O INSTITUT PASTEUR/ELsEVIER Res. Microbiol. Paris 1997 1997, 148, 217-228

Cloning and expression of colonization factor antigen I (CFA/I) epitopes of enterotoxigenic Escherichia coli (ETEC)

in Salmonella flagellin

M.G. Luna (l) M.M. Martins 0), S,M.C. Newton (2) S.O.E Costa (2), D.F. Almeida (1) and L.C.S. Ferreira 0') (*)

~1) Laborat6rio de Fisiologia Celular, Instituto de Bioffsica Carlos Chagas Filho, UFRJ-CCS, Cidade Universittiria, Rio de Janeiro, RJ 21941-590, and

(2) Departamento de Microbiologia, lnstituto de Ci~ncias Biomddicas II, Universidade de S~o Paulo, SP 05508-900 (Brazil)

SUMMARY

Oligonucleotides coding for linear epitopes of the fimbrial colonization factor antigen I (CFA/I} of enterotoxigenic Escherichia coil (ETEC) were cloned and expressed in a deleted form of the Salmonella muenchen flagellin fliC (Hl-d} gene. Four synthetic oli- gonucleotide pairs coding for regions corresponding to amino acids 1 to 15 (region I), amino acids 11 to 25 (region II), amino acids 32 to 45 (region III) and amino acids 88 to 102 (region IV) were synthesized and cloned in the Salmonella flegellin-coding gene. All four hybrid fiageUins were exported to the bacterial surface where they produced fla- gella, but only three constructs were fully motile. Sera recovered from mice immunized with intraperitoneal injections of purified flagella containing region II (Flail) or region IV (FlaW) showed high titres against dissociated solid-phase-bound CFA/I subunits. Hybrid fiagellins containing region I (Flal| or region III (Flalll} elicited a weak immune response as measured in enzyme-linked immunosorbent assay (ELISA) with dissociated CFA/I subunits. None of the sera prepared with purified hybrid flagella were able to aggluti- nate or inhibit haemagglutination promoted by CFA/I-positive strains. Moreover, inhibi- tion ELISA tests indicated that antisera directed against region I, II, III or IV cloned in fla- gellin were not able to recognize surface-exposed regions on the intact CFA/I fimbriae.

Key-words: CFA, ETEC, Flagellin, Salmonella; Epitope, CFA/I.

INTRODUCTION

Enterotoxigenic Escherichia coli (ETEC) rep- resents one of the most important causes of diar- rhoea in infants in developing countries and in travelers to these areas (Black, 1986, 1990). The

two most important virulence factors of ETEC are fimbrial adhesins named colonization factor antigens (CFAs), coli surface (CS) antigens or putative colonization factors (PCF), which are required for colonization of the small intestine, and the heat-labile (LT) or heat-stable (ST) enter-

Submitted February 18, 1996, accepted October 22, 1996.

(*) Corresponding author.

218 M.G. LUNA ET AL.

otoxins, which cause a marked loss of electro- lytes and fluid by the enterocytes.

The first CFA to be described in ETEC and also one of the most frequenOy found in epidemiologi- cal studies is CFA/I (Evans et al., 1978, 1979). CFA/I fimbriae are expressed as hair-like rigid structures on the surface of the cell, 0.5 to 1 lxm in length with a diameter of 7 nm (Moi and Graaf, 1985). Each fimbrial filament consists of approxi- mately 100 units composed of a single protein subunit with 147 amino acids which, in its mature form, has a molecular weight of 15,057 (Klemm, 1982; Cassels et al., 1992). The CFA/I subunit is the mediator of the adhesive properties, but during the assembly of the subunits into the fimbrial fila- ment, the receptor-binding sites of the inner sub- units are blocked and only the terminal subunit is accessible for the interaction with receptors, as was demonstrated by the binding of specific monoclonal antibodies (mAbs) (Biihler et al., 1991). Attempts to identify linear B-cell epitopes on the CFA/I sequence were initially reported by Klemm and Mikkelsen (1982). Later, Cassels et al. (1992) were able to experimentally identify lin- ear B-cell epitopes on the CFA/I sequence using the "Pepscan" analysis with rhesus monkey anti- sera against dissociated CFA/I subunits. Major lin- ear B-cell epitopes could be identified, but the region containing amino acids 11 to 21 was the only one recognized by the three monkeys and gave the highest records on ELISA (enzyme-lin- ked immunosorbent assay) (Cassels et aL, 1992).

Anti-colonization-based vaccines seem to be an attractive and promising alternative for protec- tion against ETEC infection (Evans et al., 1984). Moreover, the similarity observed in the first 25 amino acids of CFA/I, CS1, CS2, CS4, PCFO166 and CS17 (McConnell et aL, 1989; Sommerfelt

et aL, 1992) raises the possibility of the develop- ment of a multivalent anti-colonization ETEC vaccine. Recently, Rudin et al. (1994) reported the isolation of mAbs, after immunizat ion of mice with dissociated CFA/I subunits, able to cross-react with other ETEC fimbriae and inhibit the haemagglutination and binding to enterocyte- like Caco-2 cells promoted by CFA/I, CS2, CS4 and PCFO166 fimbriae. One of these mAbs was able to specifically recognize a synthetic peptide encompassing the first 25 amino acids of the CFA/I subunit, indicating that at least one linear sequence at the N-terminal end of CFA/I could generate antibodies able to block adhesion to host cells (Rudin et al., 1994). Such results indicated that definition of linear epitopes of CFA/I is an essential step in the rational design of a peptide- based vaccine against ETEC.

Newton et aL (1989) have developed an ele- gant and convenient way of presenting heterolo- gous antigens to the immune system by inserting linear epitopes in the Salmonella flagellin. Such a strategy has been intensively used to generate potentially bivalent attenuated Salmonella-based vaccines expressing epitopes of bacteria and virus (Newton et al., 1989, 1991, 1995; Wu et al., 1989; McEwen et al., 1992). The system is based on the cloning of synthetic oligonucleotides, cod- ing for the tested epitope, in the Salmonella fla- gellin f l i C (Hl -d ) gene present in the plasmid vector pLS408 (Newton et aL, 1989). This vector contains a copy of the f l iC gene with an EcoRV- EcoRV internal deletion of 48 bp in the hypervar- iable region. Therefore, the in-frame insertion of correctly oriented sequences in the EcoRV site of pLS408 results in the expression of hybrid fla- gella with the heterologous epitope exposed on the surface of the appendage (Newton et al., 1989).

B S A = bov ine se rum a lbumin .

C F A = co lon iza t ion f ac to r an t igen . CS = coli sur face (ant igen) .

E L I S A = e n z y m e - l i n k e d i m m u n o s o r b e n t assay . E T E C = en te ro tox igen ic Escherichia coli. Fla = f lagel l in (region).

H A = haemagg lu t i na t i on . I H A = inhibi t ion o f h a e m a g g l u t i n a t i o n .

i.p. = in t raper i toneal ( ly) .

L B = Lur i a -Be r t an i (broth) . m A b = m o n o c l o n a l an t ibody .

O D = opt ica l dens i ty . P A G E = p o l y a c r y l a m i d e gel e lec t rophores i s .

P B S = p h o s p h a t e - b u f f e r e d saline.

P C F = pu ta t ive co lon iza t ion factor . SDS = sod ium dodecy l sulphate .

CFA/I EPITOPES IN SALMONELLA FLA GELLIN 219

In this work, we cloned four oligonucleotides coding for different putative, including three experimentally defined, linear epitopes on the pr imary sequence of the CFA/I. The in vitro expression of the hybrid flagellin was investi- gated as well as the antigenicity and immunoge- nicity of the chimaeric proteins.

MATERIALS AND METHODS

Bacterial strains and growth conditions

The bacterial strains and plasmids used in this work, their relevant properties and sources are listed in table I. Unless otherwise stated, cells were grown at 37°C on Luria-Bertani (LB) broth (Difco, Detroit, MI, USA) supplemented with antibiotics, under aer- ation in orbital shakers. Swarming assays were car- ried out in agar plates containing 0.65 % tryptone and 0.35 % agar. CFA agar plates were prepared as described by Evans et al., 1979.

Synthetic oligonucleotides and recombinant DNA methods

Four oligonucleotide pairs coding for sequences corresponding to three peptides of 15 amino acids and one of 14 amino acids derived from the CFA/I subunit sequence were synthesized by Oligos Etc.,

Inc. (Wilsonville, USA), Restriction sites were included in three of the oligonucleotides, without affecting the coding message, to allow identifica- tion of recombinants by restr ict ion analysis (table II). Stop codons at different reading frames were introduced in the non-coding strands for easy selection of clones with inserts at the right orienta- tion (table II). No changes were introduced in the CFA/I sequences to adapt the codon usage of the Salmonella flagellin gene. Complementary oligonu- cleotides were phosphorylated, annealed at 65°C and blunt-end-ligated, with T4 DNA ligase (New England Biolabs, Beverly, MA, USA), to plasmid linearized with EcoRV and treated with calf intesti- nal phosphatase (New England Biolabs). All rou- tine methods for recombinant DNA were used as described by Maniatis et al. (1982). The ligation mixtures were used to transform chemically pre- pared competent DH5a cells. Plasmid DNA iso- lated from clones selected in LB-ampicillin plates were purified by the alkaline lysis method of Birn- boim and Doly (1979) and subjected to restriction analysis. The screening of the oligonucleotides cod- ing for region III of the CFA/I subunit was carried out by loss of the EcoRV site, since it was not pos- sible to introduce a new restriction site in the sequence without altering the reading code. Recom- binant plasmids were sequenced by double- stranded sequencing with "Sequenase" version 2.0 from US Biochemical, Corporation (Cleveland, OH, USA) using a 15-mer primer corresponding to a sequence 30 bp downstream from the E c o R V insertion site in the flagellin gene. Plasmids were introduced into Salmonella recipient strains by

Strain or plasmid

Table I. Bacterial strains and plasmids used in this work.

Relevant characteristics Reference

Strains: E. coli K12 DH5ct

CL447 ETEC 258909-03 S. typhimurium LB 5000 S. dublin SL5928

SL5930 Plasmids:

pLS408

pLG301 pLG302 pLG303 pLG304

supE44 AlacU169(¢p80 AlacZM15)hsdR17 recA1 endA l gyrA96 thi-1 relA1 C600 derivative, f l iC (hag) r- CFA/I + O 128:K-H? ST+/LT+( * ) r - m +

aroA,fliC: : Tn l O aroA,fliC::TnlO, pLS408

pUC19 derivative containing the flagellin gene with a deletion of 48 bp, Apr pLS408 derivative with region I coding insert pI.,S408 derivative with region II coding insert pLS408 derivative with region III coding insert pLS408 derivative with region IV coding insert

Laboratory stock

Newton et aL, 1989 Gothefors et al., 1985 Sanderson and Stocker, 1987 Newton et aL, 1989 Newton et al., 1989

Newton et al., 1989

This study This study This study This study

(*) ST=stable toxin; LT=labile toxin.

220 M.G. LUNA E T AL.

Table II. Sequence of the oligonucleotides cloned at the Ec oRV restriction site of pLS408 and their corres- ponding encoded amino acids.

CFA/I region Oligonucleotide sequence <*) Amino acid sequence

I (1-15)

II (I 1-25)

III (32-45)

YGTAGAGAAAAATA'I'r ACTGTCACAGCTTCAGTGGATCCGGTAATT3' L BamHI J

5'GTTGATCCAGTAATAOATCTTTTGCAAGCTGATGGCAATGCTCTA3' LBst nJ

5'GC'I'rATAGCCCGGCATCTAAAACTTTTGAATCATACCGTGTAY

VE TVTASV'DPVI

VDPVIDLLQADGNAL

AYSPASKTFESYRV

IV (88-102) 5'OTA'I~ATCTACAACACK;CAAAOAATTCOAAGCTGCTOC'ITrGC_K}A3' L_~m/

VLSTrAKEFEAAALG

(*) Stop codons on complementary strands are underlined. Restriction sites included in the sequences are indicated.

electroporation using a "Bio Rad" electroporator (Bio Rad, Richmond, CA, USA).

Motility and immobilization tests

Cells were grown to an optical density (OD) of 0.4 at 600 nm, and 1 Ixl of each culture was spotted onto a semi-solid agar plate with a micropipette and incubated overnight at 37°C. Their swarm sizes on semi-solid plates were measured after about 15 h at intervals of 1 h for the following 10 h. The motility of the new clones was compared with that of S. dub- lin expressing flagellin without insert (SL5930). Immobilization tests were carried out by adding 5 Ixl of antiflagellin or anti-CFA/l sera to 50 t.d of fully motile la te-exponent ia l -phase cells. Cells were spread on a glass slide and examined under a phase contrast microscope.

Purification of flagellins and CFA/I fimbriae

Flagella isolation was carried out with bacteria grown with gentle agitation at 37°C overnight in LB containing 25 ~tg/ml of ampicillin, centrifuged and concentrated in 1/10 of the original volume. Flagel- lins with or without inserts were purified by acid cleavage as previously described by Ibrahim et al. (1985). For CFA/I isolation, bacteria were grown in Roux flasks containing CFA agar medium and incu- bated at 37°C overnight. CFA/I was isolated by two methods, one based on density gradient centrifuga- tion, as described by Hall et al. (1989), and the other based on heating and treatment of the cells with

urea-based extraction buffer, as reported by Payne et al. (1991), followed by electroelution from prepara- tive gels. Both preparations had similar purity levels as could be evaluated in SDS-PAGE (sodium dode- cyl sulphate-polyacrylamide gel electrophoresis). Dissociat ion of intact CFA/I f imbriae was per- formed by boiling samples of intact fimbriae for 5 min in a solution of 0.1 N HC1 followed by neu- tralization with 0.1 N NaOH. The protein concentra- tion was determined using a procedure originally described by Lowry et al. (1951).

PAGE and Western blots

Flagellin preparations (5 I.tg of protein) were so lubi l ized in sample buf fe r and separa ted by SDS-PAGE in gels with an acrylamide (monomer) concen t ra t ion of 10% fo l lowing the Laem ml i (1970) system. All electrophoreses were carried out in the "Mini Protean II" system (Bio-Rad). For immunoblot analysis, proteins separated in poly- acrylamide gels were transferred to nitrocellulose membranes using a "Mini Protean II" transblot cell (BioRad) at 180 mA for 1 h using the buffer con- ditions described by Towbin and Gordon (1984). The membranes were blocked with 0.5 % bovine serum albumin (BSA) in phosphate-buffered saline (PBS) and incubated overnight . Mouse antisera against dissociated CFA/I subunits were diluted to 1:3,000, rabbit antiserum against intact CFA/I fim- briae (kindly donated by D. Maneval at the Center for Vaccine Development, Baltimore) was diluted to 1:2,000, and rabbit antiserum against Salmo- nel la flagellar antigen d (Difco) was diluted to

CFA/I EPITOPES IN SALMONELLA FLAGELLIN 221

1:1,000 for immunoblot tests. Bound antibodies were detected with goat anti-mouse IgG (1:1,000) or goat anti-rabbit IgG (1:1,000) (Sigma, St. Louis, MO, USA) con juga ted with perox idase . After incubat ion for 1 h with the conjugate and three washings with 0.05 % Tween-20 in PBS, the mem- branes were developed with hydrogen peroxide s u b s t r a t e and 4 - c h l o r o n a p h t o l c h r o m o g e n (Sigma).

Mice and immunization protocol

Female BALB/c mice 6-8 weeks old were immu- nized i.p. (intraperitoneally) with 10 ~tg of purified flagellin solubilized in 100 !11 of complete Freund's adjuvant. Three weeks later, a second injection of 10 lxg of the ant igen suspended in i ncomple t e Freund 's adjuvant was given i.p. to each animal. Ten days later, two additional i.p. doses of the same amount of the antigen without adjuvant were given at a four-day interval. One week after the last immu- nization, the mice were sacrificed by cervical dislo- cation, blood was drawn by heart puncture, and sera were recovered by blood centrifugation after incuba- tion at 37°C for 1 h and 4°C overnight.

Agglutination, haemagglutination and inhibition of haemagglutination tests

In agglutination experiments, bacteria expressing CFA/I cul t ivated on CFA agar plates were har- vested, suspended in PBS and mixed in glass plates with the same volume of PBS or the different sera tested. Agglutination was observed at room temper- ature after approximately 5 min. Haemagglutination (HA) tests were also performed in glass plates con- taining 20 lxl of bacteria suspended in PBS-0.5 % D- mannose (OD of 0.3 at 600 nm), 20 ~tl of PBS and 20 ~tl of washed human group A erythrocytes (2 %). Af ter comple te mixing o f the componen t s , the results were evaluated by visual inspection after approximately 5 min at room temperature. Inhibition of haemagglutination (IHA) tests were performed like the HA tests, except that the lowest amount of bacteria able to give a positive result in HA tests was first incubated with different amounts of the tested sera (final dilution varying from 1"4 to 1:100) for 10 rain at room tempera ture . A suspension (20 I~l) of erythrocytes (2 %) was then added, and the results were read after incubation at room tem- perature for 15 to 30 min.

ELISA and inhibition ELISA

Antibodies against CFA/I and flagellin were deter- mined by coating "Maxisorb" polystyrene microtitre

plates (Nunc, Rokilde, Denmark) with purified CFA/I (0.5 ~tg/well) or fiagellins (1 gg/well) suspended in PBS and incubated overnight at 4°C. After blocking the plates with 1% BSA in PBS at room temperature for 45 min, sera were added at an initial dilution of 1:40 and twofold dilution thereof. Bound antibodies were demonstrated with peroxidase-conjugated goat anti-mouse IgG (Sigma) diluted to 1:4,000 and devel- oped with o r thopheny lened iamine and H20 2 as enzyme substrate. Titres were determined as the reciprocal dilution giving an absorbance of 0.4 at 450 nm above background after 10 min of enzyme reaction. The sera from different mice were analysed individually, and the geometric means and standard deviations of reciprocal individual titres in each group were calculated.

The capacity of intact CFA/I fimbriae, present on the surface of whole cells, to inhibit binding of anti-CFA/I or anti-hybrid flagellin sera to solid- phase-bound CFA/I subunits was assayed by the ELISA inhibition method as previously described (Lopez-Vidal et al., 1988). The different sera to be tested were diluted in 0.1% BSA in PBS to a final OD corresponding to 0.6 at 450 nm. Whole cells of the ETEC strain 258909-03 were suspended in 0.1% B SA-PBS to a concentration of 1011 cells/ml, 50 Ixl of the diluted suspension were mixed with 50 ~tl of the diluted antisera and incubated at room temperature for 10 min. The mixtures were trans- ferred to microp la te wells a l ready coa ted with 0.5 ~tg of CFA/I subunits as the solid-phase antigen and incubated at room temperature for 1 h. The amount of antibody bound to the solid-phase anti- gen was determined as described above for ELISA. One mAb (mAb6) able to recognize an unmapped surface-exposed region along the CFA/I fimbriae length was kindly donated by Dr. K. Jann (BiJhler et al., 1991).

RESULTS

Construction of hybrid flagellin genes coding for CFA/I epitopes

F o u r sy n th e t i c o l i g o n u c l e o t i d e pairs , e ach encoding dis t inct amino acid sequences o f the CFA/I subunit, were chosen based on the follo- wing mapping of B-cell epitopes by "Pepscan" analysis , r eac t iv i ty wi th m A b s against CFA/I , hydrophilicity and secondary structural potential estimated by computer programs, and homology with other ETEC fimbriae (Cassels et al., 1992; Lopez-Vidal et aL, 1988; K lemm and Mikkelsen, 1982; Sommerfel t et aL, 1992) (table II). Region I

222 M.G. LUNA ET AL.

encompassed the first 15 amino acids of the mature form of the CFA/I subunit and was cho- sen due to its almost complete identity with CS4 and PCFO166 and a very significant homology with CS1, CS2, and CS17. Region II was repre- sented by amino acids 11 to 25 of CFA/I and included the most potent B-cell epitope (amino acids 11 to 21) identified by Cassels et al. (1992) in "Pepscan" analysis. Regions Ill (amino acids 32 to 45) and IV (amino acids 88 to 102) were selected based on the high potential for reverse turns, antigenicity on "Pepscan" analysis and reactivity toward CFA/I (region III)-specific mAbs (Lopez-Vidal et al., 1988). All nucleotide sequences were designed for in-frame insertion into the EcoRV site of the flagellin gene. Restric- tion sites and stop codons in the non-coding strands were included for easy selection of recombinant clones (table II). Complementary oligonucleotides were annealed, phosphorylated, cloned in the EcoRV site of pLS408 and trans- formed into DH5~t. Colonies containing recombi- nant plasmids were screened by restriction analy- sis and then confirmed by DNA sequencing. One plasmid with the right-oriented insert for each region was selected and named pLG301 (for region I), pLG302 (for region II), pLG303 (for region III) and pLG304 (for region IV). These plasmids were electroporated directly into flagel- lin-deficient E. coli CL447 and S. dublin SL5928. In some preliminary experiments, S. typhimurium LB5000 was used as an intermediary host for the plasmids before transfer to strain SL5928, but since the fmal transformation elTmiency was not affected by the direct transfer to the S. dublin strain, this procedure was abolished in subse- quent transformations. The four sequences cloned in the Salmonella flagellin gene corresponded to 54 amino acids of the mature CFA/I subunit rep- resenting 36.7% of the mature protein.

Effects of flageilin insertions on cell motifity and immobilization tests

All E. coli and S. dublin strains harbouring the recombinant plasmids were able to express a fla- gellin which could be assembled in functional flagella. The flagellin proteins coded by pLG301,

pLG302, pLG303 and pLG304 were named FlaI (expressing region I of CFA/I protein), FlalI (region II), Flalil (region III) and FIalV (region IV), respectively. The flagellin without an insert coded by the vector plasmid pLS408 was named Fla30. The SL5928 strains harbouring plasmids coding for different hybrid flagella were motile in semi-solid medium, but with different rates of spreading as shown in figure 1. The motility attributed to FlalV flagella was 90% of that detected with Fla30. Similarly, FlalI, FlaI and FlalII flagella showed motilities equivalent to 76, 45 and 19%, respectively, of that detected with Fla30 (fig. 1). The reduced motility of the S. dub- lin strain transformed with plasmid pLG303 (FlaIII) was not attributed to lower numbers or size of the flagella. Electron microscopic exam- ination of this swain using negatively stained bac- teria showed that the chimaeric flagella were structurally indistinguishable from normal fla- gella except for a tendency to coalesce as bundles (data not shown). Under optical microscopy, the cells expressing the FlaIII hybrid flagellin formed clumps of 4 to 10 cells, which were restricted in their motility. Therefore, expression of region HI in the chimaeric flagellin resulted in significant reduction of flagellar function.

Immobilization tests performed with anti- CFA/I sera prepared with dissociated CFA/I fim- briae showed immediate immobilization of the Salmonella-expressing flagellins coded by plas- raids pLG301, pLG302 and pLG304. Immobil- ization tests carried out with cells expressing hybrid flagella coded by plasmid pLG303 were difficult to evaluate due to the low motility of this strain and the tendency to form clumps. However, careful microscopic examination showed that a significant reduction in swimming and tumbling was also detected in single cells after addition of region-iiI-specific antisera. These data demon- strate that all cloned CFA/I regions were exposed at the surface of the flagella.

Antigenicity of the hybrid flageifins in E. coli and S. dublin strains

SDS-PAGE of purified flagella coded by the recombinant plasmids showed that the hybrid fla-

C F A / I E P I T O P E S I N S A L M O N E L L A F L A G E L L I N 223

25

20

.=

co

5

0 0

- 1 -~- Fla 30 . [

--*- Ra I

/ / ' ~ , 17 19 21

Time ( hour ) 23

Fig. 1. Motility test of the S. dublin SL5928 carrying plasmids coding for the hybrid flagellins and flagellin without insert.

The following strains were tested: Fla30 expresses the flagellin without insert; FlaI expresses the hybrid flagellin with amino acids 1 to 15 of mature CFA/I subunit; Flail expresses the hybrid fla- gellin with amino acids l 1 to 25 ; FIaHI expresses the hybrid flagellin with amino acids 32 to 45 ; and FIalV expresses the hybrid flagellin with amino acids 88 to 102. Each clone was inoculated on semi- solid medium and incubated at 37°C. The swarm sizes (millimeter, ram) reflect the motility of each clone expressed as a function of incubation time (hour). The values reported are averages of three experiments.

gellins had a small increase in their apparent molecular weight in relation to the flagellin with- out an insert (fig. 2A). Antigens expressed in both E. coli CL447 and S. dublin SL5928 were examined in immunoblots by probing with either rabbit antisera against flagellar antigen d, rabbit antisera against intact CFA/I fimbriae or mouse antisera against dissociated CFA/I subunits. All constructs reacted with anti-flagellin sera, indi- cating that the cloning of the inserts did not affect the antigenicity of the flagellin moiety of the hybrid proteins (fig. 2B). The flagellins coded by plasmid pLG303 (FlalII) , and in particular pLG301 (FlaI), were weakly recognized by mouse anti-CFA/I subunit sera (fig. 2C). On the other hand, the flagellins coded by plasmid pLG302 (Hal0 and pLG304 (FlaW) gave strong reactions when tested with polyclonal antibody against CFA/I subunits (fig. 2C). No reaction was

observed between the hybrid flagellins and sera obtained from rabbits immunized with intact CFA/I fimbriae (data not shown).

Humoral immune response against purified Salmonella hybrid flagellins

BALB/c female mice were immunized i.p. with purified flagellins isolated from the Salmonella strains, and the presence of specific anti-CFA/I and anti-flagellin antibodies was evaluated by IgG ELISA. ELISA titres obtained with flagellin without an insert (Fla30), used as the solid-phase- bound antigen, showed that the insertion of the CFA/I epitopes did not affect the immunogenicity of the hybrid flagellins, since high titres of anti- flagellin IgG were obtained with the four con- structs (table III). On the other hand, when CFA/I

224 M.G. LUNA E T AL.

subunits were used as solid-phase-bound antigen, differences among the ELISA titres of sera from mice immunized with different hybrid flagellins were observed. Animals immunized with flagel- lin c o d e d by p l a s m i d p L G 3 0 2 (F la I I ) and

A 1 2 3 4 5

B 1 2 3 4 5

60kD --->

C 1 2 3 4 5

601d) --~ 0

p L G 3 0 4 (F la lV) s h o w e d high E L I S A ti tres against CFA/I subunits. On the other hand, the sera recovered from animals immunized with fla- gell in encoded by p lasmid p L G 3 0 3 (Fla l I I ) showed weak reactivity toward CFA/I subunits (table III). Finally, almost no reactivity against CFAfl subunits could be detected in the ELISA test in sera of mice immunized with hybrid fla- gella coded by pLG301 (FlaI). These results demonstrate that the four linear CFA/I sequences differ markedly in their immunogenici ty, and sequences coded by the plasmids pLG302 and pLG304 are the most potent CFA/I linear B-cell epitopes tested.

Characterization of antibodies generated against hybrid flagellins

Sera col lected from mice immunized with hybrid flagellins were further analysed for the ability to agglutinate an ETEC strain and inhibit HA promoted by CFA/I-expressing cells (IHA); and inhibition ELISA was performed. None of the sera recovered from mice immunized with hybrid flagellins were able to promote agglutina- tion of the CFA/I-expressing ETEC strain (table III). Similarly, the same sera were unable to inhibit HA promoted by CFA/I-expressing cells even when tested at high concentrations (dilution of 1:4) (table III). Several attempts to change the assay condit ions of the IHA tests in order to detect even partial inhibition did not change the results (data not shown). The ability of antibodies generated against the hybrid flagellins to recog- nize and bind epitopes exposed on the surface of

Fig. 2. Electrophoretic profiles and immunoblots of par- tially purified flagellins isolated from S. dublin strains.

The flagellins were isolated from clones transformed with plasmid pLS408 [Fla30] (lanes 1), pLG301 [FlaI] (lanes 2), pLG302 [FlaII] (lanes 3), pLG303 [FlaIII] (lanes 4), and pLG304 [FlaIV] (lanes 5). The gels were stained with Coomassie brilliant blue (A) or transferred to nitrocellulose sheets and subsequently treated with rabbit antiserum against Salmonella flagellar antigen d (B), and mice antiserum against dissociated CFA/I subunits (C). The molecular weight of the flagellin without insert is indicated on the left of the figure.

CFA/I E P I T O P E S IN SALMONELLA F L A G E L L I N 225

Table III. Comparison of reciprocal ELISA IgG titres, cell agglutination and inhibition of HA ability of anti- sera against the hybrid flagellins.

ELISA titre (c~ Sera (a) anti-CFA/I (d) anti-flagellin (d) Agglutination (e) IHA (e)

FlaI 100 FlalI 6,400 FlallI 800 FIalV 1,600

Controls (b): CFA/I 64,000 Fla30

25,600 51,200 51,200 25,600

m

- - + + + +

51,200 - -

la~ Sera collected from mice immunized with hybrid flagellins FlaI (region I), Flail (region II), FlalII (region III) and FlalV (region IV), following the immunization protocol described in "Materials and Methods".

~b) Sera from mice immunized with dissociated CFA/I subunits (CFA/I) and Salmonella flagellin encoded by pLS408 (Fla30) were used as controls.

tc~ Mean ELISA titres calculated from duplicate determinations of sera collected and analysed individually from four animals for each immunization.

td~ The wells were coated with 0.5 ~g/well of CFA/I subunits or 1 gg/well of Fla30 flagellin as the solid-phase-bound antigen. te~ Agglutination and IHA were carried out with the ETEC strain 258909-03 expressing CFA/I fimbriae. Sera were diluted to 1:4

in both reactions.

CFA/I f imbriae was evaluated in inhibi t ion ELISA tests. Experiments with sera generated by animals immunized with purified Flal hybrid fla- geUin could not be performed due to the low titres against the dissociated CFA/I subunit. The bind- ing of antibodies generated after immunization with the hybrid flagellins to solid-phase-bound dissociated CFA/I fimbriae was not inhibited after incubation in the presence of CFA/I-positive bac- terial cells (fig. 3). A monoclonal ant ibody (mAb6) (Biihler et al., 1991) able to recognize a surface-exposed epitope on the CFA/I fimbriae was used as a positive control, and a clear reduc- tion in the binding to solid-phase-bound CFA/I under the same conditions could be observed (fig. 3). Altogether, these results suggested that antibodies generated against regions I, II, HI and IV expressed as flageUin-fusion proteins were not able to recognize surface-exposed regions in the intact CFA/I fimbriae.

DISCUSSION

In contrast to other reports (Wu et al., 1989; Acero-Reyes and Newton, 1994), insertion of the

chosen CFA/I epitopes did not disturb the synthe- sis and polymerization of flagellins into morpho- logically normal flagella. Nonetheless, clones expressing hybrid flagellins containing region HI of the CFA/I f imbriae cons is ten t ly showed reduced motility when compared to the parental strain. Based on electron microscopic observa- tions, the altered motility of these clones could be attributed to the tendency of the flagella to form side-by-side aggregates like bundles, which could restrict the swarming movement of the cells. A similar behaviour had already been described in mutant f lagell ins with dele t ions at surface- exposed regions or expressing heterologous B- or T-cell epitopes (Verma et al., 1995a, b; Yoshioka et al . , 1995). At present, we do not know the structural basis for the reduced motility of these chimaeric flagella, but the altered function might have impor tant impl icat ions in the i m m u n e response in orally immunized subjects, where bacterial motility may be an important determi- nant of intestinal colonization and infectivity.

In spite of the highly conserved nature of the first 20 amino acids of CFA/I, CS1, CS2, CS4, PCFO166 and CS17 (McConnell et al. , 1989; Sommerfelt et al . , 1992), the hybrid flagellin

226 M.G. LUNA ET AL.

120

E

ID 0 "6

¢1

100

80

60

40

20

0

-~- MAb 6

-e-Anti-Ra II

-~ Anti-Fla III

4- Anti-Fla IV 4- Anti-Fla IV

I .

l I J t t I J

-2 -3 -4 -5

Dilution of bacteria (log)

Fig. 3. Inhibition ELISA of antisera raised against hybrid flagellins using a CFA/I-positive strain as inhibitor of the binding to solid-phase-bound dissociated CFA/I subunit.

The following sera raised against different purified hybrid flagellin were used: anti-Hail, sera against flagellin containing amino acids 11 to 25 of mature CFA/I subunit, anti-FlalII, sera against flagellin containing amino acids 32 to 45 and anti-FlalV, sera against flagellin containing amino acids 88 to 102. The mAb6 was used as a positive control for the inhibition promoted by intact CFA/I fimbriae. The initial concentration of the suspension containing the CFA/I-positive strain 258909-03 was 10 IJ cells/ml. Relative unit 100 represents 0 . 6 0 D units at 450 nm for all antisera and mAb tested.

expressing the inserted region I (amino acids 1 to 15) of CFA/I could not el ici t a s igni f icant immune response and was hardly recognized by sera prepared against the dissociated CFA/I sub- unit. On the other hand, region II (amino acids 11 to 21) of CFA/I, also conserved among several ETEC colonization factors, was able to elicit the highest titres of sera against dissociated CFA/I subunits as compared with other tested regions (table III). Given that the region encompassing amino acids 1 to 25 presents cross-reactivity with dissociated CS1, CS2, CS4, PCFO166 and other CFA/I-related fimbriae (Rudin and Svennerholm, 1996), it is possible that region II could be useful for the generation of broad-spectrum anti-coloni- zation antibodies.

Previous evidence obtained with mAbs and "Pepscan" analyses showed that at least one immunodominant N-terminal B-cell-dependent epitope may be involved in the adhesive function

of the CFA/I fimbriae (Biihler et al., 1991 ; Cas- sels et al., 1992; Lopez-Vidal et al., 1988; Rudin et al. , 1994). Confirming previous "Pepscan" analyses (Cassels et aL, 1992), the immunogeni- city of the Flal/hybrid protein towards CFA sub- units suggests that the sequence encompassing amino acid residues 11 to 25 of the mature CFA/I fimbriae represents the strongest B-cell epitope of the N-terminal region of the protein. Moreover, the involvement of such linear sequences with the adhesive properties of the CFA/I fimbriae could be further demonstrated in ELISA tests carried out with 1-nAbs able to block the adhesion of the CFA/I-bearing ETEC cells (to be published else- where). Nonetheless, the antibodies generated after immunization with purified hybrid flagellins expressing region II of the CFA/I fimbriae could not significantly inhibit the binding of intact tim- briae in the HA test, nor even bind to whole-cell- associated fimbriae in inhibition ELISA. The

CFA/I EPITOPES IN SALMONELLA FLAGELLIN 227

same results were obtained with synthetic pep- tides encompassing the first 25 N-terminal amino acids of the CFA/I subunit (Rudin et al., 1994). Taken together, these data lead us to conclude that conformational epitopes may have a predominant role in the determination of the adhesive function of the CFA/I fmabdae. Conformational differences between the sequences exposed on the surface of the flagellar shaft and those expressed at the tip of the CFA/I fimbriae might explain the lack of receptor-binding blocking activity of sera raised against region II of CFA/I or, alternatively, more than one non-contiguous linear sequence on the N-terminal end is required for the adhesive func- tion of the fimbriae. In the first case, modification of the side amino acids f lanking the inserted sequence in the hypervariable region of the Sal- m o n e l l a f lagel l in may be an a l ternat ive for improving the presentation of the inserted peptide to the immune system, as previously demon- strated with other antigens (Verma et al., 1995a, b; Lu et al., 1995). We believe that further efforts to improve the expression of epitopes by this system could contribute to the development of peptide-based anti-colonization vaccines against ETEC and other enteric pathogens.

aux acides amines 1 h 15 (rEgion I), 11 h 25 (rEgion II), 32 h 45 (rEgion III) et 88 ~ 102 (rEgion IV), ont EtE synthEtisEes et clonEes dans le gone de Salmo- nella codant pour la flagelline. Les quatre flagellines hybrides ont EtE exportEes/~ la surface bactErienne oO elles ont produit le flagelle, mais trois de ces structures seulement avaient une pleine motilitE.

Les serums de souris immunisEes par injection intrapEritonEale de flagelline comportant la region II (Flail) ou IV (FIalV), ont montrE des titres ElevEs contre les sous-unitEs dissociEes CFA/I liEes ~t la phase solide. Les flageUines hybrides comportant la region I (FlaI) ou III (FlalII) ont provoqu6 une rEponse immunitaire faible comme celle mesurEe en ELISA avec les sous-unitEs dissociEes. Aucun serum obtenu ~t partir d'une flagelline hybride n'est capable d 'agglu t iner les souches CFA/I + ou d'inhiber l'hEmagglutination provoquEe par ces souches. De plus, les tests d'inhibition ELISA mon- trent que les immunsErums dirigEs contre les regions I, II, III ou IV clonEes dans la flagelline, ne sont pas capables de reconnaltre les regions exposEes ~ la surface sur les fimbrilles CFA/I intactes.

Mots-cl~s: CFA, ETEC, Flagelline, Salmonella; Epitope, CFA/I.

References

Acknowledgments

We thank A.-M. Svennerholm, Department of Medical Microbiology, University of GEteborg, G/Steborg, Sweden, for providing the 258909-03 ETEC strain used in this study. We also thank K. Jann, Max-Planck Institute, Freiburg, Ger- many, for the kind gift of mAb6. We acknowledge the invaluable technical support provided by C. Pereira and E. Camacho.

This work was supported by FINEP and PADC~ grants.

Clonage et expression des ~pitopes du CFA/I des souches de Escherichia coil ent~rotoxig~niques

dans la flagelline de Salmonella

Des oligonuclEotides codant pour des Epitopes linEaires du CFA/I (colonization factor antigen) de souches de Escherichia coli entErotoxigEniques, ont EtE clones et exprimEs dans une forme dE1EtEe du gone f l iC (Hl -d) de la flagelline de Salmonella mue nc he n . Quatre paires d 'o l igonuclEot ides synthEtiques codant pour les regions correspondant

Acero-Reyes, J.R. & Newton, S.M.C. (1994), Expression of cholera toxin epitopes inserted in flagellin by attenuated Salmonella strains. Brazil. J. Genet., 17, 249-254.

Birnboim, H.C. & Doly, C. (1979), A rapid alkaline extraction procedure for screening recombinant plas- mid DNA. Nucleic Acids Res., 7, 1513-1523.

Black, R.E. (1986), The epidemiology of cholera and enterotoxigenic Escherichia coli diarrhea disease, in "Development of vaccines and drugs against diar- rhea". 11 th Nobel Conference. (Holmgren, J., Lind- berg, A. & MSllby, R.) (pp. 22-32). Studentlitteratur, Lurid, Sweden.

Black, R.E. (1990), Epidemiology of travellers' diarrhea and relative importance of various pathogens. Rev. Infect. Dis., 12, $73-$79.

Btihler, T., Hoschiitzky, H. & Jann, K. (1991), Analysis of colonization factor antigen I, an adhesin of enterotox- igenic Escherichia coli O78:HI 1: fimbrial morphol- ogy and location of the receptor-binding site. Infect. Immun., 59, 3876-3882.

Cassels, F.J., Deal, C.D., Reid, R.H., Jarboe, D.L., Nauss, J.L., Carter, J.M. & Boedeker, E.C. (1992), Analysis of Escherichia coli colonization factor antigen I linear B-cell epitopes, as determined by primate responses, following protein sequence verification. Infect. lmmun., 60, 2174-2181.

Evans, D.G., Evans, D.J., Jr., Clegg, S. & Pauley, J.A. (1979), Purification and characterization of the

228 M.G. L U N A E T AL.

CFA/I antigen of enterotoxigenic Escherichia coli. Infect. lmmun., 25, 738-748.

Evans, D.G., Evans, D.J., Jr., Tjoa, W.S. & Dupont, H.L. (1978), Detection and characterization of coloniza- tion factor of enterotoxigenic Escherichia coli iso- lated from adults with diarrhea. Infect. Immun., 21, 727-736.

Evans, D.G., Graham, D.Y., Evans, D.J., Jr. & Opekun, A. (1984), Administration of purified colonization factor antigens (CFA/I, CFA/II) of enterotoxigenic Escheri- chia coli to volunteers. Response to challenge with virulent enterotoxigenic Escherichia coil Gastroen- terology, 87, 934-940.

Gothefors, L., ,&.hr6n, C., Stoll, B., Barua, D.K., Orskov, F., Salek, M.A. & Svennerholm, A.-M. (1985), Pres- ence of colonization factor antigens on fresh isolates of fecal Escherichia coli: a prospective study. J. Infect. Dis., 152, 1128-1133.

Hall, R.H., Maneval, D.R., Collins, J.H., Theibert, J.L. & Levine, M.M. (1989), Purification and analysis of colonization factor antigen I, coli surface antigen 1, and coli surface antigen 3 fimbriae from entero- toxigenic Escherichia coli. J. Bacteriol., 171, 6372- 6374.

Ibrahim, G.F., Fleet, G.H., Lyons, M.J. & Walker, R.A. (1985), Method for the isolation of highly purified Salmonella flagellins. J. Clin. MicrobioL, 22, 1040- 1044.

Klemm, P. (1982), Primary structure of the CFA/I fimbrial protein from human enterotoxigenic Escherichia coli strains. Eur. J. Biochem., 124, 339-348.

Klemm, P. & Mikkelsen, L. (1982), Prediction of anti- genic determinants and secondary structures of the K88 and CFA1 fimbrial proteins from enteropatho- genic Escherichia coli. Infect lmmun., 38, 41-45.

Laemmli, U.K. (1970), Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature (Lond.), 227, 680-685.

Lopez-Vidal, Y., Klemm, P. & Svennerholm, A.-M. (1988), Monoclonal antibodies against different epi- topes on colonization factor antigen I of enterotoxin- producing Escherichia coll. J. Clin. Microbiol., 26, 1967-1972.

Lowry, O.H., Rosebrough, N.J., Farr, A.L. & Randall, R.J. (1951), Protein measurement with the Folin phenol reagent. J. Biol. Chem., 193, 265-275.

Lu, Z., Murray, K.S., Cleave, V.V., LaVallie, E.R., Stahl, M.L. & McCoy, J.M. (1995), Expression of thiore- doxin random peptide libraries on the Escherichia coli cell surface as functional fusions to flagellin: A system designed for exploration of protein-protein interactions. BioTechnology, 13, 366-372.

Maniatis, T., Fritsch, E.F. & Sambrook, J. (1982), Molec- ular cloning: a laboratory manual. Cold Spring Har- bor Laboratory, New York.

McConnell, M.M., Chart, H. & Rowe, B. (1989), Antigenic homology within human enterotoxigenic Escherichia coli fimbrial colonization factor antigens: CFA/I, coli- surface-associated antigens CS1, CS2, CS4 and CS 17. FEMS Microbiology Left., 61, 105-108.

McEwen, J., Levi, R., Horwitz, R.J. &. Arnon, R. (1992), Synthetic recombinant vaccine expressing influenza haemagglutinin epitope in Salmonella flagellin leads to partial protection in mice. Vaccine, 10, 405-411.

Moi, F.R. & Graaf, F.K. (1985), Molecular biology of tim-

briae of enterotoxigenic Escherichia coli. Curr. Top. MicrobioL lmmunol., 118, 119-137.

Newton, S.M.C., Jacob, C.O. & Stocker, B.A.D. (1989), Immune response to cholera toxin epitope inserted in Salmonella flagellin. Science, 244, 70-72.

Newton, S.M.C., Joys, T.M., Anderson, S.A., Kennedy, R.C., Hovi, M.E. & Stocker, B.A.D. (1995), Expres- sion and immunogenicity of an 18-residue epitope of HIV gp41 inserted in the flagellar protein of a Salmo- nella live vaccine. Res. Microbiol., 146, 203-216.

Newton, S.M.C., Kotb, M., Poirier, T.P., Stocker, B.A.D. & Beachey, E.H. (1991), Expression and immunoge- nicity of a streptococcal M protein epitope inserted in Salmonella flagellin. Infect. Immun., 59, 2158- 2165.

Payne, D.W., Shuttleworth, A.D. & Lambert, P.A. (1991), Evaluation of a small-scale method for the extraction of the K88 antigen from enterotoxigenic Escherichia coli. FEMS Microbiol. Lett., 78, 81-84.

Rudin, A., McConnell, M.M. & Svennerholm, A.-M. (1994), Monoclonal antibodies against enterotoxi- genic Escherichia coli colonization factor antigen (CFA/I) that cross-react immunologically with heter- ologous CFAs. Infect. Immun., 62, 4339-4346.

Rudin, A. & Svennerholm, A-M. (1996), Identification of a cross-protective linear epitope in enterotoxigenic Escherichia coli colonization factor antigen I (CFA/I) and characterization of anti-CFA/I peptide antisera. Infect. Immun. (in press).

Sanderson, K.E. & Stocker, B.A.D. (1987), Salmonella typhimurium strains used in genetic analysis, in "'Escherichia coli and Salmonella typhimurium. Cel- lular and molecular biology" (Ingraham, J.L., Low, B., Magasanik, B., Schaechter, M. & Umbarger, H.E.) (pp. 1220-1224). American Society for Micro- biology, Washington, D.C.

Sommerfelt, H., Grewal, H.M.S., Svennerholm, A.-M., Gastra, W., Flood, P.R., Viboud, G. & Bhan, M.K. (1992), Genetic relationship of putative colonization factor O166 to colonization factor antigen I and coli surface antigen 4 of enterotoxigenic Escherichia coli. Infect. lmmun., 60, 3799-3806.

Towbin, H. & Gordon, N. (1984), Immunoblotting and dot immunobinding - - current status and outlook. J. Immunol. Methods, 72, 313-40.

Verma, N.K., Ziegler, H.K., Stocker, B.A.D. & Schoolnik, G.K. (1995b), Induct ion of a cellular immune response to a defined T-cell epitope as an insert in the flagellin of a live vaccine strain of Salmonella. Vac- cine, 13, 235-244.

Verma, N.K., Ziegler, H.K., Wilson, M., Khan, M., Safiey, S., Stocker, B.A.D. & Schoolnik, G.K. (1995a), Delivery of class I and class II MHC-restricted T-cell epitopes of listeriolysin of Listeria monocytogenes by attenuated Salmonella. Vaccine, 13, 142-150.

Wu, J.Y., Newton, S., Judd, A., Stocker, B. & Robinson, W.S. (1989), Expression of immunogenic epitopes of hepatitis B surface antigen with hybrid flagellin pro- teins by a vaccine strain of Salmonella. Proc. Natl. Acad. Sci. USA, 86, 4726-4730.

Yoshioka, K., Aizawa, S.-I. & Yamaguchi, S. (1995), Flagellar filament structure and cell motility of Sal- monella typhimurium mutants lacking part of the outer domain of flagellin. J. Bacteriol., 177, 1090- 1093.