 family in regulating differentiation and proliferation of neurons

Documents

Transcript of Critical role of the miR‐200 family in regulating differentiation and proliferation of neurons