Cs

Ya

b

a

ARR2AA

KMTmPW

1

Tiimm

lrmsaat

ftdapft

0h

Plant Science 203–204 (2013) 17–24

Contents lists available at SciVerse ScienceDirect

Plant Science

j our na l ho me p a ge: www.elsev ier .com/ locate /p lantsc i

haracterization of small RNAs and their target genes in wheat seedlings usingequencing-based approaches

ong-Fang Lia,1, Yun Zhengb,1, Guru Jagadeeswarana, Ramanjulu Sunkara,∗

Department of Biochemistry and Molecular Biology, Oklahoma State University, Stillwater, OK 74078, USAInstitute of Developmental Biology and Molecular Medicine School of Life Sciences, Fudan University, Shanghai 200433, China

r t i c l e i n f o

rticle history:eceived 3 October 2012eceived in revised form0 December 2012ccepted 23 December 2012vailable online 3 January 2013

a b s t r a c t

Wheat is the most highly cultivated plant species for its grain production throughout the world. Becausesmall RNA-dependent gene regulation is critical for successful completion of plant life cycle including itsproductivity, identification of not only miRNAs but also confirming their targets in wheat is important.To identify small RNAs including novel miRNAs as well as miRNA targets in wheat, we constructed smallRNA and degradome libraries from wheat seedlings. Small RNA analysis resulted in identification of most

eywords:icroRNAs

asiRNAsiRNA targets

conserved miRNAs including novel miRNAs that can be grouped into 32 miRNA families. The sequenceanalysis also led to the characterization of two abundantly expressed rRNA-derived small RNAs. To iden-tify miRNA targets, degradome library was sequenced and the bioinformatic analysis confirmed 53 genesas targets for miRNAs and Tas3-siRNAs. Degradome analysis also confirmed a conserved fine-tuningmechanism of Tas3-siRNA abundance by siRNA-mediated silencing of TAS3 transcripts in diverse plant

ded

ost transcriptional gene regulationheat

species. These findings ad

. Introduction

Wheat has been the basic staple food throughout the world [1].o meet future human food supply demand, significant advancesn the understanding of the wheat biology must be achieved toncrease absolute yields. This requires better understanding of

olecular mechanisms controlling wheat growth and develop-ent as well as its tolerance to stress conditions [2].The abundance of messenger RNA needs to be tightly regu-

ated in a cell, which is dependent on rate of transcription andate of degradation. Recently identified miRNAs can serve as guideolecules and degrade mRNA targets in a spatio- and temporal-

pecific manner thus fine tuning the target mRNA abundance in

given cell or tissue. This mode of gene regulation has emergeds one of the critical pathways and required for successful comple-ion of plants’ life cycle. Thus the identification of miRNAs and their

Abbreviations: ARF, auxin response factor; AP2-like, apetala 2-like transcriptionactor; DCL1, Dicer like-1; HD-Zipfactors, Homeodomainleucine zipper family ofranscription factors; miRNAs, microRNAs; NAC factors, NAM, ATAF1/2 and CUC2omain containing transcription factors; RLM-RACE, RNA ligase-mediated rapidmplification of cDNA ends; RISC, RNA-induced silencing complex; SPL, Squamosaromoter binding protein-like; tasiRNAs, trans-acting small interfering RNAs; TCPactors, Teosinte branched 1; Cycloidea, PCF (TCP)-domain protein family; TIR1,ransport inhibitor response 1.∗ Corresponding author. Tel.: +1 405 744 8496; fax: +1 405 744 7799.

E-mail address: ramanjulu.sunkar@okstate.edu (R. Sunkar).1 These authors contributed equally.

168-9452/$ – see front matter © 2012 Elsevier Ireland Ltd. All rights reserved.ttp://dx.doi.org/10.1016/j.plantsci.2012.12.014

additional information to the small RNA knowledge-base in wheat.© 2012 Elsevier Ireland Ltd. All rights reserved.

mRNA targets will aid in understanding the post-transcriptionalgene regulation in an organism. Previous studies attempted toidentify miRNAs in wheat by sequencing small RNA population[3–7] or by computational strategies [8–12]. Indeed, a recent studypredicted 42 conserved miRNAs on wheat chromosome 1AL [12].However, given the larger genome size of wheat but relativelysmaller number of miRNAs (for instance 591 miRNA loci have beenfound in rice-miRBase release 19, August 2012) identified in thisspecies suggests that there may be additional miRNAs that havenot been identified. Furthermore, identification of miRNA targetsin wheat is mostly confined to bioinformatic predictions [5,13]and only few target genes have been validated using RLM-5′RACEassay [4]. Although high throughput degradome analysis has beenapplied recently to identify miRNA targets in wheat, the study how-ever only identified a total of 29 genes (26 miRNA targets and3 Tas3-siRNA targets) as targets for some of the conserved miR-NAs and Tas3-siRNAs [6]. In this study, we report the identificationof novel small RNAs including a putative novel miRNA and con-firmed 53 genes as targets for the miRNAs and Tas3-siRNA in wheatseedlings using sequencing-based approaches.

2. Materials and methods

2.1. Small RNA library construction, sequencing and sequence

analysis

Wheat seeds were allowed to germinate in a controlledgrowth chamber (22–24 ◦C) with a 16-h photoperiod and

1 ence 203–204 (2013) 17–24

3hacliuatutahgtdc(tipTN

2a

wpsiwDcGnaBrsbga

2

[Rm

3

3

snstlwms

Table 1MicroRNAs and their frequency in a sequenced small RNA library generated fromwheat seedlings.

miRNA miRNA Sequence Frequency

miR156a UGACAGAAGAGAGUGAGCAC 204miR159a UUUGGAUUGAAGGGAGCUCUG 58miR160 UGCCUGGCUCCCUGUAUGCCA 6miR166 UCGGACCAGGCUUCAUUCCCC 276miR167 UGAAGCUGCCAGCAUGAUCUA 55miR168a UCGCUUGGUGCAGAUCGGGAA 12,981miR169a CAGCCAAGGAUGACUUGCCGA 44miR169b CAGCCAAGGAUGACUUGCCGG 44miR169h UAGCCAAGGAUGACUUGCCUG 45miR171 UGAUUGAGCCGUGCCAAUAUC 13miR171b UUGAGCCGUGCCAAUAUCACG 12miR172 AGAAUCUUGAUGAUGCUGCAU 64miR319 UUGGACUGAAGGGUGCUCCCU 8miR390 AAGCUCAGGAGGGAUAGCGCC 6miR393 UCCAAAGGGAUCGCAUUGAUC 25miR394 UUGGCAUUCUGUCCACCUCC 2miR395 UGAAGUGUUUGGGGGAACUC 22miR396a UUCCACAGCUUUCUUGAACUG 13miR396b UUCCACAGCUUUCUUGAACUU 13miR397 AUUGAGUGCAGCGUUGAUGAA 1miR408 CUGCACUGCCUCUUCCCUGGC 1miR444a-2 UGCAGUUGCUGCCUCAAGCUU 6miR444b-1 UGUUGUCUCAAGCUUGCUGCC 2miR444b-2 UGCAGUUGUUGUCUCAAGCUU 8miR444c-1 UGUUGUCUCAAGCUUGCUGCC 2miR444c-2 UGCAGUUGUUGUCUCAAGCUU 8miR444e UGCAGUUGCUGCCUCAAGCUU 6miR827 UUAGAUGACCAUCAGCAAACA 33miR894 CGUUUCACGUCGGGUUCACCA 49miR1135 CUGCGACAAGUAAUUCCGAACGGA 16miR1136 UUGUCGCAGGUAUGGAUGUAUCUA 4miR1138 GCUUAGAUGUGACAUCCUUAAAA 1miR1318 UCAGGAGAGAUGACACCGACG 2miR2002 UGAGAUGAGAUUACCCCAUAC 82miR2003 CGGUUGGGCUGUAUGAUGGCGA 92miR2006 UACCACGACUGUCAUUAAGCA 25miR2009a UGAGAAGGCAGAUCAUAAUAGC 134miR2009b UUAGAUGAGAAGGCAGAUCAUA 94miR2009c UCAGAUGAGAAGGCAGAUCAUA 43miR2009d UGAGAAGGUAGAUCAUAAUAGC 629miR2012 UUGGACGAGGAUGUGCAACUG 2miR2018 GCCCGUCUAGCUCAGUUGGU 28

8 Y.-F. Li et al. / Plant Sci

00 �mol m−2 s−1 light intensity. Seven-day-old seedlings werearvested and used for RNA isolation using Trizol (Invitrogen)ccording to the manufacturer’s instructions. For small RNA libraryonstruction, small RNAs of 18–28 nt were fractionated, iso-ated and ligated with the 5′ and 3′ RNA adapters, convertednto cDNA and then amplified using PCR [14]. The PCR prod-ct was purified and subjected for pyrosequencing. For sequencenalysis, the adaptor sequences were removed and extractedhe small RNAs. The redundant sequences were eliminated, andnique small RNAs were counted. The unique small RNAs werehen aligned to RNAs in the Repbase (http://www.girinst.org)nd the known rRNAs, tRNAs, snRNAs, snoRNAs (obtained fromttp://www.sanger.ac.uk/Software/Rfam/ftp.shtml) and messen-er RNAs of wheat obtained from the NCBI. Small RNAs mappedo these different categories of RNAs were removed from theataset [15–18]. The filtered small RNAs were used to identifyonserved or known miRNAs that are available at the miRBasehttp://microrna.sanger.ac.uk/sequences/). Some recent publica-ions (e.g., Wei et al. [4] and Xin et al. [5]) did not deposit thedentified novel miRNAs in the miRBase. We also searched thoseublications to find miRNA homologs that are reported for wheat.he leftover small RNAs were used to identify putative novel miR-As in wheat.

.2. Degradome library construction, sequencing and sequencenalysis

Degradome library was constructed using poly-A RNA, whichas isolated using MicroPoly(A)PuristTM (Ambion) as describedreviously [19,20]. Briefly, an RNA adaptor with MmeI restrictionite was ligated to cleaved ends of polyA RNA molecules possess-ng 5′ monophosphates, reverse-transcribed, amplified, digested

ith MmeI and the product was then ligated to a double-strandedNA oligo. The ligated molecules were amplified using 10 PCRycles and the resulting product was sequenced using IlluminaAII analyzer. For sequence analysis, the unique reads of 20ucleotides in length corresponding to rRNAs, tRNAs, snoRNAsnd snRNAs (http://www.sanger.ac.uk/Software/Rfam/) and Rep-ase (http://www.girinst.org/server/RepBase/) was discarded. Theemaining unique reads were aligned to the available codingequences from wheat (ESTs available at the NCBI). The SeqTarioinformatics pipeline [21] was used to find degradome sequencesenerated from miRNA-mediated cleavage using the transcriptsnd miRNAs from wheat as inputs.

.3. Small RNA blot analysis

Small RNA blot analysis was performed as described previously14] by probing the membrane that has size-fractionated smallNAs using labeled DNA oligonucleotide probe complementary toiRNA/small RNA sequence.

. Results and discussion

.1. Conserved and putative novel miRNAs in wheat seedlings

By sequencing a small RNA library generated from wheateedlings, a total of 485,274 raw reads ranging in length 18–28ucleotides were obtained. The small RNA read abundance vs theize distribution analysis revealed two peaks, i.e., one at 21 nt andhe other at 24 nt sizes, which is typical for most plant small RNA

ibraries. Furthermore, unique read abundance of 21-nt size class

as low compared to the 24-nt size because 21-nt size class wasostly represented by redundant miRNA sequences, whereas 24-nt

ize class by very few redundant sequences (Supplemental Fig. 1).

miR2020 AUAGCAUCAUCCAUCCUACCA 10s009 UGAUGACAAGUAUUUUCGGAC 20

The small RNA reads were processed to eliminate the degradationproducts from rRNA, tRNA, snRNA, snoRNA and messenger RNAs.However, we retained two small RNAs that are derived from rRNAdue to their differential accumulation relative to other fragmentsderived from the same rRNA and these were characterized in detail(see below). The remaining reads (299,177) were used for identifi-cation of conserved or known miRNAs in wheat. Sequence analysishas identified a putative novel miRNA (s009, Fig. 1a), for whichfold-back structure can be predicted using its precursor sequence(Fig. 1b). Its expression was detected using a small RNA blot analysis(Fig. 1c). BLAST searches against the wheat ESTs indicated that thisnovel miRNA is represented by two additional members differingin 1 or 2 nucleotides and fold-back structures can be predicted forall these three members (Fig. 1b). Although miR* sequence couldnot be recovered but fold-back structure predictions for all threeloci suggests this may be a novel miRNA.

Supplementary material related to this article found, in theonline version, at http://dx.doi.org/10.1016/j.plantsci.2012.12.014.

Of the 22 highly conserved miRNA families in plants, we iden-tified miRNAs belonging to 18 families (miRNA156/157, miR159,

miR160, miR165/166, miR167, miR168, miR169, miR170/171,miR172, miR319, miR390, miR393, miR394, miR395. miR396,miR397, miR408 and miR444) in wheat seedlings (Table 1). Homo-logues of conserved miR162, miR164, miR398 and miR399 were

Y.-F. Li et al. / Plant Science 203–204 (2013) 17–24 19

Fig. 1. Identification of a putative novel miRNA (s009) in wheat. (a) Sequence alignment of the miR2009 family members, (b) their predicted fold-back structures and (c)e

ntuoiAlaibMsatiiaioiitcinwbUs

xpression analysis in shoots and roots of wheat.

ot found in the small RNA library. miR162 was not found inhree independent studies that sequenced small RNA librariessing deep sequencing technologies such as 454-pyrosequencingr Illumina-sequencing-by-synthesis [3–5] or could not be detectedn Triticum dicoccoides using miRNA-array based approach [13].dditionally, it was also not found in seven independent small RNA

ibraries constructed from wheat spikes that were sequenced to depth of approximately 12 million reads per library [6]. Evenf it is expressed at extremely low levels, miR162 is likely toe recovered in some of the sequenced libraries to this depth.oreover with the exception of miR162 precursor, all other con-

erved miRNA precursors were found among the wheat ESTs thatre deposited with the NCBI database [8,9,14]. Taken together,hese observations argue in favor that miR162 may be absentn wheat. Conserved miR162 regulates the DCL1 expression thats required for miRNA biogenesis. Thus, it is unlikely that it isbsent in wheat genome, but it does not appear to be expressedn seedlings (this study and previous studies [2,4]) or spikes [6]r leaves [5]. Wheat genome analysis will reveal whether miR162s encoded in its genome or not. MicroRNA164 is another miss-ng miRNA in our sequences. However, 8 NAC-domain containingranscription factors that are targeted by miR164 were found to beleaved in the degradome library (Table 3), suggesting that miR164s expressed in seedlings, perhaps at very low levels. miR398 wasot found in our library as well as in several libraries generated from

heat spikes [6] or leaves [5]. By contrast, miR398 precursor has

een identified using EST-based miRNA prediction in wheat [8,10].nlike in Arabidopsis in which miR398 is abundantly expressed in

eedlings, it is expressed at low levels in rice and sorghum [18,14],

reflecting its low abundance in monocots. miR399 is specificallyinduced under phosphate deficiency [22,16], thus its absence in ourlibrary as in previously reported wheat small RNA libraries [3,4] isexpected.

MicroRNA168 was the most abundantly expressed miRNA,which is represented by 12,981 reads followed by miR166 andmiR156 families in wheat seedlings (Table 1). Previous report alsoindicated that miR168 is the most abundant miRNA in wheatseedlings and could represent almost 50% of the total miRNA popu-lation [5]. Because it targets Argonaute-1, the critical component ofthe RISC, the very high level expression of miR168 indicates ubiqui-tous suppression of overall miRNA-dependent post-transcriptionalgene regulation in seedlings. Detailed in situ hybridizations both formiR168 and AGO-1 (Argonaute-1) will reveal whether this silenc-ing is a general phenomenon or restricted to specific tissue or cellsin wheat seedlings.

MicroRNA homologs that are not well conserved but have beenidentified only in few plant species such as miR827 (in Arabidopsis,rice, Populus, maize, Brachypodium, Citrus, cotton and sugarcane)[23–29], miR894 (in Populus) [30], miR1135 (in Brachypodium) [31],miR1318 (in rice) [32] and two others, i.e., miR1136 and miR1138that are reported only in wheat [3] have also been identified in thisstudy (Table 1). The abundance of some of these miRNAs (miR894,miR827, miR1135 represented by 49, 33, 16 reads, respectively,and several others such as miR1136, miR1318 and miR1138 had

less than 10 sequence reads) was even greater than the frequencyof some of the conserved miRNAs such as miR160 (6 reads), miR319(8 reads), miR390 (6 reads), miR394 (2 reads), miR397 and miR408(1 read each) (Table 1). It is worth pointing here that miR397 and

20 Y.-F. Li et al. / Plant Science 203–204 (2013) 17–24

Table 2Frequency of rRNA-derived small RNAs in the sequenced small RNA libraries of wheat, rice, switchgrass and sorghum.

Sequence Number of small RNA reads

Wheat Rice Switch-grass Sorghum

mi

fwmamm[teorfmm(smrRri

o

3s

iwib

Fw

s147 GCCGGCCGGGGGACGGACCGGGA 583

s201 GCCCCGAACCCGUCGGCUGU 1747

iR408 that are highly conserved are represented by single readsn the library.

Recently reported miR2002, and three members of miR2009amily (miR2009a, miR2009b and miR2009c) [4] were also presentith relatively high frequency in our small RNA library (Table 1).iR2002 and miR2009 expression could be detected both in roots

nd shoots of wheat (Fig. 2a and b). In addition to three miR2009embers (miR2009a, b, c) as reported earlier [4], we found anotheriR2009 member (miR2009d, named as miR2005 by Xin et al.

5]), represented by 629 reads, which differs by one nucleotideo the known miR2009a (Table 1). To examine if miR2009 is alsoxpressed in related monocots, we have searched for the presencef this sequence in our small RNA libraries generated from sorghum,ice and switchgrass [14,17,18]. Indeed miR2009 homolog wasound in Sorghum and switchgrass but not in rice suggesting that

iR2009 is conserved in some monocots. Consistent with this,iR2009 expression was detected in different tissues of sorghum

Fig. 2c). The differential abundance of miR2009 in different tis-ues suggested a potential role for miR2009 in Sorghum. miR2003,iR2006, miR2018 and miR2020 reported by Wei et al. [4] were

epresented by relatively high number of reads in our wheat smallNA library (Table 1). Additionally, at least 25 other small RNAseported as miRNAs by Wei et al. [4] and Xin et al. [5] were foundn our sequences (Supplemental Table 1).

Supplementary material related to this article found, in thenline version, at http://dx.doi.org/10.1016/j.plantsci.2012.12.014.

.2. Small RNAs derived from ribosomal RNA (rRNA) in wheateedlings

Small RNAs derived from rRNAs or tRNAs often represent signif-

cant portion of total small RNA population in diverse plant species,

hich are considered as random degradation products. However,t was shown that small RNAs derived from tRNA were processedy Dicer in vivo and in vitro [33–36]. Studies also have attributed

ig. 2. Expression analysis of (a) miR2002 and (b) miR2009 in shoots and roots ofheat. (c) Expression analysis of miR2009 in different tissues of sorghum.

2059 1877 1851154 982 106

a role for tRNA-derived small RNAs in modulating developmentalprocesses or stress responses [36]. In this study, we analyzed twosmall RNAs (s201 and s147 represented by 1747 and 583 reads,respectively) (Table 2) derived from ribosomal RNA because thesetwo rRNA-derived fragments had greater frequency than the mostother fragments. Small RNA blot analysis detected the signal forthese two small RNAs in root and shoot tissues (Fig. 3a and b). Thesetwo small RNAs are derived from conserved rRNAs and accumulateto detectable levels in wheat raised the possibility that these mightalso accumulate in other plant species. We examined such a possi-bility in rice, switchgrass and sorghum small RNA libraries. Indeeds201 and s147 homologues were found in the small RNA librariesgenerated from rice, switchgrass and sorghum (Table 2) suggestingthat the processing of these two small RNAs (rRNA-derived smallRNAs) appears to be conserved in several related plant species. Byanalyzing the expression of s201 small RNA in different tissues,we further show that the abundance of this specific small RNAvary between different tissues (Fig. 3c). Their accurate processingas revealed by their occurrence in small RNA libraries from morethan one plant species suggest that some of the abundantly repre-sented rRNA-derived small RNAs are unlikely the consequence ofnon-specific degradation but appears to be a more regulated pro-cess, although their biogenesis and biological function remains tobe elucidated.

3.3. Degradome analysis to identify miRNA targets in wheatseedlings

miRNA-guided cleavage on its mRNA target leaves 5′ monophos-phate on the cleaved 3′ mRNA fragment, subsequently degradingthe target mRNA. Degradome libraries are able to capture prefer-

entially such fragments, thus can identify miRNA targets in plants[19,20,37,38]. In order to identify miRNA targets in wheat, wegenerated a degradome library from 7-day-old seedlings. A totalof 20-nt long 6,250,012 reads represented by 2,036,717 unique

Fig. 3. Detection of two rRNA-derived small RNAs (a) s147 and (b) s201 in shootsand roots of wheat. (c) Detection of s201 expression in different tissues of sorghum.

Y.-F. Li et al. / Plant Science 2

Table 3Summary of wheat degradome library.

Reads category Total reads Unique reads

Total 6,250,012 2,036,717Reads mapping to ESTs 4,624,762 1,026,602Reads mapping to TIGR transcripts assembly 4,607,663 1,021,326Reads mapping to pre-miRNAs 2211 874Reads mapping to Repeats 234,527 12,010

rocoa

TS

Reads mapping to structural RNA 119,214 8888Chloroplast/mitochondria 2,404,893 20,299

eads from the 5′ ends of uncapped, poly-adenylated RNAs were

btained (Table 3). Approximately 1% of the unique signatureould be mapped to chloroplast or mitochondrial genome; 0.44%f our unique dataset could be mapped to the rRNAs, tRNA, snRNAnd snoRNA using BLASTN search against the Rfam database;

able 4mall RNA targets identified by degradome analysis in wheat seedlings.

Small RNA Unique EST/transcript assembletarget (number of mismatches)

Percthe c

miR156 TA51444 4565 (2) 20

miR156 TA86819 4565 (2) 1.2miR156 TA88375 4565 (1) 42.8miR156 TA88376 4565 (2) 20

miR159 TA81041 4565 (2.5) 42.8miR159 TA85653 4565 (3) 85

miR160 TA98209 4565 (1) 50miR160 CJ706679 (1) 50

miR160 TA84028 4565 (2) 66.6miR160 CA615738 (1) 86.2miR160 TA79840 4565 (1) 40.3miR164 TA78777 4565 (2) 11.1miR164 CD933088 (2) 33.3miR164 CA642340 (2) 33.3miR164 CJ730124 (2) 20

miR164 TA78273 4565 (2) 11.7miR164 TA78276 4565 (2) 33.3miR164 CD929304 (2) 9.5miR164 CD929303 (2) 50

miR166 CK204430 (1.5) 100

miR166 CJ629056 (3) 100

miR166 BJ316348 (3) 100

miR169 TA70837 4565 (3) 36.3miR169 CJ545438 (3) 5.4miR169 TA74628 4565 (3.5) 81.1miR169 TA74627 4565 (3.5) 79.6miR169 TA74623 4565 (3.5) 91.4miR169 TA70840 4565 (2) 6.6miR169 DR737946 (2.5) 44.4miR169 TA87079 4565 (2.5) 66.6miR169 TA87080 4565 (2) 60

miR169 TA89550 4565 (2.5) 48.6miR171 TA85739 4565 (0.5) 10

miR171 CK210886 (0.5) 28.5miR172 CA626451 (1) 100

miR172 TA100405 4565 (3) 66.6miR172 CA612469 (1.5) 41.6miR172 CA609410 (1.5) 61.4miR319 CK153082 (3) 25

miR390 TA100969 4565 (3.5) 26.3miR393 CK193017 (3) 23.3miR393 CK208780 (1) 33.0miR393 CK168974 (1) 32.7miR394 CA638234 (0) 57.1miR395 CA681779 (3.5) 35.2miR396 CJ645826 (3) 100

miR396 TA91812 4565 (3) 61.5miR444 TA110159 4565 (0) 5.8miR1132 BE430755 (3) 26.2miR1135 TA52710 4565 (2.5) 9.7miR1136 BE443135 (2) 15.8Tas3-siRNA TA95988 4565 (0) 33.3Tas3-siRNA CJ948921.1 (0) 50

03–204 (2013) 17–24 21

the signatures corresponding to repeats/transposons were alsoremoved from the unique dataset, by performing searches againstthe repeat database. A small fraction (874 unique signatures) couldbe mapped to known wheat MIRNA precursors indicating theymight be processing remnants or degradation products from theprocessed MIRNA precursors. The remaining 1,026,602 unique sig-natures representing 50.4% of the total unique signatures couldbe mapped to wheat EST sequences/TIGR transcripts assemblies(Table 3). The limited resource of wheat ESTs/transcripts assem-blies might be one of the reasons that ∼47% of unique sequences,a higher percentage than that of rice degradome [20], could notbe mapped to wheat ESTs/transcripts assemblies. By mapping

degradome reads to the wheat ESTs, 47 distinct genes representedby unique ESTs/transcripts were confirmed as targets for 14 con-served miRNA families (Table 4). Besides these, a non-conservedtarget for miR395, and 3 other targets for less-conserved or even

entage of the reads atleavage site

EST annotation

Squamosa-promoter binding protein6 Squamosa promoter binding protein6 Squamosa promoter binding protein

Squamosa promoter binding protein6 MYB family transcription factor

MYB family transcription factorAuxin response factorAuxin response factor

7 Auxin response factor1 Auxin response factor2 Auxin response factor1 NAC domain-containing protein3 NAC domain-containing protein3 NAC domain-containing protein

NAC domain-containing protein6 NAC domain-containing protein3 NAC domain-containing protein2 NAC domain-containing protein

NAC domain-containing proteinHD-ZIP III transcription factorHD-ZIP III transcription factorHD-ZIP III transcription factor

6 CCAAT-binding transcription factor8 CCAAT-binding transcription factor3 CCAAT-binding transcription factor3 CCAAT-binding transcription factor9 CCAAT-binding transcription factor7 CCAAT-binding transcription factor4 CCAAT-binding transcription factor7 CCAAT-binding transcription factor

CCAAT-binding transcription factor5 CCAAT-binding transcription factor

Scarecrow gene regulator7 Scarecrow gene regulator

AP2 domain containing protein7 AP2 domain containing protein7 AP2 domain containing protein

AP2 domain containing proteinTCP family transcription factor

2 TAS38 TIR1-like protein3 TIR1-like protein3 TIR1-like protein4 F-box protein1 Photosystem I reaction center subunit

Growth-regulating factor4 Growth-regulating factor8 MADS-box transcription factor3 Monodehydroascorbate reductase8 Early light-inducible protein HV587 Unknown protein

Auxin response factorAuxin response factor

22 Y.-F. Li et al. / Plant Science 203–204 (2013) 17–24

F re prei as sho

wwlstfbm

u[srAbadtiS(Mwmgdot(

ig. 4. Examples of confirmed wheat miRNA targets using degradome sequencing andicated transcripts is shown. Alignment between miRNA and target transcripts w

heat-specific miRNAs such as miR1132, miR1135 and miR1136ere identified (Table 4). MicroRNA395 is known to target a

ow-affinity sulfate transporter and ATP sulfurylases, but in thistudy we found, PSI reaction center subunit, as a non-conservedarget. Some other worth pointing targets that have been identifiedrom the degradome analysis includes monodehydrate ascor-ate reducatse for miR1132 and early light-inducible protein foriR1135 (Table 4).Abundance of the signatures for each target mRNA was plotted

sing absolute read number along the target transcripts (T-plot)37]. Such plots for some of the conserved miRNA targets werehown in Fig. 4. The most abundantly cleaved transcripts are auxinesponse factors (ARFs), nuclear factor YA subunits (NFY A subunits),petala-2 (AP2) and transport inhibitor-1 (TIR1), which are targetedy miR160, miR169, miR172 and miR393, respectively (Table 3nd Fig. 4). miR444 is a monocot specific miRNA [14,39], and wasetected in wheat small RNA library (Table 1). miR444 targetsranscripts encoding MADS box transcription factors that control var-ous aspects of development and reproductive processes [14,39].ignatures corresponding to the two cleavage sites were foundSupplemental Fig. 2) on a wheat transcript (TA110159) encodingADS box transcription factor. The two cleavages on the transcriptere due to activity of two miRNA variants miR444.b.2/c.2/e andiR444.b.1/c.1 that share complementary region on the mRNA tar-

et. These results are similar to what has been reported in rice

egradome analysis [20]. Similarly, miR171 and miR171b haveverlapping target sites on TA85739 and CK210886 (Scarecrow likeranscription factor) and the cleavages at both sites were detecteddata not shown).

sented as target plots (T-plots). Signature abundance throughout the length of thewn below the corresponding T-plot.

Supplementary material related to this article found, in theonline version, at http://dx.doi.org/10.1016/j.plantsci.2012.12.014.

Independently, a recent study also applied degradome analysisto wheat to identify miRNA targets [6]. However, only 29 targets(26 were miRNA targets and the remaining 3 were Tas3-siRNA tar-gets) were found. Our degradome analysis has identified 53 genesas small RNA targets compared to 29 targets in their study. Inaddition to what has been reported by Tang et al. [6], targets formiR164, miR319 and miR444 were validated in this study (Table 4).Additionally, we found more number of targets for several miRNAfamilies such as miR156, miR160, miR169, miR171, miR172 andmiR393 than the study by Tang et al. [6], which could be attributedto the different tissue sources (7-day-old seedlings in this study vsspikes in Tang et al. [6]) used for these two different studies. Inter-estingly several genes such as AP2 and MADS box factors that areknown to function preferentially in specific developmental path-ways (flowering, for example) have been found to be regulated bymiRNAs in seedlings suggesting additional roles for these genes inseedling growth and development.

3.4. Signatures associated with TAS3 precursors and Tas3-siRNAtargets

trans-acting siRNAs (tasiRNAs), like miRNAs silence mRNAtargets in plants. Tas3-siRNA is the only evolutionarily conserved

tasiRNA from moss to higher plants [40,41]. The TAS3 transcriptsare characterized by two conserved features: (1) possessing twomiR390 complementary sites (5′ site with central mismatchesis resistant to miR390-guided cleavage and 3′ complementary

Y.-F. Li et al. / Plant Science 203–204 (2013) 17–24 23

F b) andt tes.

sTcwOcCiaftwhttdfidtgtTToTo[m

ig. 5. Two major cleavages on miR390 target transcripts in wheat (a), Arabidopsis (he cleavages locating 33 nucleotides upstream of the 3′ miR390 complementary si

ite that is subjected to miR390-guided cleavage), and (2) twoas3-siRNA sequences in tandem in between these two miR390omplementary sites [40,41]. miR390 guided cleavage at the 3′ site,ill set the phasing register for accurate production of Tas3-siRNA.n the basis of conservation of these two features, four TAS3andidates (TAS3a,b,c and d are represented by the CJ711765,N010916, CK216774 and CK156495 ESTs, respectively) were

dentified by searching the available wheat ESTs. TAS3 transcriptsre subjected to cleavage at 3′ miR390 targeting site, and suchragments can also be captured in degradome libraries. Only TAS3aranscript was cleaved at the 3′ miR390 complementary site inheat degradome library (Fig. 5a). In addition, TAS3 precursoras also been found to be cleaved precisely 33-nt upstream ofhe 3′ miR390 complementary site in Arabidopsis and Medicagoruncatula [40,16]. Analysis of publicly available Arabidopsisegradome data as well as our rice degradome library [20] con-rmed this cleavage pattern (Fig. 5b and c). Analysis of wheategradome revealed a similarly cleaved peak on the wheat TAS3ranscript (Fig. 5a). This cleavage was guided by a siRNA (–D2)enerated from the TAS3 precursor as shown in Arabidopsis and M.runcatula [40,16]. Cleavage at the 3′ target site of miR390 on theAS3 precursor is crucial to generate 21-nt phases and release ofas3-siRNAs [40,41]. By contrast cleavage exactly 33-nt upstreamf the 3′ miR390 complementary site abolishes the generation of

as3-siRNA processing by destroying the phasing such that insteadf generating active Tas3-siRNAs, the TAS3 precursor is degraded40]. The consistent cleavage pattern of 33-nt upstream to the

iR390 complementary site on TAS3 precursor in 4 different plant

, rice (c). Same cleavage pattern was found in 4 different plants (d); arrow indicated

species (Fig. 5d) suggests it is a conserved mechanism to fine-tuneTas3-siRNA abundance. Conserved Tas3-siRNAs are targeting ARF3and ARF4 [40]. Cleaved signatures guided by Tas3-siRNA werefound for two ESTs encoding ARF homologues in wheat degradomelibrary (Table 3, data not shown). In summary, by analyzing wheatsmall RNA and degradome libraries, we have characterized novelsmall RNAs and confirmed 53 genes (24 more than previouslyreported) as targets for miRNAs and Tas3-siRNAs in wheat.

Acknowledgements

This research was supported by the OCAST grant PSB07-022 andOklahoma Agricultural Experiment Station to RS and by a start-upgrant of Fudan University to YZ.

References

[1] B.S. Gill, R. Appels, A.M. Botha-Oberholster, C.R. Buell, J.L. Bennetzen, B. Chal-houb, F. Chumley, J. Dvorak, M. Iwanaga, B. Keller, W. Li, W.R. McCombie, Y.Ogihara, F. Quetier, T. Sasaki, A workshop report on wheat genome sequencing:International Genome Research on Wheat Consortium, Genetics 168 (2004)1087–1096.

[2] Y. Yao, Q. Sun, Exploration of small non coding RNAs in wheat (Triticum aestivumL.), Plant Mol. Biol. 80 (2012) 67–73.

[3] Y. Yao, G. Guo, Z. Ni, R. Sunkar, J. Du, J.K. Zhu, Q. Sun, Cloning and characteri-zation of microRNAs from wheat (Triticum aestivum L.), Genome Biol. 8 (2007)

R96.

[4] B. Wei, T. Cai, R. Zhang, A. Li, N. Huo, S. Li, Y.Q. Gu, J. Vogel, J. Jia, Y. Qi, L. Mao,Novel microRNAs uncovered by deep sequencing of small RNA transcriptomesin bread wheat (Triticum aestivum L.) and Brachypodium distachyon (L.) Beauv.,Funct. Integr. Genomics 9 (2009) 499–511.

2 ence 2

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

4 Y.-F. Li et al. / Plant Sci

[5] M. Xin, Y. Wang, Y. Yao, C. Xie, H. Peng, Z. Ni, Q. Sun, Diverse set of microRNAsare responsive to powdery mildew infection and heat stress in wheat (Triticumaestivum L.), BMC Plant Biol. 10 (2010) 123.

[6] Z. Tang, L. Zhang, C. Xu, S. Yuan, F. Zhang, Y. Zheng, C. Zhao, Uncovering smallRNA-mediated responses to cold stress in a wheat thermosensitive genic male-sterile line by deep sequencing, Plant Physiol. 159 (2012) 721–738.

[7] O.P. Gupta, V. Permar, V. Koundal, U.D. Singh, S. Praveen, MicroRNA regulateddefense responses in Triticum aestivum L. during Puccinia graminis f.sp. triticiinfection, Mol. Biol. Rep. 39 (2012) 817–824.

[8] A. Dryanova, A. Zakharov, P.J. Gulick, Data mining for miRNAs and their targetsin the Triticeae, Genome 51 (2008) 433–443.

[9] W. Jin, N. Li, B. Zhang, F. Wu, W. Li, A. Guo, Z. Deng, Identification and verificationof microRNA in wheat (Triticum aestivum), J. Plant Res. 121 (2008) 351–355.

10] R. Sunkar, G. Jagadeeswaran, In silico identification of conserved microRNAs inlarge number of diverse plant species, BMC Plant Biol. 8 (2008) 37.

11] M. Kantar, B.A. Akpinar, M. Valarik, S.J. Lucas, J. Dolezel, P. Hernandez, H. Budak,Subgenomic analysis of microRNAs in polyploid wheat, Funct. Integr. Genomics12 (2012) 465–479.

12] S.J. Lucas, H. Budak, Sorting the wheat from the chaff: identifying miRNAs ingenomic survey sequences of Triticum aestivum chromosome 1AL, PLoS ONE 7(2012) e40859.

13] M. Kantar, S.J. Lucas, H. Budak, miRNA expression patterns of Triticum dicoc-coides in response to shock drought stress, Planta 233 (2011) 471–484.

14] R. Sunkar, X. Zhou, Y. Zheng, W. Zhang, J.K. Zhu, Identification of novel andcandidate miRNAs in rice by high throughput sequencing, BMC Plant Biol. 8(2008) 25.

15] G. Jagadeeswaran, R. Sunkar, Cloning of small RNAs for the discovery of novelmicroRNAs in plants, Methods Mol. Biol. 956 (2013) 109–118.

16] G. Jagadeeswaran, Y. Zheng, Y.F. Li, L.I. Shukla, J. Matts, P. Hoyt, S.L. Macmil,G.B. Wiley, B.A. Roe, W. Zhang, R. Sunkar, Cloning and characterization of smallRNAs from Medicago truncatula reveals four novel legume-specific microRNAfamilies, New Phytol. 184 (2009) 85–98.

17] J. Matts, G. Jagadeeswaran, B.A. Roe, R. Sunkar, Identification of microRNAs andtheir targets in switchgrass, a model biofuel plant species, J. Plant Physiol. 167(2010) 896–904.

18] L. Zhang, Y. Zheng, G. Jagadeeswaran, Y. Li, K. Gowdu, R. Sunkar, Identifica-tion and temporal expression analysis of conserved and novel microRNAs inSorghum, Genomics 98 (2011) 460–468.

19] Y.F. Li, R. Sunkar, Global identification of small RNA targets in plants by sequenc-ing sliced ends of messenger RNAs, Methods Mol. Biol. 956 (2013) 119–129.

20] Y.F. Li, Y. Zheng, C. Addo-Quaye, L. Zhang, A. Saini, G. Jagadeeswaran, M.J. Axtell,W. Zhang, R. Sunkar, Transcriptome-wide identification of microRNA targets inrice, Plant J. 62 (2010) 742–759.

21] Y. Zheng, Y.F. Li, R. Sunkar, W. Zhang, SeqTar: an effective method for identifyingmicroRNA guided cleavage sites from degradome of polyadenylated transcriptsin plants, Nucleic Acids Res. 40 (2012) e28.

22] H. Fujii, T.J. Chiou, S.I. Lin, K. Aung, J.K. Zhu, A miRNA involved in phosphate-starvation response in Arabidopsis, Curr. Biol. 15 (2005) 2038–2043.

23] S. Lu, Y.H. Sun, V.L. Chiang, Stress-responsive microRNAs in Populus, Plant J. 55(2008) 131–151.

24] M. Pang, A.W. Woodward, V. Agarwal, X. Guan, M. Ha, V. Ramachandran, X.Chen, B.A. Triplett, D.M. Stelly, Z.J. Chen, Genome-wide analysis reveals rapidand dynamic changes in miRNA and siRNA sequence and expression during

[

[

03–204 (2013) 17–24

ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L.),Genome Biol. 10 (2009) R122.

25] R. Rajagopalan, H. Vaucheret, J. Trejo, D.P. Bartel, A diverse and evolution-arily fluid set of microRNAs in Arabidopsis thaliana, Genes Dev. 20 (2006)3407–3425.

26] Q. Xu, Y. Liu, A. Zhu, X. Wu, J. Ye, K. Yu, W. Guo, X. Deng, Discovery and compar-ative profiling of microRNAs in a sweet orange red-flesh mutant and its wildtype, BMC Genomics 11 (2010) 246.

27] A.S. Zanca, R. Vicentini, F.A. Ortiz-Morea, L.E. Del Bem, M.J. da Silva, M. Vincentz,F.T. Nogueira, Identification and expression analysis of microRNAs and targetsin the biofuel crop sugarcane, BMC Plant Biol. 10 (2010) 260.

28] J.Y. Zhang, Y.Y. Xu, Q. Huan, K. Chong, Deep sequencing of Brachypodium smallRNAs at the global genome level identifies microRNAs involved in cold stressresponse, BMC Genomics (2009) 10.

29] L. Zhang, J.M. Chia, S. Kumari, J.C. Stein, Z. Liu, A. Narechania, C.A. Maher, K.Guill, M.D. McMullen, D. Ware, A genome-wide characterization of microRNAgenes in maize, PLoS Genet. 5 (2009) e1000716.

30] I. Fattash, B. Voss, R. Reski, W.R. Hess, W. Frank, Evidence for the rapid expansionof microRNA-mediated regulation in early land plant evolution, BMC Plant Biol.7 (2007) 13.

31] T. Unver, H. Budak, Conserved microRNAs and their targets in model grassspecies Brachypodium distachyon, Planta 230 (2009) 659–669.

32] R.D. Morin, G. Aksay, E. Dolgosheina, H.A. Ebhardt, V. Magrini, E.R. Mardis,S.C. Sahinalp, P.J. Unrau, Comparative analysis of the small RNA trans-criptomes of Pinus contorta and Oryza sativa, Genome Res. 18 (2008)571–584.

33] C. Cole, A. Sobala, C. Lu, S.R. Thatcher, A. Bowman, J.W. Brown, P.J. Green, G.J.Barton, G. Hutvagner, Filtering of deep sequencing data reveals the existenceof abundant Dicer-dependent small RNAs derived from tRNAs, RNA 15 (2009)2147–2160.

34] Y.S. Lee, Y. Shibata, A. Malhotra, A. Dutta, A novel class of small RNAs: tRNA-derived RNA fragments (tRFs), Genes Dev. 23 (2009) 2639–2649.

35] D. Haussecker, Y. Huang, A. Lau, P. Parameswaran, A.Z. Fire, M.A. Kay, HumantRNA-derived small RNAs in the global regulation of RNA silencing, RNA 16(2010) 673–695.

36] L.C. Hsieh, S.I. Lin, H.F. Kuo, T.J. Chiou, Abundance of tRNA-derived small RNAsin phosphate-starved Arabidopsis roots, Plant Signal. Behav. 5 (2010).

37] M.A. German, M. Pillay, D.H. Jeong, A. Hetawal, S. Luo, P. Janardhanan, V. Kannan,L.A. Rymarquis, K. Nobuta, R. German, E. De Paoli, C. Lu, G. Schroth, B.C. Mey-ers, P.J. Green, Global identification of microRNA-target RNA pairs by parallelanalysis of RNA ends, Nat. Biotechnol. 26 (2008) 941–946.

38] C. Addo-Quaye, T.W. Eshoo, D.P. Bartel, M.J. Axtell, Endogenous siRNA andmiRNA targets identified by sequencing of the Arabidopsis degradome, Curr.Biol. 18 (2008) 758–762.

39] C. Lu, D.H. Jeong, K. Kulkarni, M. Pillay, K. Nobuta, R. German, S.R. Thatcher, C.Maher, L. Zhang, D. Ware, B. Liu, X. Cao, B.C. Meyers, P.J. Green, Genome-wideanalysis for discovery of rice microRNAs reveals natural antisense microRNAs(nat-miRNAs), Proc. Natl. Acad. Sci. U.S.A. 105 (2008) 4951–4956.

40] E. Allen, Z. Xie, A.M. Gustafson, J.C. Carrington, microRNA-directed phas-ing during trans-acting siRNA biogenesis in plants, Cell 121 (2005)207–221.

41] M.J. Axtell, C. Jan, R. Rajagopalan, D.P. Bartel, A two-hit trigger for siRNA bio-genesis in plants, Cell 127 (2006) 565–577.