Protein Expression and Purification 70 (2010) 60–67

Contents lists available at ScienceDirect

Protein Expression and Purification

journal homepage: www.elsevier .com/ locate /yprep

Biochemical characterization and in vitro digestibility assay of Eupenicilliumparvum (BCC17694) phytase expressed in Pichia pastoris

Anusorn Fugthong a, Katewadee Boonyapakron a,b, Warasirin Sornlek b, Sutipa Tanapongpipat b,Lily Eurwilaichitr b, Kusol Pootanakit a,*

a Institute of Molecular Biosciences, Mahidol University, Salaya Campus, Nakhon Pathom 73170, Thailandb Bioresources Technology Unit, National Center for Genetic Engineering and Biotechnology, Thailand Science Park, 113 Paholyothin Road, Klong 1, Klong Luang,Pathumthani 12120, Thailand

a r t i c l e i n f o a b s t r a c t

Article history:Received 30 July 2009and in revised form 1 October 2009Available online 8 October 2009

Keywords:Eupenicillium parvumPhytasePhytatePichia pastoris expression

1046-5928/$ - see front matter � 2009 Elsevier Inc. Adoi:10.1016/j.pep.2009.10.001

* Corresponding author. Fax: +662 441 9906.E-mail address: mbkpn@mahidol.ac.th (K. Pootana

1 Abbreviations used: HAP, histidine acid phosphcollection; AP, adaptor primer; SOE, splice overlap exphosphate.

A mature phytase cDNA, encoding 441 amino acids, from Eupenicillium parvum (BCC17694) was clonedinto a Pichia pastoris expression vector, pPICZaA, and was successfully expressed as active extracellularglycosylated protein. The recombinant phytase contained the active site RHGXRXP and HD sequencemotifs, a large a/b domain and a small a-domain that are typical of histidine acid phosphatase. Glycosyl-ation was found to be important for enzyme activity which is most active at 50 �C and pH 5.5. The recom-binant phytase displayed broad substrate specificity toward p-nitrophenyl phosphate, sodium-, calcium-,and potassium-phytate. The enzyme lost its activity after incubating at 50 �C for 5 min and is 50% inhib-ited by 5 mM Cu2+. However, the enzyme exhibits broad pH stability from 2.5 to 8.0 and is resistant topepsin. In vitro digestibility test suggested that BCC17694 phytase is at least as effective as anotherrecombinant phytase (r-A170) which is comparable to Natuphos, a commercial phytase, in releasingphosphate from corn-based animal feed, suggesting that BCC17694 phytase is suitable for use as phytasesupplement in the animal diet.

� 2009 Elsevier Inc. All rights reserved.

Introduction

Phytate (myo-inositol hexakis phosphate) is the primary storageform of phosphorus and inositol in plant seeds and grains whichserve as a major source of nutrients for the animals [1]. However,the bound phosphorus in phytate is poorly utilized in digestivetract of monogastric animals such as pig and chicken. The expen-sive inorganic phosphorus, therefore, is supplemented in animalfeeds. Meanwhile, the excess inorganic phosphorus and unutilizedphytate are excreted causing environmental pollution [2]. Further-more, phytate in animal feeds can interfere with the absorption ofdivalent cations, carbohydrates and proteins in small intestine byforming complexes with these nutrients [3]. These problems canbe solved if animal feeds are supplemented with phytase [4].

Phytase (myo-inositol hexakisphosphate phosphohydrolase)catalyzes the removal of phosphate group from phytate to givemyo-insitol derivatives and inorganic phosphate. Based on bio-chemical and catalytic properties, phytases can be divided intotwo major classes: histidine acid phosphatase (HAP; EC 3.1.3.2)1

ll rights reserved.

kit).atase; BCC, BIOTEC culturetension; pNPP, p-nitrophenyl

and alkaline phosphatase [4]. Phytases are found naturally inplants and microorganisms, particularly fungi. At present, all com-mercial feed additive phytases are produced by recombinantstrains of filamentous fungi such as Natuphos (BASF) from Asper-gillus niger, Finase (AB Enzymes) from A. awamori and Bio-FeedPhytase (Novozymes) from Peniophora lycii [5].

Current estimate of global fungal biodiversity is about 1.5 mil-lion species [6]. Since Thailand is in the tropics, she is possiblybeing home to �70,000–150,000 fungi species. Previously, throughour initial screening of �150 fungi, several fungal strains demon-strated active phytase at wide pH ranges. One of these is Eupenicil-lium parvum (BCC17694), which was shown to produce phytasethat is active at both the pH 2 and 5.5, which are close to the pHof animal gut (pH 2.7) and small intestine (pH 5.9), respectively[7]. The enzyme also exhibited high level of phytase activity at40 �C (approximately the temperature of animal stomach, cropand gizzard). This suggested the possibility of using our locally iso-lated phytase as a potential enzyme in animal feed industry. In thisstudy, this novel phytase from E. parvum (BCC17694) is cloned,fused in-frame with a-factor within pPICZaA vector, an Escherichiacoli/ Pichia pastoris shuttle vector, and expressed via methanol-inducible promoter in P. pastoris, a methylotrophic yeast [8]. Final-ly, the recombinant phytase enzyme is purified, biochemicallycharacterized, and preliminary tested for its suitability for animalfeed application.

A. Fugthong et al. / Protein Expression and Purification 70 (2010) 60–67 61

Materials and methods

Strains, plasmids, culturing conditions, and primers

Eupenicillium parvum (BCC17694) was obtained from the BIO-TEC Culture Collection (BCC), Thailand. It was isolated from soilin the central region of Thailand. The fungus was inoculated in2% soluble starch medium (2% soluble starch, 3% glucose, 0.86%NaNO3, 0.05% KCl, 0.05% MgSO4, 0.01% FeSO4) and grown at 25 �Cwith continuous shaking at 250 rpm. After 7 days, the myceliawere separated from the media by filtration through double-lay-ered cheese cloth. E. coli, DH5a, was used as host for plasmid prop-agation and P. pastoris KM71 was used as host for phytaseexpression. All oligonucleotides (Table 1) were purchased fromPROLIGO, Singapore.

Fungal genomic DNA extraction and touchdown nested-PCR

BCC17694 genomic DNA was extracted via SDS-based DNAextraction method [9] and used as template in touchdown(�0.5 �C/cycle) nested-PCR with degenerate primers (PhyI andPhyA380 for first PCR; PhyA120 and PhyA370 for the secondPCR; Table 1) using 1 U DyNAzymeII (Finnzyme, Finland). Theamplicon of the expected size was gel-purified using QIAquickgel extraction kit (Qiagen, Germany), cloned into pGEM-T Easy vec-tor (Promega, USA) and sequenced (Macrogen Inc., Korea).

Total RNA isolation, 30RACE, and Genome Walking

BCC17694 total RNA was isolated from mycelia using TRI Re-agent (Molecular Research Center, USA). For 30RACE, cDNAs weregenerated from 2 lg of total RNA using oligo(dT) adaptor (PM1)and SuperScript III reverse transcriptase (Invitrogen, USA). PCRwas performed using a gene-specific primer (30RacePhy) andPM2, an adaptor primer. See table 1 for details of the primersemployed.

Since 50RACE failed, the partial 50 end cDNA of BCC17694 phy-tase was obtained by RT-PCR. Briefly, first-strand cDNAs were gen-erated using partial-heat denaturation reverse transcription

Table 1Oligonucleotides used in this study.

Primer names Sequence (50 ? 30)

PhyI MGICAYGGIGMNMGITAYCPhyA120 GCITTYYTIAARWSITAYAAYTAa

PhyA370 RTCRTGISWRAARTCIRCRTAa

PhyA380 CCRTTRTANARICCIARNGCa

PM1 CCGGAATTCAAGCTTCTAGAGGATCCTTTTTTTTTTTTTTTTPM2 CCGGAATTCAAGCTTCTAGAGGATCC30RacePhy CATCGCCCGTTTAACCCACTC50RacePhy2Nested CTTGGGTGTTGGTTGGTGGC50RacePhy3 GAACGCAGCATCTCCCTTGAAATC50RacePhy4Nested CGGCATACCTCACGCTCTTCAdaptor Primer 1

(AP1)GTAATACGACTCACTATAGGGC

Adaptor Primer 2(AP2)

ACTATAGGGCACGCGTGGT

ExPhy-F1 CCGCTCGAGAAAAGAATGCCCAGATACGGAAGExPhy-F2 CCGCTCGAGAAAAGAATGGGTGCCGTGATCCExPhy-R1 ATGCGGCCGCTTAAGAATAGCAACTCGCCCMuXhoI-Phy-F TGCCCAAAACTTGAGAACGACTCGCTCAGCMuXhoI-Phy-R TGAGCGAGTCGTTCTCAAGTTTTGGGCAGGExPhy-R2 CCGCTCTAGATTAAGAATAGCAATCGCCCExPhy-RPRA CCGCTCGAGAAAAGACGTCCACGAGCCTGC

a For degenerate primer, the following abbreviations are used, (N = A, T, G, C;M = A, C; K = G, T; Y = C, T; R = A, G; W = A, T; S = C, G; H = A, C, T; D = A, G, T; V = A,C, G; I = Inosine).

method [10] using 50RacePhy2Nested, a gene-specific primer andSuperscript III reverse transcriptase. PCR was performed using adegenerate primer (PhyI) and again 50RacePhy2Nested primer.

The remaining 50end was obtained by using Genome Walker Uni-versal Kit (Clontech, USA). Briefly, BCC17694 genomic DNA was di-gested with PvuII and purified using Wizard DNA clean-up system(Promega, USA). Then, a GenomeWalker adaptor was ligated to thedigested genomic DNA. The DNA was then used as template in anested-PCR. The first PCR was performed using 0.2 lM of adaptorprimer (AP1) and a gene-specific primer (50RacePhy3), 1 ll PvuII-DNA library, 1.5 mM MgCl2, 0.2 mM each of dNTPs and 2 U DyNA-zyme II DNA polymerase. The second PCR condition was as the firstexcept that it contained 0.2 lM of nested adaptor primer (AP2)and nested gene-specific primer (50RacePhy4Nested), 1 ll of 1:50dilution of the first PCR product as template.

Cloning and expression of BCC17694 phytase in P. pastoris

Gene-specific primers were designed to amplify the full-lengthphytase cDNA. First-strand cDNAs were reverse transcribed usingSuperscript III and oligo(dT) adaptor (PM1). Then, PCR was per-formed using ExPhy-F2 and ExPhy-R1 primers. The phytase genewas subcloned into pPICZaA, using the XhoI and XbaI sites. Sincethere is a XhoI site in the middle of the full-length gene, a silentmutation was generated using splice overlap extension (SOE) PCRtechnique [11]; at the same time, the codon usage of P. pastoriswas also improved. The upstream part of XhoI site was changedby using ExPhy-F2 and MuXhoI-Phy-R primers while the down-stream part of XhoI site was changed using MuXhoI-Phy-F and Ex-phy-R2 primers. The PCR fragments of both reactions were gel-purified and used as template in SOE-PCR.

The mature BCC17694 phytase cDNA was amplified using Ex-Phy-RPRA and ExPhy-R2 primers using the silent mutated full-length phytase gene as template. The PCR product was gel-purifiedand double-digested with XhoI and XbaI (Promega, USA) before itwas ligated in-frame with the a-factor secretion signal present inpPICZaA. Next, the recombinant plasmids were linearized withBglII (Promega, USA) and electroporated into P. pastoris.

For small-scale expression, five integrants were randomly cho-sen and were grown in 5 ml BMGY media at 30 �C, 250 rpm, untilOD600 reached 5–6. To induce expression, cells were pelleted andresuspended in 1 ml BMMY containing 2% (v/v) methanol. Absolutemethanol was added every 24 h to maintain induction. The culturewas collected everyday for 10 days. The secreted proteins wereanalyzed by using SDS–PAGE [12] and also tested for phytase activ-ity. Scaled-up expression was carried out in 600 ml BMMY underthe same conditions for 7 days.

Purification of recombinant BCC17694 phytase

The culture media containing secreted phytase was centrifugedtwice: 4000g, 5 min and then 10,000g for 20 min at 4 �C. The se-creted protein was concentrated by using Amicon Ultra-15 30 K(Millipore, USA). The concentrated proteins were changed into anew buffer (20 mM sodium acetate, pH 4.5) using HiTrap desaltingcolumn (Amersham Bioscience, USA). Next, the proteins were puri-fied by using HiTrap SP XL, cation-exchange chromatography(Amersham Bioscience, USA), equilibrated with 20 mM sodiumacetate, pH 4.5. Fractions containing phytase activity were pooledand further concentrated by Amicon Ultra-15 10K before furtherpurified by gel filtration (Superdex 200, Amersham Bioscience,USA), equilibrated with 20 mM sodium acetate buffer, pH 4.5, con-taining 150 mM NaCl at room temperature and ran on AKTA Puri-fier (Pharmacia, USA). The enzyme was eluted with the samebuffer. The active fractions of phytase activity were pooled andstored at 4 �C for further analysis.

62 A. Fugthong et al. / Protein Expression and Purification 70 (2010) 60–67

Characterization of BCC17694 phytase from P. pastoris

Phytase activity was quantitated following the method as de-scribed [13]. One unit of phytase activity is defined as the amountof enzyme that liberates 1 lmol of inorganic phosphate per min-ute. The optimal temperature was determined by incubating it in0.5% sodium phytate in 100 mM sodium acetate, pH 5.5 for10 min at varying temperatures (30–70 �C). For optimal pH, thereaction was performed under optimal temperature at variouspHs: glycine–HCl (pH 2.5–4.0), sodium acetate (pH 5.0–6.0) andMOPS (pH 6.5–7.0). Temperature stability profile was determinedby incubating the enzyme at 30, 40 and 50 �C for 5, 10, 20 and30 min followed by determination of remaining phytase activityat 50 �C, pH 5.5 for 10 min. pH stability was performed by incubat-ing the enzyme at 25 �C for 3 h in various pH buffer: glycine–HCl(pH 2.0–4.0), sodium acetate (pH 5.0–6.0), MOPS (pH 7.0), Tris–HCl (pH 8.0–9.0) and glycine–NaOH (pH 10.0) and then determinethe remaining activity at 50 �C, pH 5.5 for 10 min. The relativeactivity was calculated by comparing the remaining activity aftereach treatment to that of the untreated enzyme. Protein concentra-tions were determined using Bio-Rad protein assay kit.

The effects of various metal ions [(5 mM) CaCl2, CoCl2, CuCl2,KCl, LiCl, MgCl2, MnCl2, NaCl and NiCl2], sulfhydryl compounds[(1.0, 5.0 mM) mercaptoethanol and DTT)], chelating agents [(1.0,5.0 mM) EDTA and PMSF] and detergents [(0.5%) Tween 20 andSDS] on the enzyme activity were performed by incorporatingthese into the reaction mixtures. Phytase activity was determinedat 50 �C, pH 5.5 for 10 min.

Protease resistance was tested by incubating 10 lg of BCC17694phytase with pepsin (80 mM glycine–HCl, pH2.5) or trypsin(80 mM NH4H2CO4) at protease/phytase (w/w) ratios of 1/500,1/200, 1/100 and 1/50, for 2 h at 37 �C. The digested protein mixtureswere analyzed by SDS–PAGE and tested for the remaining activity asdescribed above. In vitro digestion assay simulating the animaldigestive conditions were performed following the method of Zylaet al. [14], with some modifications as described [15].

The hydrolysis kinetics of recombinant phytase were performedagainst various substrates (p-nitrophenyl phosphate, sodium-, cal-cium-, and potassium-phytate) (Sigma, USA) at 50 �C in 100 mMsodium acetate, pH 5.5, for 10 min. Activity rates were measuredat six different substrate concentrations in three replicates. Theapparent kinetic constants Km, Vmax and kcat were calculated usingthe Michaelis–Menten equation for enzyme kinetics via Prism5program (Hearne Scientific Software, Australia).

Glycosylation analysis

Deglycosylation was performed by incubating 2 lg of recombi-nant phytase with 150 U of N-glycosidase F (PNGase F) or endogly-cosidase H (Endo-H) (New England Biolab, USA) at 37 �C for 24 hwithout the denaturation step as recommended by the supplier.The protein was then analyzed by SDS–PAGE and also tested forthe remaining activity at 50 �C, pH 5.5 for 10 min. A mock-treatedsample (the enzyme was incubated with buffer but without addi-tion of deglycosylation enzymes for the same period of time andtemperature as the digested sample) was also included. The re-combinant phytase was also stained for glycoprotein using Gel-Code Glycosylation staining kit (Pierce, USA).

Results

Molecular cloning of the full-length BCC17694 phytase gene

A 630 bp fragment of BCC17694 phytase gene was initially ob-tained using four degenerate primers (PhyI, PhyA120, PhyA370 and

PhyA380), designed based on the conserved sequence of phytasegenes from the genus Aspergillus, in a nested-PCR reaction (datanot shown). Sequence analysis showed 64% amino acid identityto phytases of Penicillium sp.Q7 and Penicillium oxalicum PJ3. Next,30 RACE was performed using a gene-specific primer (30RacePhy)yielding a 680 bp PCR product which showed 77% deduced aminoacid identity to Penicillium chrysogenum Wisconsin 54–1255 phy-tase phyA (data not shown); a stop codon, TAA, was also identified.Since 50RACE failed, the further upstream sequence at 50end wasobtained by RT-PCR using partial-heat denaturation method [10],resulting in a 350 bp PCR product (data not shown). The remainingsequence at 50end of approximately 300 bp was obtained by Gen-ome Walking method (data not shown). These various fragmentswere assembled in silico using Vector NTI suite, yielding a completephytase gene of 1467 bp, encoding 460 amino acids, which showedhighest identity (62%) to P. oxalicum PJ3 phytase [16] (data notshown), and is interrupted by at least a short intron of 84 bp nearthe 50end of the gene (Fig. 1).

Next, to verify that we indeed have the authentic BCC17694phytase gene, a full-length cDNA, containing 1383 nucleotides,was amplified using two gene-specific primers (ExPhy-F2 andExPhy-R1); blastn analysis showed 69% and 68% identity to a phy-tase of P. oxalicum and of A. niger, respectively. Its deduced aminoacid sequence was aligned against other fungal phytases, as inother HAP phytases, two conserved active sites, a hepta-peptidemotif RHGXRXP and a catalytically active dipeptide HD were iden-tified (Fig. 1). The 3D structure of BCC17694 phytase was predictedusing the SWISS-MODEL program. The results, using A. fumingatusphytase (PDB entry code 1QWO) as template [17], revealed onesmall a-domain and one large a/b domain (data not shown).

Expression and purification BCC17694 phytase in P. pastoris

Based on amino acid sequence alignment against other fungalphytases, a putative start position of BCC17694 mature phytaseis identified (arginine 20, Fig 1). The mature phytase cDNA of1326 nucleotides was cloned into a P. pastoris expression vectorpPICZaA and verified for the correct sequence before being electro-porated into P. pastoris KM71. Several P. pastoris integrants wererandomly chosen for small-scale expression. The optimal inductiontime was also investigated; the result showed that the highest spe-cific activity of phytase was observed at day 7 of induction (datanot shown).

The integrant which exhibited highest phytase activity was se-lected for large scale expression in a total volume of 600 ml BMMYculture under the optimal condition of 2% methanol for 7 days.After 7 days, its expression level was 2.7 U/ml. The secreted phy-tase was purified in three steps resulting in a yield of 28.3% anda purification of 6.9-fold (Table 2); its expression level was21.8 U/ml after the final gel filtration step.

Characterization of recombinant BCC17694 phytase

To determine the optimal temperature of the recombinant en-zyme, phytase activity was measured at various temperatures from30 to 70 �C. The results revealed that the purified phytase has anoptimal temperature at 50 �C (Fig. 2A). For optimal pH, the enzymewas incubated at 50 �C for 10 min at different pHs from 2.5–7.0.The enzyme showed an optimal pH of 5.5 and was inactive belowpH 2.5 or above pH 7.0 (Fig. 2B).

The thermostability of the recombinant phytase was investi-gated by incubating the enzyme at 30, 40 and 50 �C for 5, 10, 20and 30 min. The result showed that more than 60% of its activitystill remained after incubating at 40 �C for 10 min; this activitywas almost completely lost when incubating at 50 �C for 5 min(Fig. 3A). pH stability was performed by incubating the enzyme

Fig. 1. The complete phytase-encoding gene of BCC17694. The deduced amino acid sequence is shown as a single letter above the respective codon. The predicted intron isindicated by the underlined sequence (the donor and acceptor sites are in accordance with the GT-AG rule). Arrow indicates a possible cleavage site (between amino acidsarginines 19 and 20) as the putative start position as aligned against other phytases. Bold amino acid sequences in the boxes represent the conserved active site hepta-peptidemotif RHGXRXP and the catalytically active dipeptide HD. Highlighted amino acid sequences represent the potential N-linked glycosylation sites (N-X-S/T). Potential O-GlcNAc-linked glycosylation sites are indicated in the triangle. Star represents a stop codon.

Table 2Purification of BCC17694 phytase from P. pastoris.

Purification step Protein concentration(mg/ml)

Total volume (ml) Total protein (mg) Specific activity(U/mg)

Total activity (U) Yield (%) Purification fold

Crude protein 0.369 571 210.7 7.32 1541.7 100 1Ultrafiltration

(Amicon15–30 k)0.899 118 106 9.96 1056.1 68.5 1.36

Cation-exchange(HiTrap SP XL)

0.395 40 15.8 37.7 595.6 38.6 5.15

Gel filtration(Superdex 200)

0.432 20 8.64 50.46 436 28.3 6.9

Phytase activity was performed using 0.84% sodium-phytate in 0.1 M sodium acetate buffer pH 5.5 at 37 �C for 1 h. One unit of phytase activity was defined as the amount ofthe enzyme that liberates 1 lg of inorganic phosphate per minute under the assay condition. Protein concentrations were determined based on the Bradford assay usingbovine serum albumin (BSA) as standard.

A. Fugthong et al. / Protein Expression and Purification 70 (2010) 60–67 63

Temperature (oC)30 40 50 60 70

Rel

ativ

e ac

tivity

(%

)

0

20

40

60

80

100

120

pH2 3 4 5 6 7

Rel

ativ

e ac

tivity

(%

)

0

20

40

60

80

100

120(A) (B)

Fig. 2. The optimal temperature and pH of the recombinant BCC17694 phytase. (A) The optimal temperature was determined at various temperatures from 30 to 70 �C in0.1 M acetate buffer, pH 5.5, against 0.5% sodium-phytate for 10 min. (B) Optimal pH of the purified recombinant protein, the enzyme activity against 0.5% sodium-phytatewas determined at 50 �C for 10 min in 100 mM of various buffers: glycine–HCl (pH 2.5–4), sodium acetate (pH 5–6) and MOPS (pH 6.5–7). One unit of phytase activity isdefined as the amount of the enzyme that liberates 1 lg of inorganic phosphate per minute under the assay condition.

Time (min)0 5 10 15 20 25 30 35

Rel

ativ

e ac

tivi

ty (

%)

0

20

40

60

80

100

30 oC40 oC50 oC

pH1 2 3 4 5 6 7 8 9 10 11

Rel

ativ

e ac

tivity

(%

)

0

20

40

60

80

100

120

Mass ratio of protease/phytase0 1/500 1/200 1/100 1/50

Rel

ativ

e ac

tivity

(%

)

0

20

40

60

80

100

120

r-Phy17694_Pepsinr-Phy17694_Trypsin

(A) (B)

(C)

Fig. 3. The effects of temperature, pH and proteases (pepsin and trypsin) on the stability of recombinant BCC17694 phytase. (A) Thermostability of the recombinant phytasewas investigated by incubating the enzyme at 30, 40 and 50 �C for 5, 10, 20 and 30 min (B) pH stability was performed by incubating the enzyme in (100 mM) various buffers:glycine–HCl (pH 2–4), sodium acetate (pH 5–6), MOPS (pH 7), Tris–HCl (pH 8–9) and glycine–NaOH (pH 10) at 25 �C for 3 h. (C) Residual activity of the recombinant phytase,r-Phy17694, after treating with pepsin or pepsin at different protease/phytase (w/w) ratios. The remaining activity was determined using 0.5% sodium-phytate in 100 mMacetate buffer, pH 5.5, at 50 �C for 10 min. One unit of phytase activity is defined as the amount of the enzyme that liberates 1 lg of inorganic phosphate per minute under theassay condition.

64 A. Fugthong et al. / Protein Expression and Purification 70 (2010) 60–67

C kDa M N 1 2 (A)

116

66.2

� Deglycosylated Deglycosylated phytase phytase

45

35 PNGase F

25

18.4

kDa M 2 N 1 C (B)

116

66.2

Deglycosylated phytase

45

35

Endo H25

18.4

Fig. 4. N-linked deglycosylation of the recombinant phytase by PNGase F (A) andEndo-H (B). Lane M: protein marker (Fermentas). Lane N: 2 lg recombinant phytaseincubated with only deglycosylation buffer. Lane C: 2 lg intact recombinantphytase. Lane 1: 2 lg deglycosylated recombinant phytase. Lane 2: PNGase F (A) orEndo-H (B).

Table 4Effecst of metal ions, inhibitors and detergents on phytase activity.

Effect Relative enzyme activity (%)

Control 100

Metal cations 5 mMCaCl2 82.26 ± 8.2CoCl2 112.33 ± 3.84CuCl2 51.97 ± 3.01KCl 96.51 ± 1.42LiCl 99.90 ± 3.21

A. Fugthong et al. / Protein Expression and Purification 70 (2010) 60–67 65

in various pHs from 2.0–10.0 at 25 �C for 3 h and the remainingactivity was determined. It was found that the enzyme remainedactive at a wide pH range, pH 2.5–8, with more than 50% of itsmaximal activity remains (Fig. 3B). Since phytase is commonlyused as feed supplement, proteolytic resistance of recombinantBCC17694 phytase was tested. The enzyme showed resistant topepsin as its activity was unchanged after pepsin exposure at allratio tested (Fig. 3C). On the other hand, it was sensitive to trypsinat protease:phytase ratio of 1:500 or higher.

The enzyme kinetics of recombinant phytase against varioussubstrates [sodium-phytate, calcium-phytate, potassium-phytateand p-nitrophenyl phosphate (pNPP)] was investigated at substrateconcentrations from 0 to 10 mM. It revealed that recombinant phy-tase had low Km values against all substrates tested (Table 3). TheKm value against pNPP was lowest when compared to other. How-ever, Vmax of pNPP was very low. Among three substrates (sodium-phytate, calcium-phytate and potassium-phytate), the enzymeexhibited highest Vmax of 114.77 U/mg protein against potas-sium-phytate.

The SDS–PAGE of purified phytase revealed a major band of�70 kDa, which was larger than the predicted size (48.4 kDa).One possibility was that the enzyme produced form P. pastoriswas glycosylated. Deglycosylation of the recombinant enzyme byboth PNGase F (cleaves nearly all types of N-linked) and Endo-H(removes only high mannose and some hybrid types of N-linked)resulting in a single band with an apparent size of 45 kDa(Fig. 4). Thus, the percentage of glycosylation was approximately35.7%. The recombinant enzyme was also detected by glycoproteinstaining kit (data not shown). Sequence analysis showed that thededuced amino acid of BCC17694 phytase contained seven poten-tial N-liked glycosylation sites (N-X-S/T) and eight potential O-linkglycosylation site (Fig. 1), supporting the result of high carbohy-drate content in recombinant phytase. The deglycosylated enzymewas also tested for phytase activity. The result showed that greaterthan 95% and 80% of its activity was lost after treated with Endo-Hor PNGase F, respectively (data not shown), suggesting that glyco-sylation is critical for its activity.

Next, the effect of various effectors on phytase activity was alsoanalyzed (Table 4). It revealed that at 5 mM of metal ions, the en-zyme activity was not inhibited by any metal ions tested except forCa2+ (17% inhibition) and Cu2+ (48% inhibition). The chelating agentEDTA did not inhibit enzyme activity, while the reducing agentslike b-mercaptoethalnol and DTT at 5 mM did. The enzyme wasalso strongly inhibited by 1 mM PMSF (a protease inhibitor).Non-ionic detergent, Tween 20, stabilized the enzyme activity,while the anionic detergent, SDS, severely inhibited it.

Table 3Apparent kinetic constants (±SD) of the purified recombinant phytase against varioussubstrates.

Substrate Vmax

(U mg�1)Km

(mM)kcat

(s�1)kcat/Km

(mM�1 s�1)

Sodium-phytate

88.24 ± 1.06 0.58 ± 0.01 102.94 ± 1.24 177.93 ± 2.14

Calcium-phytate

100.30 ± 1.26 0.59 ± 0.03 117.01 ± 1.47 198.88 ± 2.49

Potassium-phytate

114.77 ± 1.78 0.77 ± 0.03 133.89 ± 2.07 173.67 ± 2.69

p-Nitrophenylphosphate

10.10 ± 0.19 0.13 ± 0.02 11.79 ± 0.22 88.80 ± 1.66

The purified recombinant phytase was incubated in various concentrations of dif-ferent substrates in 100 mM sodium acetate buffer (pH 5.5) at 50 �C for 10 min andcalculated for phytase activity. One unit of phytase activity was defined as theamount of the enzyme that liberates 1 lg of inorganic phosphate per minute underthe assay condition. Vmax, Km and kcat were calculated using the the Michaelis–Menten equation from the obtained hyperbolic curve of Prism5 program. Theresults are mean ± SD from three independent experiments.

MgCl2 99.96 ± 4.88MnCl2 107.46 ± 3.78NaCl 95.60 ± 10.93NiCl2 108.52 ± 3.28

Inhibitors 1 mM 5 mMEDTA 95.76 ± 3.25 92.27 ± 1.26b-Mercaptoethalnol 94.13 ± 4.74 87.65 ± 0.85DTT 96.19 ± 2.35 61.12 ± 1.06PMSF 17.67 ± 0.49 1.80 ± 0.22

Detergents 0.5%Tween 20 101.45 ± 4.38SDS 0.35 ± 0.12

Phytase activity was investigated with 0.5% sodium phytate in 100 mM sodiumacetate buffer, pH 5.5, at 50 �C for 10 min. Control means the enzyme was incubatedwithout addition of metal ion, inhibitors or detergents. One unit of phytase activityis defined as the amount of the enzyme that liberates 1 lg of inorganic phosphateper minute under the assay condition. The results are mean ± SD from three inde-pendent experiments.

In vitro digestibility test revealed that the amount of phosphatereleased from feed mixed with 3.8 U/g of the recombinantBCC17694 phytase was 0.84 ± 0.04 lmol/ml. This result is slightly

66 A. Fugthong et al. / Protein Expression and Purification 70 (2010) 60–67

higher than another recombinant A. niger phytase (r-PhyA170)which releases 0.67 ± 0.09 lmol/ml phosphate when used at3.7 U/g feed. Previously, in a similar assay condition, a study [15]showed that this r-PhyA170 releases phosphate at a comparablerate to Natuphos, a commercial phytase.

Discussion

The full-length phytase gene of 1383 nucleotides encoding 460amino acids from E. parvum (BCC17694) was identified. Its ORFcontained the conserved active sites RHGXRXP and HD motifs,which are typically found among HAPs. In addition, the 3D struc-ture prediction of BCC17694 phytase using SWISS-MODEL revealeda conserved large a/b domain and a small a-domain (data notshown) which also are the conserved domains in HAPs [4], con-firming that the obtained phytase belongs to the histidine acidphosphatase family.

Recombinant BCC17694 phytase exhibited highest activity at50 �C and pH 5.5. This optimal temperature and pH of recombinantphytase differed from the crude native enzyme which was 60 �Cand pH 4.0 (data not shown). The difference between native andrecombinant phytase are also observed in other phytases such asA. japonicus phytase and A. niger phytase which showed differencesin pH optima [15]. The differences in temperature and pH optimabetween crude native phytase and purified recombinant phytasemay be due to additives present in the crude extract that affect en-zyme properties. For instance, several additives such as sorbitol,trehalose, glycerol, and phytic acid are reportedly increase phytaseactivity by maintaining protein stability [18].

BCC17694 phytase was able to withstand temperature only upto 40 �C which is quite low; however, this is within the range ofgut temperature (37–40 �C) of swine and poultry. Moreover, itexhibited broad pH stability between 2.5 and 8.0. The enzyme alsoshowed broad substrate specificity with Km values between 0.58and 0.77 mM toward sodium-, calcium- and potassium-phytate,suggesting a good affinity for phytate substrate when comparedto other phytases [19]. In addition, the enzyme has a higher affinityfor p-nitrophenyl phosphate (0.13 mM) than for sodium-phytate(0.58 mM), which is similar to an A. fumigatus ATCC34525 phytase[20]. However, BCC17694 phytase showed slower hydrolysis rateof pNPP than sodium-phytate.

The recombinant enzyme was glycosylated with approximately35.7% of carbohydrate content resulting in a diffuse band of�70 kDa in SDS–PAGE. Generally, glycosylation is known to facili-tate protein folding and increases stability [21]. Also, glycosylationis reported to be vital for phytase thermostability, but does nothave a significant impact upon the optimum pH or temperatureof the enzymes [22,23]. However, for recombinant BCC17694 phy-tase, after treatment with PNGase F or Endo-H, the enzyme activitywas almost completely lost, suggesting that glycosylation is criticalfor its activity. Glycosylation was also reported to be important inseveral phytases such as r-PhyA86 and r-PhyA170 phytase [15].Deglycosylation of r-PhyA86 and r-PhyA170 by Endo-H loweredtheir thermostability, while deglycosylation by PNGase F affectedenzyme activity (personal communication). The recombinantBCC17694 phytase was more resistant to pepsin than trypsinwhich is similar to other phytases [21,24].

The enzyme activity was not affected by K+, Li+, Mg2+, Mn2+, Na+

and Ni2+. However, its activity was slightly increased by Co2+ andslightly decrease by Ca2+, while Cu2+ showed moderate inhibitoryeffect (�50% decrease). These results are similar to most fungalphytases [25] but differed from that of Bacillus subtilis phytase[26]. Zinc and copper ions are reported to inhibit phytase activityof several fungi such as A. japonicus, A. niger [15] and Sporotrichumthermophile [27]. The inhibition could be due to the formation ofinsoluble complex between phytate and metal ions, leading to a

decrease of available substrates for the enzyme [27]. The chelatingagent, EDTA, did not inhibit enzyme activity, suggesting that theenzyme does not require metal ions for its activity which is similarto most phytases except for alkaline phytases which require Ca2+

[4]. The recombinant enzyme was slightly inhibited by 5 mM b-mercaptoethalnol (14% decrease) and DTT (39% decrease) whichis differed from other phytases [27,28]. This suggested that thesulfhydryl group is involved in the catalytic activity of the enzyme.The enzyme was also strongly inhibited by 1 mM PMSF (82.5% de-crease). This result is similar to other phytases such as an A. nigerphytase which lost most of its activity when 0.5 mM PMSF wasused [20]. Another phytase from S. thermophile loses 28% of itsactivity in 5 mM PMSF [27]. It appears that at low concentration,PMSF stabilizes the enzyme, but at concentration above 0.5 mMit acts as an inhibitor [28].

Non-ionic detergent (Tween 20) stabilizes BCC17694 phytaseactivity, while the anionic detergent (SDS) severely inhibited it.SDS also shows strong inhibitory effect on other phytases, suchas A. niger van Teighem phytase which loses 92% of its activity at0.1% SDS [28]. This inhibition may be due to the interactions be-tween the negatively charged detergent and the positively chargedactive site of the HAPs, leading to the unavailability of active sitefor substrate.

For in vitro digestibility test to mimic the animal guts environ-ment, the recombinant BCC17694 phytase was as effective as an-other recombinant phytase from A. niger (r-PhyA170) which isshown to be comparable to Natuphos, a commercial phytase, inreleasing phosphate from corn-based animal feed in vitro [15]. Thissuggested that recombinant BCC17694 phytase is therefore a suit-able source of phytase in feed supplement.

In summary, we have successfully obtained and expressed anovel phytase gene from E. parvum (BCC17694) in P. pastoris. Itsenzymatic and in vitro digestibility properties were investigated.Even though various fungal phytases have been cloned and ex-pressed, only a few are from the Penicillium subfamily and thisis the first report from the E. parvum. Genetic engineering willneed to be performed to gain a better understanding of the struc-ture–function of this enzyme and also to modify it for desirabletraits.

Acknowledgment

This research is partially supported by the Thailand GraduateInstitute of Science and Technology, National Science and Technol-ogy Development Agency, Thailand. (A.F., TGIST 01-50-017).

References

[1] D. Cosgrove, The chemistry and biochemistry of inositol polyphosphates, Rev.Pure Appl. Chem. 16 (1966) 209–215.

[2] X. Lei, J. Porres, Phytase enzymology, applications, and biotechnology,Biotechnol. Lett. 25 (2003) 1787–1794.

[3] M. Cheryan, Phytic acid interactions in food systems, CRC Crit. Rev. Food Sci.Nutr. 13 (1980) 297–335.

[4] B. Oh, W. Choi, S. Park, Y. Kim, T. Oh, Biochemical properties and substratespecificities of alkaline and histidine acid phytases, Appl. Microbiol.Biotechnol. 63 (2004) 362–372.

[5] S. Haefner, A. Knietsch, E. Scholten, J. Braun, M. Lohscheidt, O. Zelder,Biotechnological production and applications of phytases, Appl. Microbiol.Biotechnol. 68 (2005) 588–597.

[6] D. Hawksworth, The fungal dimension of biodiversity: magnitude, significance,and conservation, Mycol. Res. 95 (2006) 641–655.

[7] Y. Wu, V. Ravindran, J. Pierce, W. Hendriks, Influence of three phytasepreparations in broiler diets based on wheat or corn: in vitro measurements ofnutrient release, Int. J. Poul. Sci. 3 (2004) 450–455.

[8] J.L. Cereghino, J.M. Cregg, Heterologous protein expression in themethylotrophic yeast Pichia pastoris, FEMS Microbiol. Rev. 24 (2000) 45–66.

[9] T. Al-Samarrai, J. Schmid, A simple method for extraction of fungal genomicDNA, Lett. Appl. Microbiol. 30 (2000) 53–56.

[10] M. Huttemann, Partial heat denaturation step during reverse transcription andPCR screening yield full-length 50-cDNAs, Biotechniques 32 (2002) 730–736.

A. Fugthong et al. / Protein Expression and Purification 70 (2010) 60–67 67

[11] B. Lefebvre, P. Formstecher, P. Lefebvre, Improvement of the gene splicingoverlap (SOE) method, Biotechniques 19 (1995) 186–188.

[12] U.K. Laemmli, Cleavage of structural proteins during the assembly of the headof bacteriophage T 4, Nature 227 (1970) 680–685.

[13] A. Engelen, F.C. van der Heeft, P.H. Randsdorp, E.L. Sinita, Simple and rapiddetermination of phytase activity, J. AOAC Int. 77 (1994) 760–764.

[14] K. Zyla, D. Gogol, J. Koreleski, S. Swiatkiewcz, D. Ledoux, Simultaneousapplication of phytase and xylanase to broiler feeds based on wheat: in vitromeasurements of phosphorus and pentose release from wheats and wheat-based feeds, J. Sci. Food Agric. 19 (1999) 1832–1840.

[15] P. Promdonkoy, K. Tang, W. Sornlake, P. Harnpicharnchai, R.S. Kobayashi, V.Ruanglek, T. Upathanpreecha, M. Vesaratchavest, L. Eurwilaichitr, S.Tanapongpipat, Expression and characterization of Aspergillus thermostablephytases in Pichia pastoris, FEMS Microbiol. Lett. 290 (2009) 18–24.

[16] J. Lee, Y. Choi, P.-C. Lee, S. Kang, J. Bok, J. Cho, Recombinant production ofPenicillium oxalicum PJ3 phytase in Pichia pastoris, World J. Microbiol.Biotechnol. 23 (2007) 443–446.

[17] T. Xiang, Q. Liu, A.M. Deacon, M. Koshy, I.A. Kriksunov, X.G. Lei, Q. Hao, D.J.Thiel, Crystal structure of a heat-resilient phytase from Aspergillus fumigatus,carrying a phosphorylated histidine, J. Mol. Biol. 339 (2004) 437–445.

[18] B. Singh, T. Satyanarayana, Characterization of a HAP-phytase from athermophilic mould Sporotrichum thermophile, Bioresour. Technol. 100(2009) 2046–2051.

[19] P. Vats, U. Banerjee, Production studies and catalytic properties of phytases(myo-inositolhexakisphosphate phosphohhydrolase): an overview, EnzymeMicrob. Technol. 35 (2004) 3–14.

[20] E. Rodriguez, E. Mullaney, X. Lei, Expression of the Aspergillus fumigatusphytase gene in Pichia pastoris and characterization of the recombinantenzyme, Biochem. Biophys. Res. Commun. 268 (2000) 373–378.

[21] M. Haraguchi, S. Yamashiro, K. Furukawa, K. Takamiya, H.K.F. Shiku, The effects ofthe site-directed removal of N-glycosylation sites from beta-1,4-N-acetyl-galactos-aminyltransferase on its function, Biochem. J. 312 (1995) 273–280.

[22] Y. Han, D. Wilson, X. Lei, Expression of an Aspergillus niger phytase gene (phyA)in Saccharomyces cerevisiae, Appl. Environ. Microb. 65 (1999) 1915–1918.

[23] Y. Kim, H. Kim, J. Lee, K. Kim, S. Lee, Molecular cloning of the phytase genefrom Citrobacter braakii and its expression in Saccharomyces cerevisiae,Biotechnol. Lett. 28 (2006) 33–38.

[24] Y. Wang, X. Gao, Q. Su, W. Wu, L. An, Cloning, expression, and enzymecharacterization of an acid heat-stable phytase from Aspergillus fumigatus WY-2, Curr. Microbiol. 55 (2007) 65–70.

[25] M. Wyss, R. Brugger, A. Kronenberger, R. Remy, R. Fimbel, G. Oesterhelt, M.Lehmann, A.P. van Loon, Biochemical characterization of fungal phytases(myo-inositol hexakisphosphate phosphohydrolases): catalytic properties,Appl. Environ. Microbiol. 65 (1999) 367–373.

[26] J. Kerovuo, M. Lauraeus, P. Nurminen, N. Kalkkinen, J. Apajalahti, Isolation,characterization, molecular gene cloning, and sequencing of a novel phytasefrom Bacillus subtilis, Appl. Environ. Microbiol. 64 (1998) 2079–2085.

[27] U. Konietzny, R. Greiner, Molecular and catalytic properties of phytate-degrading enzymes (phytase), Int. J. Food Sci. Technol. 37 (2002) 791–812.

[28] P. Vats, U. Banerjee, Biochemical characterisation of extracellular phytase (myo-inositol hexakisphosphate phosphohydrolase) from a hyper-producing strain ofAspergillus niger van Teighem, J. Ind. Microbiol. Biotechnol. 32 (2005) 141–147.