Clinical isolates of Streptococcus pneumoniae bind the complement inhibitor C4b-binding protein in a...

of June 13, 2013.This information is current as

Protein in a PspC Allele-Dependent FashionBind the Complement Inhibitor C4b-Binding Clinical Isolates of Streptococcus pneumoniae

and Barbara AlbigerSeppo Meri, Birgitta Henriques-Normark, Kristian Riesbeck Antoine Dieudonné-Vatran, Stefanie Krentz, Anna M. Blom,

http://www.jimmunol.org/content/182/12/7865doi: 10.4049/jimmunol.0802376

2009; 182:7865-7877; ;J Immunol

Referenceshttp://www.jimmunol.org/content/182/12/7865.full#ref-list-1

, 41 of which you can access for free at: cites 70 articlesThis article

Subscriptionshttp://jimmunol.org/subscriptions

is online at: The Journal of ImmunologyInformation about subscribing to

Permissionshttp://www.aai.org/ji/copyright.htmlSubmit copyright permission requests at:

Email Alertshttp://jimmunol.org/cgi/alerts/etocReceive free email-alerts when new articles cite this article. Sign up at:

Print ISSN: 0022-1767 Online ISSN: 1550-6606. Immunologists, Inc. All rights reserved.Copyright © 2009 by The American Association of9650 Rockville Pike, Bethesda, MD 20814-3994.The American Association of Immunologists, Inc.,

is published twice each month byThe Journal of Immunology

by guest on June 13, 2013http://w

ww

.jimm

unol.org/D

ownloaded from

http://www.jimmunol.org/

Clinical Isolates of Streptococcus pneumoniae Bind theComplement Inhibitor C4b-Binding Protein in a PspCAllele-Dependent Fashion1

Antoine Dieudonne-Vatran,* Stefanie Krentz,* Anna M. Blom,† Seppo Meri,‡

Birgitta Henriques-Normark,§¶ Kristian Riesbeck,* and Barbara Albiger2*¶

The complement system constitutes an important component of the innate immune system. To colonize their host and/or to causedisease, many pathogens have evolved strategies to avoid complement-mediated bacterial lysis and opsonophagocytosis. In thisstudy, using a collection of 55 clinical isolates of Streptococcus pneumoniae, we demonstrate for the first time that pneumococcibind the complement inhibitor C4b-binding protein (C4BP). C4BP binding seems to be restricted to certain serotypes such asserotype 4, 6B, 7F, and 14, of which the strains of serotype 14 are the strongest binders. We show that bacteria-bound C4BP retainsits functional activity and down-regulates the activation of the classical pathway. Thus, this major respiratory pathogen mayescape immune recognition and eradication by the complement system. Furthermore, we show that C4BP binding varies betweenstrains but is dependent on the expression of pneumococcal surface protein C, PspC of group 4. The study of the distribution ofgroup 4 pspC locus shows that most of high-binder serotype 14 isolates harbor an allelic variant of group 4 pspC. Using PspC-negative mutant strains, we identified a new allelic variant of PspC (PspC4.4) as a major ligand for C4BP, revealing a new functionfor this important pneumococcal virulence factor. Thus pneumococci exploit host C4BP for complement evasion in a PspCallele-dependent manner. The Journal of Immunology, 2009, 182: 7865–7877.

T he complement system is part of the first line of hostinnate immune defense. It is composed of �30 solubleand membrane-bound proteins that upon microbial recog-

nition initiate a regulated cascade of reactions. There are threepathways of complement activation: 1) the classical pathway, 2)the alternative pathway, and 3) the lectin pathway. Activation ofthe classical pathway is initiated by C1q binding to, for example,lipopolysaccharides or Fc regions of Abs on bacterial surfaces. Thealternative and lectin pathways are activated directly by bacterialsurface components in the absence of Ab-Ag complexes. All threepathways lead to the formation of the C3 convertase with subse-quent cleavage into C3a (anaphylatoxin) and C3b (opsonin). Thisresults in either opsonization and phagocytosis of the pathogen orin the formation of the bacteriolytic membrane attack complex

(MAC).3 To avoid overconsumption and attack against host cells,while targeting microbial surfaces, the complement activationneeds to be tightly regulated. This regulation occurs via both sol-uble (factor I, factor H, FHL-1, C4b-binding protein (C4BP)) andmembrane-bound (CRIg, CD35, CD46, CD55, and CD59) com-plement regulatory proteins.

C4BP is the major soluble inhibitor of the classical and lectinpathways. It inhibits the formation and accelerates the decay ofthe C3 convertase (C4bC2a) (1, 2). It is a 570-kDa glycoproteincomposed of eight polypeptide chains (seven �-chains and one�-chain) arranged in a spider-like structure. Both the �-chainsand �-chain are composed of repeating domains of �60 aaeach, known as complement control protein (CCP) domains orshort consensus repeats (SCRs). The physiologic concentrationrange of C4BP in normal human serum (NHS) is 200 –300 �g/ml. Most complement proteins are produced in the liver, butproduction of complement factors, particularly of C1q and C7,and inhibitors also occurs in the lungs by alveolar macrophagesand epithelial cells (3, 4). Upon inflammation, plasma exudatescan also leak complement proteins into the respiratory tract.

To colonize the host and/or to cause disease, microbes have toovercome recognition and clearance by the immune system, andthey have evolved a plethora of strategies to evade the complementsystem. One such strategy is to bind C4BP, which will prevent theactivation of the classical pathway on the bacterial surface. Indeed,

*Department of Laboratory Medicine, Medical Microbiology, and †Department ofLaboratory Medicine, Medical Protein Chemistry, Lund University, Malmo, Sweden;‡Department of Bacteriology and Immunology, Haartman Institute, Helsinki, Finland;§Department of Bacteriology, Swedish Institute for Infectious Disease Control, Solna,Sweden; and ¶Department of Microbiology, Tumorbiology and Cell Biology, Karo-linska Institutet, Stockholm, Sweden

Received for publication July 22, 2008. Accepted for publication April 10, 2009.

The costs of publication of this article were defrayed in part by the payment of pagecharges. This article must therefore be hereby marked advertisement in accordancewith 18 U.S.C. Section 1734 solely to indicate this fact.1 B.A. was supported by grants from the Swedish Medical Research Council,Crafoord Foundation, the Swedish Society of Medicine, Lars Hiertas Memory Funds,Alfred Osterlund Foundation, Langmanska Culture Foundation, and O. E. & EddaJohansson Scientific Foundation. A.M.B. received grants from the Swedish MedicalResearch Council and the Swedish Foundation for Strategic Research. B.H.N. wasfinanced by the Swedish Medical Research Council, Torsten and Ragnar SoderbergsFoundation, the Swedish Royal Academy of Science, and by the European Unionproject Pneumococcal Resistance Epidemicity and Virulence—An InternationalStudy funded by Directorate General research with the Sixth Framework Program.S.M. was supported by grants from the Academy of Finland, the Sigrid JuseliusFoundation, and the Helsinki University Hospital Funds (EVO).2 Address correspondence and reprint requests to Dr. Barbara Albiger, Department ofLaboratory Medicine, Medical Microbiology, Malmo University Hospital, Lund Uni-versity, Malmo, SE-205 02 Sweden. E-mail address: [email protected]

3 Abbreviations used in this paper: MAC, membrane attack complex; C4BP, C4b-binding protein; CCP, complement control protein; SCR, short consensus repeat;NHS, normal human serum; IPD, invasive pneumococcal disease; PspC, pneu-mococcal surface protein C; MLST, multilocus sequence typing; ST, sequencetype; wt, wild type; CSP, competence stimulatory peptide; FH, factor H; FI, factorI; RT, room temperature; GVB, gelatin-veronal buffer; pC4BP, plasma-purifiedC4BP; sIgA, secretory IgA; PAF-R, platelet-activating factor receptor; pIgR,polymeric IgG receptor.

Copyright © 2009 by The American Association of Immunologists, Inc. 0022-1767/09/$2.00

The Journal of Immunology

www.jimmunol.org/cgi/doi/10.4049/jimmunol.0802376


ww

.jimm

unol.org/D

ownloaded from


many pathogens (Escerichia coli K1, Bordetella pertussis, Neiss-seria meningitidis, Neissseria gonorrhoeae, Moraxella catarrha-lis, Haemophilus influenzae, Streptococcus pyogenes, Borrelia re-currentis, and Borrelia duttonii) have been shown to avoiddeleterious effects of complement activation by binding C4BP(5–11).

A recent report from the World Health Organization and theUnited Nations Children’s Fund showed that pneumonia kills morechildren �5 years of age than any other infectious diseases world-wide (AIDS, malaria, tuberculosis, measles). Thus, �2 millionchildren die annually, mainly in developing countries from pneu-monia (12). The major causative agent is the bacterium Strepto-coccus pneumoniae (also called pneumococcus). Pneumococci areencapsulated Gram-positive bacteria with 91 different capsulesor serotypes identified so far. Pneumococci cause invasivepneumococcal diseases (IPD) such as sepsis and meningitis,which kill and leave severe sequelae in children worldwide.Additionally, pneumococci are among the most common bac-terial causes of middle ear infections (otitis media). The naso-pharynx of small children constitutes the normal habitat forpneumococci and asymptomatic carriage may be found in up to70% of healthy children �2 years of age. Carriage is thought tofacilitate horizontal gene transfer between strains and also rep-resents a prerequisite for the spread of this pathogen in thecommunity. A period of nasopharyngeal colonization usuallyoccurs before and during the development of IPD (13).

Pneumococci express many virulence factors helping the bac-teria both to inhibit complement deposition and to resist op-sonophagocytosis. Important virulence factors are, for example,the polysaccharide capsule, the cytotoxin pneumolysin, and thepneumococcal surface protein, PspC. The capsule may reducethe amount of bound C3b and restrict the access of professionalphagocytes for cell-bound C3b, which hampers opsonophago-cytosis (14). Pneumolysin contributes to complement resistanceby quenching complement away from the pneumococcal surface(15). The PspC protein family can inhibit C3b deposition, butalso bind the host complement inhibitor factor H, leading toinhibition of the alternative pathway activation (16 –18). Re-cently, the pneumococcal histidine triad (Pht) was shown to berequired for inhibition of complement deposition on the pneu-mococcal surface through the recruitment of complement factorH (19). Therefore, complement resistance is a major contributorto pneumococcal virulence and pathogenesis.

In this study, we investigated whether clinical isolates of S.pneumoniae bind the complement inhibitor C4BP as mechanism ofimmune evasion. We also investigated the relative contribution ofthe polysaccharide capsule, pneumolysin, and PspC in C4BP-me-diated immune evasion. We show that pneumococcal isolates bindC4BP to various degrees and that this interaction is dependent ona new allelic variant (PspC4.4) of PspC but not on capsular sero-type or pneumolysin expression. Thus, we demonstrate that thepneumococcus exploits host C4BP for complement evasion in aPspC allele-dependent manner.

Materials and MethodsBacterial strains and culture conditions

All pneumococcal strains, except TIGR4 and D39, used in this study areclinical pneumococcal isolates obtained from the Swedish Institute for In-fectious Disease Control, Stockholm (Table I) (20, 21). The clinical iso-lates were selected to represent common serotypes and different clones asassessed by serotyping and multilocus sequence typing (MLST) (22).TIGR4 is a clinical encapsulated isolate of serotype 4 sequenced by theInstitute for Genomic Research (TIGR) (American Type Culture Collec-tion BAA-334; www.jcvi.org). The isogenic variants of TIGR4 expressingdifferent capsular types, that is, serotypes 6B (TIGR4:64), 7F (TIGR4:74),

14 (TIGR4:144), or 19F (TIGR4:194), and their parental capsule donors619, 703, 1401, and 1902, respectively, were a gift from Prof. M. Lipsitchfrom Harvard School for Public Health (Boston, MA) (23). BBH18 andNTHi506 are clinical isolates of M. catarrhalis and non-typeable H. influ-enzae (8, 10).

For in vitro experiments, bacteria were grown overnight from frozenstocks on blood agar or chocolate agar plates at 37°C and 5% CO2. Col-onies were taken directly from plates in PBS to OD600 nm of 0.5 (1 � 108

bacteria/ml). Appropriate dilutions were made to obtain the desired con-centration. The concentration was retrospectively confirmed by viablecounting on blood agar plates.

Multilocus sequence typing

MLST was performed as previously described (22). In brief, internal frag-ments of the seven housekeeping genes (aroE, gdh, gki, recP, spi, xpt, andddl) were amplified by PCR from bacterial genomic DNA and sequenced.Sequences were compared with existent sequences in the MLST database(http://spneumoniae.mlst.net). After sequence alignment analyses, a se-quence type (ST) was attributed.

Construction of S. pneumoniae pneumolysin-negative,capsule-negative, and PspC-negative strains using PCR ligationmutagenesis

Flanking regions upstream and downstream of the target gene (SP1923,ply; capsule operon, cps; or SP2190, pspC) were amplified from TIGR4chromosomal DNA using specific primers (Table II). Each fragment was�1 kb and contained restriction sites for either ApaI (5� end of upstreamfragment, underlined in the primer sequence) or BamHI (3� end of down-stream fragment, underlined in the primer sequence). The PCR productswere digested with corresponding restriction enzymes, purified, and ligatedwith either the Km-rpsL cassette, Janus (24), or the erythromycin cassettefrom the shuttle vector pMU1328 (25) amplified using specific primers,creating a PCR product with ApaI and BamHI termini (Table II). Theligation was performed using equal molar amounts of upstream fragment,downstream fragment, and either erythromycin or Janus fragment. Theligation product was then used to transform the TIGR4 wild-type (wt)strain or into the recipient pneumococcal strain. The recipient pneumococ-cal strains were grown in 5 ml of C�Y medium to an OD620 nm of 0.2, and2.5 �l of competence stimulatory peptide (CSP)1 (EMRLSKFFRDFILQRKK) and/or CSP2 (EMRISRIILDFLFLRKK) was added to 200 �lof the log-phase culture (CSP1 and CSP2 were a gift from Prof. D. Mor-rison, University of Illinois, Chicago, IL). Ten microliters of the ligationmix was added to the competent cells and the mixture was incubatedsuccessively on ice for 10 min, at 31°C for 30 min, and finally at 37°Cfor 2 h. The transformation mixture was then plated on blood agar platescontaining kanamycin (400 �g/ml) and/or erythromycin (1 �g/ml) andincubated overnight at 37°C, 5% CO2. Several independent transfor-mants were selected. They were verified by PCR and by sequencingwith control primers. Pneumolysin-negative strains were checked forthe production of pneumolysin by Western blot using a polyclonal anti-pneumolysin antiserum (provided by Prof. T. J. Mitchell, University ofGlasgow, Glasgow, U.K.). PspC-negative strains were also checked forthe production of PspC by Western blot using rabbit polyclonal anti-PspC antiserum (gift from Prof. E. Tuomanen, St. Jude Children Re-search Hospital, Memphis, TN).

Sequencing of pspC allelic variant, pspC4.4, and nucleotidesequence accession number

Using primers located in the upstream and downstream flanking regions ofthe pspC gene (SP2189/SP2191), the pspC gene of BHN79 strain wasamplified by PCR. The PCR fragment was subsequently sequenced by aprimer walking strategy using BigDye Terminator v3.1 cycle sequencingkit (Applied Biosystems) according to the manufacturer’s instructions.New primers were designed from the obtained sequences until full se-quence was completed. The nucleotide sequence of the pspC gene ofBHN79 strain is assigned GenBank accession no. EU881702 (www.ncbi.nlm.nih.gov/nuccore/195963558).

Cloning and expression of pspC allelic variant, pspC3.4, as aHis6-tagged fusion protein

The full-length pspC3.4 gene (excluding the leader peptide and the stopcodon) was amplified with high-fidelity pfu DNA polymerase (Fermentas/Life Sciences) from TIGR4 chromosomal DNA using primers BamStart-PspC and SalStopPspC (Table II). The resulting PCR product with BamHIand SalI termini was cloned into pET21b vector and expressed into E. coli

7866 C4BP BINDING TO PNEUMOCOCCI


ww

.jimm

unol.org/D

ownloaded from


BL21 (DE3)pLysS (Novagen). Recombinant PspC3.4 was expressed asHis6-tagged fusion protein and was purified by HisPur Cobalt Resin puri-fication kit according to the manufacturer’s instructions (Pierce/Thermo

Fisher Scientific). The purified protein was run on SDS-PAGE for correctsize and also checked by Western blot using rabbit polyclonal anti-PspCantiserum.

Table I. Strains used in this study and carriage of group 4 pspC allele among clinical isolatesa

Strains Serotype ST C4BP Binding (%)Group 4 pspC

Alleleb PCR (kb)c Reference

S. pneumoniaeBHN30 1 306 6.53 (�1.52) � 1.4 (20, 70)BHN31 1 306 4.54 (�1.77) � 1.4 (20, 70)BHN32 1 228 6.72 (�5.00) � 1.4 (20, 70)BHN412 1 ND 6.87 (�3.74) � 1.4 (20, 70)D39 2 128 2.50 (�0.3) � (20, 70)BHN34 2 227 6.60 (�2.15) � (20, 70)BHN35 3 180 0.90 (�0.53) � (19, 70)BHN413 3 ND 1.54 (�0.08) � (19, 70)BHN414 3 ND 0.38 (�0.19) � (19, 70)TIGR4 4 205 4.89 (�0.6) � (19, 70)T4pspC 4 205 6.70 (�2.75) � (71)T4ply 4 205 2.27 (�0.86) � This studyBHN42 4 1222 13.03 (�1.42) � 2 (19, 70)BHN44 4 1222 15.60 (�2.34) � 2 (19, 70)BHN49 6B 138 11.40 (�2.30) � 2 (19, 70)BHN50 6B 176 11.45 (�0.28) � 2 (19, 70)BHN51 6B 176 8.15 (�1.33) � 2 (19, 70)TIGR4:64 6B ND 3.92 (�0.74) ND ND (23)619 6B ND 8,46 (�5.36) ND ND (23)BHN54 7F 191 15.75 (�7.79) � 2 (20, 70)BHN56 7F 191 12.22 (�1.30) � 2 (20, 70)TIGR4:74 7F ND 4.35 (�1.15) ND ND (23)703 7F ND 6.14 (�2.58) ND ND (23)BNH60 9V 838 9.97 (�7.86) � (20, 70)BHN62 9V 162 4.64 (�3.09) � (20, 70)BHN96 19F 162 7.71 (�9.73) � (20, 70)BHN97 19F 425 1.87 (�0.60) � (20, 70)BHN98 19F 156 9.33 (�2.52) � (71)BHN100 19F 162 1.51 (�0.47) � This studyTIGR4:194 19F ND 3.04 (�0.69) ND ND (22)1902 19F ND 6.40 (�2.71) ND ND (22)

Serotype 14 ST9BHN182 14 13 7.68 (�3.99) � 1.1 This studyBHN397 14 2654 12.74 (�8.54) � 2.5 This studyBHN400 14 9 18.44 (�10.55) � 2.6 This studyBHN401 14 9 13.40 (�4.03) � 2.6 This studyBHN402 14 13 16.18 (�9.47) � 2.2 This studyBHN408 14 13 18.84 (�6.92) � 2.6 This study

ST124BHN78 14 124 25.84 (�7.23) � 2.6 (20, 70)BHN78cps 307 31.77 (�11.38) � 2.6 This studyBHN79 14 307 27.38 (�9.35) � 2.6 (20, 70)BHN79cps 307 61.05 (�10.70) � 2.6 This studyBHN79pspC 14 307 � This studyBHN79 ply 14 307 31.36 (�12.09) � 2.6 This studyBHN84 14 124 18.79 (�4.59) � 2.6 (20, 70)BHN84pspC 14 124 3.17 (�1.92) � This studyBHN318 14 124 54.27 (�5.91) � 2.6 This studyBHN342 14 124 49.07 (�12.90) � 2.2 This studyBHN359 14 124 44.50 (�1.57) � 2.6 This studyBHN392 14 124 50.72 (�10.31) � 2.6 This studyBHN393 14 124 49.68 (�14.53) � 2.3 This studyBHN394 14 124 37.85 (�8.41) � 2.5 This studyBHN395 14 124 48.35 (�5.55) � 2.5 This studyBHN398 14 124 31.36 (�12.724) � 2.3 This study

Other STBHN83 14 555 25.29 (�8.64) � 1.7 (20, 70)BHN180 14 143 17.69 (�5.51) � This studyBHN181 14 156 10.27 (�2.19) � This studyBHN183 14 143 8.55 (�4.42) � This studyBHN396 14 63 48.67 (�2.84) � 1.7 This studyBHN399 14 782 38.07 (�15.55) � 1.7 This studyBHN403 14 156 22.24 (�3.29) � This studyBHN404 14 67 15.43 (�7.39) � 1.7 This studyBHN405 14 230 20.98 (�7.37) � This studyBHN406 14 708 59.15 (�3.35) � This studyBHN407 14 230 56.58 (�7.26) � This studyTIGR4:144 14 ND 4.15 (�1.39) ND ND This study1401 14 ND 7.61 (�0.59) � This study

NT Haemophilus influenzaeNTHi506 61.08 (�1.50) (8)

Moraxella catarrhalisBBH18 69.96 (�5.00) (10)

a ST124 and ST306 belong to the same clonal lineage and ST9, ST13, and ST2654 belong also to the same clonal lineage.b Presence (�) or absence (�) of group 4 pspC allele.c Size of fragment after PCR amplification using LU9/LU10 primers.

7867The Journal of Immunology


ww

.jimm

unol.org/D

ownloaded from


Proteins and Abs

Human C4BP was purified from human plasma (26). rC4BP was expressedin human kidney cells 293 and purified using affinity chromatography witha mAb directed against the �-chain of C4BP (27). The recombinant C4BPmutants lacking individual CCPs (CCP1–8) were constructed and ex-pressed as previously described (28). C3b-like (C3met) and C4b-like(C4met) molecules were prepared by incubation of C3 and C4 with 100mM methylamine (pH 7.6) for 1 h at 37°C and subsequent dialysis against100 mM Tris-HCl and 150 mM NaCl (pH7.5). Both C3met and C4met arefunctionally equivalent to C3b and C4b and will be referred to as such.Purified factor H (FH), factor I (FI), the secondary peroxidase-conjugatedanti-mouse IgG Ab, and the polyclonal goat anti-C3 IgG were purchasedfrom Sigma-Aldrich. The polyclonal rabbit anti-C4c IgG, the secondaryperoxidase-conjugated swine anti-rabbit IgG Ab, and the peroxidase-con-jugated anti-goat IgG Ab were purchased from Dako. The polyclonal rabbitanti-human C4BP and the murine monoclonal against CCP1 and CCP4 ofC4BP (mAb104 and mAb67, respectively) were a gift of Prof. B. Dahlback(Lund University, Malmo, Sweden).

Direct binding assay with 125I-C4BP and with 125I-FH

Fifty micrograms of C4BP from plasma and purified FH were labeled with0.05 mol of iodine per mol of protein using chloramine-T method. Bacteriawere grown overnight on blood agar plates and were washed once andresuspended to OD600 nm of 0.5 in PBS with 1% BSA. Bacteria (1010) wereincubated for 1 h at 37°C with 1.5 �g/ml 125I-labeled C4BP in PBS with1% BSA. In the inhibition assays, unlabelled C4BP (0–1500 nM), pro-thrombin (0–1000 nM), recombinant PspC3.4 (0–1500 nM), heparin(0–10 mg/ml), NaCl (0–500 mM), and C4met (0–100 nM) were added tothe reaction with 125I-labeled C4BP and incubated for 1 h at 37°C. Then,bacterial-bound 125I-C4BP was separated from unbound 125I-C4BP by cen-trifugation through 20% sucrose columns for 3 min at 10,000 rpm. Bothbound and unbound 125I-C4BP to bacteria was measured in a gammacounter.

Serum absorption of C4BP

NHS pool was prepared from the blood of five healthy volunteers. Theblood was allowed to clot for 30 min at room temperature (RT), followedwith 1 h of incubation on ice. After centrifugation the sera were pooled,aliquoted, and stored at �70°C. Bacteria were grown overnight on bloodagar plates and were washed once and resuspended in gelatin veronal buffer(GVB; 142 mM NaCl, 1.8 mM sodium barbital, 3.3 mM barbituric acid,0.1% fish gelatin (pH 7.4)). Bacteria (108) were incubated for 30 min at37°C with 30% NHS or GVB. The unbound proteins were removed withfive washes with PBS. The bacterial pellet was resuspended in 30 �l of 0.1M glycine (pH 2.5) and was incubated 20 min at 37°C to elute the bound

proteins. The bacteria were centrifuged and the supernatant was recoveredand neutralized with 30 �l of 1 M Tris-HCl (pH 9.5). Ten microliters of thesupernatants were run on a gradient 4–12% NuPAGE Tris gel (Invitrogen)under nonreducing conditions. The proteins were transferred to a polyvi-nylidene difluoride membrane and submitted to Western blotting using amouse monoclonal anti-C4BP Ab (mAb 104) directed against CCP1 fromC4BP and a secondary peroxidase-conjugated anti-mouse IgG Ab.

Flow cytometry

Bacteria were grown overnight on blood agar plates and washed once andresuspended to OD600 nm of 0.5 in PBS with 1% BSA. Bacteria (108, 107,and 106) were incubated for 1 h at 37°C with 80 �g/ml plasma C4BP, 50�g/ml rC4BP, 50 �g/ml rC4BP (CCP1–8), 50% NHS (containing�100–150 �g/ml C4BP), or PBS with 1% BSA. After three washes, thesamples were incubated for 1 h either with a polyclonal rabbit anti-C4BPserum or with anti-C4c Ab. After an additional three washes with PBS,incubation with FITC-conjugated swine anti-rabbit Ab was performed. Thesamples were processed by flow cytometry using the FACSCalibur.

ELISA for C4BP binding to S. pneumoniae

To validate C4BP binding to S. pneumoniae, a saturation assay was per-formed by whole-cell ELISA. Ninety-six-well plates were coated eitherwith bacterial suspension (107) and air dried at room temperature or withpurified recombinant PspC3.4 (5 �g/well) and incubated overnight at 4°C.The plates were subsequently blocked with 200 �l of PBS-3% fish gelatin(Sigma-Aldrich) for 2 h at RT before 50 �l of different concentrations ofpurified C4BP were added to each well for 1 h at RT. Then the plates wereincubated 1 h at RT with 50 �l of mouse anti-C4BP (mAB67) diluted1/5000, washed three times, and incubated with 50 �l of secondary per-oxidase-conjugated anti-mouse IgG Ab diluted 1/5000 for 1 h at RT. Fi-nally, the plates were developed using tetramethylbenzidine substrate re-agent set (BD Biosciences) for 30 min before determining the OD450 usinga microtiter plate reader.

Functional assay for cofactor activity of cell-bound C4BP

The cofactor activity of C4BP bound to pneumococci was analyzed bymeasuring FI-mediated degradation of C3met (C3b) and C4met (C4b).Bacteria were grown overnight on blood agar plates and washed once andresuspended to OD600 nm of 0.5 in PBS. Pneumococci (5 � 107) wereincubated with plasma-purified C4BP (80 �g/ml) for 1 h at 37°C withgentle agitation. After extensive washing with PBS, C3met/C4met (20 �g/ml) and FI (50 �g/ml) were added to the bacteria and the mixture wasincubated for 1 h at 37°C with gentle agitation. The cells were sedimentedby centrifugation at 14,000 � g for 10 min and the supernatants weremixed with sample buffer (Invitrogen). The samples were then subjected to

Table II. Primers used for construction of capsule, pneumolysin, and pspC mutants and for screening of pspC locusa

Primers Sequence Description Reference

Ply-up5 TCA ATC CAG CTA CCT GTC GCC C 5� primer upstream ply gene This studyPly-up3 TTT GGG CCC CTT CTA CCT CCT AAT AAG TTC C 3� primer upstream ply gene This studyPly-down5 TTG GAT CCG AGA GGA GAA TGC TTG CGA C 5� primer downstream ply gene This studyPly-down3 AGC TGC TAC ATA GAT TTC TAC ACC 3� primer downstream ply gene This studyDexBF ACC ATG ACC TCC CTC GTA TTG T 5� primer upstream capsule operon This studyDexBR-BamHI TTT GGA TCC TTA TAG TAA TTC CAC ACA GAA AGC A 3� primer upstream capsule operon This studyAliAF-ApaI TTT TGG GCC CAT GAA AAG TTC AAA ACT ACT TGC CC 5� primer downstream capsule operon This studyAliAR AGA GAG CCT TTT TAG TCG ATG C 3� primer downstream capsule operon This studySP2189 ATG ATTGGC AAT ATT GAG ATT CCC AA; 5� primer upstream pspC gene This studySP2189-BamHI TTG GAT CCT GCTCCACGGAGTTTGGCAGC 3� primer upstream pspC gene This studySP2189-ApaI TTT GGG CCC ACC TTA CTA TAT CAC TTC AAT ATG AA 5� primer downstream pspC gene This studySP2191 ATG GTA TTA GCG ATT ATT TTA GTA ACA TTC 3� primer downstream pspC gene This studyErmApa TTT TTG GGC CCT TCG TGT TCG TGC TGA CTT GC 5� primer erythromycin cassette pMU1328 (24)ErmBam TTT TTG GAT CCG ATG TTG CTG ATT AAG ACG AGC 3� primer erythromycin cassette pMU1328 (24)DAM406 TCT ATG CCT ATT CCA AGA GGA AAT GGA AT 5� primer janus cassette (23)DAM351 CTA GGG CCC CTT TCC TTA TGC TTT TGG AC 3� primer janus cassette (23)BamStartPspC TTT TGG ATC CGA CAG AGA ACG AGG GAG CTA CCC AAG

TAC CCA CTT CTT C5� primer pspC3.4 gene This study

SalStopPspC TTT TGT CGA CGT TTA CCC ATT CAC CAT TGG CAT TGACTC CAT AGC CAT CT

3� primer pspC3.4 gene This study

LU9 GAA GAG GTT AGA AGA GGG AAT AAC CTC ACG GT 5�-specific primer for PspC type 4 This studyLU10 GTT TAC CCA TTT ACC ATT GGC ATT GAC TCT A 3�-specific primer for PspC type 4 This study

a Primers LU9 and LU10 have been designed to specifically amplify group 4 pspC locus. Both primers sequences have been matched against all known pspC groups insequence databases. LU9 hybridizes right after the leader peptide sequence while LU10 hybridizes at the 3� end including the stop codon.



ww

.jimm

unol.org/D

ownloaded from


SDS-PAGE under reducing conditions and transferred to a polyvinylidenedifluoride membrane (Invitrogen). C3met degradation products were eval-uated by detection of the �-chain cleavage fragments of 76 kDa and 43 kDaby using polyclonal goat anti-C3 IgG (Sigma-Aldrich) at a final dilution of1/1000 and a secondary peroxidase-conjugated anti-goat IgG Ab. C4metdegradation was evaluated by detection of the degradation of the �-chainusing a polyclonal rabbit anti-C4c IgG at a final dilution of 1/500 and asecondary peroxidase-conjugated anti-rabbit IgG Ab. The polyclonal rabbitanti-C4c IgG recognizes C4, C4b, and C4c but not C4d.

ResultsPneumococci bind the complement inhibitor C4BP

To investigate whether S. pneumoniae binds human C4BP, weincubated 26 clinical isolates of S. pneumoniae of different sero-types with radiolabeled plasma-purified C4BP. The two laboratorystrains D39 and TIGR4 were included as well as M. catarrhalis(BBH18) and nontypeable H. influenzae (NTHi506), which wereused as positive controls because they were previously shown tobind C4BP (8, 10). We observed that pneumococci bound C4BPwith binding percentages ranging from 0.4% to 27.4%. The strainscould be divided in three groups: 1) strong binders with bindingrates ranging from 25.3% to 27.4%, 2) medium or intermediatebinders with rates between 11.2% and 18.7%, and 3) weak ornonbinders with rates between 0.4% and 9.9% (Fig. 1A). None ofthe pneumococcal strains tested bound C4BP as efficiently asNTHi506 or BBH18 (61.1 � 1.5% and 69.9 � 5%, respectively).Interestingly, both D39 and TIGR4 were weak binders (2.5 �0.3% and 4.9 � 0.6%, respectively) (Fig. 1A, indicated with stars).Several strains of serotype 4, 6B, and 7F exhibited intermediatebinding to C4BP. We also observed that all isolates (n 4) ofserotype 14 tested were either strong (n 3) or intermediate bind-ers (n 1).

To study whether C4BP binding is capsule-dependent orwhether the serotypes 4, 6B, 7F, and 14 capsule have biochemical

FIGURE 1. Binding of pC4BP to clinical isolates of S. pneumoniae. A, Atotal of 28 pneumococcal strains of different serotypes (1, 2, 3, 4, 6B, 7F, 9V,14, 19F) including TIGR4 (serotype 4) and D39 (serotype 2), a strain of M.catarrhalis BBH18, and a strain of nontypeable H. influenzae (NTHi506) wereincubated with 1.5 �g/ml purified plasma 125I-C4BP. The binding was definedas a ratio between bound radioactivity and total amount of added radioactivity.Binding varies between 0.4% and 27.4% for pneumococcal strains. The meanvalues of at least three independent experiments are shown, and each circlerepresents an individual strain. The binding for TIGR4 and D39 is highlightedwith star symbols. Binding was considered weak below 10%, medium or in-termediate between 10% and 20%, and strong above 20%. B, C4BP binding toencapsulated and unencapsulated strains. C4BP binding to four isogenic cap-sular variants of TIGR4 harboring either serotypes 6B (TIGR4:64), 7F(TIGR4:74), 14 (TIGR4:144), or 19F (TIGR4:194) capsules to their parentalcapsule donor strains (619, 703, 1401, 1902) and to capsule-deficient mutants(BHN78cps and BHN79cps) was compared with C4BP binding to wtTIGR4, BHN78, and BHN79, respectively. Binding for isogenic capsular vari-ants of TIGR4 ranges between 3% and 11.1%, while the binding for unen-capsulated strains and their isogenic parents varies between 27.5% and 66.9%.The mean values of at least three independent experiments are shown. Bindingbelow 10% was considered weak. C4BP binding rates were analyzed by anonparametric Mann-Whitney test. ��, p � 0.01. C, C4BP binding to serotype14 strains belonging to different clonal lineages. Binding varies between 7.7%and 59.1%. The mean values of at least three independent experiments areshown. Binding was considered weak below 10%, medium or intermediatebetween 10% and 20%, and strong above 20%.

FIGURE 2. C4BP binding to TIGR4 and BHN79 strains. A, Represen-tative flow cytometry histograms of C4BP binding to TIGR4 and BHN79strains. Bacteria (107) were incubated with either 80 �g/ml pC4BP (darkgray line), 50% NHS (light gray line), or PBS (black line). The binding wasdetected using a polyclonal rabbit anti-C4BP serum and FITC-conjugatedswine anti-rabbit Ab. B, Pneumococcal strain BHN79 but not TIGR4 re-cruits C4BP from NHS. Bacteria (108) were incubated with either 30%NHS or GVB buffer. Bound proteins were eluted from bacterial surfaces,run onto SDS-PAGE, and submitted to Western blot using a monoclonalanti-C4BP Ab (mAb104) and a secondary peroxidase-conjugated anti-mouse IgG Ab. Lane 1, 1% NHS; lane 2, BHN79 in absence of NHS; lane3, BHN79 in presence of NHS; lane 4, TIGR4 in absence of NHS; and lane5, TIGR4 in presence of NHS.



ww

.jimm

unol.org/D

ownloaded from


or structural properties that allow C4BP binding as compared withother capsular serotypes, we analyzed the C4BP binding capacityof isogenic variants of TIGR4 expressing different capsular types(gift from Dr. M. Lipsitch, Harvard School for Public Health, Bos-ton, MA), that is, serotypes 6B (TIGR4:64), 7F (TIGR4:74), 14(TIGR4:144), or 19F (TIGR4:194), respectively, as well as of iso-genic capsule deletion mutants (cps) of two selected serotype 14strains, BHN78 and BHN79. When we compared the C4BP bind-ing capacity between TIGR4 and its isogenic capsular strains, weobserved that all the isogenic capsular variants exhibited the sameweak C4BP binding as compared with wt TIGR4 (Fig. 1B). All

parental capsule donor strains, including the serotype 14 parentalisolate, also showed weak C4BP binding. Furthermore, we ob-served that the loss of capsule significantly increased C4BP bind-ing, demonstrating that the polysaccharide capsule hinders ratherthan promotes the binding (Fig. 1B). Thus, we conclude that it isunlikely that C4BP binds to a specific sugar moiety of the poly-saccharide capsule.

To study the genetic relatedness between clinical isolates (orclonality), sequence-based methods such as multilocus sequencetyping are used. Using MLST, we found that of the four serotype14 strains tested (Fig. 1A), three isolates (BHN78, BHN79, and

FIGURE 3. Characterization ofthe interaction between pC4BP andBHN79. A, Binding of C4BP toBHN79 is saturable and dose-depen-dent. Bacteria (106) or 5 �g of puri-fied recombinant PspC3.4 (rec-PspC3.4) was immobilized inmicrotiter plates and consequently in-cubated with rC4BP. Bound C4BPwas detected by ELISA with mAbs(mAb67). The mean values of tripli-cates from one representative experi-ment are shown. B–D, Inhibition of125I -C4BP binding with increasingamount of competitors. BHN79 strain(108) was coincubated with 1.5 �g/ml125I plasma C4BP and increasing con-centrations of cold recombinantC4BP (0.1–1500 nM), prothrombin(0.1–1000 nM), heparin (0–10 mg/ml), C4met (0–100 nM). Prothrom-bin was used as negative control. Thebinding was determined as a ratio be-tween bound radioactivity and totalamount of added radioactivity. Themean values of at least three indepen-dent experiments are shown. E, Effectof salt on the binding of C4BP toBHN79 strain. Increasing amounts ofNaCl (0–500 mM) were added tophosphate buffer containing 150 mMNaCl. The binding was determined asa ratio between bound radioactivityand total amount of added radioactiv-ity. The mean values of at least threeindependent experiments are shown.F, Localization of the pneumococcal-binding site on C4BP using rC4BPdeletion mutants. Bacteria (107) wereincubated either with 50 �g/ml wtrC4BP or with recombinant mutantC4BP lacking individual CCP do-mains (CCP1–8). The binding wasdetected with flow cytometry using apolyclonal rabbit anti-C4BP serumand FITC-conjugated swine anti-rabbit Ab. The mean fluorescence in-tensity (MFI) of at least three inde-pendent experiments is shown. C4BPbinding rates were analyzed byANNOVA test. �, p � 0.05.



ww

.jimm

unol.org/D

ownloaded from


BHN84) belonged to the same clone or ST (i.e., ST124), whileBHN83 belonged to an unrelated clone ST555. To investigatewhether C4BP binding correlates with clonal properties, we se-lected 24 additional clinical isolates of serotype 14 belonging todifferent clonal clusters. We chose six and eight isolates from thetwo major invasive clones, ST9 and ST124, respectively, as well as10 strains from unrelated minor clones. We tested these strains forC4BP binding and observed that all isolates but three exhibitedstrong or intermediate binding capacities with rates between 7.7%and 59.2% (Fig. 1C and Table I). This confirmed our previousobservation (Fig. 1A) that most serotype 14 strains are able to bindC4BP to various degrees as compared with strains from other se-rotypes. Furthermore, we also observed that the strength to whichthe isolates bind C4BP seemed to correlate with clonal properties,as all isolates belonging to the clone ST124 were strong binders(Fig. 1C). Taken together, our data show that the strength to bindC4BP is dependent on one or more genetic properties present inspecific clonal types of pneumococci.

Next, we selected two strains BHN79 and TIGR4, a strong anda weak binder, respectively, and confirmed C4BP binding by flowcytometry using a polyclonal anti-C4BP antiserum (Fig. 2A). Bothstrains were incubated with 80 �g/ml plasma-purified C4BP(pC4BP) or with PBS (Fig. 2A). pC4BP was deposited in highamounts on the surface of BHN79 and significantly less C4BP wasbound to TIGR4 (Fig. 2A). C4BP deposition on BHN79 dependedon the quantity of bacteria used with the maximum binding oc-curring at a dose of 106-107 bacteria (data not shown). We alsoinvestigated whether BHN79 is able to recognize and bind C4BPin whole human serum. We performed absorption assays by incu-bating the bacteria with 30–50% NHS and assessed C4BP bindingby either flow cytometry (Fig. 2A) or Western blotting (Fig. 2B).Since pneumococci have a thick and rigid cell wall, they are re-sistant to lysis by MAC. Both TIGR4 and BHN79 survived in 50%NHS for over 1 h as determined by colony forming units (data notshown). Moreover, our data show that C4BP was absorbed fromwhole human serum by strain BHN79 in contrast to TIGR4 (Fig.2). Taken together, our data show that pneumococci are able tobind C4BP also from serum but binding efficiency varies betweendifferent strains. Interestingly, we also observed that serum C4BPbinding to BHN79 was weaker as compared with pC4BP (Fig. 2A),suggesting that the efficiency of C4BP binding to bacteria might beinfluenced by the presence of other serum proteins such as FH.

Binding of C4BP to pneumococci is specific and dose-dependent

We tested the specificity of the C4BP binding to BHN79 strain byincubating BHN79 with increasing amounts of rC4BP in a whole-cell ELISA (Fig. 3A). BHN79 bound C4BP in a dose-dependentmanner, reaching saturation at 100–200 �g/ml (Fig. 3A). This con-centration correlated with the physiologic concentration range ofC4BP in NHS, which is 200–300 �g/ml. In contrast, TIGR4bound significantly less C4BP (Fig. 3A).

To confirm specificity of C4BP binding, BHN79 strain was in-cubated with increasing amounts of unlabeled rC4BP or humanprothrombin in addition to 125I-C4BP in a competition assay (Fig.3B). rC4BP inhibited the binding of 125I-C4BP, whereas prothrom-bin did not affect the binding (Fig. 3B). Our data demonstrate thatthe interaction between pneumococci and C4BP is specific anddose-dependent.

Inhibition of C4BP binding to pneumococci by C4b, heparin,and salt

To further characterize the structural properties of the interactionbetween plasma C4BP and BHN79, we performed competitionexperiments using heparin and C4met (Fig. 3, C and D) (1). Both

heparin and C4met are ligands of C4BP and bind to the CCP1-CCP3 domains of the C4BP �-chain. Increasing concentrations ofeither heparin or C4met inhibited C4BP binding to BHN79 (Fig. 3,C and D).

Using increasing amounts of NaCl, we demonstrated that theinteraction between C4BP and BHN79 was salt sensitive as anaddition of 50 mM NaCl to physiological ionic strength bufferresulted in a 58% reduction in C4BP binding (Fig. 3E). Thus, wehave shown that BHN79 in addition to binding to plasma purifiedC4BP (Figs. 1 and 2) also bound rC4BP, which is exclusivelycomposed of the �-chain (Fig. 3F) (27). Using eight mutant rC4BPproteins, each lacking individual CCP domains, we highlighted theimportance of CCP2-CCP3 region for the interaction (Fig. 3F). Itseems also that to some extent CCP8 might play a role in theinteraction. These data suggest that the interaction between pneu-mococci and C4BP is ionic and probably mediated by the CCP2-CCP3 region of the C4BP �-chain.

Bacteria-bound C4BP retains its functional activity

C4BP acts as a cofactor for the serine protease FI to inactivateboth fluid phase and cell-bound C4b, and thereby it inhibits theclassical complement pathway. C4met is composed of threechains, �-, �-, and �-chains of 97, 75, and 33 kDa, respectively(Fig. 4, lane 8). In the presence of both soluble purified FI andC4BP, the �-chain of C4met becomes entirely degraded (Fig. 4,lane 1).

To investigate whether bacteria-bound C4BP could retain itsfunctional activities, we performed C4met degradation assays (Fig.4). TIGR4 and BHN79 were first incubated with C4BP, and afterremoval of unbound C4BP, bacteria were incubated with FI andC4met. In negative controls, either FI or C4BP were omitted (datanot shown). C4BP retained its cofactor activity when bound toBHN79, as demonstrated by the almost total degradation of C4met�-chain (Fig. 4, lane 4). In contrast, insufficient amounts of C4BPbound to TIGR4 did not allow C4met cleavage (Fig. 4, lane 2).The degradation of C4met was not a result of a proteolytic orcofactor activity from the bacteria themselves, as shown by a con-trol experiment, where bacteria without bound C4BP were incu-bated with C4met alone (Fig. 4, lanes 6 and 7) or with C4met andFI (data not shown).

FIGURE 4. Analysis of bacterial-bound C4BP cofactor activity byC4met degradation. Bacteria (108) were coincubated with C4met andC4BP in presence of FI. Degradation of the �-chain of C4met was analyzedby Western blot using a polyclonal rabbit anti-C4c IgG and a secondaryperoxidase-conjugated anti-rabbit IgG Ab. As positive control, C4met wascoincubated with FI, and C4BP (lane 1), TIGR4 (lane 2), TIGR4pspC(lane 3), BHN79 (lane 4), and BHN79pspC (lane 5) were coincubatedwith FI, C4BP, and C4met; TIGR4 (lane 6) and BHN79 (lane 7) werecoincubated with C4met in absence of C4BP and FI; the three chains ofC4met are visualized in lane 8.



ww

.jimm

unol.org/D

ownloaded from


C4BP also acts to some extent as a cofactor for FI in degradationof soluble and surface-bound C3b. C3b is composed of two chains,��- and �-chains of 110 and 75 kDa, respectively, and when de-graded by FI in association with C4BP, the ��-chain is cleaved intotwo fragments. C4BP bound to BHN79 retained its cofactor ac-tivity as demonstrated by the appearance of the degradation frag-ments of the C3met ��-chain of appropriate sizes (data not shown).

A new allelic variant of PspC is a ligand for C4BP

PspC is a pneumococcal surface-exposed protein that binds severalhost proteins (i.e., secretory IgA (sIgA), plateletactivating factor

receptor (PAF-R), and polymeric IgG receptor (pIgR)) and morespecifically complement proteins such as C3 and FH (16, 17, 29–32). To study whether PspC is also involved in pneumococcalbinding to C4BP, we engineered pspC deletion mutants of TIGR4and BHN79 strains T4pspC and BHN79pspC, respectively.There was no difference in growth fitness between wt and mutantstrains as determined by growth curves in vitro (data not shown).Since PspC is one of the known pneumococcal ligand of FH, wetested both pspC mutants for FH binding in a direct binding assaywith 125I-purified FH (Fig. 5A) and in an absorption assay withNHS (Fig. 5B). We confirmed that the loss of PspC expression on

FIGURE 5. Effect of pspC muta-tions on FH and C4BP binding. pspCisogenic mutants of TIGR4 andBHN79 were engineered by insertionreplacement with an erythromycin re-sistance cassette. The binding was de-fined as a ratio between bound radio-activity and total amount of addedradioactivity. FH and C4BP bindingrate were analyzed by a nonparamet-ric Mann-Whitney test. ��, p � 0.01.A, Binding of 125I-FH to pspC mu-tants was compared with wt strains. B,Representative flow cytometry histo-grams of FH binding to BHN79 andBHN79pspC. Bacteria (107) wereincubated with either 50% NHS (grayline) or PBS (black line). M repre-sents the histogram marker for thepositive population; MFI, mean fluo-rescence intensity. C, Binding of 125I-C4BP to pspC mutants of TIGR4,BHN79, and BHN84 strains. D, Rep-resentative flow cytometry histogramsof C4BP binding to BHN79 andBHN79pspC. Bacteria (107) wereincubated with either 50% NHS (grayline) or PBS (black line). M repre-sents the histogram marker for thepositive population; MFI, mean fluo-rescence intensity. E, PCR amplifica-tion of pspC locus of TIGR4 (lanes 1and 3) and BHN79 (lanes 2 and 4)using either primers of the upstreamand downstream flanking regionsSP2189/SP2191 (lanes 1 and 2) orspecific primers of pspC group 4 LU9/LU10 (lanes 3 and 4); lane 7, 1-kbDNA ladder (Invitrogen). F, Sche-matic representation of PspC3.4 andPspC4.4. The overall percentage ofidentity at the protein level is 46.5%.The leader peptide (LP) is conserved(37 aa). PspC4.4 harbors a single R2-like domain, which exhibits a 51.8%identity with the R2 domain ofPspC3.4. The C-terminal anchor ofPspC4.4 is composed of 10 choline-binding domain (CBD) repeats ascompared with 8 CBD for PspC3.4.Localization of primers LU9 andLU10 is shown. LU10 has two mis-matches against pspC3.4 sequence. P,Proline-rich region; R1 and R2, R1and R2 domains.



ww

.jimm

unol.org/D

ownloaded from


the bacterial surface correlated with a reduced binding of FH (Fig.5, A and B). When we tested our isogenic pairs for C4BP bindingin direct binding (Figs. 3A and 5C), we observed that the deletionof PspC in BHN79pspC resulted in a significant reduction ofC4BP binding (Figs. 3A and 5C) and of C4met cleavage (Fig. 4,lane 5). Additionally, we performed an absorption assay with NHSand assessed C4BP binding to BHN79 and its isogenic mutantBHN79pspC by flow cytometry (Fig. 5D). We observed that theshift to the right is lost in the pspC-negative strain, confirming theloss of C4BP binding by BHN79pspC. However, no differencewas observed with TIGR4 and its isogenic pspC mutant (Figs. 3A,4, lanes 2 and 3, and 5C). Furthermore, we observed that bindingof serum C4BP to BHN79 was weaker as compared with bindingof serum FH (Fig. 5, B and D). This is in agreement with ourprevious observation (Fig. 2A) that the efficiency of C4BP bindingto bacteria might be influenced by the presence of other serumproteins such as FH. We also tested isogenic mutants of BHN79and TIGR4 deleted in pneumolysin (ply), a cytotoxin known toinhibit complement by inhibiting C3 deposition, but found no dif-ference between wt and isogenic ply mutant strains with respect toC4BP binding (data not shown).

Although the pspC locus varies in size and in sequence, it islocated at the same chromosomal position in all pneumococcalstrains tested (33). The pspC locus of TIGR4 is located betweentwo open reading frames annotated SP2189 and SP2191. PCR am-plification using primers located in the upstream and downstreamflanking regions of the pspC gene (SP2189/SP2191) showed thatthe pspC gene product of BHN79 is larger than the pspC geneproduct of TIGR4 (Fig. 5D, lanes 1 and 2). We sequenced thepspC gene of BHN79 and showed that it had a size of 2814 bp(GenBank accession no. EU881702; www.ncbi.nlm.nih.gov/nuc-core/195963558) as compared with 2082 bp for TIGR4, confirm-ing that PspC of BHN79 is of larger size than PspC of TIGR4.

Allelic variants of PspC can be divided into 11 groups, and PspCof TIGR4 belongs to group 3. It is the fourth sequenced member ofthis group and is hence designated as PspC3.4 (Fig. 5, E and F).PspC of the serotype 2 strain D39 (PspC3.1) is the archetype of thegroup 3. However, sequence and PCR analysis showed that thepspC gene of BHN79 belonged to group 4 (data not shown andFig. 5D, lanes 3 and 4). This group contains three sequenced mem-bers, PspC4.1, PspC4.2, and PspC/SP14-BS69 (GenBank acces-sion nos. AF145044, AF154033, and ZP01827960; www.ncbi.nlm.nih.gov) (33). Thus, PspC of BHN79 is the fourth sequencedmember of this family and is therefore referred to as PspC4.4 (Fig.5E). When we compared PspC3.4 (TIGR4) and PspC4.4 (BHN79),we only found an overall percentage of identity of 46.5% at theprotein level. Both PspC3.4 and Psp4.4 express a conserved 37-aaleader peptide. Like all members of group 4, PspC4.4 harbors asingle R2-like domain, which exhibits a 51.8% identity with theR2 domain of PspC3.4. The C-terminal anchor of PspC4.4 is com-posed of 10 choline-binding domain repeats as compared with 8choline-binding domain repeats for PspC3.4 (Fig. 5D). Using pu-rified recombinant PspC3.4, we showed that there is no direct in-teraction with C4BP (Fig. 3A). We also performed a heterologouscompetition assay using increasing amounts of recombinantPspC3.4 to inhibit BHN79 binding to C4BP and we showed thateven the highest concentration of PspC3.4 did not inhibit the in-teraction between C4BP and BHN79 (data not shown). Taken to-gether, our data suggest that pneumococcal C4BP binding occursin a PspC allele-dependent manner.

Interestingly, both PspC4.1 and PspC/SP14-BS69 have been se-quenced from serotype 14 isolates, V26 and SP14-BS69 strains,respectively (33). Moreover, SP14-BS69 belongs to the clonal lin-eage of ST124. PspC4.2 has been sequenced from a serotype 6

strain, G100, and the pspC locus from this strain contains twopspC genes ( pspC4.2 and pspC10.1) in tandem separated by aninsertion sequence (33). Sequence comparisons showed thatPspC4.1, PspC/SP14-BS69, and PspC4.4 clustered together, whilePspC4.2 is more distant (Fig. 6A). Therefore, we studied the dis-tribution of group 4 pspC allele among our strain collection andinvestigated whether the expression of group 4 pspC alleles cor-relates with C4BP binding. PCR amplification using primers (LU9/LU10) designed to specifically amplify group 4 pspC locusshowed that group 4 pspC alleles are polymorphic, with size of theresulting PCR fragments ranging between 1.1 and 2.6 kb (Table I).This is in agreement with the high allelic variability betweenstrains. We also found that group 4 pspC alleles were mostlypresent in strains able to bind C4BP. All ST124 and ST9 isolatesof serotype 14 (Fig. 6B) as well as isolates of serotype 4, 6B, and7F (Table I) with intermediate binding to C4BP harbored a copy ofgroup 4 pspC gene. However, no PCR product could be amplifiedfrom seven strains of serotype 14 using either LU9/LU10 primersor other specific primers of pspC4.4 (Table I and data not shown).Three of these strains, BHN181, BHN183, and 1401, exhibited aweak C4BP binding, which could be explained by the absence ofa group 4 pspC allele. Four strains (BHN180, BHN405, BHN406,and BHN407) lacking a group 4 pspC allele were intermediate tohigh binders, suggesting that either PspC from another group couldbind C4BP as well or that these strains express another C4BPligand. Interestingly, strains of serotype 1, which are weak C4BPbinders, contained a shorter variant of group 4 pspC gene (Table I),suggesting that the shorter variant might have lost the C4BP bind-ing site. Taken together, our data show that certain subtypes ofPspC may be potential ligands for C4BP.

To confirm the importance of the expression of PspC4.4 forC4BP binding, we created an additional isogenic pspC deletionmutant of the ST124 isolate BHN84, BHN84pspC. We testedthis mutant for C4BP binding and we observed that the deletion ofPspC in the BHN84 strain also resulted in a significant reductionof C4BP binding (Fig. 5B), confirming that the PspC4.4 allelicvariant expressed by pneumococcal strains of ST124 acts as a spe-cific receptor for C4BP.

Bacteria-bound C4BP down-regulates the activation of theclassical pathway

Activation of the classical pathway results in surface deposition ofC4b, which in the presence of C4BP and FI is degraded to C4c andC4d. Thus, if the classical pathway is down-regulated by C4BP,high amounts of C4c will be detected. We selected two serotype 14

FIGURE 6. Distribution of group 4 pspC allele. A, Phylogenetic tree ofall the allelic variants of PspC of group 4 PspC4.1, PspC4.2, PspC SP14-BS69, and Psp4.4 using Megalign program (DNAStar Lasergene). B, PCRamplification of pspC locus of serotype 14 isolates using primers LU9/LU10. Mw, m.w. 1-kb DNA ladder (Invitrogen).



ww

.jimm

unol.org/D

ownloaded from


isolates, BHN79 and BHN182, a strong and a weak C4BP binder,respectively. Bacteria were incubated with 50% NHS and we es-timated C4b degradation by measuring C4c by flow cytometry(Fig. 7). Less C4c was detected in association with BHN182 ascompared with BHN79 (Fig. 7A). Since we demonstrated that thePspC4.4 allelic variant is a specific receptor for C4BP, we alsocompared C4b degradation between BHN79 and its isogenic PspCmutant BHN79pspC (Fig. 7B). The absence of PspC4.4 resultedin a reduced C4b degradation as less C4c was detected. Our resultsshow that the ability to bind C4BP affects C4b degradation, whichin turn will affect bacterial virulence.

DiscussionBoth the classical and the alternative pathways of the complementare crucial players in the innate immunity response to pneumo-cocci (34). Clinical and experimental studies have shown that pa-tients with deficiencies in various components of the complementsystem are at higher risk to develop IPD (35). A Swedish studyshowed that �50% of patients with C2 deficiency had one or moreepisodes of infection (sepsis, meningitis, and pneumonia) with en-capsulated bacteria mainly pneumococci, while 40% of C3-defi-

cient patients had an increased susceptibility to pneumococcal in-fections (36, 37). Similarly, complement-deficient mice (C1q, C3,C4) developed severe and rapid septicemia after pneumococcalinfections (34, 38, 39). Additionally, a new mechanism of classicalpathway activation was recently identified whereby the pneumo-coccal polysaccharide capsule interacts with the C-type lectin re-ceptor SIGN-R1 and C1q, allowing assembly of a C3 convertasewithout the need for Abs or factor B (40, 41). SIGN-R1-deficientmice are also more susceptible to lethal pneumococcal infections(42). Thus, complement plays a crucial role against pneumococcalinfections both at the early stages of colonization and pneumoniaas well as at the later bacteremic phase of the infection. Never-theless, despite these responses, pneumococci can cause severeinfections, indicating that it has evolved efficient complement eva-sion strategies.

Many pathogens have developed common strategies to evadecomplement activation. One such strategy is the acquisition of flu-id-phase complement inhibitor, such as C4BP. Indeed, binding toC4BP renders two common respiratory bacteria, M. catarrhalisand nontypeable H. influenzae, resistant to serum-mediated killingand is responsible for S. pyogenes resistance to phagocytosis. It islikely that S. pneumoniae uses the same strategy to evade com-plement activation. In the present study, we investigated whetherS. pneumoniae could also bind C4BP.

Using a collection of clinical isolates representing common se-rotypes and clones causing invasive disease, we showed that sev-eral pneumococcal isolates bound strongly C4BP. This is in con-trast to previous studies where no significant C4BP binding topneumococci was found (43, 44). Hence, our report is the first toshow a binding between C4BP and pneumococci. Interestingly,several strains of serotype 4, 6B, and 7F exhibited intermediatebinding to C4BP, but most strains of serotype 14 tested showed astrong binding of C4BP. While the pneumococcus can express upto 91 different capsular polysaccharide types, only �20 serotypesare responsible for �80% of IPD worldwide in all age groups (13,45, 46). The serotype 14 is a common serotype among invasiveisolates around the world, especially in young children. It ac-counted for nearly 30% of the invasive isolates collected fromCanadian children between 1991 and 2004 and 25% of the inva-sive isolates recovered in German children between 1999 and 2003(47, 48). Similarly, serotype 14 isolates accounted for 10% of theinvasive isolates collected from the Stockholm area in 1997, andthis serotype has also been shown to spread and expand success-fully in Sweden (21). Furthermore, two major clones of serotype14 as identified by MLST, ST9 and ST124, have been shown tospread around the world causing a major part of invasive diseasesin children. We therefore investigated whether C4BP binding cor-related specifically with the expression of the serotype 14 capsuleand/or with specific clonal properties. Using isogenic serotype 6B,7F, 14, and 19F capsular variants of TIGR4 (23), we demonstratedthat C4BP binding was not dependent on the capsule type butrather on the expression of other virulence determinants. More-over, the presence of the capsule significantly decreased C4BPbinding, indicating that the capsule interferes with the binding aspreviously seen in binding studies with sIgA or FH (16, 30). Sim-ilar observations were done with unencapsulated N. meningitidisstrains as compared with encapsulated ones (9). We also observedthat while C4BP binding was strong or intermediate for most ofserotype 14 strains tested, a strong binding correlated mostly withthe clone ST124. This is in agreement with epidemiologicalstudies, which have shown that not only capsular types are im-portant for disease outcome but that also other genetic proper-ties such as specific virulence factors associated with genetically

FIGURE 7. Pneumococcal C4b degradation in normal human serum.Bacteria (107) were incubated with 50% NHS. C4c was detected using ananti-C4c serum IgG. M represents the histogram marker for the positivepopulation; MFI, mean fluorescence intensity. A, Representative flow cy-tometry histograms of C4c. BHN182, gray line; BHN79, black line. B,Representative flow cytometry histograms of C4c. BHN79pspC, grayline; BHN79, black line.



ww

.jimm

unol.org/D

ownloaded from


related strains or clonal clusters may play an important role forpathogenicity (21, 49).

Most binding interactions between microbes and C4BP havebeen found to be either hydrophobic or ionic (5–10, 50–54). Incontrast to S. pyogenes, we demonstrated that the interaction be-tween the pneumococcal strain BHN79 and C4BP was ionic innature, as it could be inhibited using increasing concentrations ofNaCl. The ionic interaction is presumably mediated by a patch ofpositively charged amino acids on the interface of CCP1 and CCP2of the �-chain. This indicates that these two domains of the�-chain are important for C4BP binding to the pneumococcus.Using C4met and heparin, two C4BP ligands, whose binding siteshave been mapped to CCP1–3 (1), and deletion mutants of indi-vidual CCP, we confirmed the importance of the CCP2–3 regionfor pneumococcal binding to C4BP. This is similar to most otherbacterial pathogens previously investigated. Only M. catarrhalisand H. influenzae bind via CCP7 as well (8, 10). Although, thepneumococcus binds via the same site as C4b, we showed thatC4BP retained its inhibitory function and cofactor activity whenbound to the bacteria. Since C4BP is a polymer of seven identical�-chains, it can bind simultaneously C4b and bacteria.

The pneumococcus expresses multiple virulence factors, andamong them the pneumococcal surface protein C family (alsocalled CbpA, Hic, PbcA, SpsA, and SP2190) has been extensivelystudied. PspC surface proteins are expressed by 75% of all pneu-mococcal clinical isolates. Most PspC proteins are choline-bindingproteins, although a few variants, such as Hic expressed by sero-type 3 strains, are anchored to the cell wall by the typical LPXTGmotif (33, 55). Even though there is a high variability at the se-quence level and allelic variants of PspC are divided into 11groups, all PspC proteins have a common organization (33, 55).PspC contributes to virulence in colonization and systemic mousemodels (56–60). PspC is a multifunctional protein that binds to thesecretory component of pIgR to promote adherence and invasionof epithelial cells (61). It also binds soluble host factors such assIgA and IgM as well C3 and FH (62). Pneumococcal binding toC3 and FH help in the evasion of the complement system. Pneu-mococcal recognition of multiple serum proteins probably influ-ences the efficiency of C4BP binding and could explain the lowerefficiency of BHN79 to bind serum C4BP as compared withpC4BP.

We identified a new allelic variant of PspC belonging to thegroup 4, PspC4.4, and we showed that the loss of expression ofPspC4.4 protein led to the loss of C4BP binding. We also foundthat the presence of pspC alleles of group 4 correlated with theability to bind C4BP. Interestingly, all serotype 14 strains exceptfour are high C4BP binders and 72% of them harbor a group 4pspC allele, including ST124 isolates. Furthermore, of the threePspC of group 4 found by sequence database searches, two werefrom serotype 14 isolates and one of these isolates SP14-BS69belongs to the clone, ST124. Hence, PspC of group 4 is widelyexpressed by the clone ST124, which could suggest that the ex-pression of PspC group 4 might give a selective advantage to theserotype 14 strains in general and more specifically to the cloneST124. We also observed a high polymorphism among the group4 pspC alleles in size. Given the high variability of PspC, it ispossible that some variants lack some of the virulence phenotypesassociated with this protein, which would explain the variation indegrees of binding by the different isolates. Although high binders,few isolates of serotype 14 did not express a PspC of group 4,suggesting that a second ligand also could promote binding ofC4BP on the bacterial surface, for example, a PspC of anothergroup or an unrelated protein.

Several pneumococcal surface proteins have been described tobind to complement inhibitors and to reduce the amounts of C3bdeposition on their surfaces (63). For instance, pneumococcal sur-face protein PspA can inhibit the formation of the C3 convertase(64), and pneumolysin, an intracellular cytotoxin released duringautolysis, can reduce the opsonic capacity by depleting C3 binding(15). However, using deletion mutants of pneumolysin, we dem-onstrated that C4BP binding correlated specifically with the ex-pression of PspC and not of pneumolysin.

Pneumococcal adherence to epithelial cells is dependent on theexpression of several adhesins such as PspC and pili encoded bythe newly discovered rlrA pathogenicity island (65). Of interest,C4BP binding does not correlate to pilus expression, since none ofthe serotype 14 strains tested harbors the rlrA operon (B. Hen-riques-Normark, unpublished observation).

PspC promotes pneumococcal adherence and invasion of epi-thelial cells by binding to the pIgR, but also the interaction withFH was shown recently to mediate pneumococcal adherence toepithelial cells in vitro and to enhance invasion of mouse lungs invivo (66, 67). C4BP binding was shown to enhance the adhesionof the yeast Candida albicans to host endothelial cells (68). It istherefore possible that binding to C4BP could promote pneumo-coccal adhesion as well. C4BP is also a ligand for the endocyticreceptor CD91 (also known as the LDL receptor-related protein),and CD91 in association with heparan sulfate proteoglycan con-tributes to the cellular uptake of C4BP in vitro (69). Hence, it istempting to speculate that C4BP binding could mediate pneumo-coccal invasion of host cells. Whether bacteria-bound C4BP couldhave a dual role in pneumococcal infection as suggested for bac-teria-bound FH on mucosal surfaces promoting adherence and in-vasion and in the bloodstream promoting bacterial survival (66)remains to be investigated.

Our data show that C4BP binding seems to be restricted to cer-tain serotypes and to certain clonal lineages such as ST124 ofserotype 14, and this binding property may provide a virulenceattribute to ST124 strains that are successfully spreading through-out the world. We are currently collecting a large number of strainsisolated from either healthy carriers or patients with pneumonia orIPD from different parts of the world to obtain a global epidemi-ological overview of the importance of C4BP binding for immuneevasion and invasive disease.

In conclusion, we have demonstrated for the first time that S.pneumoniae can recognize and bind complement inhibitor C4BPand identified a new allelic variant of the cell surface-expressedprotein and major virulence factor PspC as a ligand for C4BP. Thisnew allelic variant of PspC is expressed mostly by serotype 14isolates commonly associated with invasive human disease. How-ever, while we have identified a new function for PspC, a secondligand yet unidentified also promotes binding of C4BP on the bac-terial surface. The identification of the second potential C4BP li-gand is in progress.

AcknowledgmentsThe authors thank Prof. Mark Lipsitch for providing the isogenic capsularvariants, Prof. Don Morrison for providing the competent sequence pep-tides and for providing advice on transformation techniques, Prof. TimothyJ. Mitchell for providing the rabbit polyclonal anti-pneumolysin antiserum,Prof. Elaine Tumonanen for providing the rabbit polyclonal anti-PspC an-tiserum, and Prof. Bjorn Dahlback for the polyclonal rabbit anti-humanC4BP and the murine monoclonal against CCP1 of C4BP (mAb104). Wealso thank Prof. Staffan Normark for critical reading of the manuscript.Christina Johansson, Gunnel Mollerberg, and Ingrid Andersson are greatlyacknowledged for characterization of clinical pneumococcal isolates, andHelen Andersson and Raged El-Ali are acknowledged for technicalassistance.



ww

.jimm

unol.org/D

ownloaded from


DisclosuresThe authors have no financial conflicts of interest.

References1. Ziccardi, R. J., B. Dahlback, and H. J. Muller-Eberhard. 1984. Characterization

of the interaction of human C4b-binding protein with physiological ligands.J. Biol. Chem. 259: 13674–13679.

2. Dahlback, B., and B. Hildebrand. 1983. Degradation of human complement com-ponent C4b in the presence of the C4b-binding protein-protein S complex. Bio-chem. J. 209: 857–863.

3. Cole, F. S., W. J. Matthews, Jr., T. H. Rossing, D. J. Gash, N. A. Lichtenberg, andJ. E. Pennington. 1983. Complement biosynthesis by human bronchoalveolarmacrophages. Clin. Immunol. Immunopathol. 27: 153–159.

4. Strunk, R. C., D. M. Eidlen, and R. J. Mason. 1988. Pulmonary alveolar type IIepithelial cells synthesize and secrete proteins of the classical and alternativecomplement pathways. J. Clin. Invest. 81: 1419–1426.

5. Berggard, K., E. Johnsson, F. R. Mooi, and G. Lindahl. 1997. Bordetella per-tussis binds the human complement regulator C4BP: role of filamentous hemag-glutinin. Infect. Immun. 65: 3638–3643.

6. Berggard, K., E. Johnsson, E. Morfeldt, J. Persson, M. Stalhammar-Carlemalm,and G. Lindahl. 2001. Binding of human C4BP to the hypervariable region of Mprotein: a molecular mechanism of phagocytosis resistance in Streptococcus pyo-genes. Mol. Microbiol. 42: 539–551.

7. Berggard, K., G. Lindahl, B. Dahlback, and A. M. Blom. 2001. Bordetella per-tussis binds to human C4b-binding protein (C4BP) at a site similar to that usedby the natural ligand C4b. Eur. J. Immunol. 31: 2771–2780.

8. Hallstrom, T., H. Jarva, K. Riesbeck, and A. M. Blom. 2007. Interaction withC4b-binding protein contributes to nontypeable Haemophilus influenzae serumresistance. J. Immunol. 178: 6359–6366.

9. Jarva, H., S. Ram, U. Vogel, A. M. Blom, and S. Meri. 2005. Binding of thecomplement inhibitor C4bp to serogroup B Neisseria meningitidis. J. Immunol.174: 6299–6307.

10. Nordstrom, T., A. M. Blom, A. Forsgren, and K. Riesbeck. 2004. The emergingpathogen Moraxella catarrhalis interacts with complement inhibitor C4b bindingprotein through ubiquitous surface proteins A1 and A2. J. Immunol. 173:4598–4606.

11. Meri, T., S. J. Cutler, A. M. Blom, S. Meri, and T. S. Jokiranta. 2006. Relapsingfever spirochetes Borrelia recurrentis and B. duttonii acquire complement reg-ulators C4b-binding protein and factor H. Infect. Immun. 74: 4157–4163.

12. Wardlaw, T. M., E. W. Johansson, and M. Hodge; for World Health Organizationand the United Nations Children’s Fund. 2006. Pneumonia: The Forgotten Killerof Children. World Health Organization/United Nations Children’s Fund.

13. Bogaert, D., R. De Groot, and P. W. Hermans. 2004. Streptococcus pneumoniaecolonisation: the key to pneumococcal disease. Lancet Infect. Dis. 4: 144–154.

14. Abeyta, M., G. G. Hardy, and J. Yother. 2003. Genetic alteration of capsule typebut not PspA type affects accessibility of surface-bound complement and surfaceantigens of Streptococcus pneumoniae. Infect. Immun. 71: 218–225.

15. Paton, J. C., B. Rowan-Kelly, and A. Ferrante. 1984. Activation of human com-plement by the pneumococcal toxin pneumolysin. Infect. Immun. 43: 1085–1087.

16. Janulczyk, R., F. Iannelli, A. G. Sjoholm, G. Pozzi, and L. Bjorck. 2000. Hic, anovel surface protein of Streptococcus pneumoniae that interferes with comple-ment function. J. Biol. Chem. 275: 37257–37263.

17. Jarva, H., R. Janulczyk, J. Hellwage, P. F. Zipfel, L. Bjorck, and S. Meri. 2002.Streptococcus pneumoniae evades complement attack and opsonophagocytosisby expressing the pspC locus-encoded Hic protein that binds to short consensusrepeats 8–11 of factor H. J. Immunol. 168: 1886–1894.

18. Smith, B. L., and M. K. Hostetter. 2000. C3 as substrate for adhesion of Strep-tococcus pneumoniae. J. Infect. Dis. 182: 497–508.

19. Ogunniyi, A. D., M. Grabowicz, L. K. Mahdi, J. Cook, D. L. Gordon,T. A. Sadlon, and J. C. Paton. 2009. Pneumococcal histidine triad proteins areregulated by the Zn2�-dependent repressor AdcR and inhibit complement dep-osition through the recruitment of complement factor H. FASEB J. 23: 731–738.

20. Sandgren, A., B. Albiger, C. J. Orihuela, E. Tuomanen, S. Normark, andB. Henriques-Normark. 2005. Virulence in mice of pneumococcal clonal typeswith known invasive disease potential in humans. J. Infect. Dis. 192: 791–800.

21. Sandgren, A., K. Sjostrom, B. Olsson-Liljequist, B. Christensson, A. Samuelsson,G. Kronvall, and B. Henriques Normark. 2004. Effect of clonal and serotype-specific properties on the invasive capacity of Streptococcus pneumoniae. J. In-fect. Dis. 189: 785–796.

22. Enright, M. C., and B. G. Spratt. 1999. Multilocus sequence typing. Trends Mi-crobiol. 7: 482–487.

23. Trzcinski, K., C. M. Thompson, and M. Lipsitch. 2003. Construction of otherwiseisogenic serotype 6B, 7F, 14, and 19F capsular variants of Streptococcus pneu-moniae strain TIGR4. Appl. Environ. Microbiol. 69: 7364–7370.

24. Sung, C. K., H. Li, J. P. Claverys, and D. A. Morrison. 2001. An rpsL cassette,Janus, for gene replacement through negative selection in Streptococcus pneu-moniae. Appl. Environ. Microbiol. 67: 5190–5196.

25. Achen, M. G., B. E. Davidson, and A. J. Hillier. 1986. Construction of plasmidvectors for the detection of streptococcal promoters. Gene 45: 45–49.

26. Dahlback, B. 1983. Purification of human C4b-binding protein and formation ofits complex with vitamin K-dependent protein S. Biochem. J. 209: 847–856.

27. Kask, L., A. Hillarp, B. Ramesh, B. Dahlback, and A. M. Blom. 2002. Structuralrequirements for the intracellular subunit polymerization of the complement in-hibitor C4b-binding protein. Biochemistry 41: 9349–9357.

28. Blom, A. M., L. Kask, and B. Dahlback. 2001. Structural requirements for thecomplement regulatory activities of C4BP. J. Biol. Chem. 276: 27136–27144.

29. Dave, S., M. K. Pangburn, C. Pruitt, and L. S. McDaniel. 2004. Interaction ofhuman factor H with PspC of Streptococcus pneumoniae. Indian J. Med. Res.119(Suppl.): 66–73.

30. Dave, S., S. Carmicle, S. Hammerschmidt, M. K. Pangburn, and L. S. McDaniel.2004. Dual roles of PspC, a surface protein of Streptococcus pneumoniae, inbinding human secretory IgA and factor H. J. Immunol. 173: 471–477.

31. Duthy, T. G., R. J. Ormsby, E. Giannakis, A. D. Ogunniyi, U. H. Stroeher,J. C. Paton, and D. L. Gordon. 2002. The human complement regulator factor Hbinds pneumococcal surface protein PspC via short consensus repeats 13 to 15.Infect. Immun. 70: 5604–5611.

32. Dave, S., A. Brooks-Walter, M. K. Pangburn, and L. S. McDaniel. 2001. PspC,a pneumococcal surface protein, binds human factor H. Infect. Immun. 69:3435–3437.

33. Iannelli, F., M. R. Oggioni, and G. Pozzi. 2002. Allelic variation in the highlypolymorphic locus pspC of Streptococcus pneumoniae. Gene 284: 63–71.

34. Brown, J. S., T. Hussell, S. M. Gilliland, D. W. Holden, J. C. Paton,M. R. Ehrenstein, M. J. Walport, and M. Botto. 2002. The classical pathway is thedominant complement pathway required for innate immunity to Streptococcuspneumoniae infection in mice. Proc. Natl. Acad. Sci. USA 99: 16969–16974.

35. Sjoholm, A. G., G. Jonsson, J. H. Braconier, G. Sturfelt, and L. Truedsson. 2006.Complement deficiency and disease: an update. Mol. Immunol. 43: 78–85.

36. Jonsson, G., L. Truedsson, G. Sturfelt, V. A. Oxelius, J. H. Braconier, andA. G. Sjoholm. 2005. Hereditary C2 deficiency in Sweden: frequent occurrenceof invasive infection, atherosclerosis, and rheumatic disease. Medicine (Balti-more) 84: 23–34.

37. Alper, C. A., J. Xu, K. Cosmopoulos, B. Dolinski, R. Stein, G. Uko, C. E. Larsen,D. P. Dubey, P. Densen, L. Truedsson, et al. 2003. Immunoglobulin deficienciesand susceptibility to infection among homozygotes and heterozygotes for C2deficiency. J Clin. Immunol. 23: 297–305.

38. Rupprecht, T. A., B. Angele, M. Klein, J. Heesemann, H. W. Pfister, M. Botto,and U. Koedel. 2007. Complement C1q and C3 are critical for the innate immuneresponse to Streptococcus pneumoniae in the central nervous system. J. Immunol.178: 1861–1869.

39. Yuste, J., M. Botto, S. E. Bottoms, and J. S. Brown. 2007. Serum amyloid P aidscomplement-mediated immunity to Streptococcus pneumoniae. PLoS Pathog. 3:1208–1219.

40. Kang, Y. S., Y. Do, H. K. Lee, S. H. Park, C. Cheong, R. M. Lynch,J. M. Loeffler, R. M. Steinman, and C. G. Park. 2006. A dominant complementfixation pathway for pneumococcal polysaccharides initiated by SIGN-R1 inter-acting with C1q. Cell 125: 47–58.

41. Kang, Y. S., J. Y. Kim, S. A. Bruening, M. Pack, A. Charalambous, A. Pritsker,T. M. Moran, J. M. Loeffler, R. M. Steinman, and C. G. Park. 2004. The C-typelectin SIGN-R1 mediates uptake of the capsular polysaccharide of Streptococcuspneumoniae in the marginal zone of mouse spleen. Proc. Natl. Acad. Sci. USA101: 215–220.

42. Lanoue, A., M. R. Clatworthy, P. Smith, S. Green, M. J. Townsend, H. E. Jolin,K. G. Smith, P. G. Fallon, and A. N. McKenzie. 2004. SIGN-R1 contributes toprotection against lethal pneumococcal infection in mice. J. Exp. Med. 200:1383–1393.

43. Thern, A., L. Stenberg, B. Dahlback, and G. Lindahl. 1995. Ig-binding surfaceproteins of Streptococcus pyogenes also bind human C4b-binding protein(C4BP), a regulatory component of the complement system. J. Immunol. 154:375–386.

44. Yuste, J., A. Sen, L. Truedsson, G. Jonsson, L. S. Tay, C. Hyams,H. E. Baxendale, F. Goldblatt, M. Botto, and J. S. Brown. 2008. Impaired op-sonisation with C3b and phagocytosis of Streptococcus pneumoniae in serumfrom subjects with defects in the classical complement pathway. Infect. Immun.76: 3761–3770.

45. Aanensen, D. M., A. Mavroidi, S. D. Bentley, P. R. Reeves, and B. G. Spratt.2007. Predicted functions and linkage specificities of the products of the Strep-tococcus pneumoniae capsular biosynthetic loci. J. Bacteriol. 189: 7856–7876.

46. Bentley, S. D., D. M. Aanensen, A. Mavroidi, D. Saunders, E. Rabbinowitsch,M. Collins, K. Donohoe, D. Harris, L. Murphy, M. A. Quail, et al. 2006. Geneticanalysis of the capsular biosynthetic locus from all 90 pneumococcal serotypes.PLoS Genet. 2: e31.

47. Ruckinger, S., R. von Kries, R. R. Reinert, M. van der Linden, and A. Siedler.2008. Childhood invasive pneumococcal disease in Germany between 1997 and2003: variability in incidence and serotype distribution in absence of generalpneumococcal conjugate vaccination. Vaccine 26: 3984–3986.

48. Burgess, T. S., A. F. Hirschfeld, G. J. Tyrrell, J. A. Bettinger, and S. E. Turvey.2008. Commonly invasive serotypes of Streptococcus pneumoniae trigger a re-duced innate immune response compared with serotypes rarely responsible forinvasive infection. FEMS Immunol. Med. Microbiol. 53: 136–139.

49. Coffey, T. J., M. C. Enright, M. Daniels, P. Wilkinson, S. Berron, A. Fenoll, andB. G. Spratt. 1998. Serotype 19A variants of the Spanish serotype 23F multire-sistant clone of Streptococcus pneumoniae. Microb. Drug Resist. 4: 51–55.

50. Andre, I., J. Persson, A. M. Blom, H. Nilsson, T. Drakenberg, G. Lindahl, andS. Linse. 2006. Streptococcal M protein: structural studies of the hypervariableregion, free and bound to human C4BP. Biochemistry 45: 4559–4568.

51. Jarva, H., J. Ngampasutadol, S. Ram, P. A. Rice, B. O. Villoutreix, andA. M. Blom. 2007. Molecular characterization of the interaction between porinsof Neisseria gonorrhoeae and C4b-binding protein. J. Immunol. 179: 540–547.

52. Johnsson, E., A. Thern, B. Dahlback, L. O. Heden, M. Wikstrom, and G. Lindahl.1996. A highly variable region in members of the streptococcal M protein familybinds the human complement regulator C4BP. J. Immunol. 157: 3021–3029.



ww

.jimm

unol.org/D

ownloaded from


53. Johnsson, E., A. Thern, B. Dahlback, L. O. Heden, M. Wikstrom, and G. Lindahl.1997. Human C4BP binds to the hypervariable N-terminal region of many mem-bers in the streptococcal M protein family. Adv. Exp. Med. Biol. 418: 505–510.

54. Ram, S., M. Cullinane, A. M. Blom, S. Gulati, D. P. McQuillen, R. Boden,B. G. Monks, C. O’Connell, C. Elkins, M. K. Pangburn, et al. 2001. C4bp bindingto porin mediates stable serum resistance of Neisseria gonorrhoeae. Int. Immu-nopharmacol. 1: 423–432.

55. Brooks-Walter, A., D. E. Briles, and S. K. Hollingshead. 1999. The pspC gene ofStreptococcus pneumoniae encodes a polymorphic protein, PspC, which elicitscross-reactive antibodies to PspA and provides immunity to pneumococcal bac-teremia. Infect. Immun. 67: 6533–6542.

56. Balachandran, P., A. Brooks-Walter, A. Virolainen-Julkunen, S. K. Hollingshead,and D. E. Briles. 2002. Role of pneumococcal surface protein C in nasopharyn-geal carriage and pneumonia and its ability to elicit protection against carriage ofStreptococcus pneumoniae. Infect. Immun. 70: 2526–2534.

57. Iannelli, F., D. Chiavolini, S. Ricci, M. R. Oggioni, and G. Pozzi. 2004. Pneu-mococcal surface protein C contributes to sepsis caused by Streptococcus pneu-moniae in mice. Infect. Immun. 72: 3077–3080.

58. Ogunniyi, A. D., K. S. LeMessurier, R. M. Graham, J. M. Watt, D. E. Briles,U. H. Stroeher, and J. C. Paton. 2007. Contributions of pneumolysin, pneumo-coccal surface protein A (PspA), and PspC to pathogenicity of Streptococcuspneumoniae D39 in a mouse model. Infect. Immun. 75: 1843–1851.

59. Quin, L. R., Q. C. Moore, 3rd, and L. S. McDaniel. 2007. Pneumolysin, PspA,and PspC contribute to pneumococcal evasion of early innate immune responsesduring bacteremia in mice. Infect. Immun. 75:2067–2070.

60. Quin, L. R., Q. C. Moore, 3rd, J. A. Thornton, and L. S. McDaniel. 2008. Peri-toneal challenge modulates expression of pneumococcal surface protein C (PspC)during bacteremia in mice. Infect. Immun. 76: 1122–1127.

61. Zhang, J. R., K. E. Mostov, M. E. Lamm, M. Nanno, S. Shimida, M. Ohwaki, andE. Tuomanen. 2000. The polymeric immunoglobulin receptor translocates pneu-mococci across human nasopharyngeal epithelial cells. Cell 102: 827–837.

62. Hammerschmidt, S. 2006. Adherence molecules of pathogenic pneumococci.Curr. Opin. Microbiol. 9: 12–20.

63. Jarva, H., T. S. Jokiranta, R. Wurzner, and S. Meri. 2003. Complement resistancemechanisms of streptococci. Mol. Immunol. 40: 95–107.

64. Tu, A. H., R. L. Fulgham, M. A. McCrory, D. E. Briles, and A. J. Szalai. 1999.Pneumococcal surface protein A inhibits complement activation by Streptococcuspneumoniae. Infect. Immun. 67: 4720–4724.

65. Barocchi, M. A., J. Ries, X. Zogaj, C. Hemsley, B. Albiger, A. Kanth,S. Dahlberg, J. Fernebro, M. Moschioni, V. Masignani, et al. 2006. A pneumo-coccal pilus influences virulence and host inflammatory responses. Proc. Natl.Acad. Sci. USA 103: 2857–2862.

66. Hammerschmidt, S., V. Agarwal, A. Kunert, S. Haelbich, C. Skerka, andP. F. Zipfel. 2007. The host immune regulator factor H interacts via two contactsites with the PspC protein of Streptococcus pneumoniae and mediates adhesionto host epithelial cells. J. Immunol. 178: 5848–5858.

67. Quin, L. R., C. Onwubiko, Q. C. Moore, M. F. Mills, L. S. McDaniel, andS. Carmicle. 2007. Factor H binding to PspC of Streptococcus pneumoniae in-creases adherence to human cell lines in vitro and enhances invasion of mouselungs in vivo. Infect. Immun. 75: 4082–4087.

68. Meri, T., A. M. Blom, A. Hartmann, D. Lenk, S. Meri, and P. F. Zipfel. 2004. Thehyphal and yeast forms of Candida albicans bind the complement regulator C4b-binding protein. Infect. Immun. 72: 6633–6641.

69. Spijkers, P. P., C. V. Denis, A. M. Blom, and P. J. Lenting. 2008. Cellular uptakeof C4b-binding protein is mediated by heparan sulfate proteoglycans and CD91/LDL receptor-related protein. Eur. J. Immunol. 38: 809–817.

70. Sjostrom, K., C. Blomberg, J. Fernebro, J. Dagerhamn, E. Morfeldt,M. A. Barocchi, S. Browall, M. Moschioni, M. Andersson, F. Henriques, et al.2007. Clonal success of piliated penicillin nonsusceptible pneumococci. Proc.Natl. Acad. Sci. USA 104: 12907–12912.

71. Wartha, F., K. Beiter, B. Albiger, J. Fernebro, A. Zychlinsky, S. Normark, andB. Henriques-Normark. 2007. Capsule and D-alanylated lipoteichoic acids pro-tect Streptococcus pneumoniae against neutrophil extracellular traps. Cell. Mi-crobiol. 9: 1162–1171.



ww

.jimm

unol.org/D

ownloaded from


Clinical isolates of Streptococcus pneumoniae bind the complement inhibitor C4b-binding protein in a...

Documents

Transcript of Clinical isolates of Streptococcus pneumoniae bind the complement inhibitor C4b-binding protein in a...