Activating Notch1 mutations in mouse models of T-ALL

doi:10.1182/blood-2005-06-2553Prepublished online September 15, 2005;

Frederick W Alt, Michelle Kelliher and A T LookJennifer O'Neil, Jennifer Calvo, Keith McKenna, Veena Krishnamoorthy, Jon C Aster, Craig H Bassing, Activating Notch1 mutations in mouse models of T-ALL

(1930 articles)Signal Transduction � (795 articles)Oncogenes and Tumor Suppressors �

(4217 articles)Neoplasia � (1653 articles)Brief Reports �

Articles on similar topics can be found in the following Blood collections

http://bloodjournal.hematologylibrary.org/site/misc/rights.xhtml#repub_requestsInformation about reproducing this article in parts or in its entirety may be found online at:

http://bloodjournal.hematologylibrary.org/site/misc/rights.xhtml#reprintsInformation about ordering reprints may be found online at:

http://bloodjournal.hematologylibrary.org/site/subscriptions/index.xhtmlInformation about subscriptions and ASH membership may be found online at:

digital object identifier (DOIs) and date of initial publication. theindexed by PubMed from initial publication. Citations to Advance online articles must include

final publication). Advance online articles are citable and establish publication priority; they areappeared in the paper journal (edited, typeset versions may be posted when available prior to Advance online articles have been peer reviewed and accepted for publication but have not yet

Copyright 2011 by The American Society of Hematology; all rights reserved.20036.the American Society of Hematology, 2021 L St, NW, Suite 900, Washington DC Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by

For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

http://bloodjournal.hematologylibrary.org/cgi/collection/brief_reports

http://bloodjournal.hematologylibrary.org/cgi/collection/neoplasia

http://bloodjournal.hematologylibrary.org/cgi/collection/oncogenes_and_tumor_suppressors

http://bloodjournal.hematologylibrary.org/cgi/collection/signal_transduction

http://bloodjournal.hematologylibrary.org/site/misc/rights.xhtml#repub_requests

http://bloodjournal.hematologylibrary.org/site/misc/rights.xhtml#reprints

http://bloodjournal.hematologylibrary.org/site/subscriptions/index.xhtml

http://bloodjournal.hematologylibrary.org/subscriptions/ToS.dtl

http://bloodjournal.hematologylibrary.org/


1

Activating Notch1 Mutations in Mouse Models of T-ALL

Jennifer O’Neil1, Jennifer Calvo2, Keith McKenna1, Veena Krishnamoorthy2, Jon C.

Aster3, Craig H. Bassing4, Frederick W. Alt4, Michelle Kelliher2* and A. Thomas Look1*

1Department of Pediatric Oncology, Dana-Farber Cancer Institute, Boston, MA 02115, USA. 2Department of Cancer Biology, University of Massachusetts Medical School, Worcester, MA 01605, USA. 3Department of Pathology, Brigham and Women’s Hospital, Harvard Medical School, Boston, MA 02115. 4Howard Hughes Medical Institute, The Children’s Hospital, Department of Genetics, Harvard Medical School and The Center for Blood Research, Boston, MA 02115. *Both laboratories contributed equally to this work. Reprints: A. Thomas Look, Dana-Farber Cancer Institute, Mayer Bldg, Rm 630, 44 Binney Street, Boston, MA 02115, Fax 617-632-6989, Phone 617-632-5826 [email protected] abstract word count: 129 total text word count: 1477 Scientific Heading: Neoplasia

Blood First Edition Paper, prepublished online September 15, 2005; DOI 10.1182/blood-2005-06-2553

Copyright © 2005 American Society of Hematology




2

Abstract

Recent studies have demonstrated that the majority of T-ALL patients have

activating mutations in NOTCH1. We sought to determine whether these mutations are

also acquired in mouse models of T-ALL. We have sequenced the heterodimerization

domain and PEST domain of notch1 in our mouse model of TAL1-induced leukemia and

have found that 74% of the tumors harbor activating mutations in notch1. Cell lines

derived from these tumors undergo G0/G1 arrest and apoptosis when treated with a γ-

secretase inhibitor. In addition, we found activating notch1 mutations in 31% of thymic

lymphomas that occur in mice deficient for various combinations of the H2AX, p53 and

Rag2 genes. Thus, notch1 mutations are often acquired as a part of the molecular

pathogenesis of T-ALLs that develop in mice with known predisposing genetic

alterations.




3

Introduction

TAL1 is a basic helix-loop-helix (bHLH) transcription factor that is normally

expressed in hematopoietic cells, endothelial cells and cells of the central nervous system.

Through chromosomal translocation, interstitial deletion or biallelic activation, TAL1 is

misexpressed in thymocytes of 60 and 45% of pediatric and adult T-ALL patients

respectively1,2. Improved results in the treatment of pediatric T-ALL have been achieved

in recent years by intensifying chemotherapy regimens, leading to a five-year event free

survival rate approaching 80%3,4, however, patients whose lymphoblasts overexpress the

TAL1 oncogene have a less favorable prognosis than patients with activation of other

oncogenes5,6.

Double-strand breaks occur in mammalian cells as a result of exposure to DNA-

damaging agents such as ionizing radiation or during V(D)J recombination in

lymphocytes. Many T-ALL tumors harbor chromosomal translocations or

rearrangements that activate oncogenes, or create oncogenic fusion genes7. These

translocations and rearrangements likely occur as a result of errors in the repair of

double-strand breaks. The histone H2A variant, H2AX, plays a role in the cellular

response to IR-induced double-strand breaks8,9. H2AX deficiency alone causes only a

modest predisposition to cancer; however, mice deficient for both H2AX and p53 rapidly

develop T and B cell lymphomas and solid tumors demonstrating that H2AX acts as a

tumor suppressor in mice10,11. The fact that human H2AX (H2AFX) maps to 11q23, a

region that is frequently altered in human cancer, suggests that the human gene may also

function as a tumor suppressor10.




4

The NOTCH genes encode single pass transmembrane receptors that regulate

apoptosis, proliferation and cell fate determination in multicellular organisms. Binding

of NOTCH ligands initiates a series of proteolytic cleavages in NOTCH1. The last of

these cleavages, which is catalyzed by γ-secretase, results in the release of the

intracellular domain of NOTCH1 (ICN), permitting it to translocate to the nucleus and

form part of a multiprotein complex that regulates gene transcription12. Recent work

from our laboratories has revealed that activating mutations in NOTCH1 occur in over

50% of cases of human T-ALL13. Previous studies have demonstrated that the notch1

gene is a frequent site of retroviral insertional mutagenesis in mouse models of T-ALL14-

17 (see also http://RTCGD.ncifcrf.gov). In order to determine whether notch

mutations are acquired in mouse models of T-ALL, we sequenced the heterodimerization

domain and PEST domain of all four notch genes in tumors from our previously

established models of T-ALL.

Study Design

Mice

FVB/N lck-tal1 transgenic mice and tal1/+HEB+/- mice have been previously

described18,19. Ink4a/Arf+/- mice were obtained from the MMHCC mouse repository20

and mated to tal1 transgenic mice to obtain tal1/+Ink4a/Arf+/- mice (Calvo and

Kelliher, unpublished data) . 129Sv/ev p53-/-, H2AX-/-, H2AX-/-p53-/-, and

H2AX+/-p53-/- mice were described previously10. RAG2 deficient mice21 were

mated to the above mice to obtain H2AX-/-p53+/-RAG-/- and H2AX+/-p53-/-

RAG-/- mice.




5

Mutation Detection

Exon 26 and 27 of notch1 were amplified using the following primers: exon 26 forward

5’-ACGGGAGGACCTAACCAAAC-3’, exon 26 reverse 5’-

CAGCTTGGTCTCCAACACCT-3’, exon 27 forward 5’-

CGCTGAGTGCTAAACACTGG-3’, and exon 27 reverse 5’-

GTTTTGCCTGCATGTACGTC-3’. Exon 34 was amplified in two fragments using the

following primers: forward 1 5’-GCTCCCTCATGTACCTCCTG-3’, reverse 1 5’-

TAGTGGCCCCATCATGCTAT-3’, forward 2 5’-ATAGCATGATGGGGCCACTA-3’,

reverse 2 5’-CTTCACCCTGACCAGGAAAA-3’. The products were direct sequenced

at Agencourt Bioscience Corporation (Beverly, MA) and the results were analyzed using

Mutation Surveyor.

Gamma-Secretase Inhibitor Treatment

Murine tal1 tumor cell lines were either treated with 1μΜ DAPT [N–N-(3,5-

Difluorophenacetyl)-L-alanyl-(S)-phenylglycine t-butyl ester] (Calbiochem San Diego,

CA Cat#565770) or mock treated with DMSO for 6 days. The cells were fixed with

70% ethanol, stained with propidium iodide and analyzed by flow cytometry.

Western Blotting

Tal1 tumor cell lines were either untreated or treated with 1μM DAPT. Cell lysates were

fractionated on a SDS-PAGE gel and then transferred to PVDF. Intracellular Notch1 was

detected by probing the blot with the V1744 antibody (Cell Signaling Technology




6

Beverly, MA). The blot was then stripped and reprobed with an anti-β actin antibody

(Sigma St. Louis, MO) to insure equal loading.

RT-PCR

RNA was extracted from tal1 tumor cells that were untreated or treated with DAPT using

Trizol (Invitrogen Carlsbad, CA). cDNA was prepared with Superscript II reverse

transcriptase (Invitrogen). RT-PCR was then performed using primers specific for

Deltex, Hes1 and GAPDH22.

Results and Discussion

We sequenced the heterodimerization domain and PEST domain of all four notch

genes in tumors from tal1/+, tal1/+HEB+/-, and tal1/+Ink4a/Arf+/- mice. Of the 27

tumors that we analyzed, we found activating mutations in the notch1 gene in 20 samples

(74%) (Table 1). One tumor (9205) had a point mutation in the heterodimerization

domain leading to a leucine to proline change at residue 1668 (1679 in human NOTCH1).

Point mutations causing identical L to P substitutions have been observed in four human

T-ALL patients13. The majority of mutations that we detected in the mouse tumors were

in the PEST domain. Here, as in the human cell lines and samples, we found insertions,

deletions and point mutations resulting in premature stop codons and loss of the notch1

PEST domain. In contrast, we found no mutations in notch2, notch3, or notch4.

In addition to the notch1 mutations found in tal1 transgenic mice, we also found

notch1 mutations in 9 out of 29 (31%) of T cell tumors that developed in H2AX-/-, p53-/-,

H2AX-/-p53-/-, H2AX+/-p53-/-, p53-/-RAG-/-, H2AX-/-p53-/-RAG-/-, and H2AX-/-




7

p53+/-RAG-/- mice. One tumor (455) had an alanine to proline missense mutation in the

heterodimerization domain of notch1. This same mutation at the homologous residue in

human NOTCH1 (1702) was also observed in one primary sample from a T-ALL

patient13. However, as in the tal1 transgenic mice most of the mutations were in the

PEST domain. This data indicates that notch1 mutations are not specific to leukemias

arising in tal1 transgenic mice, but arise in diverse T-ALL-prone backgrounds. Of note,

notch1 mutations are significantly more common in tal1 transgenic mice compared to

mice that are heterozygous or deficient for p53 (p=0.0009), H2AX (p=0.006), or RAG

(p=0.0006) using a two-tailed Fisher’s exact test. Because of the complex genotypes of

the mice analyzed in this study, further experiments will be necessary to determine the

individual contributions of p53, H2AX or RAG deficiency to susceptibility to notch1

mutations.

The mutations we have found affecting full-length notch proteins in murine T-

ALL are predicted to activate notch pathway signaling in way that is dependent on

cellular γ-secretase activity. Therefore, to determine whether the tumor cells depend on

notch signaling, we treated tumor cell lines derived from these mice with the γ-secretase

inhibitor DAPT (Figure 1 and Supplemental Table 1). After treatment of the cell lines

with the inhibitor for six days, we found that the majority of cell lines exhibited a G0/G1

arrest and/or an increase in apoptosis, as indicated by cells with 45-70% sub-G0/G1 DNA

content (similar results were also seen after 3 days). In addition, we demonstrate that in

both sensitive and resistant cell lines, DAPT treatment inhibits the production of

activated notch (Figure 1E) and the transcription of the notch target genes deltex and hes1

(Figure 1F). Some tal1 tumor cell lines were resistant to the γ-secretase inhibitor




8

treatment. Two out of four γ-secretase resistant cell lines did not have mutations in

notch1. Resistant cell lines with mutations in notch1 have likely incurred additional

mutations rendering them independent of notch pathway signaling for growth and

survival since DAPT treatment does decrease notch1 signaling in these cells. In fact, our

previous studies have demonstrated that tumor 5146 displays constitutive NFκB

activation, therefore it may be dependent on NFκB signaling rather than notch signaling

for its growth/survival23. One cell line was sensitive to the γ-secretase inhibitor but did

not have a mutation in notch1. In this case, we hypothesize that there may be activating

mutations in one or more other components of the notch signaling pathway. However,

we cannot rule out the possibility that this cell line has a mutation in another substrate of

γ-secretase. This work provides further evidence that notch1 activation plays a key role

in the pathogenesis of T-ALL in both humans and in murine models and provides model

systems incorporating clinically relevant oncogenes and tumor suppressors for testing

therapeutics that target the NOTCH signaling pathway.




9

Figure Legend

Figure 1. Cell lines derived from tal1 tumors are sensitive to a γ-secretase inhibitor.

Tal1 tumor cell lines were treated with 1μΜ DAPT or DMSO (control) for six days and

the DNA content of propidium-iodide-stained cell populations was determined by flow

cytometry. The numbers over the cell populations indicate the percentage of cells in sub-

G0/G1, G0/ G1, S and G2/M (A-D). Tal1 tumor cells were untreated or treated with DAPT

for 40 hours. Western blot analysis using an antibody that specifically recognizes the

activated form of notch1 (E). A tal1 T-ALL cell line was either untreated or treated with

DAPT for 24 or 48 hours. RT-PCR analysis was performed with primers specific for

deltex, hes1 and GAPDH (F).

References

1. Ferrando AA, Look AT. Gene expression profiling in T-cell acute lymphoblastic leukemia. Semin Hematol. 2003;40:274-280. 2. Ferrando AA, Herblot S, Palomero T, et al. Biallelic transcriptional activation of oncogenic transcription factors in T-cell acute lymphoblastic leukemia. Blood. 2003. 3. Schrappe M, Reiter A, Ludwig WD, et al. Improved outcome in childhood acute lymphoblastic leukemia despite reduced use of anthracyclines and cranial radiotherapy: results of trial ALL-BFM 90. German-Austrian-Swiss ALL-BFM Study Group. Blood. 2000;95:3310-3322. 4. Silverman LB, Gelber RD, Dalton VK, et al. Improved outcome for children with acute lymphoblastic leukemia: results of Dana-Farber Consortium Protocol 91-01. Blood. 2001;97:1211-1218. 5. Ferrando AA, Neuberg DS, Dodge RK, et al. Prognostic importance of TLX1 (HOX11) oncogene expression in adults with T-cell acute lymphoblastic leukaemia. Lancet. 2004;363:535-536. 6. Ferrando AA, Neuberg DS, Staunton J, et al. Gene expression signatures define novel oncogenic pathways in T cell acute lymphoblastic leukemia. Cancer Cell. 2002;1:75-87. 7. Ferrando AA, Look AT. Clinical implications of recurring chromosomal and associated molecular abnormalities in acute lymphoblastic leukemia. Semin Hematol. 2000;37:381-395.




10

8. Bassing CH, Chua KF, Sekiguchi J, et al. Increased ionizing radiation sensitivity and genomic instability in the absence of histone H2AX. Proc Natl Acad Sci U S A. 2002;99:8173-8178. 9. Celeste A, Petersen S, Romanienko PJ, et al. Genomic instability in mice lacking histone H2AX. Science. 2002;296:922-927. 10. Bassing CH, Suh H, Ferguson DO, et al. Histone H2AX: a dosage-dependent suppressor of oncogenic translocations and tumors. Cell. 2003;114:359-370. 11. Celeste A, Difilippantonio S, Difilippantonio MJ, et al. H2AX haploinsufficiency modifies genomic stability and tumor susceptibility. Cell. 2003;114:371-383. 12. Artavanis-Tsakonas S, Rand MD, Lake RJ. Notch signaling: cell fate control and signal integration in development. Science. 1999;284:770-776. 13. Weng AP, Ferrando AA, Lee W, et al. Activating mutations of NOTCH1 in human T cell acute lymphoblastic leukemia. Science. 2004;306:269-271. 14. Feldman BJ, Hampton T, Cleary ML. A carboxy-terminal deletion mutant of Notch1 accelerates lymphoid oncogenesis in E2A-PBX1 transgenic mice. Blood. 2000;96:1906-1913. 15. Hoemann CD, Beaulieu N, Girard L, Rebai N, Jolicoeur P. Two distinct Notch1 mutant alleles are involved in the induction of T-cell leukemia in c-myc transgenic mice. Mol Cell Biol. 2000;20:3831-3842. 16. Girard L, Jolicoeur P. A full-length Notch1 allele is dispensable for transformation associated with a provirally activated truncated Notch1 allele in Moloney MuLV-infected MMTV(D)/myc transgenic mice. Oncogene. 1998;16:517-522. 17. Yanagawa S, Lee JS, Kakimi K, Matsuda Y, Honjo T, Ishimoto A. Identification of Notch1 as a frequent target for provirus insertional mutagenesis in T-cell lymphomas induced by leukemogenic mutants of mouse mammary tumor virus. J Virol. 2000;74:9786-9791. 18. Kelliher MA, Seldin DC, Leder P. Tal-1 induces T cell acute lymphoblastic leukemia accelerated by casein kinase IIalpha. Embo J. 1996;15:5160-5166. 19. O'Neil J, Shank J, Cusson N, Murre C, Kelliher M. TAL1/SCL induces leukemia by inhibiting the transcriptional activity of E47/HEB. Cancer Cell. 2004;5:587-596. 20. Serrano M, Lee H, Chin L, Cordon-Cardo C, Beach D, DePinho RA. Role of the INK4a locus in tumor suppression and cell mortality. Cell. 1996;85:27-37. 21. Shinkai Y, Rathbun G, Lam KP, et al. RAG-2-deficient mice lack mature lymphocytes owing to inability to initiate V(D)J rearrangement. Cell. 1992;68:855-867. 22. Deftos ML, Huang E, Ojala EW, Forbush KA, Bevan MJ. Notch1 signaling promotes the maturation of CD4 and CD8 SP thymocytes. Immunity. 2000;13:73-84. 23. O'Neil J, Ventura JJ, Cusson N, Kelliher M. NF-{kappa}B activation in premalignant mouse tal-1/scl thymocytes and tumors. Blood. 2003;102:2593-2596.




11




12

Table 1. Activating Notch 1 mutations occur at a high frequency in mouse T-ALL

Tumor Genotype Phenotype* Nucleotide Change┼

Amino Acid Change‡ Mutational Consequence

5046 tal1/+ nd insertion G 7501 insertion 2421 premature stop in PEST domain

5151 tal1/+ nd deletion CCCTGACCAGTG

GT 7716

deletion 2492 premature stop in PEST domain

5146 tal1/+ nd deletion CT 7709 deletion 2490 premature stop in PEST domain

1444 tal1/+ DP deletion AC 7320 deletion 2360 premature stop in PEST domain

5015 tal1/+ nd insertion CGTGG 7322

insertion 2361 premature stop in PEST domain

1330 tal1/+ CD8 SP wildtype 5148 tal1/+ nd wildtype 5188 tal1/+ nd insertion GG 7322 deletion 2361 premature stop in PEST

domain 1161 tal1/+ nd C>T 7495 Q>stop 2419 premature stop in PEST

domain 5145 tal1/+ nd insertion C 7322 insertion 2361 premature stop in PEST

domain 4862 tal1/+ DP deletion CT 7709 deletion 2490 premature stop in PEST

domain 1469 tal1/+ CD4 SP insertion

GGGGGGGG 7324 insertion 2361 premature stop in PEST

domain 1011 tal1/+ CD8 SP C>T 7495 Q>stop 2419 premature stop in PEST

domain 8998 tal1/+

HEB+/- nd C>T 7129 Q>stop 2296 premature stop in PEST

domain 9450 tal1/+

HEB+/- nd insertion C 7510 insertion 2420 premature stop in PEST

domain 9205 tal1/+

HEB+/- DP C>T 5243 L>P 1668 missense in

heterodimerization domain

9306 tal1/+ HEB+/-

nd wildtype

6839 tal1/+ HEB+/-

nd insertion CCTC 7321


8283 tal1/+ nd wildtype




13

HEB+/- 3199 tal1/+

ink4a/ arf+/-

CD8 SP deletion C 7520 deletion 2427 premature stop in PEST domain

2871 tal1/+ ink4a/ arf+/-

nd wildtype


CD8 SP and DP

deletion CT 7709 deletion 2490 premature stop in PEST domain


CD8 SP wildtype


nd C>T 7384 Q>stop 2382 premature stop in PEST domain


CD8 SP and DP

wildtype


DP insertion C 7663



nd insertion G 7325 insertion 2362 premature stop in PEST domain

603 H2AX-/-p53-/-

DP deletion GGCTGGCAACAC

AG 7320


541 H2AX-/-p53+/-RAG-/-

DP wildtype

706 p53-/- nd wildtype 720 H2AX-/-

p53-/- DP and CD8 SP

insertion C 7322 insertion 2361 premature stop in PEST domain

80 H2AX-/-p53-/-

nd wildtype

538 p53-/- CD8 wildtype 364 H2AX-/- DP insertion G 7436 insertion 2399 premature stop in PEST

domain 799 H2AX-/-

p53+/-RAG-/-

nd wildtype

311 H2AX-/-p53-/-RAG-/-

DN, DP and CD8 SP

wildtype




14

859 H2AX+/-p53-/-

DP wildtype

618 H2AX-/-p53-/-

DN, DP and CD8 SP

deletion GCCACAGAACTTACAGCTCCAGCC

TCAGA 7365


455 H2AX-/- DP G>C 5308 A>P 1690 missense in heterodimerization

domain 727 H2AX-/-

p53-/- DP wildtype

613 H2AX+/-p53-/-

DP deletion CT 7709 deletion 2490 premature stop in PEST domain

84 H2AX-/-p53-/-

nd wildtype

310 H2AX+/-p53-/-

nd deletion ATGTACAACCGCTGGGCCCCAGCA

G 7490


308 H2AX-/-p53-/-RAG-/-

DN and CD8 SP

wildtype

761 H2AX-/-p53-/-RAG-/-

DP wildtype

728 H2AX-/-p53-/-

DP wildtype

274 H2AX+/-p53-/-

DN and CD8 SP

wildtype

814 H2AX+/-p53-/-

nd wildtype

634 H2AX-/-p53-/-

DP insertion T 7518 insertion 2426 premature stop in PEST domain

540 p53-/-RAG-/-

CD8 wildtype

696 H2AX-/-p53-/-

DN and CD8 SP

wildtype

24 H2AX-/-p53+/-RAG-/-

DP wildtype

414 H2AX-/-p53+/-RAG-/-

DP and CD8 SP

wildtype

814 H2AX-/-p53+/-

DN and CD8 SP

deletion AGTCTGCCTGTG

deletion 2425

premature stop in PEST domain




15

RAG-/- CACACCATTCTGCCCCAGGAAAGCCAGGCCCTGCCCACATCACTGCCATCCTCCATGGTCCCACCCATGACCACTACCCAGTTC

CTGAC 7513 deletion

CTTCCCAGCACAGTTACTCCTCCTCCCCTGTGGACAACACCCCCAGCCACCAGCTGCAGGTGCCAGAGCACCCCTTCCTCACCCCATCCCCTGAGTCCCCTGACCAGTGGTCCAGCTCCTCCCCGCATTCCAACATCTCTGATTGGTCCGAGGGCATCTCCAGCCCGCCCACCACCATGCCGTCCCAGATCACCCACATTCCAGAGGCATTTAAAT

7619

deletion 2460

399 H2AX-/-p53+/-RAG-/-

DP and CD8 SP

wildtype

531 H2AX-/-p53+/-RAG-/-

DN wildtype

*nd-not determined ┼Numbers correspond to nucleotide position in notch1 cDNA. ‡Numbers indicate amino acid residue in notch1 at which mutation occurs.




Activating Notch1 mutations in mouse models of T-ALL

Documents

Transcript of Activating Notch1 mutations in mouse models of T-ALL