Seediscussions,stats,andauthorprofilesforthispublicationat:https://www.researchgate.net/publication/26653295

ArchaeaintheGulfofAqaba

ArticleinFEMSMicrobiologyEcology·August2009

DOI:10.1111/j.1574-6941.2009.00721.x·Source:PubMed

CITATIONS

21

READS

56

10authors,including:

Someoftheauthorsofthispublicationarealsoworkingontheserelatedprojects:

BridginginBiodiversity(BIBS;http://www.bbib.org/bibs-project.html)partofBerlinBrandenburg

InstituteofBiodiversity(http://www.bbib.org/)Viewproject

BrankoRihtman

TheUniversityofWarwick

13PUBLICATIONS31CITATIONS

SEEPROFILE

LenaHazanov

Technion-IsraelInstituteofTechnology

3PUBLICATIONS31CITATIONS

SEEPROFILE

AntonFPost

MarineBiologicalLaboratory

103PUBLICATIONS5,066CITATIONS

SEEPROFILE

AllcontentfollowingthispagewasuploadedbyBrankoRihtmanon01December2016.

Theuserhasrequestedenhancementofthedownloadedfile.Allin-textreferencesunderlinedinbluearelinkedtopublicationsonResearchGate,lettingyouaccessandreadthemimmediately.

R E S E A R C H A R T I C L E

Archaea in theGulfofAqabaDanny Ionescu1,2, Sigrid Penno1,6, Maya Haimovich1, Branko Rihtman1, Aram Goodwin3, DanielSchwartz4, Lena Hazanov5,6, Mark Chernihovsky1,6, Anton F. Post1,6 & Aharon Oren1

1Department of Plant and Environmental Sciences, The Institute of Life Sciences, The Hebrew University of Jerusalem, Jerusalem, Israel; 2The School

for Marine Sciences, The Ruppin Academic Center, Emek-Hefer, Israel; 3Earth Sciences Institute, The Hebrew University of Jerusalem, Jerusalem, Israel;4The Faculty of Biology, The Technion, Haifa, Israel; 5Mina and Everard Goodman Faculty of Life Sciences, Bar-Ilan University, Ramat Gan, Israel; and6H. Steinitz Marine Biology Laboratory, The Interuniversity Institute for Marine Sciences, Eilat, Israel

Correspondence: Danny Ionescu,

Department of Plant and Environmental

Sciences, The Institute of Life Sciences, The

Hebrew University of Jerusalem, 91904

Jerusalem, Israel. Tel.: 1972 2 658 5135;

fax: 1972 2 658 4425;

e-mail: danny.ionescu@mail.huji.ac.il

Received 10 December 2008; revised 8 April

2009; accepted 1 June 2009.

Final version published online 6 July 2009.

DOI:10.1111/j.1574-6941.2009.00721.x

Editor: Patricia Sobecky

Keywords

Archaea; Crenarchaeota; Euryarchaeota; Gulf

of Aqaba; inorganic CO2 uptake.

Abstract

Using a polyphasic approach, we examined the presence of Archaea in the Gulf of

Aqaba, a warm marine ecosystem, isolated from major ocean currents and subject

to pronounced seasonal changes in hydrography. Catalyzed reported deposition

FISH analyses showed that Archaea make up to 4 20% of the prokaryotic

community in the Gulf. A spatial separation between the two major phyla of

Archaea was observed during summer stratification. Euryarchaeota were found

exclusively in the upper 200 m, whereas Crenarchaeota were present in greater

numbers in layers below the summer thermocline. 16S rRNA gene-based denatur-

ing gradient gel electrophoresis confirmed this depth partitioning and revealed

further diversity of Crenarchaeota and Euryarchaeota populations along depth

profiles. Phylogenetic analysis showed pelagic Crenarchaeota and Euryarchaeota to

differ from coral-associated Archaea from the Gulf, forming distinct clusters

within the Marine Archaea Groups I and II. Endsequencing of fosmid libraries of

environmental DNA provided a tentative identification of some members of the

archaeal community and their role in the microbial community of the Gulf.

Incorporation studies of radiolabeled leucine and bicarbonate in the presence of

different inhibitors suggest that the archaeal community participates in auto-

trophic CO2 uptake and contributes little to the heterotrophic activity.

Introduction

Well over a decade ago, it became evident that Archaea are

abundant in the open sea. Fuhrman et al. (1992) obtained

the first archaeal 16S rRNA gene sequences from marine

pelagic clone libraries. Using a targeted PCR approach,

DeLong (1992) showed that Archaea are abundantly found

in the coastal waters of North America. Phylogenetic analy-

sis placed these newly found marine Archaea both in the

Crenarchaeota and in the Euryarchaeota.

It is now well established that Archaea form an important

component within the marine prokaryoplankton across all

latitudes, but they are most abundant in colder layers of the

intermediate and deep waters (Karner et al., 2001; Herndl

et al., 2005). Planktonic marine Archaea are diverse, and

several groups of marine Crenarchaeota and Euryarchaeota

can be distinguished on the basis of their 16S rRNA gene

sequences (DeLong et al., 1994; Fuhrman & Davis, 1997;

Massana et al., 1997; McInerney et al., 1997; Fuhrman &

Ouverney, 1998; DeLong et al., 1999; Church et al., 2003;

DeLong, 2003; Lin et al., 2006; Kirchman et al., 2007). In the

deep pelagic waters of the Pacific Ocean, Crenarchaeota were

found in numbers similar to those of the Bacteria (Karner

et al., 2001). Recently, an autotrophic ammonium-oxidizing

marine Crenarchaeote was isolated and characterized, im-

plying a role for Archaea in nitrification (Konneke et al.,

2005). Ammonium-oxidizing Archaea are widely distribu-

ted in the world oceans (Francis et al., 2005). Representa-

tives of the Korarchaeota and Nanoarchaeota, two additional

phyla of the Archaea, have not been detected so far in the

marine prokaryoplankton.

The Gulf of Aqaba, in the northernmost part of the Red

Sea, is a narrow deep basin with an average width of 14 km

and a total length of 180 km. The Gulf is fed by a thermo-

haline current of warm surface waters, and annual deep water

temperatures never decline below 20.7 1C. Annual events

FEMS Microbiol Ecol 69 (2009) 425–438 c� 2009 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

MIC

ROBI

OLO

GY

EC

OLO

GY

of deep convective mixing occur during winter and often

reach down to over 600 m (Genin et al., 1995; Lindell & Post,

1995), thus causing a homogenous distribution of microbial

communities. The hydrography and the oligotrophic nature

of the Gulf together ensure year-round oxic conditions

throughout the water column. As the presence and con-

tribution of Archaea in warm marine basins has never been

ascertained, the Gulf of Aqaba is a suitable location to test

the hypothesis that temperature is a major determinant of

the community structure of marine Archaea.

Embarking on a polyphasic approach, we characterized

planktonic Archaea populations in the Gulf of Aqaba and

examined their abundance, distribution and diversity by

catalyzed reported deposition FISH (CARD FISH; Perntha-

ler et al., 2002), denaturing gradient gel electrophoresis

(DGGE), 16S rRNA gene sequence analysis and endsequen-

cing of fosmid clone libraries of environmental DNA from

the Gulf. Furthermore, we have measured incorporation of

radiolabeled bicarbonate and leucine in the presence of

different inhibitors in an attempt to assess the possible role

of Archaea in primary and heterotrophic productivity in the

Gulf. We show that planktonic Archaea are a quantitatively

significant and highly diverse component of the prokaryo-

plankton community in the Gulf of Aqaba, and provide

evidence that they may contribute to the autotrophic CO2

fixation in the deep water.

Materials and methods

Sampling procedures

Water was sampled at station A, 291280N, 341550E, in the

Gulf of Aqaba (seafloor depth 735 m) on March 30, 2003,

August 21, 2003, March 20, 2007, May 17, 2007, and April

29, 2008, using a Rosette sampler with 12 L Niskin bottles

(General Oceanics). Continuous readings of temperature,

salinity, light penetration and chlorophyll a concentration

were collected using a CTD (Seacat SBE19, Seabird Electro-

nics) equipped with a LiCOR light sensor (LI192A) and a

fluorimeter (Seapoint). Duplicate samples for dissolved

oxygen determination were withdrawn from each Niskin

bottle, immediately fixed and concentrations were deter-

mined by the Winkler titration method using an automatic

titrator (Metrohm).

Samples for CARD FISH analysis were taken in May

2007. Water was sampled at various depths from the surface

to 730 m (5 m above the bottom). Formaldehyde at a

final concentration of 4% was added to duplicate 50 mL

samples from each depth. After 2 h of fixation, two 15 mL

subsamples from each duplicate were filtered on polycarbo-

nate Whatman filters (0.22mm, +25 mm). A polyester

backing filter (0.45mm, +25 mm) was used for support.

Filters were air-dried and either analyzed immediately or

kept frozen at � 20 1C until further processing.

For 16S rRNA gene sequence analyses water was sampled

from depths o 400 m using Niskin bottles and from

shallower depths using an aseptic approach according to

the procedure described by Zobell (1946). In principle, a

glass bottle is sealed immediately after being autoclaved

using a rubber cork through which a sealed glass pipette is

inserted. A series of such bottles inside their holders was

lowered into the water. The impact of a messenger weight

breaks the glass capillary, allowing water from the desired

depth to flow in, and at the same time releases a messenger

to operate the bottle below. Upon resurfacing, the water was

transferred to 500 mL screw cap sterile bottles. The entire

amount of water up to 500 mL was filtered on a polycarbo-

nate Whatman filter (0.22mm, +25 mm) and was used for

genomic DNA extraction.

Samples for fosmid libraries were taken from 20 m

depth in March 2003 and from 20 and 140 m depth in

August 2003. Seawater (20 L, prefiltered over a 6mm mesh)

was filtered under gentle vacuum (o 15 mm Hg) onto

0.45 mm polysulfone filters (Supor-450, +47 mm, Gelman).

The filters were placed in 4 mL DNA extraction buffer

(750 mM sucrose, 400 mM NaCl, 20 mM EDTA, 50 mM

Tris-HCl, pH 9) in cryovial tubes, frozen in liquid nitrogen

and stored at � 20 1C.

Leucine and NaH14CO3 uptake measurements

Quadruplicate 50 mL samples from each of the evaluated

depths were taken for leucine uptake and bicarbonate

fixation experiments and wrapped in an aluminum foil to

prevent light-driven primary production in the samples.

Ampicillin and streptomycin were added to half of the

samples to a final concentration of 50mg mL�1 each and left

in the dark before further processing. The samples were

incubated with a final concentration of 0.02 mM of 3H-

labeled leucine (specific activity 109 Ci mmol�1)10.18 mM

of unlabeled leucine or with 5 mM NaH14CO3 (specific

activity 4.0 mCi mmol�1) with or without antibiotics as

described above. After incubation for 24 h at 24 1C, the

samples were fixed with 2% formaldehyde, proteins were

precipitated with 5% cold TCA and the samples were filtered

on nitrile acetate filters (0.22mm, +25 mm, Osmonics).

The filters were then placed in scintillation vials with 5 mL of

Ultima Gold (PerkinElmer) scintillation liquid and counted

in a Packard Tri-Carb 2200CA liquid scintillation analyzer.

Bacterial production was estimated using the following

equation:

mgC L�1 h�1 ¼Leuðmmol Leu L�1 h�1Þ � 131:2

� ð%LeuÞ�1 � ðC : ProteinÞ � IDð1Þ

FEMS Microbiol Ecol 69 (2009) 425–438c� 2009 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

426 D. Ionescu et al.

where 131.2 is the molecular weight of leucine, %Leu is the

proportion of leucine in total protein, assumed to be 0.073

(Simon & Azam, 1989), C : Protein is the ratio of cellular

carbon to protein, assumed to be 0.86 (Simon & Azam,

1989), and ID represents isotope dilution, assumed to be 2

in oligotrophic samples; however, due to the dilution of the

labeled leucine dilution we applied, this factor was not taken

into consideration.

For dark inorganic carbon (Ci) incorporation counts per

minute (CPM) were translated to disintegrations per minute

(DPM) using commercially available standards. For calcu-

lating the incorporated 14C labeled Ci, we used an estimated

value of 2.5 mM total inorganic carbon for the Gulf of

Aqaba.

CARD FISH preparation and analysis

CARD FISH was carried out with slight modifications

according to Pernthaler et al. (2002). Subsamples of each

filter were embedded in 0.1% low-melting-point agarose

and were left to dry on glass slides face up. After the samples

were dehydrated and removed from the glass using 96%

ethanol, they were left to air dry. Endogenous peroxidases

were inactivated by placing the filters for 10 min in 0.01 M

HCl, after which they were washed with 1� phosphate-

buffered saline (PBS). Cells were permeabilized using

10 mg mL�1 lysozyme in 0.05 M EDTA, 0.1 M Tris (pH 8)

for 30 min at 37 1C. Samples intended for labeling with

archaeal probes were further treated with 60 U mL�1 achro-

mopeptidase in 0.01 M NaCl and 0.01 M Tris-HCl (pH 8.0)

for 30 min at 37 1C (Sekar et al., 2003; Ishii et al., 2004). Up

to five filter pieces were placed in 0.5 mL Eppendorf tubes

with 300 mL hybridization buffer [0.9 M NaCl, 20 mM Tris-

HCl (pH 7.5), 10% dextran sulfate, 0.02% sodium dodecyl

sulfate (SDS), formamide at the concentration indicated in

Table 1, 1% blocking reagent] (Roche) and 3 mL probe

(50 ng mL�1) (Table 1). Following a hybridization period of

4 h at 37 1C, the filters were washed at 37 1C in prewarmed

washing buffer [3 mM NaCl, 5 mM EDTA (pH 8.0), 20 mM

Tris-HCl (pH 7.5), 0.01% SDS, formamide as indicated in

Table 1] for 10 min. Excess buffer was removed by absorp-

tion with blotting paper and filters were incubated for

15 min in 1� PBS. The filters were transferred to 1 mL

amplification buffer [1�PBS, pH 7.6, 10% dextran sulfate,

0.1% blocking reagent (Roche), 2 M NaCl] to which 10 mL

of freshly prepared 0.15% H2O2 and 3 mL of tyramides

prelabeled with Alexa488 succinimidyl ester dye (Molecular

Probes) were added. CARD incubation was carried out in

the dark at 37 1C for 15 min, after which the filter pieces were

washed in the dark for 15 min in 1�PBS, twice in double

distilled water (DDW) and were let to air dry. The dried filter

pieces were counterstained with 50mL (500 ng mL�1) 40,60-

diamidino-2-phenylindole (DAPI; Sigma) for 5 min, fol-

lowed by 5 min in DDW and 5 min in 80% ethanol. Before

mounting, filters were air dried in the dark for 1 h. Filter

pieces were mounted on glass slides using 1 : 1 (v : v)

VectraShield (Vector Labs) and PPDA [1 : 9 v : v 100 mM

paraphenylene diamine (pH 8.6) : glycerol] and viewed

under an epifluorescent microscope (Nikon Eclipse 80i

equipped with a CCD camera).

Denaturating gradient gel electrophoresis(DGGE)

Filters prepared for DNA extraction were incubated

for 10 min in 0.5 mL lysis buffer (0.1 M Tris, 0.05 M

EDTA, 100 mM NaCl, 1% SDS, pH 8) at 100 1C in a dry

heating block, after which 0.5 mL of 25 : 24 : 1 (v : v : v)

phenol : chloroform : isoamylalcohol was added and the

samples were briefly vortexed. Following a 5 min incuba-

tion at room temperature, the tubes were centrifuged for

5 min at 20 000 g. The upper phase was re-extracted using

24 : 1 (v : v) chloroform : isoamylalcohol. DNA was precipi-

tated by adding three volumes of anhydrous ethanol and

1% (final volume) 3 M sodium acetate (pH 5.5), followed

by 30 min at � 80 1C. After a 20 min centrifugation at

21 000 g, the pellet was washed in 75% ethanol, recollected

by centrifugation and dissolved in 50 mL of molecular-

grade water.

The DNA was then amplified by PCR, using a Bio-

er-thermocycler. We used an initial 5 min denaturation step

at 94 1C, 35 cycles of 1 min denaturation at 94 1C, 1 min

annealing at 55 1C, 1 min elongation at 72 1C and a final

elongation step of 10 min at 72 1C. The primers used are

Table 1. List of probes used for CARD FISH analysis of marine prokaryoplankton in the Gulf of Aqaba along with the concentration of formamide used

in the hybridization and washing buffers

Probes Target organisms Sequence (50–30) Position Formamide (%) References

EUB338 Most Bacteria GCTGCCTCCCGTAGGAGT 338–355 55 Amann et al. (1990)

EUB338II Verrucomicrobiales GCTGCCACCGCTAGGTGT 338–355 55 Daims et al. (1999)

EUB338III Planktomycetales GCAGCCACCCGTAGGTGT 338–355 55 Daims et al. (1999)

NONEUB Negative control ACTCCTACGGGAGGCAGC 338–355 55 Wallner et al. (1993)

ARCH915 Archaea GTGCTCCCCCGCCAATTCCT 934–915 20 Stahl & Amann (1991)

EURY806 Euryarchaeota CACAGCGTTTACACCTAG 823–806 20 Teira et al. (2004)

CREN537 Crenarchaeota TGACCACTTGAGGTGCTG 554–537 20 Teira et al. (2004)

FEMS Microbiol Ecol 69 (2009) 425–438 c� 2009 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

427Archaea in the Gulf of Aqaba

given in Table 2. Primers 7F and 518R were used to amplify

crenarchaeotal sequences, primers 498F and 934R were used

to amplify euryarchaeotal sequences and primers 340F and

934R were used to amplify general archaeal sequences. All

forward primers contained a GC clamp (Table 2). The PCR

products were then loaded onto a vertical 6% acryl amide

gel with a 30–60% formamide urea gradient (100% denatur-

ing conditions are 40% formamide and 7 M urea).

Calculation of the pair-wise similarities of densitometric

profiles was based on Jaccard’s similarity coefficient and

Pearson’s correlation coefficient (Michener & Sokal, 1957)

to construct dendrograms using the Unweighted Pair-Group

Method Analysis (FINGERPRINT2s software, BioRad).

Genomic DNA extraction and 16S rRNA genesequence analysis

DNA was extracted as described above. PCR was carried out

using a company-made master mix (ABgene). Primers

(Table 2) were added to a final concentration of 1 mM. The

PCR reaction was carried out in a thermocycler (MJ

Research) starting with a 5 min initial denaturation at

95 1C, followed by 35 cycles of 1 min at 94 1C, 1 min at

55 1C and 1 min at 72 1C. The reaction was completed by a

5 min elongation step at 72 1C. The PCR products were

cloned using the pGEM-T kit (Promega) according to the

manufacturer’s instructions. A set of 96 clones covering all

sampled depths was sequenced. For identification the se-

quences were submitted for BLASTN analysis at the NCBI

GenBank and were aligned using the CLUSTALW algorithm. A

set of 170 archaeal 16S rRNA gene sequences including the

results from the Gulf of Aqaba, and 133 additional archaeal

sequences representing the major archaeal groups, were

plotted as a minimum evolution tree using the MEGA 4.0

software (Tamura et al., 2007). The distance matrix was

calculated using the maximum composite likelihood algo-

rithm and the results were validated using a bootstrap

analysis. Gulf of Aqaba sequences used in the phylogenetic

analysis have been submitted to the GenBank databases

under accession numbers EU263022–EU263058.

Fosmid library construction and analysis

Frozen filters were thawed on ice and used for genomic

DNA extraction. To obtain high-molecular-weight DNA

(4 40 000 bp), mechanical stress and shear forces were

minimized by avoiding vortexing and intensive pipetting

and using wide bore tips. Genomic DNA was extracted

according to Penno et al. (2006). Between 8 and 15 mg of

environmental DNA of c. 40 kb length were used for fosmid

library construction using the CopyControlTM Fosmid

Library Production Kit with the pCCFOS1TM vector (Epi-

centre Biotechnologies) following the manufacturer’s in-

structions. Individual fosmid clones were picked and

grown in 96-well growth blocks in Luria–Bertani (LB)

medium with 12.5 mg mL�1 chloramphenicol overnight at

37 1C and 350 r.p.m. horizontal shaking. After inoculation of

fresh LB/chloramphenicol medium containing 0.1% induc-

tion solution (Epicentre Biotechnologies) with 1/10 of the

overnight culture, the clones were grown for an additional

5 h under the above-mentioned conditions. Cells were

pelleted by centrifugation at 1500 g for 8 min and the pellets

were resuspended in 50 mM Tris HCl (pH 8), 10 mM EDTA

and 0.1 mg mL�1 RNAse A. Fosmid DNA was extracted

using alkaline lysis. Briefly, cell lysis was carried out for

5 min in 0.2 N NaOH and 0.1% SDS, followed by neutraliza-

tion with 3 M potassium acetate (pH 5.2 after adjusting with

acetic acid). After centrifugation at 1800 g for 20 min, the

cell lysate was transferred to a 96-well 0.66 mm polystyrene

glass fiber filter plate (Corning) placed on top of a 96-well

Costar polystyrene plate (Corning). Assembled plates were

centrifuged for 5 min at 1500 g. The fosmid DNA was

precipitated in the 96-well Costar plates by adding

0.7 volume isopropanol. After an overnight incubation

at � 20 1C, the DNA was pelleted by centrifugation at

2800 g for 40 min. The pellets were washed with 70%

ethanol and air dried for 10 min. Fosmid clones were

Table 2. List of primers used to amplify archaeal 16S rRNA genes

Primers Specificity Sequence (50–30) References

21F Archaea TTCCGGTTGATCCYGCCGGA DeLong (1992)

958R Archaea YCCGGCGTTGAMTCCAATT DeLong (1992)

A1 Euryarchaeota TCYGKTTGATCCYGSCRGAG Embley et al. (1992)

A1100 Euryarchaeota TGGGTCTCGCTCGTTG Embley et al. (1992)

7F Crenarchaeota TTCCGGTTGATCCYGCCGGACC Perevalova et al. (2003)

518R Crenarchaeota GCTGGTWTTACCGCGGCGGCTGA Perevalova et al. (2003)

340F Archaea CCTACGGGGYGCASCAG Øvreas et al. (1997)

934R Archaea GTGCTCCCCCGCCAATTCCT Raskin et al. (1994)

498F Euryarchaeota AAGGGCYGGGCAAG Burggraf et al. (1994)

GC clamp DGGE CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGG

Primers 7F, 340F and 498F were synthesized with a GC clamp at the 50 end to be used for DGGE.

FEMS Microbiol Ecol 69 (2009) 425–438c� 2009 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

428 D. Ionescu et al.

sequenced from both ends using the T7 and pCC1TM/

pEpiFOSTM RP-2 (Epicentre Biotechnologies) primers. The

resulting sequences were submitted to the NCBI GenBank

for identification using BLASTX. Only sequences 4 100 bp

length and BLAST tophits with e-valueso 1.00E� 03 and

score values 4 30 were included in the analysis. Sequences

with archaeal BLAST tophits have been submitted to GenBank

(accession numbers FI901681 – FI901797).

Results

Hydrographic properties

Water samples were collected at five different time points at

station A in the Gulf of Aqaba, reflecting diverse hydro-

graphic conditions. In March 2007 the water column was

mixed down to the sea floor (735 m) with a constant

temperature of 21 1C throughout. In April 2008, May 2007

and August 2003, the water column became stratified, with

a more pronounced thermocline as summer progressed

(Fig. 1). The water column was fully oxygenated at the five

sampling times and salinity was constant at 40.5–40.7%(salinity data were not available for April 2008). In situ

fluorescence measurements, representing chlorophyll a con-

centration, showed high, uniform values in the mixed upper

part of the water column and declined to background levels

below the thermocline during stratification. A deep chlor-

ophyll maximum existed at 45 m in May 2007 (Fig. 1), and it

typically deepens during summer (e.g. 110 m by August in

2003). Analysis of inorganic N species was carried out for all

water samples. Figure 2 depicts the data obtained in April

2008, showing a peak in NO2 at a depth of 75 m.

CARD FISH community analysis

Application of CARD FISH using a universal probe (Table 1)

to enumerate both Bacteria and Archaea in samples from the

Gulf of Aqaba resulted in labeling of 4 90% of the DAPI cell

counts. Using specific probes, we showed that Archaea

contributed 20–40% of the prokaryoplankton (Fig. 3).

Likewise, samples labeled with a general Archaea probe were

a close match to the combined counts obtained with

Archaea-specific probes distinguishing Crenarchaeota and

Euryarchaeota (Table 1). An experiment using the FISH

technique without the CARD amplification yielded few

visible Archaea (data not shown). Compared with the total

cell numbers, both the bacterial and the archaeal commu-

nities showed similar trends, with the highest numbers

around the deep chlorophyll maximum and close to the

sediment (Fig. 3a). However, the ratio between Archaea and

Bacteria throughout the water column did not follow any

clear pattern (Fig. 3b). No Euryarchaeota were observed

below the thermocline of the stratified column in May 2007

(Fig. 3c). In most cases, the sum of labeled Euryarchaeota

and Crenarchaeota matched total Archaea numbers labeled

with the general probe.

Phylogenetic analysis of 16S rRNA genes

16S rRNA gene sequences from all samples along the mixed

water column were submitted to BLASTN searches and phylo-

genetic analyses and identified members of both Euryarch-

aeota and Crenarchaeota (Fig. 4). All Euryarchaeota

sequences resulted from PCR products obtained with a

general archaeal primer pair. Although the Euryarchaeota-

specific primers yielded PCR products for several reference

strains and environmental samples from hypersaline envir-

onments (data not shown), they did not amplify 16S rRNA

gene fragments from the Gulf of Aqaba. Crenarchaeota

sequences were obtained using both Crenarchaeota-specific

as well as general Archaea primers (Table 2). The best BLASTN

matches were always to uncultured marine Archaea.

Phylogenetic analyses of 170 16S rRNA gene sequences

representing the major known archaeal groups clearly place

the Gulf of Aqaba sequences in two separate clusters: one

within the Euryarchaeota and one within the Crenarchaeota

lineage with distinct groups not related to any known

species (Fig. 4). The crenarchaeotal sequences form a

distinct cluster within the Marine Group I (MGI) most

closely related to the MGI a and b subgroups. Most of the

euryarchaeotal sequences group within the Marine Group II

(MGII) as a distinct cluster branching off the MCII bsubgroup (Fig. 4). Others cluster together with uncultured

archaeal sequences isolated from corals in the Red Sea within

the MCII b subgroup. One Gulf of Aqaba euryarchaeotal

sequence clusters in the MGII a subgroup branching deeply

away from other members of this subgroup. Euryarchaeotal

and crenarchaeotal environmental clone sequences shared

between 91–98% and 92–99% identity, respectively, with

sequences from the NCBI database. Plotting the sequences

using the neighbor joining and maximum parsimony algo-

rithms implemented in the MEGA 4.0 package resulted in

similar tree topologies and did not alter the clustering

pattern shown in Fig. 4 (data not shown).

Archaeal fosmid library clones

Three fosmid libraries of Gulf of Aqaba environmental

DNA, two from 20 m depth (winter mixed vs. summer

stratified column) and one from 140 m depth (stratified

column), were screened to determine sequence distributions

over the microbial community. Among a total of 4 6000

fosmid clones analyzed, we identified 118 Archaea sequences

(237–907 bp in length) that showed best BLAST hits (e-values

ranging from 1E� 06 to 1E� 118) to Archaea (Table 3).

Out of a total of prokaryotic sequences (n = 2484), Archaea-

like sequences comprised c. 5% of the total. The Archaea-

like sequences showed affinity with both the Euryarchaeota

FEMS Microbiol Ecol 69 (2009) 425–438 c� 2009 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

429Archaea in the Gulf of Aqaba

(41%) and Crenarchaeota (56%). The c. 1 : 3 ratio for

Crenarchaeota- and Euryarchaeota-like sequences identified

in the fosmid libraries corresponded to ratios obtained for

16S clone libraries (Fig. 4). The closest archaeal matches

based on protein BLAST searches against the nr database of

GenBank identified these sequences as relatives of ‘Candida-

tus Nitrosopumilus maritimus’ as well as functional groups

such as the methanogens (Methanopyrales, Methanosarcinales

Oxygen (µmol L–1)

Temperature (°C)

Temperature (°C)

Temperature (°C)

Temperature (°C)

Oxygen (µmol L–1)

Oxygen (µmol L–1)

Oxygen (µmol L–1)

Fluorescence (AU)

Fluorescence (AU)

Fluorescence (AU)

Dep

th (

m)

Dep

th (

m)

Dep

th (

m)

Dep

th (

m)

Dep

th (

m)

Dep

th (

m)

April 2008

March 2007

May 2007

August 2003

Fluorescence (AU)

Salinity (‰)

Salinity (‰)

Salinity (‰)

Fig. 1. Temperature, salinity (left panels), chlorophyll

fluorescence and oxygen (right panels) profiles of the water

column at station A in the Gulf of Aqaba at the various

sampling times: sampling for fosmid libraries generation,

August 2003; sampling for archaeal 16S rRNA gene

amplification, March 2007; sampling for CARD FISH analysis,

May 2007; sampling for productivity measurements,

April 2008.

FEMS Microbiol Ecol 69 (2009) 425–438c� 2009 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

430 D. Ionescu et al.

and Methanococcales), halophiles (Halobacteriales) and dif-

ferent groups of thermophiles (Thermococcales, Thermoplas-

matales, Sulfolobales and Desulfurococcales). A small number

of sequences had closest hits to uncultured Euryarchaeota

or Crenarchaeota derived from environmental samples

(Table 3). Most archaeal fosmid sequences shared 23–59%

amino acid identities (and 37–74% conserved amino acid

positions) with their respective BLASTX tophit. Some fosmid

sequences matching BLASTX hits for methanogens shared

60–74% amino acid identity. Protein sequence identities

4 75% (up to 88%) were found exclusively between fosmid

sequences and GenBank entrances for ‘Candidatus N. mari-

timus’ and uncultured Archaea.

DGGE analysis

Characterization of archaeal communities by DGGE was

performed twice on the DNA from the April 2008 samples

using a general Archaea primer and specific primer pairs for

Crenarchaeota and Euryarchaeota (Table 2). The results

indicate the existence of several genetically distinct popula-

tions with three clusters in the Archaea and Euryarchaeota

and four clusters in the Crenarchaeota (Fig. 5). Clustering of

the general archaeal populations resembled that of the

euryarchaeotal-specific ones showing a separation between

deep and shallow populations. The clustering in the cre-

narchaeotal population had no evident depth-related parti-

tioning.

Uptake of radiolabeled leucine and bicarbonate

We quantified incorporation of 3H-labeled leucine and

NaH14CO3 into the protein fraction of the samples. Leucine

incorporation of untreated 0.2–20 mm plankton samples (a

proxy for heterotrophic productivity) decreased 4 10-fold

below the photic zone. The addition of ampicillin and

streptomycin to such samples inhibited leucine uptake rates

by 4 90% (Fig. 6). These antibiotics are known to inhibit

bacterial productivity at large, but they do not affect

Archaea. The inhibitory affect of these antibiotics was

successfully tested on an ammonium oxidizer (Nitrosococcus

sp.) (data not shown). Dark inorganic carbon incorporation

showed two peaks: one in the photic zone and one in the

deeper waters. The antibiotic-insensitive fraction showed

two minor peaks in the upper waters and one major peak in

the deep waters. Three peaks of dark incorporation of Ci

were found, at 65, 250 and 560 m (Fig. 7). The upper peak

corresponded to the location of the primary nitrite max-

imum (Fig. 2), suggesting that the peak in dark Ci incor-

poration may be related to ammonia-oxidizing bacteria.

Dark Ci incorporation levels in the presence of ampicillin

and streptomycin showed two minor peaks above and below

the main peak at 65 m. In the upper 500 m of the water

column, about 86% of the dark Ci incorporation was

inhibited by the antibiotics, while little inhibition was

observed in the deeper waters (Fig. 7).

Discussion

The Gulf of Aqaba, northern Red Sea, is a unique oceanic

environment with deep water temperatures of 4 20 1C and

year-round oxic conditions. Using a polyphasic approach we

have obtained qualitative as well as quantitative information

on the presence of Archaea in the Gulf. CARD FISH analysis

showed Archaea to make up slightly over 20% of the

prokaryoplankton community in the Gulf (Fig. 3).

Although Archaea are present throughout the water

column, there is spatial separation between Euryarchaeota

and Crenarchaeota during periods of stratification of the

water column (Fig. 3). In many stratified marine ecosystems,

Euryarchaeota are most abundant in the upper water layers

while Crenarchaeota appear mainly in the mixed layer below

the thermocline (Massana et al., 1997; DeLong et al., 1999;

DeLong, 2003, 2006). Although a phylum-based separation

cannot be derived from our DGGE analysis, it was shown

that different communities, both of total Archaea and of

Euryarchaeota, were present above and below the thermo-

cline (located at 100 m depth at the time of the analysis).

NO2, PO4 (µM)

0.0

0

100

200

300NO2

NO3

PO4400

Dep

th (

m)

500

600

700

0 1 2 3 4

NO3 (µM)5 6 7

0.1 0.2 0.3 0.4 0.5 0.6 0.7

Fig. 2. Nitrite, nitrate and phosphate profiles at the time of dark CO2

incorporation measurements (April 2008).

FEMS Microbiol Ecol 69 (2009) 425–438 c� 2009 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

431Archaea in the Gulf of Aqaba

The spatial separation among the Crenarchaeota is less clear

and appears not to be depth related (Fig. 5).

An apparent contradiction arises when comparing the

archaeal abundance estimated from fosmid library screening

(5%) with the CARD FISH results (20%). This discrepancy

may be founded in the nature of the different analyses.

Fosmid library construction and screening constitute a shot-

gun approach, which, in principle, is free of bias, but

1.0E+05

0

100

200

Dep

th (

m)

Dep

th (

m)

Dep

th (

m)

300

400

500

600

700

0

0.0 10.0 20.0 30.0 40.0 50.0 60.0 70.0 80.0 90.0 100.0

100

200

300

400

500

600

700

0

100

200

300

400

500

600

700

EubacteriaArchaea

Total DAPI counts

Eubacteria

Archaea

Archaea and Eubacteria

Euryarchaea

Archaea

Crenarchaea

2.1E+06 4.1E+06 6.1E+06Cells mL–1

8.1E+06 1.0E+07 1.2E+07 1.4E+07

1.0E+05 1.1E+06 2.1E+06Cells mL–1

Percent of DAPI-labeled cells

3.1E+06 4.1E+06 5.1E+06

(a)

(b)

(c)

Fig. 3. CARD FISH analysis results of the

prokaryoplankton community in the Gulf of

Aqaba: Archaea, Bacteria and total DAPI counts

per milliliter (a); percent of total DAPI counts

labeled with the general archaeal and general

bacterial probe (b); Euryarchaeota and

Crenarchaeota cells per milliliter as compared

with the total Archaea counts (c).

FEMS Microbiol Ecol 69 (2009) 425–438c� 2009 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

432 D. Ionescu et al.

establishing taxonomic relationships is compounded by the

breadth of the (ever expanding) databases. The major

emphasis on 16S rRNA gene sequences in diversity assess-

ments is more straightforward than the use of functional

genes. Thus, deciphering random archaeal sequences relies

largely on the current status of genome sequences. To date,

there are c. 65 archaeal genomes available vs. 4 1000

bacterial ones (data taken from NCBI GenBank). Therefore,

Fig. 4. A minimum evolution

phylogenetic tree of all major

Archaea groups and the archaeal

sequences from the Gulf of Aqaba.

Distances were calculated using

the maximum composite

likelihood algorithm as embedded

in the MEGA 4.0 software. Bootstrap

values (1000 replicates) over 50%

are shown next to the relevant

branches. MGI, Marine Group I;

GoAqPCG, Gulf of Aqaba Pelagic

Crenarchaeota Group; SCG, Soil

Crenarchaeota Group; MBG,

Marine Benthic Group; MHVG,

Marine Hydrothermal Vent

Group; MCG, Miscellaneous

Crenarchaeota Group; T/A/M/Mp/H,

Thermococcales, Archaeoglobales,

Methanococcales, Methanopyrales

and Haloarcula, respectively;

SAGMEG, South Africa Gold

Mine Euryarchaeota Group;

TMEG, Terrestrial Miscellaneous

Euryarchaeotal Group; MGII, Marine

Group II; GoAqPEG, Gulf of Aqaba

Pelagic Euryarchaeota Group; MGIII,

Marine Group III.

FEMS Microbiol Ecol 69 (2009) 425–438 c� 2009 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

433Archaea in the Gulf of Aqaba

it is quite possible that additional archaeal sequences may

‘hide’ among the 49% unidentified BLAST results from our

fosmid library screening.

With the exception of few euryarchaeotal sequences

obtained from the Gulf of Aqaba, all of the sequences

cluster in unique clades within known crenarchaeotal and

euryarchaeotal groups. As in other examined marine envir-

onments the MGI and MGII groups are the dominant

archaeal populations (Massana et al., 1997). The formation

of the unique clusters GoAqPCG (Gulf of Aqaba Pelagic

Crenarchaeota Group) and GoAqPEG (Gulf of Aqaba

Pelagic Euryarchaeota Group) (Fig. 4) may be due to the

source of the water in the Gulf. The Red Sea is connected to

the Indian Ocean (Gulf of Aden) via the Bab-el-Mandeb

straits, which form a shallow water barrier only c. 140 m

deep, allowing only surface water to enter the Red Sea. The

incoming waters are driven north mainly by winds and a

thermohaline current. The entrance to the Gulf of Aqaba is

blocked by the even shallower straits of Tiran that allow

only the upper c. 80 m of water to enter the Gulf. The

existence of two shallow barriers between the Gulf of Aden

and the Gulf of Aqaba leads to a severe selection of surface-

related Archaea, which in turn may have diverged into a

unique community specific only to the Gulf of Aqaba. We

have compared the sequences obtained from the Gulf of

Aqaba in this study with those obtained during the Global

Ocean Sampling expedition (Shaw et al., 2008) and found

no preferential similarity between Archaea from the Indian

Ocean and those from the Gulf of Aqaba (data not shown).

This may be due to a divergence progress that becomes

more apparent the further we go from the source of the

waters. However, as no data are available regarding archaeal

diversity in other parts of the Red Sea, this hypothesis

cannot be supported yet. Teske & Sørensen (2008) have

analyzed the phylogenetic relations between various

Archaea groups, most of which have been plotted in Fig. 4.

Their analysis has shown that the archaeal communities

group according to their local environment rather than

their geographical position. Considering this we may not

necessarily expect the archaeal population in the Gulf of

Aqaba to resemble that in the Gulf of Aden, but rather a

marine community with a similar ecological function.

Siboni et al. (2008) have published a large number of

sequences from coral-associated Archaea from the Gulf of

Aqaba. These sequences, although from the same geogra-

phical location, cluster separately from the pelagic

sequences obtained in this study. This further supports the

theory of functional and not geographical clustering.

Table 3. List of most fosmid clones with archaeal matches found using BLASTX search

e-value Number of times Phylum Closest BLAST match

3.00E� 76 11 Crenarchaeota Nitrosopumilus maritimus SCM1

1.00E� 46 6 Euryarchaeota Methanococcoides burtonii DSM 6242

5.10E� 77 5 Euryarchaeota Uncultured Marine Group II euryarchaeote 37F11

4.10E� 53 5 Euryarchaeota Natronomonas pharaonis DSM 2160

3.00E� 32 5 Euryarchaeota Methanosarcina acetivorans C2A

2.10E� 67 5 Euryarchaeota Methanoculleus marisnigri JR1

1.00E� 118 4 Euryarchaeota Uncultured Marine Group II euryarchaeote DeepAnt-JyKC7

6.00E� 52 4 Euryarchaeota Methanosarcina barkeri str. Fusaro

2.00E� 29 4 Euryarchaeota Haloquadratum walsbyi DSM 16790

5.00E150 3 Euryarchaeota Uncultured Marine Group II euryarchaeote HF70_39H11

2.00E� 10 3 Euryarchaeota Pyrococcus horikoshii OT3

7.00E� 41 3 Euryarchaeota Pyrococcus abyssi GE5

1.00E� 36 3 Euryarchaeota Methanothermobacter thermautotrophicus str. Delta H

8.10E� 34 3 Euryarchaeota Methanosaeta thermophila PT

2.00E� 44 3 Euryarchaeota Methanopyrus kandleri AV19

3.00E� 17 3 Euryarchaeota Methanocaldococcus jannaschii DSM 2661

4.00E� 17 3 Euryarchaeota Halorubrum lacusprofundi ATCC 49239

4.00E� 21 3 Euryarchaeota Haloarcula marismortui ATCC 43049

8.00E� 18 2 Crenarchaeota Cenarchaeum symbiosum

1.00E� 09 2 Euryarchaeota Thermoplasma volcanium GSS1

1.00E� 25 2 Euryarchaeota Thermococcus kodakarensis KOD1

1.00E� 17 2 Euryarchaeota Pyrococcus furiosus DSM 3638

1.00E� 06 2 Crenarchaeota Pyrobaculum aerophilum str. IM2

4.10E� 34 2 Euryarchaeota Methanospirillum hungatei JF-1

9.00E� 39 2 Euryarchaeota Archaeoglobus fulgidus DSM 4304

7.10E� 49 1 Crenarchaeota Pyrobaculum arsenaticum DSM 13514

BLAST e-value and identity of the closest match are given as well as the number of times this organisms showed up as best BLAST match.

FEMS Microbiol Ecol 69 (2009) 425–438c� 2009 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

434 D. Ionescu et al.

All data obtained from 16S rRNA gene sequencing using

different archaeal-specific primers yielded sequences close to

other uncultured marine Archaea whose ecological role is still

unknown. However, fosmid analysis identified most Archaea

as members of functional groups such as the methanogens,

halophiles or thermophiles, leaving only 19% with a closest

match to uncultured marine Archaea (Table 3). Given the

very low sequence similarity between fosmid archaeal se-

quences and closest BLAST matches (except for uncultured

Archaea and Candidatus N. maritimus) and the low number

of database entrances for functional protein sequences of

uncultured Archaea, the identification of methanogens,

halophiles or thermophiles and therefore their presence in

the Gulf is strongly questioned and rather unlikely.

To estimate the possible role of Archaea in heterotrophic

and autotrophic processes, we introduced an approach

based on the use of antibiotics that supposedly do not affect

Archaea, assessing their effect on the incorporation of3H-leucine and H14CO3

�. Heterotrophic production as mea-

sured by leucine incorporation was significantly higher in

the photic zone (c. 75 m, data not shown) than in the deeper

waters. In the upper 30 m, the addition of ampicillin and

streptomycin lowered the rate of leucine incorporation by

85–90% (Fig. 6); whether the remaining 10–15% can be

attributed to archaeal activity or to bacteria not affected by

the inhibitors cannot be ascertained on the basis of our data.

In deeper waters, there was no clear trend in the effect of the

antibiotics on leucine incorporation (Fig. 6, inset). In the

upper water layers most of the dark CO2 incorporation was

inhibited by the antibiotics, but most of the activity in the

deeper waters was not affected. At least some of this activity

may be attributed to autotrophic ammonia-oxidizing

Crenarchaeota, such as have been documented from various

Fig. 5. DGGE dendrograms for total Archaea, Crenarchaeota and

Euryarchaeota. The lane images are computer generated from the

original DGGE gels for densitometric analysis. Depths represent the

origin of the samples.

0

0

0

0.05 0.1 0.15 0.2

µg C L–1 day–1

0

100

200

300

Dep

th (

m)

400

500

600

700

100

200

300No inhibitors

With inhibitors

400

500

600

700

1 2

Fig. 6. Heterotrophic productivity as calculated from leucine uptake

experiments performed with and without bacterial inhibitors in April

2008. The insert shows a magnification of the results deeper than

50 m depth.

FEMS Microbiol Ecol 69 (2009) 425–438 c� 2009 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

435Archaea in the Gulf of Aqaba

marine environments (Treusch et al., 2005; Wuchter et al.,

2006; Beman et al., 2007; Lam et al., 2007). This agrees with

our CARD FISH results, showing that the majority of the

Crenarchaeota were present in the deeper waters (Fig. 3).

Additional support for the existence of ammonia-oxidizing

Archaea in the Gulf of Aqaba was obtained from the fosmid

library screening, as multiple significant BLAST hits were most

similar to the archaeal ammonia oxidizer Candidatus N.

maritimus (Table 3). Ammonia-oxidizing Archaea as well as

ammonia oxidation itself were found to exist in corals from

the Gulf of Aqaba (Siboni et al., 2008). Although there is no

close similarity between the coral and pelagic Archaea found

in the Gulf of Aqaba, this further supports that Archaea-

mediated ammonia oxidation is a common process that is

probably present in the pelagic part of the Gulf as well.

While we do not claim that the use of ampicillin and

streptomycin enables a full differentiation between activities

due to Archaea and to Bacteria, the data obtained suggest

that interesting information can be obtained in such studies

using different inhibitors. More in-depth controlled studies

will be required to fully evaluate the validity of the approach.

The spatial distribution of the Archaea in the Gulf as

observed by the CARD FISH analysis as well as by the DGGE

analysis may also be function related. Given that the Archaea

in the Gulf all originate from Red Sea surface waters, the

descent and establishment of the Crenarchaeota community

in deeper areas may be related to available, necessary

nutrients. This could also account for the unique clusters

obtained by the 16S rRNA gene sequences. As previously

crenarchaeotal ammonia oxidation has been described to

occur in deep waters, which, in this case, are blocked from

entering the Gulf of Aqaba, the pelagic Crenarchaeota in the

Gulf may be a less common, opportunistic ammonia-

oxidizing Archaea. Because DGGE does not provide quanti-

tative information, we cannot deduce anything regarding

the contribution of each depth-related cluster to the total

archaeal community, and therefore the existence of other

Crenarchaeota or Euryarchaeota in shallower or deeper

waters, respectively, is not surprising.

It appears that the archaeal community in the Gulf of

Aqaba is unique, a speciation that may have been caused by

the selection of shallow water species. However, regardless of

this speciation, a special differentiation is noticed between

Crenarchaeota and Euryarchaeota. Further studies are

needed to determine the nature of this separation as well as

the changes that occur in the archaeal communities along

the Red Sea.

Acknowledgements

We would like to acknowledge the State of Niedersachsen

(Germany) for supporting the CARD FISH analysis, which

was initiated as part of a marine microbiology course project

with students Kirsten Oesterwind and Stefan Thiele

(University of Osnabruck) and Nathalie Vaisman (the

Hebrew University of Jerusalem). We thank Rita B. Dom-

ingues for her constructive criticism, and Ilana Berman-

Frank for access to her fluorescent microscope. Katherina

Hammar provided assistance in fosmid sequence analyses.

We acknowledge the National Monitoring Program at the

IUI for oceanographic data. Financial support was available

from the Moshe Shilo Minerva Center for Marine Biogeo-

chemistry (A.F.P., A.O.), the Bridging the Rift Foundation

(D.I., A.O.), Niedersachsen State Fund at the Hebrew Uni-

versity, grant 135/05 by the Israel Science Foundation

(A.F.P.). Fosmid clone sequencing received support of the

MBL Gruss-Lipper Fund, Woods Hole, MA (A.F.P.).

References

Amann R, Binder BJ, Olson RJ, Chisholm SW, Devereux R &

Stahl DA (1990) Combination of 16S rRNA-targeted

oligonucleotide probes with flow cytometry for analyzing

mixed microbial populations. Appl Environ Microb 56:

1919–1925.

Beman JM, Roberts JK, Wegley L, Rohwer F & Francis AC (2007)

Distribution and diversity of ammonia monooxygenase genes

associated with corals. Appl Environ Microb 73: 5642–5647.

0

0

100

200

300

400

No inhibitors

With inhibitors

Dep

th (

m)

500

600

700

1 2 3

µg C L–1 day–1

4 5 6 7

Fig. 7. Dark uptake of H14CO3� in the presence and absence of ampicillin

and streptomycin, as measured in April 2008.

FEMS Microbiol Ecol 69 (2009) 425–438c� 2009 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

436 D. Ionescu et al.

Burggraf S, Mayer T, Amann R, Schadhauser S, Woese CR &

Stetter KO (1994) Identifying members of the domain Archaea

with rRNA-targeted oligonucleotide probes. Appl Environ

Microb 60: 3112–3119.

Church MJ, DeLong EF, Ducklow HW, Karner MB, Preston CM

& Karl DM (2003) Abundance and distribution of planktonic

archaea and bacteria in the waters west of the Antarctic

Peninsula. Limnol Oceanogr 48: 1893–1902.

Daims H, Bruhl A, Amann R, Schleifer KH & Wagner M (1999)

The domain-specific probe EUB338 is insufficient for the

detection of all Bacteria: development and evaluation of a more

comprehensive probe set. Syst Appl Microbiol 22: 434–444.

DeLong EF (1992) Archaeal in coastal marine environments.

P Natl Acad Sci USA 89: 5685–5689.

DeLong EF (2003) Oceans of archaea. ASM News 69: 503–511.

DeLong EF (2006) Archaeal mysteries of the deep revealed. P Natl

Acad Sci USA 103: 6417–6418.

DeLong EF, Wu KY, Prezelin BB & Jovine RVM (1994) High

abundance of archaea in Antarctic marine picoplankton.

Nature 371: 695–697.

DeLong EF, Taylor LT, Marsh TL & Preston CM (1999)

Visualization and enumeration of marine planktonic archaea

and bacteria by using polyribonucleotide probes and

fluorescence in situ hybridization. Appl Environ Microb 65:

5554–5556.

Embley TM, Finlay BJ, Thomas RH & Dyal PL (1992) The use of

rRNA sequences and fluorescent probes to investigate the

phylogenetic positions of the anaerobic ciliate Metopus

palaeformis and its archaeobacterial endosymbiont. J Gen

Microbiol 138: 1479–1487.

Francis CA, Roberts KJ, Beman JM, Santoro AE & Oakley BB

(2005) Ubiquity and diversity of ammonia-oxidizing archaea

in water columns and sediments of the ocean. P Natl Acad Sci

USA 102: 14683–14688.

Fuhrman JA & Davis AA (1997) Widespread archaea and novel

bacteria from the deep sea as shown by 16S rRNA gene

sequencing. Mar Ecol-Prog Ser 150: 275–285.

Fuhrman JA & Ouverney CC (1998) Marine microbial diversity

studied via 16S rRNA sequences: coastal cloning results and

counting of native archaea with fluorescent single cell probes.

Aquat Ecol 32: 3–15.

Fuhrman JA, McCallum K & Davis AA (1992) Novel major

archaebacterial group from marine plankton. Nature 356:

148–149.

Genin A, Lazar B & Brenner S (1995) Vertical mixing and coral

death in the Red Sea following the eruption of Mount

Pinatubo. Nature 377: 507–510.

Herndl JG, Reinthaer T, Teira E, van Aken H, Veth C, Pernthaler A

& Pernthaler J (2005) Contribution of Archaea to total

prokaryotic production in the Deep Atlantic Ocean. Appl

Environ Microb 71: 2303–2309.

Ishii K, Mußmann M, MacGregor BJ & Amann R (2004) An

improved fluorescence in situ hybridization protocol for the

identification of bacteria and archaea in marine sediments.

FEMS Microbiol Ecol 50: 203–213.

Karner MB, DeLong EF & Karl DM (2001) Archaeal dominance

in the mesopelagic zone of the Pacific Ocean. Nature 409:

507–510.

Kirchman DL, Elifantz H, Dittel AI, Malmstrom RR &

Cottrell MT (2007) Standing stocks of Archaea and Bacteria

in the western Arctic Ocean. Limnol Oceanogr 52:

495–507.

Konneke M, Bernhard AE, de la Torre JR, Walker CB, Waterbury

JB & Stahl DA (2005) Isolation of an autotrophic ammonia-

oxidizing marine archaeon. Nature 437: 543–546.

Lam P, Jensesn MM, Lavik G, McGinnis DF, Muller B, Schubert

CJ, Amann R, Thamdrup B & Kuypers MMM (2007) Linking

crenarchaeotal and bacterial nitrification to anammox in the

Black Sea. P Natl Acad Sci USA 104: 7104–7109.

Lin X, Wakeham SG, Putnam IF, Astor YM, Scranton MI,

Chistoserdov AY & Taylor GT (2006) Comparison of vertical

distributions of prokaryotic assemblages in the anoxic Cariaco

Basin and Black Sea by use of fluorescence in situ

hybridization. Appl Environ Microb 72: 2679–2690.

Lindell D & Post AF (1995) Ultraphytoplankton succession is

triggered by deep winter mixing in the Gulf of Aqaba (Eilat),

Red Sea. Limnol Oceanogr 40: 1130–1141.

Massana R, Murray A, Preston CM & DeLong EF (1997) Vertical

distribution and phylogenetic characterization of marine

planktonic archaea in the Santa Barbara channel. Appl Environ

Microb 63: 50–56.

McInerney JO, Mullarkey M, Wernecke ME & Powell R (1997)

Phylogenetic analysis of Group I marine archaeal rRNA

sequences emphasizes the hidden diversity within the primary

group archaea. P Roy Soc Lond B Bio 264: 1663–1669.

Michener CD & Sokal RR (1957) A quantitative approach to a

problem in classification. Evolution 11: 130–262.

Øvreas L, Forney L, Daae FL & Torsvik V (1997) Distribution of

bacterioplankton in meromictic Lake Saelenvannet, as

determined by denaturing gradient gel electrophoresis of PCR

amplified gene fragments coding for 16S rRNA. Appl Environ

Microb 63: 3367–3373.

Penno S, Lindell D & Post AF (2006) Diversity of Synechococcus

and Prochlorococcus populations determined from DNA

sequences of the N-regulatory gene ntcA. Environ Microbiol 8:

1200–1211.

Perevalova AA, Lebedinsky AV, Bonch-Osmolovskaya EA &

Chernykh NA (2003) Detection of hyperthermophilic archaea

of the genus Desulfurococcus by hybridization with

oligonucleotide probes. Microbiology 72: 340–346.

Pernthaler A, Pernthaler J & Amann R (2002) Fluorescence

in situ hybridization and catalyzed reporter deposition for

identification of marine bacteria. Appl Environ Microb 68:

3094–3101.

Raskin L, Stromley JM, Rittmann BE & Stahl DA (1994) Group

specific 16S rRNA hybridization probes to describe natural

communities of methanogens. Appl Environ Microb 60:

1232–1240.

Sekar R, Pernthaler A, Pernthaler J, Warneke F, Posch T & Amann

R (2003) An improved protocol for quantification of

FEMS Microbiol Ecol 69 (2009) 425–438 c� 2009 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

437Archaea in the Gulf of Aqaba

freshwater Actinobacteria by fluorescence in situ hybridization.

Appl Environ Microb 69: 2928–2935.

Shaw AK, Halpern AL, Beeson K, Tran B, Venter JC & Martiny JB

(2008) It’s all relative: ranking the diversity of aquatic bacterial

communities. Environ Microbiol 10: 2200–2210.

Siboni N, Ben-Dov E, Sivan A & Kushmaro A (2008) Global

distribution and diversity of coral-associated Archaea and

their possible role in the coral holobiont nitrogen cycle.

Environ Microbiol 10: 2979–2990.

Simon M & Azam F (1989) Protein content and protein synthesis

rates of planktonic marine bacteria. Mar Ecol-Prog Ser 51:

201–213.

Stahl DA & Amann R (1991) Development and application of

nucleic acid probes. Nucleic Acid Techniques in Bacterial

Systematics (Stackebrandt E & Goodfellow M, eds),

pp. 205–247. John Wiley & Sons, Chichester.

Tamura K, Dudley J, Nei M & Kumar S (2007) MEGA4:

Molecular Evolutionary Genetics Analysis (MEGA) software

version 4.0. Mol Biol Evol 24: 1596–1599.

Teira E, Reinthaler T, Pernthaler A, Pernthaler J & Herndl GJ

(2004) Combining catalyzed reporter deposition-fluorescence

in situ hybridization and microautoradiography to detect

substrate utilization by Bacteria and Archaea in the deep

ocean. Appl Environ Microb 70: 4411–4414.

Teske A & Sørensen KB (2008) Uncultured archaea in deep

marine subsurface sediments: have we caught them all?

ISME J 2: 3–18.

Treusch HA, Leininger S, Kletzin A, Schuster CS, Klenk HP &

Schleper C (2005) Novel genes for nitrite reductase and Amo-

related proteins indicate a role of uncultivated mesophilic

Crenarchaeota in nitrogen cycling. Environ Microbiol 7:

1985–1995.

Wallner G, Amann R & Beisker W (1993) Optimizing fluorescent

in situ hybridization with rRNA-targeted oligonucleotide

probes for flow cytometric identification of microorganisms.

Cytometry 14: 136–143.

Wuchter C, Abbas B, Coolen JLM et al. (2006) Archaeal

nitrification in the ocean. P Natl Acad Sci USA 103:

12317–12322.

Zobell CE (1946) Marine Microbiology. A Monograph on

Hydrobacteriology. Chronica Botanica Company,

Waltham.

FEMS Microbiol Ecol 69 (2009) 425–438c� 2009 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

438 D. Ionescu et al.