A STUDY ON THE GUIDELINES STATUS AND THE PREVALENCE OF GENETICALLY MODIFIED PRODUCTS IN JORDAN

A STUDY ON THE GUIDELINES STATUS AND THE

PREVALENCE OF GENETICALLY MODIFIED

PRODUCTS IN JORDAN

By

Nawar Tareq Kamal El Husseini

Supervisor

Prof. Mohammed Abdulkader Ibrahim Al-Obaide

Co- Supervisor

Dr. Nisreen Daifallah Al-Hmoud

This thesis was submitted in partial fulfillment of the requirements for the

Master’s Degree in Environmental Management and Technology

King Abdulla School for Graduate Studies and Scientific Research

Princess Sumaya University for Technology

May, 2013

ii

ACKNOWLEDGEMENT

I thank God who guided me all through this research and gave me the strength and

knowledge. I also thank deeply my supervisor Professor Mohammed Al-Obaide and my

co- supervisor Dr. Nisreen Al Hmoud for their patience, continuous support and

motivation to carry out this challenging research. I am also very grateful to Professor

Eric Kubler for giving me the chance to train at the FHNW (University of Applied

Sciences North Western Switzerland), labs. Furthermore I also want to express my

gratitude to the Royal Scientific Society/Biosafety Unit for offering me the opportunity

to carry out my experiments in their professional labs.

Most importantly I thank Princess Sumaya University of Technology (PSUT) and the

Environment Technology & Management faculty for their efforts, collaboration and

encouragement throughout my research and the whole master program.

I finally dedicate all the results and findings of my thesis to the relevant and concerned

stakeholders and officials in Jordan and I hope they can take all the recommendations

seriously and implement all the necessary actions to ensure better health and safer

environment for all.

iii

TABLE OF CONTENTS

COMMITTEE DECISION…………………………………………………………………ii

ACKNOWLEDGEMENT…………………………………………………………………iv

LIST OF TABLES………………………………………………………………………...iiiii

LIST OF FIGURES……………………………………………………………………...viii

LIST OF ABBREVIATIONS …………………………………………………………….x

LIST OF ANNEXES……………………………………………………………………...xii

ABSTRACT….…………………………………………………………………………..xiii

INTRODUCTION…………………………………………………………………………1

CHAPTERONE: LITERATURE REVIEW

1.1 What is genetically modified food…………………………………………………5

1.2 The historical background and global cultivation of genetically modified crops..…6

1.3 Public perceptions and consumers acceptance of genetically modified food

crops in different parts of the world…………………………………………… 10

1.4 Health risks,environmental impacts and biosafety of genetically modified food and

feed……………………………………………………………………………...…12

1.5 Ethical and religious views of biotechnology and genetically modified food…….16

1.6 Laws and regulations controlling the prevalence of genetically modified food and

feed………………………………………………………………………………...18

CHAPTER 2: RESEARCH METHODOLOGY

2.1 Prevalence of genetically modified maize in Jordan………………………………23

2.1.1 Collection of maize samples from Jordanian market….………………………23

2.1.2 Samples pretreatment……………………………………………………….....24

2.1.3 Lab procedure for extraction of genomic DNA from plant. ………………….27

2.1.4 Determination of DNA purity and concentration:…………………………… 28

2.1.5 DNA amplification by qualitative Polymerase Chain Reaction (PCR)……… 28

2.1.6 Gel electrophoresis…………………………………………………………….30

2.2 Examining Jordanians awareness regarding the different issues of genetically

modified food and feed…………………………………………………………...33

2.2.1 Survey methodology………………………………………………………..…33

2.2.2 Data entry and processing……………………………………………………..35

iv

2.3 Assessing the current status of laws and regulations controlling genetically

modified food and feed in Jordan…………………………………………………36

CHAPTER 3: RESULTS & DISCUSSION

3.1 Local production of maize………………………………………………………...37

3.2 Incidence of 123 bp and 390 bp DNA fragments in genetically modified maize...43

3.3 Sequencing results of genetically modified maize with second band…………….45

3.3.1 Alignment sequence analysis…………………………………………………….47

3.3.2 Genetic event of genetically modified maize……………………………………48

3.4 Results of survey analysis………………………………………………………....52

3.5 Major findings of laws and regulations governing genetically modified food and

feed………………………………………………………………………………...76

3.5.1 Current status of bio-safety laws in Jordan……………………………………83

3.5.2 Summary of Jordan biosafety framework, draft by law and latest national report

on the implementation of the Cartagena Protocol on

Biosafety…………………......................................................................................88

Discussion……………………………………………………………………………...…91

Conclusions and Recommendations……………………………………………………...96

References ………………………………………………….……………………….…..100

Annexes………………………………………………………………………………….107

Arabic Abstract………………………………………………………………………..…178

v

LIST OF TABLES

NUMBER TABLE CAPTION PAGE

1.6 EU Biotech Regulations. 20

2.1.5 – A

Sequences of primers used in PCR amplification

experiments and sizes in Base pairs (bp) of PCR

amplified DNA fragments.

30

2.2.1 Numbers of surveys carried out in different

organizations around Jordan.

34

3.1-A Total quantities and price of yellow maize imported from

different countries around the world from 1994 -2010. 38

3.1-B Self-Sufficiency Ratio (SSR) of maize, Jordan, 2002 –

2010. 39

3.1- C Biotec Mega Countries. 41

3.1-D Jordan imports of maize from different countries between

1994 -2010. 42

3.2

Incidence of 123 bp and 390 bp DNA fragments in

maize (food and feed) samples and country of origin, +

and – indicate presence and absence of DNA fragments

respectively.

46

3.3 The amplified DNA sequences obtained from 390 bp

DNA sequence.

49

3.3.1

Sizes in base pairs (bp) of PCR amplified DNA

fragments when using specific primers for detection of

GM maize MON810/JBU.

51

3.5 Current status of GMO regulations in different Arab

Countries. 79

0 Jordan status with regard to Cartagena Protocol treaty. 85

vi

LIST OF FIGURES

NUMBER FIGURE CAPTION PAGE

1.1 The composition of the new genetically modified

(GM) DNA construct.

6

1.2-A Major Cultivation of GM crops. 8

1.2-B Estimated number of farmers cultivating GM crops

worldwide.

9

23.12.1.3

Experimental procedure for extraction of genomic

DNA from plant.

26

2.1.4

Determination of DNA concentration using a

spectrophotometer and an Eppendorf

Biophotometer.

28

2.1.5 Graphic illustration of a section of the GM maize

cassette with the CaMV 35S-promoter and the

maize hsp70 intron, and relative position of primers

mg1,mg2,mg3 and mg4.

32

3.13.1

Total production of yellow maize in Jordan between

1994- 2010.

37

3.2-A

Agarose gel electrophoresis revealing incidence of

123 bp and 390 bp DNA fragments in extracted

DNA from standard maize MON810/JBU1.

44

3.2-B Agarose gel electrophoresis for the detection of

amplified PCR products of maize samples.

45

3.3.1 The matching sequence of second sequence 390 bp

(V3) which matches a plant transformation vector

PSITEII-8C1.

47

3.3.2-A Agarose gel electrophoresis for the detection of

amplified nested products for standard maize

MON810/JBU1.

49

3.3.2-B Agarose gel electrophoresis for the detection of

amplified PCR products with p35S (F,R) for

standard maize MON810/JBU1.

49

3.3.2-C Agarose gel electrophoresis for the detection of

amplified PCR products.

50

vii

NUMBER FIGURE CAPTION PAGE

2.3 3.4 - A Pie charts of participants demonstrating socio-

demographic characteristics: (A) age, (B) gender,

(C) marital Status, (d) educational background, (e)

the university major specialty and (F) educational

level.

53

3.4 - B General awareness of participants on basics of

biotechnology.

55

3.4 – C

General knowledge of participants on genetically

modified Food.

59

3.4 – D Participants‟ perception on laws and ethical

standards governing GM food.

66

3.4 – E Economical and environmental awareness of

participants in GM food & feed.

70

viii

LIST OFABBREVIATION

ARM Antibiotic Resistant Marker

BT Bacillus Thuringiensis Toxin

BLAST Basic Local Alignment Search Tool

BC Before Christ

DNA Deoxyribonucleic Acid

CBD Convention on Biological Diversity

DNTP Deoxynucleotide Triphosphates ("building blocks" for DNA)

DOS Department of statistics

EFSA European Food Safety Authority

EPA Environmental Protection Agency

EU European Union

FAO Food and Agricultural Organization

FDA Food and Drug Administration

GMO Genetically Modified Organism

g The force of gravity, (1 g is equal to the force of gravity at the

Earth's surface, which is 9.8 meters per second).

Ha Hectare

JAEC Jordan Atomic Energy Center

JBU1 Jordan Bio-safety Unit

JFDA Jordan Food and Drug Administration

LMOs Living Modified Organisms

Mha Million hectare

Nm Nanometers, (measurement unit of wave length)

NCBI National Center for Biotechnology information

ix

MoEnv Ministry of Environment

MON Monsanto

NCARE National Center for Agricultural Research & Extension

NGO Non Governmental Organization

PCR Polymerase Chain Reaction

PC Binding Buffer

PE Elution Buffer

PL1 Lysis Buffer

PL2 Lysis Buffer

PW1 Wash Buffer

PW2 Wash Buffer

USA United States of America

UV Ultra Violet

RSS Royal Scientific Society

SSR Self Sufficiency Ratio

SPSS Statistical package for social science

X Concentration of Suspension

TAE Tris base Acetic acid and EDTA

x

LIST OF ANNEXES

NUMBER ANNEX TITLE PAGE

1

A: Detection of GM Food Training Certificate in the

Molecular Biology Laboratory of the University of

Applied Sciences Northwestern Switzerland (N/W)

107

B: Equipments used in the laboratories of the School

of Life Sciences/Institute of Chemistry and Bio

analytics/University of Applied Sciences

Northwestern Switzerland FHNW.

108

2 Quantities and country of origin of the imported

yellow maize to Jordan in different years

109

3

A: Protocol for extraction of genomic DNA from

plant

116

B: Protocol for extraction of genomic DNA from

agarose gel

121

4

A: Forward Sequencing of the second band with

390 bp length.

122

B: Reverse sequencing of the second band with

390bp length.

120

5 List of interviewee and visited organizations 123

6

A: Ratification list of Cartagena Protocol on

Biosafety

126

B: Ratification list of Nagoya – Kuala Lumpur

Protocol on Biosafety

131

7

A: The complete survey on genetically modified

food in English.

133

B: The complete survey on genetically modified

food in Arabic

138

C: Official response of department of statistics on

the methodology of survey dissemination.

143

D: Survey results 144

8

A: Jordan By-Law for bio-safety of genetically

modified organisms (2006)

163

B: Draft of Jordan Law for bio-safety of genetically

modified organisms (2013)

171

xi

A STUDY ON THE GUIDELINES STATUS AND THE

PREVALENCE OF GENETICALLY MODIFIED PRODUCTS IN

JORDAN

By

Nawar El Husseini

Supervisor

Prof. Mohammed Abdulkader Ibrahim Al-Obaide

Co- Supervisor

Dr. Nisreen Daifallah Al-Hmoud

ABSTRACT

Genetically modified (GM) crops are providing supply for ever increasing demand

of food and feed; however, there are concerns about their biosafety. Many unlabeled

genetically modified products have started to appear in the Jordanian market, this raise a

question about the origin of these products and whether the genetic events are

authorized. This research study intends to investigate this issue in-depth as it aims at the

detection of GM maize food and feed in the Jordanian Market. It also seeks to examine

Jordanians awareness towards GM products, and look into the current status of laws and

regulations as well as examine the ethical and religious views of the public regarding

this subject.

The research methodology included reviewing related articles and previous

studies, looking through the internet and documentaries, and most importantly

collecting maize samples from the market and carrying out lab experiments for

detection of maize GM products. This was followed by developing a survey and

interviewing people from public/ private sectors and several governmental & non-

governmental institutions.

Experimental results have shown that out of 40 maize samples collected 29

(72.5%) were found to be genetically modified. Moreover 20 GM maize samples (69%)

were found to contain genetic element of 390 bp in addition to 123 bp sequence. The

results showed that the primer pair normally used to amplify a 123 bp DNA fragment of

the standard CaMV P-35S promoter also amplified a 390 bp DNA fragment in GM

maize.

xii

The results of Jordanians awareness towards GM products showed that out of the

400 people who were surveyed 18 % said that they know very well what genetically

modified food is. However out of this percent very few people gave the exact right

scientific answer. When asked about their religious and ethical views more than 45 %

said their judgment depends on the nature of the change i.e (the kind of species it was

taken from) and the reason behind this change. 75.5 % of the people stressed that it is

very important to label genetically modified food, and 80 % think that the government

must enact strict law and set regulations which control and monitor the genetically

modified products (GM) products and prevent the entry of unauthorized GM products.

In 2004, Jordan came out with a National Bio-safety Framework and a Proposed

By-Law for bio-safety of Genetically Modified Organisms which was published in

gazette in 2006. Recently, the Ministry of Environment in collaboration with specialists

from governmental, non-governmental organizations and universities has prepared a

bio-safety law which we hope to be put into force as soon as possible.

1

Introduction

This thesis intends to discuss the “Guidelines Status and the Prevalence of Genetically

Modified Products in Jordan”. The real reason behind choosing this topic was first a

personal interest in the field of genetics and the DNA which withholds countless

number of hidden secrets that is still waiting to be revealed until this day. Moreover the

researcher was motivated to investigate the new emerging molecular biotechnologies

and their impact on the environment, food supply, and our health. This in addition to the

desire to raise the awareness and improve Jordanians understanding of the pros and cons

of the spread and consumption of genetically modified (GM) food, as well as to

improve and alert the local government to examine, monitor and control the plantation

and entry of such products to Jordan without the public knowledge or consent.

The first insertion of bacterial gene into a plant appeared in 1983. Later on and in 1994

was the first production of GM tomato, which entered the USA market (Jensen, 2009).

Switzerland was one of the first countries to place a labelling law for GM food, in 1998

the European Union had stopped the approval of new GM crops for import or

cultivation on European soils (Weasel, 2009).

Many previous studies have pointed out that gene technology is under great

controversy, which has started in Europe in the 1980s and is still problematic until this

day in many parts of the world. Other studies revealed that around 58 % of Americans

are unaware of the difference between the GM and normal foods. (Jebreen, 2010)

The Cartagena Protocol on bio-safety recognized the growing public concerns of GMOs

risks to human health and biodiversity. In this respect, several studies on the bio-safety

2

issue of GM crops showed negative effects on health. A recent study showed the risk of

feeding experimental animals with commercialized GM maize. The negative effects

were mostly associated with kidney, heart, adrenal glands, spleen, hematopoietic system

and liver (Seralini et al., 2012).

On the other hand some scientists support this technology and think that it is a new

science, which aims to increasing yields, strengthening resistance to diseases, pests and

herbicides, shortening crops maturation time, engineering new products and improving

growing techniques which will eventually increase food security for the growing

population. This in addition to that GMOs could be used in scientific and medical

research.

Accordingly, this study intends to investigate the prevalence of GM maize which is

present in the Jordanian market. It also seeks to examine Jordanians awareness

regarding the different issues of GM food and feed and measure their knowledge and

understanding of this subject. Additionally, it will assess the current laws and

regulations that control GM food and feed entry, plantation and consumption in Jordan.

Finally, the study aspires to research the ethical and different religious views of GM

food and feed.

In order to achieve the above goals, the research had begun with the collection of maize

food and feed samples from Jordanian market, followed by lab experiments to detect the

presence of GM products. Secondly, a survey was developed to tackle many aspects,

such as public background of biotechnology, GM food, laws and moral standards

related to GM food and feed. These surveys were then disseminated to several

institutions in different regions of Jordan (Amman, Irbid and Tafilah). Additionally,

there were several structured and semi structured interviews with several key persons

3

from public and private sectors in Jordan in order to acquire more information on the

current status of the regulatory system regarding the GM products entry and trade as

well as to understand how governmental institutions act in response to the presence of

such products.

Problem Statement

The Conflict of the Study

There has been lately a great controversy surrounding Genetic Engineering Technology

as a result of many factors; as the lack of in-depth and comprehensive expertise in that

specific field, the spread of GM food and feed without the knowledge of the public,

insufficient laboratory testing, and absence of bindings laws that hold all parties who

trade and deal with these products accountable.

Many scientific researches carried out worldwide show that the impacts of such

products may be harmful to human health and the environment. Other researches point

out to the fact that the impact is still unknown; conversely some researches state that

GM products are useful and have no harm at all. This as well as many uncertainties and

ambiguities that encircle this technology.

Goals of the Study

This study aims to detect the occurrence of GM maize from food and feed which are not

labeled in the Jordanian Market. It also seeks to examine Jordanians awareness towards

GM products and assess their knowledge concerning different issues related to

consumption, trade, regulations, religious and ethical views through a survey

questionnaire; the specific survey‟s objectives were to:

4

- Provide baseline data that will help guide future researchers to understand the

population trend towards dealing with GM products.

- Assess the Jordanians knowledge on GM products and their prevalence and measure

the degree of public acceptance of the appearance and spread of GM products in their

daily diet.

- Explore participants understanding about the risk factors associated with the

consumption of GM food.

- Provide recommendations about the high priority issues that must be dealt with to

protect the health and safety of humans and their environment.

Furthermore, one of these research goals is to study the current status of laws and

regulations that should control GM food and feed entry, plantation and consumption in

Jordan. Moreover, this study has also looked into ethical and some religious views

against the consumption of GM food and feed.

The Major Drive behind the Study

The primary motive that encouraged the researcher to carry out this study stemmed

from the personal interest in the mysteries of the genome which carries numerous

numbers of recipes that forms humans, animals, plants, bacteria, viruses and many other

living organisms on earth. This tiny little nano-molecule called DNA withholds

countless number of hidden secrets that is still waiting to be unfolded till this day.

Additionally, the desire to improve our country‟s system to monitor, control and

efficiently manage the entry of GM products together with all the facts that were

mentioned in the two above sections created a very strong driving force to perform this

research.

5

Chapter 1 Literature Review

1.1 What genetically modified food is

Genetic Engineering (GE) is a selective deliberate process of transferring a gene or

genes that has a certain desirable trait from one species and then moving it to another

unrelated species. In other words, it is a manipulation and alteration of the genetic

material (constitution) of an organism in such a way as to allow it to produce different

(foreign) proteins. Some other words often applicable to the same process are gene

splicing, gene manipulation, or recombinant deoxyribonucleic acid (DNA) technology

(Rees, 2006). For example a gene could be transferred from bacteria or animal to plants

to gain required property; a gene responsible for conferring antifreeze property in

Flounder (an ocean-dwelling flatfish species that is found in coastal lagoons and

estuaries of the Northern Atlantic and Pacific Oceans) was transferred to a tomato so it

can gain its antifreeze properties (McHughen, 2000). Another example is the transfer of

a gene coding for Bacillus thuringiensis (BT) toxin from a soil bacterium and moving it

into a potato genome, so it can produce its own pesticide (Smith, 2003).

Accordingly, the process of genetic engineering involves first selecting the DNA

segment that has the desired trait, then taking it out from the donor species (like bacteria

or other organisms as mentioned in the above examples), cloning it inside bacterial

vector, and then transferring it to the genomic DNA of the new host like maize, tomato,

potato or to any other organism. The transferred gene is within new DNA construct

which is associated with what is called a promoter and marker gene, Figure (1.1).

Marker gene is necessary in order to give a signal for the successful insertion of the new

gene into the plant or target organism. The promoter sequence is required to express its

desire trait in the new host. Consequently, the strategy for development of GM plants

http://en.wikipedia.org/wiki/Flatfish

http://en.wikipedia.org/wiki/Estuary

http://en.wikipedia.org/wiki/Northern_Atlantic

http://en.wikipedia.org/wiki/Pacific_Ocean

6

includes adding useful characteristics such as herbicide tolerance and insect and virus

resistance (Hu, 2007).

Figure (1.1): The composition of the new GM DNA construct.

There are several techniques that are used to insert the new construct into the host's

DNA in the host‟s genomic DNA. These techniques use vectors (plasmid, virus or

transposon) for the DNA insertion into host‟s genome (Miragliaa, 2004).

As a result of insertion of the foreign DNA by the genetic engineering technology,

DNA sequences from bacteria, viruses, animal and plants DNA can be transfered into

host‟s genome. It is seen as acceptable and natural for genetic information to be

transferred vertically among the same species from generation to generation. However,

it is not usual or normal to transfer DNA horizontally between different species or

kingdoms (Wickson, 2004).

1.2 The historical background and global cultivation of GM crops

The beginning of agricultural activity took place in the Mediterranean region long time

ago at about 11,000 BC; grains were the first crops to be planted. Mesopotamian

developed a method of breeding of various cereal crops. Currently, about nine grain

crops (rice, wheat, maize, sorghum, millet rye, barley, common bean, soybean and

groundnut) provide about 80% of the plant nutrients used by humans (CABI Publishing,

2009).

Genetic engineering had first appeared in the early 1970s, as with the advancement of

science. Scientists knew that with the intelligent methods they had developed they may

Marker Gene Promoter Transgene Terminator

7

be able to move sequences of the DNA and transfer it from one species to another

(Weasel, 2009). In 1983, the first plant transformation appeared

Which was the insertion of bacterial gene in tobacco, nonfood plant. The first field

experiment was undertaken in 1986. This was followed by economic production in the

year 1992 in china. In 1994, the first modified food tomato “FlavrSavr“entered the

market in the USA (Hu, 2007).

In 1996, the first commercial genetically-modified maize”Bt Corn” (corn modified with

a bacterium gene to give it insect resistance) was planted in the United States. In the

same year, Roundup Ready Soybeans (soybeans resistant to Roundup herbicide) started

to be grown as well (Halford, 2003).

In 1997 GM maize has started to spread from USA to Canada. Now it is being grown in

13 countries occupying more than 35 million hectares i.e. 24% of area worldwide

(Hellmich et al., 2008). However among all the GMO varieties, soybeans remain the

most common GMO plant (Hu, 2007).

Following these successes of GM Crops, the DNA technology was adopted so quickly

to develop new genetically modified (GM) plants that by 1999 more than 40 genetic

modifications related to 13 different crops had been approved and produced in 12

countries, as well as distributed among other countries through international trade

(Kaphengst et al., 2011).

On the other hand, public opposition against GM food in Europe led to the introduction

of strict regulations, consequently only few countries were able to grow GM crops. The

following crops: soybean, cotton, maize and rapeseed occupied more than 143 million

hectare in 23 countries in 2007.

It is worth noting that there are around 29 countries planting GM crops; out of these, 19

are developing countries and 10 are industrialized countries, Figure (1.2-A). For the last

8

Figure (1.2-A): Major Cultivation of (GM) crops.

Other biotech countries: 0.3 mha (Australia, Bulgaria, Colombia, Germany, Honduras,

India, Indonesia, Mexico, Philippines, Romania, Spain and Uruguay)

(Source: http://news.bbc.co.uk/2/hi/science/nature/3711507.stm)

15 years, farmers have been planting biotech crops on an area as large as the United

States. 48% of global GM crops are planted by developing countries which will very

soon overtake the industrial countries in total hectares. In 2010, the number of farmers

who have adopted this technology reached 1.5 million which summed up to 15.4 million

farmers worldwide Figure (1.2-B); 90 % of these farmers (poor - small resource) are

from developing countries (James, 2010).

http://news.bbc.co.uk/2/hi/science/nature/3711507.stm

9

Figure (1.2-B): Estimated number of farmers cultivating GM crops worldwide

In the year 2010, BT maize and AM-flora high quality potato was grown by eight

European countries, AM-flora is considered as the first EU approval for planting GM

crops in thirteen years (James, 2010).

A new feature „stacked traits „has lately appeared in GM crops, US has the largest

hectares of the stacked traits. For example a new type of biotech maize called smart

stacks was released in USA and Canada in 2010, these stacks contains eight genes

conferring resistance to two pests plus herbicide tolerance (James, 2010). Many people

believed that biotech crops contribute to food and feed fiber security, helps to save the

land and also alleviate poverty and hunger; moreover, it reduces agricultural

environmental footprint. On the other hand, many others are totally against the

plantation of such crops because they believe that it might have a harmful, unknown and

long term impact on human health and on the environment.

10

1.3 Public perceptions and consumers acceptance of GM food & crops

in different parts of the world

The major argument related to gene technology had first appeared in Europe in the

1980s during the industrial application of gene technology just before the

commercialization stage of genetically engineered products. Later on, many studies had

found that the major driver for the acceptability or rejection of certain emerging

technologies such as GM foods is the public risk perceptions and fears, although these

have not yet been integrated within the regulatory system (Frewera, 2004).

In the United States, some studies found that Americans were somehow addicted to the

consumption of corn and soy although they did not know that they were eating GM

products added to processed food in so many products. Thus, it is not that Americans

are not concerned about GM food but it is the fact that they are not well informed about

it (Weasel, 2009). Some studies revealed that 58% of Americans were ignorant towards

the difference between the GM and normal foods.

A study conducted in Europe concluded that consumers are concerned about most of the

unknown risk that comes with the consumption of GM products (Gaskell et al., 2004).

On the other hand, in Colombia for example it was found that around 66% of

populations were willing to purchase GM foods due to lack of high quality food

(Pachico, 2002). One research found that 90% of Nigerians had good knowledge of GM

products but worried about the ethical issues associated with genetic engineering

technology (Kushwala et al., 2004). In Zambia, one of the major reasons behind

refusing GM food aid was the fear that they would contaminate the country‟s own non-

GM seed stock (Weasel, 2009).

In October 2002, the governments of Zimbabwe, Zambia, Mozambique and Malawi

refused a US food aid shipment as they had suspected the presence of GM maize. Many

11

of South Africans believes that such kind of aid is not about or it has a little to do with

the issue of famine at all; instead it aims to promote the adoption of genetically

engineered crops in South Africa, and thus expanding the market access of transnational

corporations and undermining local smallholder production and as a result causing

greater food insecurity on the Continent (Zerbe, 2004).

Onyango, 2004 (as cited in Jebreen, 2010), reported that the moment consumers are

fully aware of the GM food risk their readiness to purchase such products greatly

diminish.

On the other hand, people who support biotechnology claim that genetic modification of

crops is not a new technology since traditional plant breeding programs is used to

altering the genes of crop plants for thousands of years (Tester, 2001).

Supporters of biotechnology who come primarily from United States as well as from

other countries considered to be GM exporters, like Canada, Australia, and Argentina

accused their opponents of allowing millions of Africans to starve because of their

refusal and skepticism about the risks of consuming GM foods (Zerbe, 2004).

Some of the reasons behind the acceptance of GM food among consumers are poverty

and lack of sufficient knowledge of the products. In developing countries positive

opinions toward GM foods came as a result of urgent needs for food availability and its

nutritional content (Jebreen, 2010). Other attractive feature that may convince

consumers to purchase GM foods is its price, packaging, availability or the convenience

of its preparation (Frewera, 2004).

On the other hand, Mathew and Huffman 2001 (as cited in Jebreen, 2010) reported that

the opposition of GM foods may be due to ethical reasons, health concerns, possible

environmental impacts and trade worries; the opinions of people also varies from one

12

country to another. In most cases, proper information about the GM products has a

valuable role in people attitudes (Jebreen, 2010).

Nowadays the majority of food sold in our regional grocery stores contains GM food

ingredients without the consent or knowledge of people. As many people say, we are

now in the middle of the biggest feeding experiment in history (Smith, 2003).

1.4 Health risks, environmental impacts and biosafety of GM food

and feed

It was found that there are some advantages & disadvantages that might impact the

environment as a result of using GM crops that are insect-resistant for example. This

applies to genetically engineered BT crop which has a soil bacterium (Bacillus

thuringiensis) gene that is capable of protecting itself from a certain insect without the

use of any insecticide, but this not only harms the target insect it also harms other types

of useful insects such as monarch larvae. Knowing that some insects are vital and

crucial components in other animal and insect food chain, this can cause a decline in the

number of some animal population. Thus, we conclude that we should search for other

options that reduce the use of pesticides and preserve the environment at the same time

(Amin, 2009).

Another finding related to the example mentioned earlier about the gene transferred

from the flounder fish into a tomato or strawberry in order to gain the antifreeze

properties. This would benefit farmers and merchants; however in order to do this an

artificially constructed vectors is used to multiply copies of genes, and in some cases, to

carry and smuggle genes into cells. This kind of insertion may have a harmful effect

(Al-Hayani, 2007).

In the United States, GM potatoes that had a gene from a soil bacterium similar to

Bacillus anthrax are all officially classified as pesticides by the US Environmental

13

Protection Agency (EPA). However, the US Food and Drug Administration (FDA) have

declared that they consider GM crops to be safe and that they offer similar nutritional

value as their natural counterparts. This declaration is considered as a basis in US policy

which permitted millions of acres of GM food to be planted, sold and eaten without

prior safety testing (Smith, 2003).

Pusztai, as reported in (Smith, 2003) found shocking results during his research on GM

potatoes; he noticed that rats which were fed on GM Potatoes suffered from a damaged

immune system, due to a slow response of white blood cells compared to those in rats

fed on non-GM potato. Organs like spleen and thymus were somehow damaged; the rats

fed on GM potato had smaller, less developed brains, livers and testicles. Other rats had

enlarged tissues, including the pancreas and intestines. In addition, structural changes

and proliferation of cells in the stomach and intestines, this may indicate an increased

probability of getting cancer. Adding to this, the nutritional content of some GM

potatoes which were different from their non- GM parent lines.

A recent research investigated health risks by using hamsters to study the effects of GM

food, the scientists found that in the second generation of hamsters the growth rate was

lower and sexual maturity was delayed compared to natural conditions. This in addition

to that the mortality rate for hamsters that ate GM Soy was five times higher than the

hamsters who did not eat soy. What is also shocking is that all the third generation of

GM soy eating hamsters were sterile (unproductive) and also experienced hair growing

inside their mouths (Surov, 2010).

Recent results demonstrated the harmful effects of GM maize on mice when fed for two

years in comparison with mice fed on non-GM maize. For example Females developed

large mammary tumors and all treated groups died 2–3 times more than controls, and

more rapidly, Biochemistry data confirmed very significant kidney chronic deficiencies

14

.(Seralini et al., 2012).

Monsanto (which is one of the world‟s largest multinational agricultural biotechnology

corporations and is also a leading producer of genetically engineered seeds) intellectual

property protection rules do not allow farmers to keep, store or replant the seed from

their harvest which is considered an old conventional practice in agriculture. This forces

farmers to keep returning to the source each year paying each time to get the seeds for

planting. Many farmers were also attacked by such corporations when GM plants were

found on their fields without purchasing agreements (Weasel, 2009).

If we recall the process of genetic engineering and the means by which the new DNA

construct is transferred either physical (e.g. gene gun or electroporation) or biological

(e.g. agrobacterium), it was found that the exact location where the new construct gene

is inserted in to the genome is not controlled. This randomness has raised many

questions and worries on how might this impact the organism‟s overall genetic

structure, function and response. One possible effect might be the pleiotropic effect

which may result in new interactions with the host organism genetic code producing

unintended effects and not just the desired trait, another effect is the effect where the

new inserted gene is silenced (Wickson, 2004).

The silencing of a gene may occur if the new construct gene ends up right in the middle

of the original gene, this happened in an experiment and the mouse embryos ended up

dying, this means that silencing of native genes may have many unpredictable

outcomes. During the testimony of Michael Hansen of the consumer union in front of

the Environmental Protection Agency (EPA) of USA, he warned that if genetic

engineering turned off a native gene which is responsible for preventing the expression

of a certain toxin, this may cause the level of that toxin to increase (Smith, 2003)37.

15

It is also worthy to mention that nowadays GM testing of crops covers important

agronomic and nutritional traits; however, it may not detect other changes that may

occur in the plant‟s secondary metabolism, and this means that we still lack experience

and data on what ecological interactions may arise coming to a conclusion that the

impact of GM crops on the environment is considered an area with a high degree of

scientific uncertainty and even ignorance (Wolfenbarger, 2000).

Other scientists say that genetic engineering is a hit and miss issue. Genes might be

transferred in the wrong way or several copies may spread through the plant genome;

they may be inserted inside other genes damaging their function or activity; as a result

the whole genetic makeup may become unstable with unknown results, and as

mentioned earlier genes might switch on or off unexpectedly with unpredictable

impacts. Instability of DNA is considered a familiar feature in genetic engineering; in

about thirty surveyed companies which are developing GM crops, all had observed this

event (Smith, 2003).

There are other serious concerns from many scientists that when humans and animals

consume GM food, an Antibiotic Resistant Marker (ARM) (which is used to find out

what cells of the thousands that exist on the plate have the foreign gene in their DNA)

might transfer into the bacteria that is found in the digestive system; if this occurs, it

might cause a new and dangerous antibiotic resistant diseases. This is one of the major

reasons why the British Medical Association called for a moratorium on GM foods

(Smith, 2003). 37

It is also believed that those who will benefit the most from the spread of GM products

are the multinational biotechnology companies which are currently being backed up and

supported by mass media that is trying hard to convince the world that GM products is

16

the miracle that will solve the world famine, lower the dependence on pesticides and

cure diseases of humankind (Kuiper, 2010).

1.5 Ethical and religious views of biotechnology and GM food

The reason behind ethical opposition of GM food revolves around the harm it may

cause to humans, living things, the environment or biodiversity; it may also extends to

unjustified pain to animals used in research and production.

Some Researchers say that it is difficult to know if harms outweigh potential benefits

for GM food unless research, field tests and data analysis is conducted to come out with

a scientifically informed assessment.

One of the arguments that drive GM supporters to encourage biotechnology is that it has

humanitarian goals such as ending hunger; on the other hand, GM opponents perceive

biotechnology as unnatural (National Agricultural Biotechnology Council Report,

2001).

In times before the year 1999, people did not relate crop biotechnology with impacts on

the environment or on endangered species; however in that specific year, there were

some reports that BT crops may harm monarch butterflies; this news has awakened

people on the possible adverse effects of GM crops on wild species for the first time

(Smith, 2003).

Opponents of GM food view it as a threat to the environment and to other non-

transgenic crops as the GM plants may contaminate organic or non-transgeneic crops,

by pollen drift or by mixing up with the original seed supply.

17

Some people think that transferring genes horizontally or between species is something

that we should not do. They believe that if this happens then its the end of nature, they

say that we shouldn‟t play in this matter; it is not only about ethics, it is about moral

principles of protecting the environment.

In the United States for example, one of the ethical principles used to win over

American consumers in favor of GM food is to convince them that it is the only solution

for solving the world hunger problem and feed the world (Coward, 2009).

People who criticized biotechnology noted that transgenic crops is being used in the

production of drugs as well as industrial products; they believe that these products must

be controlled or even restricted to limit the environmental exposure to human health

hazards (Coward, 2009).

In Islam for example, ethics were mentioned in Quran (the holy book of muslims) and

through Prophet Mohammad (peace be upon him) teachings in the Hadith or Sunnah. In

Islam, ethic is classified into three parts: ethical issues related to Allah, ethics among

human beings, and ethics related to living things. There is a proverb that we muslims

believe in and that is “Religion is all about how you treat others”. It is expected to

practice these ethics and any muslim who does not follow them or harm others will be

punished, or has to compensate those who were harmed (Al-Hayani, 2007).

Some muslims believe that genetic engineering is about manipulating creatures and

interfering with Allah creation; in Quran, Allah has stated that he is the only one who

can create everything and has the power to control everything in the universe, (Al Imran

3:190). There is another verse which says that humans cannot create something as

perfect as Allah great creations, as God is the maker and has all the knowledge and

secrets of things that no human will ever have the ability or the capability to produce

18

anything that is healthy, complete and perfect. This verse is: “O men! Here is a parable

set forth! Listen to it! Those on whom, besides Allah, ye call, cannot create (even) a fly,

if they all met together for the purpose! and if the fly should snatch away anything from

them, they would have no power to release it from the fly. Feeble are those who petition

and those whom they petition!” (Al-Qur‟an, Al Hajj 22:73). However, it is worth

mentioning that there is no creation in GM technology, it is kind of manipulation.

Another aspect of biotechnology for muslims is the source of the gene if it was taken

from forbidden animal food such as swine, this can only be found out through lab

testing (Amin, 2009).

Christianity people‟s attitudes vary from those who support such advancement to those

who are totally against it, and there are others who stand in between. The Old Testament

(Romans 14:17) mentioned that “The kingdom of God is not about eating and drinking

but righteousness, Peace and Joy in the Holy Spirit”. (Coward, 2009). This means that

in developing GM food, biotech companies must ensure the safety and security of its

products through comprehensive research prior to releasing it in the market.

1.6 Laws & regulations controlling the prevalence of GM food and

feed

Back in 1995, Switzerland was one of the first countries in the world to institute a

labeling law of GM products. During 1996 the first shipments of GM maize and soy

bean reached the European shores coming from the US, this has triggered several

environmental and consumer groups to protest against the technology the thing that

attracted a widespread of media attention (Weasel, 2009).

In 1998, the European Union had bunged the approval of new GM crops for import or

cultivation on European soils. In the year after, five EU countries announced the

19

prohibition of GM crops awaiting for the policy makers to set regulations that would

require traceability and labeling of all GM products. Switzerland on the other hand was

free from EU constraints as it had its own GM labeling policy which was already in

effect.

On the 29th

of January 2000, more than 130 countries (Jordan was among these

countries) adopted the Cartagena Protocol on Biosafety; this protocol is considered as

an international agreement which aims to ensure the safe handling, transport and use of

living modified organisms (LMOs/GMOs) resulting from modern biotechnology that

may have adverse effects on biological diversity, taking also into account risks to

human health. This agreement entered into force on 11th

of September 2003 (Weasel,

2009).

One great advancement towards regulating GMOs in Europe was the establishment of

the European Food Safety Authority (EFSA) in January 2002 and it is based in Parma,

Italy. This authority consists of 21 scientific experts from several European research

bodies, universities and risk assessment institutions. Some of the EFSA responsibilities

includes coming out with guiding documents for risk assessment of GMOs, using

animal feeding trials for testing of whole GM/ food/feed, post-market environmental

monitoring in addition to many other duties (Kuipera, 2010).

Furthermore, a new legal framework was designed by the European Commission to deal

with bio safety problems. This framework covers the whole food/feed chain, it also

incorporate procedures for the authorization of GMOs; this framework includes several

actors as the European Commission, EFSA, competent authorities of member states and

regulatory and standing committees of EU member states‟ representatives, and the

councils of ministers. The process follows what is called the comitology rule and this

refers to the committee system which oversees the delegated acts implemented by the

http://en.wikipedia.org/wiki/Parma

http://en.wikipedia.org/wiki/Italy

20

European Commission. However, this system is known to be complex, demand

extensive timeframes, and decision-making lacks transparency and decisiveness in

making final decisions. Today the European Union requires labeling on all GM foods

containing transgenic material (Kuipera, 2010).

The EU present legislation in relation to genetically modified organisms (GMOs)

control topics as environmental aspects and food and feed safety, measures for

commercialization and labeling terms (Miragliaa, 2004). Table (1.6) shows key events

in EU biotech regulations.

Table (3.51.6 ): EU Biotech Regulations.

Year Key Events in EU Biotech regulations

January, 2000 White Paper (clarifies the issue and background) on food safety

January, 2000 Communication on the precautionary principle

January, 2000 Cartagena Protocol on Biosafety adopted

March, 2001 Council and EP adopt directive 2001/18, replacing 90/ 220 on

deliberate release of GMOs

January, 2002 Establishment of European food safety Authority

May,2003 US launches WTO complain over EU regulation of GMO

September, 2003 Council and EP adopt regulation 1830/2003 on GM food and feed

September, 2003 Council and EP adopt regulation 1829/2003 on GM food and feed

April, 2004 Entry into force of regulations 1829/2003 and 1830/2003

May, 2004 Commission ends moratorium with approval of Bt-11 Maize

May, 2005 Commission orientation debate, decision to press ahead with new

approvals- challenge member state bans.

June, 2005 Environment council rejects commission efforts to overturn

national safeguard bans

September, 2006 WTO ruling in EC biotech dispute

July, 2007 Member state fails to agree on approval of GM potato for

cultivation

November, 2007 EU environment commissioner Dimas proposes to deny approval

of two GM maize varieties for cultivation

January, 2008 France announces new national ban on MON810

May, 2008 Removal of Austrian safeguard ban on sale of two varieties

commission delays approval of seven new varieties pending new

studies

http://en.wikipedia.org/wiki/European_Commission

21

Year Key Events in EU Biotech regulations

July, 2008 French EU presidency announces creation of group to consider

strengthening EU regulations on GMOs

Source: (Pollack and shaffer, 2009)

In Australia for example, ethical committees and community consultation does exist

within Australia‟s regulatory framework. However, these entities have no influence over

the decision making process as the other scientific experts committees and this is caused

by the type of approach selected which denies the concept of a social risk (which is

defined as the risks of negative impacts on social structure or the violation of basic

moral beliefs) (Wickson, 2004).

Regarding to labeling policies, in the United States GM food labeling is considered

voluntary; however, in Japan and Europe it is mandatory. It was found that labeling of

GM food may cause the increase in the consumers‟ rejection of GM food (Abdel-

Mawgood, 2006 as cited in (Jebreen, 2010)). It is believed by many scientists that it is

necessary to specify the GM content on the product in order to give consumers the

freedom of whether to buy the product or not (Jebreen, 2010).

One of the greatest responsibilities of governments toward their people is to design a

holistic regulatory framework for GM crops considering scientific, social, ethical and

religious aspects; this will for sure guarantee a safer and healthier environment for the

people. It will also control the spread of such products, and thus minimize their possible

negative impacts on the biological and social environments (Wickson, 2004).

22

Chapter 2 Research Methodology

This Chapter includes an overview and description of the approach that was followed in

performing this research study. A clear picture on the means of data gathering

techniques is given such as lab experiments, surveying, interviewing, etc. Moreover, a

section is dedicated to present data analysis methods that were used to obtain the most

important findings and conclusions.

The initial investigation began by carrying out a lot of background reading and literature

review of subjects related to GM products prevalence in different parts of the world and

the conflicts that came out as a result. This was an on-going process, and this initial

reading influenced the selection of the study focus; and contributed to the formation of

research objectives.

This research utilized quantitative and qualitative methods for data gathering. For

example the literature review, the analysis of relevant documents, as well as the semi-

structured interviews are all considered qualitative methods. Whereas, structured

interview, collection of public perception through surveys, and maize samples analysis

in the laboratory are all form of quantitative methods.

There are several reasons behind the detection of GMOs, one of these is to measure to

what extent GMOs are spread among food and feed in a certain market like the

Jordanian market. It could also be used to reveal unauthorized products (Holst-Jensen,

2009). Detection of GMOs is necessary as well to acquire certification of purity and

identity crop material, which is an approach, used to distinguish between GM and non-

modified crop products (Elsanhoty, 2010).

23

Simple methods are usually used to test for a single trait or GMO event, alternatively

multiple or combination of methods are required to detect the presence of multiple

events. The entry of unauthorized GMOs is considered one of the biggest challenges

these days especially for those countries that lack any laws, regulations or a well

structured framework to control the entry of GM food (Holst-Jensen, 2009).

2.1 Prevalence of genetically modified maize in Jordan

2.1.1 Collection of maize samples from Jordanian market

Quantities of maize grown in Jordan as well as the quantities imported from abroad and

the prices associated with them were obtained from Department of Statistics Annex (2).

The collected data were summarized and presented in a bar chart in order to enable the

audience to observe the trend in the quantity grown locally and that which is imported

from abroad through time. Usually in a bar chart the categories (which represent the

years 1994-2010) are shown along the horizontal axis and the frequencies (which are

the costs) are indicated on the vertical axis. Additionally all the interviews that were

undertaken were interpreted and all the relevant information was extracted and recorded

in this research.

A total of forty commercial maize products were obtained during the period of study.

These were obtained from different outdoor markets, supermarkets, bakeries and

Animal Wealth department of Amman, Jordan. Standard maize samples, genetically

non-modified (ERM-BF413a) and GM MON 810 maize (BF413f) were obtained from

Dr. Eric Kubler. These samples were originally purchased from European Commission,

DG JRC and IRMM, Belgium. MON810/JBU1 was obtained from the Biosafety Unit-

RSS.

24

General equipments used:

Following equipment were used in this study: 1.5 ml microcentrifuge tubes

(NucleoSpin®Plant II), Disposable tips, Manual pipettes, Microcentrifuge (RIBO-

SPAIN eppendorf), Analytical Balance (KERN AL J 220-4), Vortex Mixer, (KMC-

1300 V, Vision Scientific), Heating block (dry bath incubator),Grinder, Themocycler

(PCR, VERITI with 96 wells), Electrophoresis system (MIDI plus-1 horizintal gel

system model:ME10-7), Power supply (MS major science, MP- 300 V),

Transilluminator and documentation system (compact UV tables type SNGLE, ECX-

20-M), Eppendorf Biophotometer, Infrared oven, Fridge (4oC), Freezer (-20

oC),

Googles and a Micropippete).

2.1.2 Samples pretreatment

Grinding of corn samples

Corn samples were finely grounded using a small electrical grinder with three blades;

this step is considered necessary as the plant tissue is very robust and the lysis

procedure later on will be most effective with a well homogenized sample. The grinder

was carefully cleaned using soup and water, and then washed by ethanol (three times);

afterwards, by hypochlorite (three times), and finally the grinder was washed with

double distilled water. Cleaning of grinder was carried out to ensure sterility and avoid

cross contamination among different samples.

All samples were kept inside sterile small plastic bottles and labeled with all

information including number of sample, country of origin and date of collection.

25

2.1.3 Lab procedure for extraction of genomic DNA from plant

DNA was extracted from ground corn samples by using the kit method. The extracted

DNA was kept at -20 °C until it was used for further molecular tests. The procedure for

extraction of DNA from maize samples was as indicated by supplier in Annex (3-A).

(NucleoSpin® Plant II kit from MACHEREY-NAGEL (MN) Switzerland).

The kit contains the following solutions: Lysis Buffer PL1, Lysis Buffer PL2,

Precipitation Buffer PL3, Binding Buffer PC, Wash Buffer PW1, Wash Buffer PW2,

Elution buffer PE, RNase. Some of these solutions (PW2, RNase) need to be prepared

as follows before conducting molecular analysis experiment: first 100 ml of ethanol (96-

100%) was added to Wash Buffer PW2, then 600 µl of H2O was also added to RNase A,

which was then divided into small aliquots and stored at -20 C°. After that Elution

Buffer PE was Preheated to 70 °C.

DNA extraction was carried out as followes: Around 100 mg dry weight of

homogenized corn sample was transferred to an eppendorf tube (1.5 ml) where 400 µl

of cell lysis Buffer PL1 was added; this buffer contains chaotropic salts, denaturing

agents, and detergents. The mixture is then vortexed and 10 µl of RNase A is added and

mixed, after that the suspension is incubated for 10 minutes at 65C° in a heating block

(Figure 2.1.3). The following step was for the filtration and clarification of crude lysate

where a new collection tube (2 ml) was prepared and a violet ring “NucleoSpin Filter”

was placed into that tube. The lysate was then loaded onto the column and centrifuged

for 2 minutes at 11,000 x g, the clear flow-through was then collected and the

NucleoSpin filter was discarded.

26

(a) (b)

(c) (d)

(e)

Figure (2.1.3): Experimental procedure for extraction of genomic DNA from

plant. (a) Balance (b) Eppendorf tube (c) Heating block (d) Spinfuge (e)

Microcentrifuge

27

In order to adjust DNA binding conditions, 450 µl of the buffer PC is added to the

clear flow from the previous step and mixed thoroughly by pipeting up and down

five times or by vortexing. Around 700 µl of the sample was then loaded to a

NucleoSpin Plant II Column “green ring” that was placed into a new collection

tube (2ml). Then it is centrifuged for 1 minute at 11,000 x g, where the flow-

through was discarded. The next step aims to wash and dry Silica Membrane; in

the first wash 400 µl Buffer PW1 was added to the NucleoSpin Plant II Column

and then it was centrifuged for 1 minute at 11,000 x g and the flow through was

also discarded, the second wash was the same as the first one but with the addition

of 700 µl of Buffer PW2, the third wash was performed similarly but with the

addition of 200 µl Buffer PW2 and then centrifuged for 2 minutes at 11,000 x g in

order to remove wash buffer and dry the silica membrane completely.

The preceding step aims to elute DNA, where the NucleoSpin Plant II Column

from the previous step was placed into a new 1.5 ml microcentrifuge tube. 50 µl

from the PE Buffer (70°C) was loaded on to the membrane and then the

NucleoSpin Plant II Column was incubated for 5 minutes at 70°C. Finally the

sample is centrifuged for 1 minute at 11,000 x g to elute the DNA. This step was

repeated with another 50 µl Buffer PE and eluted into the same tube.

Finally the extracted DNA was kept at -20 C° until it was used for subsequent steps.

28

2.1.4 Determination of DNA purity and concentration:

The concentration of the extracted DNA was measured at 260 nm against a blank using

a spectrophotometer/ an Eppendorf Biophotometer. (Figure (2.1.4)). The ratio

A260/A280 was used to estimate the purity of extracted DNA in “ηg/µL”. A number of

measurements were conducted to determine DNA purity for some samples results

varied between 10.7- 48.6 ηg/µL.

(a) (b)

2.1.5 DNA amplification by qualitative Polymerase Chain Reaction (PCR)

After the extraction of DNA from maize samples, and in order to detect the presence of

GM in the 40 maize samples collected from the Jordanian market, Polymerse Chain

Reaction PCR analysis were carried out by using specific primers.

Table (2.1.5-A) shows the sequences of primers used in the study. Primer pair p35S-cf3

forward and p35S-cr4 reverse were used to amplify the 35S promoter CaAM35S; whereas

the genetic event MON 810 maize was identified by using the specific primer pairs

Figure (2.1.4): Determination of DNA concentration using: (a)

spectrophotometer and (b) an Eppendorf Biophotometer

29

mg1/mg2 and mg3/mg4. Other primers which were used to identify the genetic events are

also shown in the table, for the details see the result section.

Table (2.1.5-A): Sequences of primers used in PCR amplification experiments and sizes in base pairs

(bp) of PCR amplified DNA fragments.

Primers Sequence ( 5´ - 3´)

Length of

amplified

sequence

CaMV 35S promoter

p35S-cf3, F:

p35S-cr4, R:

CCACGTCTTCAAAGCAAGTGG

TCCTCTCCAAATGAAATGAACTTCC 123

MON 810 specific (nested PCR)

mg1

mg2

TATCTCCACTGACGTAAGGGATGAC

TGCCCTATAACACCAACATGTGCTT 401


mg3

mg4

ACTATCCTTCGCAAGACCCTTCCTC

GCATTCAGAGAAACGTGGCAGTAAC 149

MON 810 new

(F )

(R)

TCG AAG GAC GAA GGA CTC TAA CGT

GCC ACC TTC CTT TTC CAC TAT CTT

-

MON 863 Primer

(F )

(R)

GTAGGATCGGAAAGCTTGGTAC

TGTTACGGCCTAAATGCTGAACT 84

NK 603 Primer

(F )

(R)

ATG AAT GAC CTC GAG TAAGCTTGT TAA

AAG AGA TAA CAG GAT CCACTCAAACACT 108

MON 88017 Primer

(F )

(R)

GAG CAG GACCTG CAG AAGCT

TCC GGA GTTGACCATCCA 95

Primer GA21

(F )

(R)

CGT TAT GCT AAT TGC AAC TTTAGAACA

GCG ATC CTC CTCGCG TT 101

390new REV 1

REV 2

AGC TGG GCA ATG GAA TCC GAG

TGG AAT CCG AGG TTT CCG

-

PCR reaction mixture

The PCR amplifications were performed and each PCR reaction mixture (50 μl final

volume) contained: 5 μl of 10x PCR Buffer, 5 μl of 25 mM MgCl2, 0.25 μl of Taq DNA

polymerase from the Top Taq TM PCR kit (Qiagen/Germany), 2.5 μl of 16 mM dNTPs

(Promega/Germany), 1.25 μl of a 20 μM solution of each primer, 32.75 μl nucleasefree

water and 2 μl of extracted DNA (10.7- 48.6 ngMl-1), (Querci et al., 2006).

30

Amplification of CaMV 35S region

The conditions for PCR amplifications experiments for CaMV 35S promoter primers

used for detection of GM maize food and feed products were: 3 minutes initial

denaturation at 95ºC followed by 50 cycles of 25 s denaturation at 95 ºC, 30 s annealing

at 62ºC, 45 s extension at 72ºC and a final 7 minutes extension at 72 ºC.

Nested PCR

The amplification conditions of nested PCR experiments were carried out according to

the standard protocols (Querci et al., 2006). Parameters for PCR amplifications

experiments for specific primers mg1/mg2 and mg3/mg4 used for detection of specific

genetic event of MON810 GM maize (Figure 2.1.5) were: 3 minutes initial denaturation

at 95ºC followed by (35 cycles for mg1/mg2 and 40 cycles for mg3/mg4) of 45 s

denaturation at 95ºC, 50 s annealing at 60ºC, 50 s extension at 72ºC and a final 3

minutes extension at 72ºC.

2.1.6 Gel Electrophoresis

Agarose gel (1.0 %) containing ethiduim bromide with final concentration of 0.5 µg/ml

were prepared in 1X TAE buffer. Samples of DNA were mixed with 1/5 volume of

loading buffer and added to the well on the gel. Generally, the gel buffer was added up

to the level of horizontal gel surface and gels were run for 1 hour at 3-5 v/cm. DNA

bands were visualized by UV illumination at 366 nm wavelength on UV illuminator

(Sambrook and Russell, 2001).

31

Figure (2.1.5): Graphic illustration of a section of the GM maize cassette with the CaMV 35S-promoter and

the maize hsp70 intron, and relative position of primers mg1,mg2,mg3 and mg4. (Querci, 2006)

Sequencing of the 390 bp DNA fragment

The large DNA fragment of 390 bp was extracted and purified from agarose gel by

using the PCR clean-up gel extraction according to the protocol described by the

manufacture (NucleoSpin ® Extract ll Kit purchased from MACHEREY-NAGEL,

Germany). The 390 bp fragment was removed from the agarose gel, weighed and

transferred to a clean sterilized tube. Two hundred ml of NT buffer was added, the

sample was then incubated at 50 °C for 10 minutes and vortexed for 2 to 3 minutes until

the gel slice was completely dissolved. The obtained solution was placed in Nucleospin

extract II column and the extraction of the fragment was continued according to the

recommended procedure. The extracted DNA was kept at -70 C° until further use.

Frozen samples of extracted DNA were then sent to Synergene Biotech GmbH

(Schlieren /Switzerland) for DNA sequencing.

32

Analysis of the DNA sequences

The complement strand for the reverse primer p35S-cr4 was obtained by using the tool

in (http://www.cellbiol.com/scripts/complement/reverse_complement_sequence.html).

The Basic Local Alignment Search Tool (BLAST) of the NCBI website

(http://blast.ncbi.nlm.nih.gov/Blast.cgi) was searched for the source of 390 bp sequence.

2.2 Examining Jordanians awareness on different issues of GM Food

and Feed

One of the other foremost important goals of this study was to examine Jordanians

awareness regarding the different issues of GM food and feed, and measure their

knowledge and understanding of this subject.

2.2.1 Survey methodology

During the preparation of the survey, a literature review was undertaken to study the

approach followed in previous surveys on similar subjects. The design of the

questionnaire was based on the indicators reported in the reviewed papers (Chern et al.,

(2002); Jebreen (2010); Frewera (2004); Han (2006); Demirci (2008)), discussion with

the supervisors and Dr Hind Al Hammouri, specialist in measurement and evaluation

from the Hashemite University. The survey included 34 indicators/questions which

were designed to determine the extent of people knowledge and acceptance of GM food.

Thirty of them were closed ended and four indicators were open ended. It was decided

to compile each group of indicators/questions with a similar topic under a specific

theme (category). Consequently, the questions in the survey were compiled under five

different themes/categories based on the questions content and subjects; these themes

are: Socio-demographic characteristics of participants (theme with 6 indicators),

http://www.cellbiol.com/scripts/complement/reverse_complement_sequence.html

33

biotechnology background of surveyed individuals (five indicators/questions), public

background of GM food (nine indicators/questions), laws and ethical issues related to

GM food and feed (seven questions), and economical and environmental awareness of

participants in GM food and feed (seven indicators). The five categories and 34

indicators are shown in Annex (6-A) (questionnaire is presented in Arabic and English).

Ms Gaida Al- Khasawneh from the Department of Statistics was consulted regarding

choosing a representative sample for the survey to obtain most accurate opinions and

perceptions of Jordanians towards GM food. It was agreed to disseminate 400 survey

forms to several university students and/or employees and governmental departments

employees, where all should be above 18 years old and from different educational levels

(High School Certificate and above); Annex (7-C). Based on the recommendation from

the Department of Statistics, the 400 survey forms were disseminated to Ministry of

Environment, 5 universities and 2 research centers; Table (2.2.1). These were in “Irbid”

(North), Amman (Middle), and “Al Tafila” (South).

Table (2.2.1): Numbers of surveys carried out in different organizations around Jordan.

Name of Organization Surveyed Number of completed surveys

1. El Hassan Science City /Royal Scientific

Society (RSS) 61

2. Jordan Atomic Energy Commission (JAEC) 35

3. Ministry of Environment (MoEnv) 21

4. Jordan Food and Drug Administration (JFDA) 15

5. University of Jordan 52

6. Princess Sumaya University for Technology

(PSUT) 38

7. German Jordan University 7

8. Jordan University of Science & Technology

(JUST) (in the north of Jordan). 100

34

9. Al Tafila University ( in the south of Jordan) 71

Total 400

2.2.2 Data entry and processing

Following the completion of the survey, the 400 questionnaires were numbered from 1

to 400. The indicators of the survey were analyzed using the SPSS (Statistical package

for social science) version 19 software and employing descriptive statistics i.e

frequencies procedure which provides statistics and graphical displays that are useful

for describing many types of variables. In order to regulate the data entry process and

set the variables, each indicator in the survey beginning with demographics was given a

number and then is recorded in what is called the variable view sheet in the SPSS

software. Each numbered indicator/question is then labeled i.e., the whole question is

recorded and all the multiple choice answers related to this question are assigned values

from 0 to 4 depending on how many answers there are per indicator, then the indicators

are labeled; for example for the question of Gender the two choices are: 0: Male and 1:

Female etc. After inserting all the survey questions and answers in the variable view

sheet, the responses of 400 participants will be inserted in the data view sheet.

Descriptive frequencies were used for analysis and to describe the basic features of the

data. In addition, graphs and figures were used to provide a visual summary of the

findings. The graphical displays included pie charts which are considered a good tool

for assessing the relative frequencies of each category, and a bar chart which helps to

visually compare the relative frequencies.

35

2.3 Assessing the current status of laws and regulations controlling

genetically modified food and feed in Jordan

An important part of the study is to investigate the current laws and regulations which

control the GM food and feed in Jordan. This was achieved by conducting structured

and semi structured interviews with several key persons from public, private sectors and

governmental sectors in Jordan; i.e., ministries, research centers, universities, NGOs etc.

During the structured interviews several issues related to the research subject were

discussed. Through an organized set of questions to get basic understanding on

qualitative matters such as: The current status of food and feed testing and types of tests

in Jordan, and whether there is a monitoring system of imported food and feed. Other

questions inquired about the existing laws, regulations or provisions regarding GM food

and feed and if these are activated or not. There were also semi-structured interviews;

these included general discussions on the GM products to get information of people‟s

knowledge and their acceptance and attitude towards this issue. Annex 5-A shows the

list of interviewee and visited organizations.

36

Chapter 3

Results

3.1 Local production of maize

According to the information collected from the Department of Statistics on the 17th

of

November 2011, the amounts of yellow maize produced locally in Jordan during the

period 1994-2010 are shown in Figure (3.1).

Figure (3.1): Total production of yellow maize in Jordan during the period 1994-

2010.

The local production of yellow maize crop is mainly used as food for humans and the

left over may be used as animal feed, and since the need of yellow maize as animal feed

is huge and could not be secured by local production, Jordan has been importing large

quantities of yellow maize from different countries around the world to be consumed as

animal feed to cover its deficiency in this product. Table (3.1-A) show quantities and

37

prices of the imported yellow maize from countries all over the world during the period

1994 to 2010.

Table: (3.1-A) Total quantities and price of yellow maize imported from different countries around the

world during the period 1994 -2010

Year of

Import Total quantity of maize imported

Ton /year

Price of maize

imported

(JOD)

1994 329,266.26 28,440,914

1995 383,944.32 35,464,305

1996 487,262.57 58,470,076

1997 89,758.12 8,541,377

1998 54,405.97 4,431,626

1999 26,054.666 1,894,823

2000 477,261.67 36,546,872

2001 485,422.60 37,312,998

2002 516,562.41 40,630,120

2003 564,408.19 51,870,996

2004 470,058.61 51,231,458

2005 475,386.72 47,131,765

2006 524,932.93 51,834,315

2007 494,991.12 77,779,186

2008 524,779.47 110,094,408

2009 650,117.33 124,560,324

2010 577,403.43 114,509,041

Total 7,132,016.39

880,744,604

Source: Department of Statistics (DOS), 2011

Table (3.1-A) shows that for 16 years and during the period 1994 and 2010, Jordan

imported 7,132,016 Ton of yellow maize, and had incurred the government of Jordan

around 880,744,604 Million JOD, and these are indeed considerably huge numbers.

38

These amounts are imported each year from different countries all over the world such

as (Canada, United Russia, Romania, Egypt, Israel, India, Ethiopia, Ukraine, Spain,

USA, Bulgaria, Brazil Uruguay, Lebanon, Argentina, Paraguay, Muldoof, Turkey,

South Africa, Egypt, Syria, Iraq etc…..), Annex (2).

Table (3.1-B); show that there is a wide gap between exports and imports of maize in

Jordan. It is quite clear that imports exceeds exports and this is reflected in the Self

Sufficiency Ratio (SSR) which demonstrates the ability of Jordan or any country to

grow its own food and become economically independent and not need any aid or

support to survive and cover the needs of its own people. To be more specific the self-

sufficiency ratio expresses the magnitude of production in relation to domestic

utilization i.e. it is calculated as follows SSR = Production / (Production + imports –

exports) X 100, source (FAO).

Table (3.1-B): Self-Sufficiency Ratio (SSR) of maize in Jordan between 2002-2010

Year SSR % Exports

(Ton)

Imports

(Ton)

Production (Ton)

2002 2.9 0.00 469,624 13,800

2003 2.0 0.00 513,098 10,700

2004 3.4 1062 427,326 14,800

2005 6.7 677 430,182 30,783

2006 3.0 6,263 477,212 14452

2007 3.8 2,366 449,992 17,781

2008 1.6 1,877 477,072 7,835

2009 3.9 31,950 525,211 19,754

2010 5.3 5,083 525,238 29,006

Source: Department of Statistics, Jordan (2011)

39

The figures shown in table (3.1-B) demonstrate the importance of working on

innovative ideas to increase the production of yellow maize in Jordan. Accordingly, all

concerned parties (governmental organizations, universities and NGOs) should work

Closely in research projects to come out with solutions to increase maize production.

Moreover, the production could be increased by intensifying local plantation of maize

for animal feed, or by searching for alternatives local resources of yellow maize used for

feed which serves the same purpose as maize. This issue should be prioritized when

setting strategic plans of ministries of Agriculture or Environment or any other relevant

entity since around 86 % of maize planted in the United States is GM and around 26%

of maize planted and traded worldwide is considered genetically modified (Nass, 2010).

If we compare both tables below we notice that the countries shaded in grey in table 3.1-

D) are all present in tables (3.1-C); this means that there is a high probability that Jordan

might have been importing GM food since 1994 or early nineties without being aware

of this because there has been no monitoring system or testing program for the food

merchants being imported from abroad.

40

Table 3.1-C): Biotec Mega Countries

Rank Country Area (Million

Hectares)

Biotech crops

1 USA 66.8 Maize, Soybean, Cotton, Canola,

Sugar beat, alfalfa, Papaya,

Squash

2 Brazil 25.4 Soybean, Maize, Cotton

3 Argentina 22.9 Soybean, Maize, Cotton

4 India 9.4 Cotton

5 Canada 8.8 Canola, Maize, Soybean, Sugar

beats

6 China 3.5 Cotton, Papaya, Poplar, tomato,

Sweet Pepper

7 Paraguay 2.6 Soybean

8 Pakistan 2.4 Cotton

9 South Africa 2.2 Maize, Soybean, Cotton

10 Uruguay 1.1 Soybean, Maize

11 Bolivia 0.9 Soybean

12 Australia 0.7 Cotton, Canola

13 Philippines 0.5 Maize

14 Myanmar 0.3 Cotton

15 Burkina Faso 0.3 Cotton

16 Spain 0.1 Maize

17 Mexico 0.1 Cotton, Soybean

18 Colombia < 0.1 Cotton

19 Chile < 0.1 Maize, Soybean, Canola

20 Honduras < 0.1 Maize

21 Portugal < 0.1 Maize

22 Czech Republic < 0.1 Maize, Potato

23 Poland < 0.1 Maize

24 Egypt < 0.1 Maize

25 Slovakia < 0.1 Maize

26 Costa Rica < 0.1 Cotton, Soy Bean

27 Romania < 0.1 Maize

28 Sweden < 0.1 Potato

29 Germany < 0.1 Potato

Total 148

Source: (James, 2010)

41

Table (3.1-D): Jordan imports of maize from different countries between 1994 -2010

1994 1995 1996 1997 1998 1999 2000 2001 2002

Lebanon South

Africa

United

States

Turkey Ukraine Bulgaria Argentina Argentina Argentina

Argentine Argentine Argentine United

States

Hungary Australia USA Brazil USA

United

States

United

States

Turkey Israel Romania Ukraine Canada USA Canada

Italy - - Italy Yugoslavia Turkey Bulgaria Turkey Romania

China - - Australia Bulgaria - Australia South

Africa

Hungaria

India - - - - - Turkey Egypt Canada

Turkey - - - - - South

Africa

- Turkey

- - - - - - UAE - South

Africa - - - - - - - - Lebanon - - - - - - - - Iraq

42

Source: Department of Statistic (www.dos.gov.jo), 2002

2003 2004 2005 2006 2007 2008 2009 2010

Argentina Argentina Argentina Argentina Lebanon Canada Canada Canada

USA Brazil

USA Brazil

Egypt Romania United

Russia

United

Russia

Brazil USA Ukrane USA Israel Lebanon Romania Romania

Turkey India India Italy USA Egypt Egypt Egypt

South Africa Egypt Turkey Ukrane Brazil Israel Israel Israel

Egypt Syria Egypt Turkey Turkey India India India

Syria Iraq Syria Egypt Syria Croatia Ethiopia Ethiopia

Iraq -

Lebanon Syria

Argentina United

Kingdom

Ukraine Ukraine

- - - Lebanon Sudan Ukraine Spain Spain - - - - - Spain USA USA - - - - - Yugoslavia Bulgaria Bulgaria - - - - - USA Brazil Brazil - - - - - Bulgaria Uruguay Uruguay - - - - - Brazil Argentina Argentina - - - - - Syria Paraguay Paraguay - - - - - Argentina Muldoof Muldoof - - - - - Sudan - -

- - - - - Hungary - -

http://www.dos.gov.jo/

43

3.2 Incidence of 123 bp and 390 bp DNA fragments in genetically

modified maize

Biosafety Unit at RSS started in 2008 monitoring GM maize and soybean. The primer

pair (p35S-cf3, forward and p35S-cr4, reverse) was used to amplify a 123 bp fragment of

the standard 35S promoter (CaM35S) for detection of GM maize samples collected from

local markets. Moreover, these studies showed the amplification of second DNA

fragment of 390 bp in some samples (Al-Hmoud et al., 2010; Al-Rousan et al., 2010).

In the current investigation, the tested maize samples which originate from different

countries around the world were subjected to molecular analysis with the above

mentioned primers. 19 of purchased maize samples were used for human consumption

and 21 of maize samples were used as animal feed. Samples were obtained between

January 2011 and March 2012. The origins of samples were: Argentina, Bulgaria,

Canada, Israel, Jordan, Romania, Syria, Ukraine and USA.

Out of 40 maize samples tested, 29 samples (72.5 %) were found to be carrier of

CaAM35S suggesting that they contained genetically modified maize. Furthermore, the

results showed that 9 maize samples out of the 29 (31%) revealed only a single DNA

fragment of 123 bp which was amplified by the 35S promoter specific primers. On the

other hand, the remaining 20 maize samples contain a second DNA fragment of 390 bp

which was also amplified by p35S (Table 3.2, Figure 3.2 A-B). The 390 bp DNA

fragment was not detected in wild type maize (ERM-BF413a) and control GM maize

[MON810 maize (BF413f) and MON863 (ERM-BF416d)]. The researcher carried out

further work to investigate the nature of the genetic element of 390 bp.

44

Figure ( 3.2-A): Agarose gel (1%) electrophoresis revealing 123 bp and 390 bp

DNA fragments in extracted DNA from standard local maize MON810/JBU1.

Table (3.2): Incidence of 123 bp and 390 bp DNA fragments in maize food and feed samples and

country of origin, (+) and (–) indicate presence and absence of DNA fragments respectively.

Type of maize Country of

origin

No. of

samples

123 bp

(GM indicator)

390 bp

(Gateway

Vector)

Food

Egypt 1 1 (+) 1 (+)

Italy 1 1 (+) 1 (+)

Jordan 13 12 (+)

1 (+)

12 (+)

1 (-)

Syria 1 1 (+) 1 (-)

USA 4 1 (+)

1 (+)

2 (-)

1 (+)

1 (-)

2 (-)

Feed

Argentina 1 1 (+) 1 (-)

Bulgaria 3 1 (+)

1 (+)

1 (-)

1 (+)

1 (-)

1 (-)

Canada 1 1 (+) 1 (+)

India 2 2 (-) 2 (-)

Israel 6 3 (-)

1 (+)

2 (+)

3 (-)

1 (-)

2 (+)

Romania 4 2 (-)

2 (+)

2 (-)

2 (-)

Ukraine 2 1 (-)

1 (+)

1 (-)

1 (-)

USA 1 1 (+) 1 (+)

Total number

of samples

- 40 29 (+)

11 (-)

20 (+)

20 (-)

123 bp

390 bp

50

100

150

0

1350

200

400

123 bp

390 bp

50

100 150

0

1350

200

400

45

Figure (3.2-B): Agarose gel (1.5%) electrophoresis for the detection of

amplified PCR products for maize samples

3.3 Sequencing Results of genetically modified maize with second Band

The large identified DNA fragment of 390 bp was extracted and purified from agarose

gel by using the PCR clean-up gel extraction kit as mentioned in materials and methods

section. The isolated DNA fragment was then sequenced by Synergene Biotech GmbH

(Schlieren/Switzerland). Annex (4-A, B) show the sequencing results as received from

the company.

The results of sequencing of 390 bp DNA fragment which was obtained by the specific

primer p35S-cf3, F (V1), primer p35S-cr4, R(V2a) and the reverse sequence

complement of primer p35S-cr4, R (V2c) are shown in the Table (3.3).

The same table shows the reverse sequence complement of V2a which is designated as

V2b and the sequence (V3) which was constructed from the combination of the two

sequences V1 and V2b; taking into the account the sequences of forward primer (p35S-

cf3) and reverse complement of backward primer V2c.

Ladder -ve 2 3 6 7 8 9 11 12 13 14 15

100bp

50bp

390bp

50bp 400bp

50bp 123 bp

46

Table (3.3): The amplified DNA sequences obtained from 390 bp DNA fragment. V1 (amplification product

of p35S-cf3, F), V2a (amplification product of p35S-cr4, R), V2b (reverse complement of V2a, V2b (reverse

complement of p35S-cr4, R) and V3 (constructed sequence from V1 and V2b sequences). V3 sequence is used

in the BLAST and MATLAB Bioinformatics analysis.

Sequences of amplified 390 bp fragment (5’ 3’)

Length of

Sequence sequence

V1

AAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAA

AGGCCATCGTTGAAGATGCCTCTGCCGACAGTGGTCCCAAAGATGG

ACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAAC

CACGTCTTCAAAGCAAGTGGATTGATGTGATATCTCCACTGACGTA

AGGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTA

TATAAGGAAGTTCATTTCATTTGGAGAGGAAG

260 bp

V2a

CTTGCGAGGATAGTGGGATTGTGCGTCATCCCTTACGTCAGTGGAG

ATATCACATCAATCCACTTGCTTTGAAGACGTGGTTGGAACGTCTTC

TTTTTCCACGATGCTCCTCGTGGGTGGGGGTCCATCTTTGGGACCAC

TGTCGGCAGAGGCATCTTCAACGATGGCCTTTCCTTTATCGCAATGA

TGGCATTTGTAGGAGCCACCTTCCTTTTCCACTATCTTCACAATAAA

GTGACAGATAGCTGGGCAATGGAATCCGAGGAGGTTTCCGGATATT

ACCCTTTGTTGAAAAGTCTCAATCGGACCATCACATCAATCCACTTG

CTTGAAAGACGTGGA

342 bp

V2b

TCCACGTCTTTCAAGCAAGTGGATTGATGTGATGGTCCGATTGAGA

CTTTTCAACAAAGGGTAATATCCGGAAACCTCCTCGGATTCCATTG

CCCAGCTATCTGTCACTTTATTGTGAAGATAGTGGAAAAGGAAGGT

GGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCCATCGTTG

AAGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCAC

GAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAA

GCAAGTGGATTGATGTGATATCTCCACTGACGTAAGGGATGACGCA

CAATCCCACTATCCTCGCAAG

343 bp

V2c AAGTTCATTTCATTTGGAGAGGA 23 bp

V3

TCCACGTCTTTCAAGCAAGTGGATTGATGTGATGGTCCGATTGAGA

CTTTTCAACAAAGGGTAATATCCGGAAACCTCCTCGGATTCCATTG

CCCAGCTATCTGTCACTTTATTGTGAAGATAGTGGAAAAGGAAGGT

GGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCCATCGTTG

AAGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCAC

GAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAA

GCAAGTGGATTGATGTGATATCTCCACTGACGTAAGGGATGACGCA

CAATCCCACTATCCTCGCAAGACCCTTCCTCTATATAAGGAAGTTCA

TTTCATTTGGAGAGGAAG

386 bp

47

3.3.1 Alignment sequence analysis

The sequence V3 was copied to the NCBI website:

(http://blast.ncbi.nlm.nih.gov/Blast.cgi) in order to search for the source of 390 bp

sequence, NCBI website was used since it finds regions of local similarity between

sequences. The website contains tools which compares nucleotide or protein sequences

to sequence databases and calculates the statistical significance of matches. BLAST can

also help to identify members of gene families. It was found that the sequence (V3)

represent or match a Plant transformation vector PSITEII-8C1, which has the following

sequence (Figure 3.3.1):

Figure (3.3.1): The matching sequence of second band 390 bp (V3) which

represent or match a plant transformation vector PSITEII-8C1. Source:

(http://blast.ncbi.nlm.nih.gov/Blast.cgi)

181 tacccataat agctgtttgc caaccggtca acatgtggag cacgacacac ttgtctactc

241 caaaaatatc aaagatacag tctcagaaga ccaaagggca attgagactt ttcaacaaag

301 ggtaatatcc ggaaacctcc tcggattcca ttgcccagct atctgtcact ttattgtgaa

361 gatagtggaa aaggaaggtg gctcctacaa atgccatcat tgcgataaag gaaaggccat

421 cgttgaagat gcctctgccg acagtggtcc caaagatgga cccccaccca cgaggagcat

481 cgtggaaaaa gaagacgttc caaccacgtc ttcaaagcaa gtggattgat gtgataacat

541 ggtggagcac gacacacttg tctactccaa aaatatcaaa gatacagtct cagaagacca

601 aagggcaatt gagacttttc aacaaagggt aatatccgga aacctcctcg gattccattg

661 cccagctatc tgtcacttta ttgtgaagat agtggaaaag gaaggtggct cctacaaatg

721 ccatcattgc gataaaggaa aggccatcgt tgaagatgcc tctgccgaca gtggtcccaa

781 agatggaccc ccacccacga ggagcatcgt ggaaaaagaa gacgttccaa ccacgtcttc

841 aaagcaagtg gattgatgtg atatctccac tgacgtaagg gatgacgcac aatcccacta

901 tccttcgcaa gacccttcct ctatataagg aagttcattt catttggaga ggacgtcgag

961 agttctcaac acaacatata caaaacaaac gaatctcaag caatcaagca ttctacttct

1021 attgcagcaa tttaaatcat ttcttttaaa gcaaaagcaa ttttctgaaa attttcacca

1081 tttacgaacg atagccatgg ggccggccat gagtgtgatt aaaccagaca tgaagatcaa

P35s-cf3 (f)

forward

primer

Reverse

complement

of P35s-cr4

(R) Reverse

primer

P35s-cf3 (f)

forward

primer

Sequence of the second band (390 base pair)

found in Plant transformation vector

PSITEII-8C1

http://blast.ncbi.nlm.nih.gov/Blast.cgi

http://blast.ncbi.nlm.nih.gov/Blast.cgi

48

The DNA sequence which starts from the base pair 500 to 954 (each letter is counted as

one base pair; the number in the beginning of the line to the left is taken like 481 until

the first letter in the forward primer P35S-cf3 (f) which counts to 500. If we look to line

901 we notice that at 930 base pair the reverse complement of P35s-cr4 (R) of reverse

primer which ends at 954, if we subtract 954 from 500 we get 454 which should be the

length of the product we sent for sequencing. But the one we sent for sequencing was

390 bp, we can justify this since our product is found at 696 bp, and from 607 until 954

there is 347 bp but we have additional 39 bp so we end up with 386 bp (≈390).

3.3.2 Genetic event of genetically modified maize

Further PCR experiments were undertaken in order to identify the specific event carrying

the 390 bp amplified fragment. Figure (3.3.2-A) shows the results of nested PCR analysis

of identified GM maize MON810/JBU1 carrying the large DNA sequence. Primers mg1,

mg2 were used to amplify DNA fragment equivalent to 401 bp, then this DNA fragment

was amplified by mg2, mg3; mg3, mg4; mg1, mg4 the products were of 330bp,149bp,

274bp, respectively. This technique was found effective for the detection of a specific

transgenic (MON810) event. Theoretical basis of the obtained results of nested PCR

experiment is demonstrated in Figure (2.1.5); it is possible to indicate that the tested GM

maize contained the hsp70 exon1/intron1 region of maize MON810.

Terminator

49

Figure (3.3.2-A) Agarose gel electrophoresis for the detection of amplified nested

products for maize MON810/JBU1, Lane 1: Ladder; Lane 2: 401 bp sequence

identified by mg1, mg2 primers; Lane 3: 330bp sequence identified by mg2, mg3

primers; Lane 4: 149 bp sequence identified by mg3, mg4 primers. Lane 5: 274 bp

sequence identified by mg1, mg4 primers. Electrophoresis was performed on 1.5%

agarose gel and run with 3 volt cm-1

.

Furthermore, the second band of 390 bp that has appeared with the P35S primers is still

unknown; Figure (3.3.2-B) is part of a series of PCR experiments, which aims to

investigate the origin of the 390 bp sequence detected by 35S Primers.

Figure (3.3.2-B) Agarose gel electrophoresis for the detection of amplified PCR

products with p35S (F, R) for maize MON810/JBU1. Lane 1: Ladder; Lane 2:

390bp & 123bp sequences identified by p35S primers; Lane 3: Duplicate of

previous sample; Lane 4: 123 bp sequence identified by p35S primers with MON

863 maize. Lane 5: Duplicate of previous sample. Electrophoresis was performed

on 1.5% agarose gel and run with 3 volt cm-1

.

This PCR experiment was conducted to investigate the origin of 390bp second band that

appeared in maize MON810/JBU; it was compared to the maize event MON 863 in lane

4. However, as shown in the figure above, MON 863 gave only one band (123bp) with

1 2 3 4

5

401bp 330

bp 149

bp

274bp

1 2 3 4 5

390bp 123bp

123bp

50

P35S primers; thus, the maize MON810/JBU1 is not the MON 863 event.

Consequently, the investigation was continued in a similar manner.

Figure (3.3.2-C): Agarose gel electrophoresis for the detection of amplified PCR

products. Lane 1: Ladder; Lane 2: maize MON810/JBU1 with Mon 863 (F,R);

Lane 3: Duplicate of previous sample; Lane 4: maize MON810/JBU1 with Mon 880

(F, R); Lane 5: Duplicate of previous sample; Lane 6: maize MON810/JBU1 with

NK 603 (F, R); Lane 7: Duplicate of previous sample, Lane 8: maize

MON810/JBU1 with LY038 (F, R); Lane 9: Duplicate of previous sample; Lane 10:

maize MON810/JBU1 with GA21 (F, R); Lane 11:Duplicate of previous sample.

This experiment is part of a series PCR experiments that intends to investigate the

second band in the maize MON810/JBU1. Figure (3.3.2-C) shows a band with 95bp in

size (Lane 4), and a band of 70 bp size (Lane 6); NK 603 (F,R) should give 108bp band.

Therefore, the Maize MON810/JBU1 may be a second generation/ hybrid between Mon

880, NK 603 and MON 810 Table (3.3.1). Although the assumption that the sample

might be infected by a virus is also possible.

1 2 3 4 5 6 7 8 9 10 11

95b

p 70b

p

51

Table (3.3.1): Sizes in base pairs (bp) of PCR amplified DNA fragments when using

specific primers for detection of GM maize MON810/JBU1

Primers Amplified DNA fragment

detected in this study

CaMV 35S promoter

p35S-cf3, F:

p35S-cr4, R:

Detected


mg1

mg2

Detected


mg3

mg4

Detected

MON 863 Primer

(F)

(R)

Not detected

NK 603 Primer

(F)

(R)

Not detected

MON 88017 Primer

(F)

(R)

Detected

Primer GA21

(F)

(R)

Not detected

52

3.4 Results of survey analysis

During this study, a survey was conducted to test the awareness, perception and

attitudes of 400 people toward GM food and feed products. An assessment was

conducted according to the individual‟s response towards GM products based on five

categories of indicators/questions. The Arabic and English versions of the questionnaire

are shown in Annex (6-A, B). The SPSS analysis of the data is shown in Annex (6-D).

The results of the investigation of first category “socio-demographic characteristics of

participants” are shown in Figure (3.4 – A) and Annex (6-D (1)), looking at Figure

(3.4 – A) shows that the larger 219 participants (63.7%) were in the age group 18-25

years, 99 participants (28.8%) were in the age group 25-35 years, (4.7%) of participants

were within the age group (36-46) years old; whereas the percentage of age category 58-

68 years was 0.3 % of participants; Figure (3.4 – A) “A”). In addition, the figure shows

that the number of male and female participants in the survey were almost the same.

The study included 188 males (48.58%) and 199 females (51.42%); Figure (3.4 – A)

“B”). Moreover, the survey demonstrated that the majority of the participants were

holders of bachelor degree (82.4%) and the population sample included wide range of

specializations, e.g., engineering, business, social science and other specializations.;

there were engineers, graduates in the fields of Chemistry, Environment, Geology,

Information Systems, Biology, Physics, Nutrition, Pharmacy etc. There were also

specialties in management, business administration, accounting, law, media, libraries,

English, Arabic, political science, economics, logistics, child education, etceteras. The

detailed numbers of participants are shown in Annex (6-D 1).

The figures below represent the analysis of the 27 questions in the survey, where the x-

axis represents the multiple choice answers and the y-axis represent the frequency i.e.

53

(number of respondents who answered the question), the frequencies reflected as

percentages are presented on each figure as well.

(A)

2.6

(B)

63.7 % 28.8%

4.7 %

2.6 %

0.3 %

54

(C)

(D)

Figure (3.4 - A): Socio-demographic characteristics of participants. (A) Age, (B)

Gender, (C) University major specialty (D) Educational level.

Figure (3.4 – B) below reveals that the majority of the participants (around 96.2 %) gave

the right answer for the question in part (A) which is about participants‟ knowledge of

DNA. Similarly, the correct answers for the question in part (B) what is responsible for

1.6 %

82.4 %

14 %

2 %

55

the genetic characteristics were around 87.4 %. On the other hand, when participants

were questioned about genetic fingerprint part (C) and gene therapy part (D) the results

indicated that most of respondents have little information about these subjects. Thus, we

conclude that the majority of the participants of the study are well educated in terms of

their general background information on the nature of genetic material nevertheless they

lack knowledge of more specifics detailed facts and concepts related to biotechnology.

The answers for the question in part (E) indicate that the majority of participants (71.6

%) illustrate genetic Engineering technology should be encouraged as a mean of

progress and development.

(A)

DNA

96.2 %

0.7 % 1.3 % 1.8 %

56

(B)

(C)

49.9 %

25.2%

%

12.2 %

%

12.7%

87.4 %

%%

2.8 % 0.5 % 7.5 %

87.4

%

1.8 %

57

(D)

(E)

Figure (3.4 - B): General awareness of participants on basics of biotechnology.

23.8%

42.9%

27 %

6.3%

71.6 %

19.3% 9.1%

58

Figure (3.4 – C) demonstrate that nearly 55.3 % of participants have limited knowledge

about GMO while (21.1%), of respondents heard only about it. And 18.3 % knows very

well what the GM food is. Those who had the knowledge about GM technology were

asked to write down their understanding. Only 7.5 % answered this question; very few

people gave the exact right answer scientifically, others gave a general answer. Some of

the responses mentioned that the reason behind producing GM food is to get higher

quality and quantity products, improve the appearance, change the color, and the taste

and to be able to counter certain diseases, or to improve a specific inherited trait, also to

plant the crop that can withstand harsh conditions like high temperature and salinity

and/or be available in any season. Some participants think that GM food is a food that

has been genetically altered i.e. through manipulating the genes of foods without the

addition of any external source. Others think that GM technique is the same as natural

breeding i.e. it is a cross breeding between two similar plants; some respondents believe

that GM technology is about taking out undesired genes and replacing them with the

desired ones. The response for the question in part (B) indicate that 64.4% of the

participants believe that there are methods to detect the GM food; however a very small

percentage (4.3%) of respondents thought that there are no methods/techniques to detect

these GM foods. Concerning the perspective of participants regarding the impact of GM

food and feed products and whether they have positive or negative effect. Answers for

this question show that the participants are not certain about the impact of these

products on human health and the environment. Question in part (D) is similar to the

previous one and the pattern of participant‟s answers assures the same findings that

people are not sure whether GM food is useful or harmful.

59

On the other hand (43.3 %) of responses indicate that GMO may have harmful impact

on human health and the environment, while about 28.9% of respondents do not know

anything about this subject. Question in part (E)

In the question in part (F), 53.4 % of the participants mentioned that they read the

nutritional facts on the food products some times, 18.5 % of the survey sample, always

read the facts and 23.3 % never look at any information written on the product.

Almost 51.6 % of the survey sample believes that the role of media in promoting the

awareness about GM food and feed products is weak and limited. While 27.3 % of

participants think its effective and 21.1 % believe that there is no role for the media at

all (part G).

The response for the question in part (H) show that 23.4 % of participants purchase GM

products, while 37.6 % indicate that they have never purchased GM products.

Conversely 39 % of respondents admit that they do not know if they ever purchased

GM food or not.

(A)

18.3 %

55.3 %

21.1%

5.3 %

60

(B)

(d)

(C)

(C)

(D)

64.4 %

4.3 % 31.3 %

32.6 % 33.7 %

12.9 %

20.8 %

61

(D)

(E)

(F)

( g)

(h)

6.1 % 10.6 %

43.3 %

11.1 %

28.9 %

17 %

6.1 %

30.3 %

46.6 %

62

(F)

(G)

18.5 %

53.4 %

23.3 %

4.8 %

51.6 %

27.3 %

21.1 %

63

(H)

Figure (3.4 – C): General knowledge of participants on genetically

modified Food

Figure (3.4 - C): General knowledge of participants on genetically modified food

Figure (3.4 – D) shows participants response and their perception about laws and ethical

standards governing GM food. Participants, responses to questions in part (A) and (b)

reveals that they perceive the religious and ethical beliefs in a very similar manner as in

both questions the higher percent of respondents said that the acceptance or rejection of

GM food is conditional, i.e it depends on the nature of the change (from which species

was it taken) and the cause of this change. For example some participants mentioned

that they may consume GM food after checking its source and the type of modification

that was performed.

These answers were also compatible with other answers that were given by religious

men (Islam & Christianity); when interviewed and asked about the religions view about

consuming GM food a priest from the Evangelical Baptist Church was interviewed and

asked to express the church views towards consuming GM food; he said that by

engineering such a food we interfere with the laws of creation because God has created

23.4 %

37.6 %

39 %

?

64

everything in the most perfect and complete form to serve and benefit humanity. He also

stressed on the real intent behind producing this kind of food and if it was only for

money and profit; if this was the case, then it is not ethical as loving money is the root

of all evil he said. Conversely, if the goal of producing GM food was to improve

humanity then it is authorized with the condition of performing intensive research to

prove its safety for humans & animals consumption and that it has no risk of causing

any harm to the environment. Otherwise, if some research found GM food to be harmful

to humans or animals then it is not permitted to produce it or trade it.

Another interview was carried out with Dr. Jameela Al Refaii (Assistant Professor) from

the Islamic Religious studies department at the University of Jordan to demonstrate

Islamic perspective of GM food. Dr. Jameela stressed that Islamic Sharea‟a supports

and encourages scientific research and development which aims to improve people lives

and serve humanity. She continued that one of Share‟a‟s aspirations is to preserve the

five necessities which are: Religion, the self, the mind, generations and money; There

are many Verses in Quran as well as in Hadeeth that mentions that humans should not

come up with anything that brings harm to themselves, to others, to animals or to the

environment. Therefore, if this technology was proved to cause any harm to human

health or other living creatures then its prohibited to continue with it; conversely, if it

was proven to be beneficial and has a potential of improving human lives and the

environment then scientists should make the best use of it. Keeping in mind that usually

any manipulation or tampering with nature leads to unpleasant results. Furthermore,

Quran has clearly stated that Allah is the only creator who is able to create everything

and has all the power to control everything in this world (Al Imran 3: 190). In this

Surah, Allah demonstrates an example of men who are non believers, where Allah

65

challenges them by saying that they are unable to create anything even as small as an

insect (a fly for example) even if all the scientists have gathered to do so. They have no

ability or the power to create something without the permission of Allah. Some people

claim that through genetic engineering they are able to manipulate living things, despite

of these claims Allah has mentioned in the Quran that that humans cannot create

something as perfect as Allah‟s creation: “O men! Here is a parable set forth! Listen to

it! Those on whom, besides Allah, ye call, cannot create (even) a fly, if they all met

together for the purpose! and if the fly should snatch away anything from them, they

would have no power to release it from the fly. Feeble are those who petition and those

whom they petition!” (al-Qur‟an, al Hajj 22: 73) (Amin, 2009).

Concerning the consumption of GM food, 41.58% of participants expressed their

rejection to purchase or consume GM products. 42.6% said they will try it. However,

15.82% of respondents agreed to purchase it and have no problem with consuming such

food, question in part (C).

On the other hand, 77.8% of the survey sample believes that it is very important to label

the GM food; while, only 7.2% thinks that it is not crucial, based on the responses to

question in part (D). Consequently, the responses to the questions in part (F) and (G)

illustrate that 80.8 % of the participants of the study believe that it is of great importance

that the government should take strict laws to prevent the entry of GM food and feed

and they believe that the already established system (scientific, regulatory and

legislative) has the capability to monitor the access to GM food and feed products.

66

(A)

(B)

12.6 % 15.1 %

44.9 %

27.4 %

19.3 % 18.8 %

48 %

13.9 %

67

(C)

(D)

77.8 %

7.2 % 15 %

?

?

68

(E)

(F)

(F)

(G)

80.1 %

8.9 % 11 %

68.8 %

16.6 % 14.6 %

69

(G)

Figure (3.4 – D): Participants perception on laws and ethical standards

governing GM food.

Figure (3.4 – E) below represents the awareness of participants related to the

economical and environmental impact of GM food and feed products. In response to the

question in part (A), the highest percentage of participants said that the price of GM

food must be less than the non- GM food. In part (B) 61.8 % of the survey sample said

that they are willing to pay higher price for food if it will be non-GM.

The majority of respondents to the question in part (C), 69 % believe that genetic

engineering help farmers to produce large amounts of crops more efficiently and with

better quality. 42.4 % of the survey sample said that GM food may partially solve the

famine of the world; 31.4 % believe strongly that GM food will solve the famine of the

world; however, 18.8% of the participants do not believe that GM food is the solution,

based on the answers for the question part (D).

The question in part (E) shows that 46.2 % of respondents think that there are

environmental risks associated with the plantation of GM crops, 23.1 % do not think

80.8 %

8.2 % 11 %

70

that this is true and, 30.7% of participants do not know the right answer for this

question.

On the other hand, and based on the responses to the question in part (F), 53 % of

participants believe that GM food sold to developing countries is of lower quality than

that sold to developed countries, 34 % of respondents have no idea.

(A)

(B)

(B)

18.3 %

38.3 %

21.1 % 22.3 %

61.8 %

38.2 %

71

(C)

(D)

(E)

69%

12.4 % 18.6 %

31.4 %

18.8 %

42.4 %

7.4 %

72

(E)

(F)

Figure (3.4 – E): Economical and environmental awareness of participants in

GM food and feed.

53 %

6.4 % 6.6 %

34 %

46.2 %

23.1 %

30.7 %

73

In the last question of the survey (no.28), which was an open ended question, the

participants were asked if they have any additional comments or fears that they would

like to mention. Around 62 (15.5 %) out of 400 participants answered this question;

some of the answers highlighted/ outlined the impact of GM technologies on human and

plants; as Allah has created them perfectly and they should stay as they are. In addition

and since GM food price shall be more expensive than the other non-GM food. Some

participants stressed on the importance of the role of media in raising the awareness

about this subject, and that currently the role of media is not present at all. Furthermore,

there was a recommendation for farmers to focus on increasing agricultural activities

specially organic farming. Some argued that the responsibility and role of the Ministry

of Agriculture is somehow absent because the ministry does not prevent the spread of

GM products that may cause cancer.

On the other hand, many believe that GM food may be safe if many tests have been

carried out that focus on long term effects on humans and the environment, i.e a lot of

research must be carried out on these products before releasing them into the

environment. Moreover, there should be authorized accredited labs that test random

samples from the market, and prove if it was GM product or not. Some participants

argued that if the genetic modifications were only among the same plant species then

that is considered a good improvement; however, if the modification came from

different species from animals to plants then it‟s not acceptable.

Unfortunately, there are insufficient studies and information for the public on the risk

and health impact of GM products on humans, animals and the environment as this kind

of research is still in its early stages.

74

There were opinions that support the plantation of GM crops in the developing countries

in order to help the country to be self sufficient and lower the imports as much as

possible, also they said that GM food may contribute to ending hunger in the world. It

was mentioned that testing, monitoring and tracking of GM products as well as traces of

pesticides in foods is very important. Furthermore, any entity which imports GM food

must first investigate more on the source of the product and if the country of origin

where these products came from do have this technology or not, then decide whether to

allow the entry or not. Some mentioned that there should be specific regulations that

deal with the safety and security of GM food, they also stressed on the importance of

labeling of GM food and said that it is crucial and is considered as one of the consumer

rights.

Moreover, a number of participants in the survey feared that human beings are being

used as rats for experimenting the quality of such products without the consent of

people specially those who live in poor and developing countries. In Addition, there are

many fears that people are consuming GM food without their knowledge about it.

Then again a few respondents are worried about any potential impact of what is called

genes interaction. Several people said that GM food may cause cancer, mental illness

and sterility, or new disease that no one knows about. There is also a strong belief that

this technology alters the natural genetic traits that Allah has created in creatures and

that they may cause negative impacts which may not appear now but may appear later

on in the future generations; some had said that even if there was a very low possibility

of 1% of bad health impacts of GM foods on the humans and the natural environment,

then there is no need at all for it.

75

Some recommended to sell GM food at higher prices than non-GM food in order to

poor people not to buy them, and that they should be sold in specific places, some

people have never heard about this topic at all.

Respondents of the survey‟s questionnaire thought that awareness activities must be

more active in informing the public of the nature and risks of the spread of GM

products, as sooner or later this technology and GM products will be part of our daily

lives so what we must do is to make sure that the product is safe through extra research.

In addition, there are fears that the goal of this technology is only to gain more money

by farmers and business men that is why governments must monitor farms and protect

the public from fraud. There were also many concerns that genetic engineering

technology may interfere with religious and moral values.

Many have stressed on the true intent behind producing GM food; if the goal was to

improve these crops or foods and sell them in a similar price of other non-GM food, and

at the same time to ensure that it is safe for humans and animals to consume them, then

this type of food is accepted. Conversely, many reject this type of genetic engineering

completely and prefer organic food over GM food.

There were important recommendations to disseminate the results of this study over a

wide range of public since more than 70 % of the population have never heard of GM

food.

76

3.5 Major findings of laws and regulations governing genetically

modified food and feed

As mentioned in the result section (3.2) about the occurrence of GM food and feed in

Jordan, it is important to control GM products by regulations and Laws; this issue must

be seriously and immediately dealt with, as the researcher personally believe that the

spread of GM products might have an impact on human health, environment and the

biodiversity in Jordan.

One of the primary international agreements which is considered legally binding is the

Cartagena Protocol on biosafety, this agreement was adopted in year 2000 by 130

countries (Jordan was among those countries); it is regarded as a supplementary

agreement to the Convention on Biological Diversity (CBD) which entered into force on

11 September 2003. It aims at governing the movements of living modified organisms

(LMOs) resulting from modern biotechnology from one country to another. Today the

number of countries signing this protocol increased to 162, Bahrain, Morocco and

Somalia were one of the new countries which ratified this protocol (Weasel, 2009);

Annex (6-A).

The Cartagena Protocol is based on the precautionary principle which relies on

anticipatory action in the absence of definite scientific evidence, i.e. when there is

considerable loss of biological diversity, lack of full scientific certainty should not be

taken as a reason to delay measures that minimize or prevent such a threat. The

inclusion of this principle in the GMO argument has caused debate especially for the big

77

GMO producers as US, Canada, Argentina who objected to the World Trade

Organization, claiming that the precautionary principle includes unnecessary obstacles

to trade their GM products (Herrera, 2007).

It is also worth noting that despite that 162 countries signed this agreement this does not

mean that all these countries follow all the regulations and abide to them 100%

(http://bch.cbd.int/protocol/supplementary/).

On October, 16th

, 2010, a new treaty was adopted by the world community called “the

Nagoya – Kuala Lumpur Supplementary Protocol on Liability and Redress to the

Cartagena Protocol on Biosafety”; this treaty includes international rules and procedure

on liability and redress for damage to biodiversity resulting from living modified

organisms. To be liable means to be accountable and able to compensate the damage

caused by an action of a specific organization, entity or a person. The new treaty was

open for signature at the United Nations Headquarters in New York from 7th

of March

2011 to 6th

of March 2012; it was expected to enter into force 90 days after being

ratified by at least 40 Parties to the Cartagena Protocol on Biosafety. Until today, there

are around 51 countries who have already signed this treaty, Annex (6-B).

In Europe, the new community regulations regarding the GM food indicate that labeling

is compulsory if the concentration of GM material is higher than 0.9%. (Elsanhoty,

2010). Based on the performed lab experiments and the findings reported in this

research, a new transgenic event was found which is the 390 bp DNA sequence; this

reveals the urgent need to investigate the degree of prevalance of such events in the

Jordanian market, and to enforce stringent laws to control the entry of such prodcuts to

our country.

http://bch.cbd.int/protocol/supplementary/

78

Current status of GMO regulations in different Arab countries

Table (3.5) shows the GMO regulations status in different arab countries, to which

illustrates that the majority of countries have signed and ratified the Cartagena Protocol

(CPB) between the year 2000-2012; however, only few countries have develped their

biosafty framwork as (Egypt, Jordan, Lebanon and Libya), the rest of the countries have

no biosafty framework in place yet. Regarding the existance of laws and regulations,

some countries do have either a by-law or a draft law. Unfortunatly, there is no

implementation of any of these regulations at all, none of them is activated yet, i.e no

party is held laible or acountable if they import, trade, or plant GMO. One of the reasons

for this is that in some countries there is no accredited labs or qualified staff which are

cabable of testing the GMO products yet, another important reason is that if the GMO

laws were implemented and enforced this might casue the uproot of a billion dollar

industry (biotech companies). It should be mentioned that these companies are currently

getting enourmouse profits out of the spread of GMO seeds/ crops all over the world,

they also have a huge power which may affect the decigions of many governmental

entities; thus, the implementation of such laws will diffently hinder their progress. It

might even cause enourmouse loses for these companies which are alreay spread in

several arab and developing countries without any restrictions.

79

Table (3.5): Current status of GMO regulations in different Arab Countries

Country/ Status

of GMO

Legislation

Bahrain Egypt Iraq Jordan Kuwait

Ratification on

International

Treaties

1996: CBD

2012: Cartagena

Protocol (CPB)

1994: CBD

2003:Cartagena Protocol

(CPB)

2009: CBD

1996: CBD

2004: Cartagena

Protocol (CPB)

Recently a

memorandum on the

ratification of

biosafety protocol

was sent to the

Administration of

Legal Advice and

Legislation

Biosafety

Framework

-

Exist from the beginning

of nineties

-

The National Biosafety

framework was

formulated by the

ministry of

Environment in year

2004

-

Legislation

Regulations &

Laws

People importing,

exporting or growing

genetically modified or

contaminated crops

would

face a minimum of three

months in jail, or a more

severe punishment

1997: Requiring approval

by the

SCFS for the import of

GMOs for food.

Prepared a draft

of national

legislation on

Biosafety (draft

Biosafety law of

Living Modified

Organisms and

their products)

There is a Proposed

By-Law for Bio-safety

of Genetically

Modified Organisms

which was published in

the gazette in 2006.

In 2008 Jordan food &

Drug administration

(JFDA) established a

draft of non-buiding

guidelines on Biosafety

-

80

Country/ Status of GMO

Legislation

Bahrain Egypt Iraq Jordan Kuwait

GMOs grown for

Research purposes - Contained use,

experimental

releases

- Present -

GMOs grown for

commercial Purposes - Products intended

for food *

- - -

Registration of New GMO

seeds - 1998: set a protocol

for GM food

Registration**

- - -

Food Labeling No Labeling Not applied - - -

Enforcement &

Monitoring

NO routine testing

of imported

products for

presence GMO

Not Applied - - -

81

Continue…. Table (3.5 ): Current status of GMO regulations in differner Arab Countries

Country/ Status

Of GMO

Legislation

Lebanon Libya Oman Qatar Saudi Arabia Tunisia UAE

Ratification on

International

Treaties

2008 :

Cartagena

Protocol

(CPB)

2001: CBD

2005: Cartagena

Protocol (CPB)

1994: CBD

2000:

Cartagena

Protocol

(CPB)

2007:

Cartagena

Protocol

(CPB)

2007:Accessio

n of Cartagena

Protocol (CPB)

1992: CBD

2003:

Cartagena

Protocol (CPB)

-

Biosafety

Framework - In 2005

Lebanon

developed

its NBF

- In 2008: Libya

has completed its

National

Biosafety

Framework

- Not Existing - - - -

Legislation

Regulations &

Laws

Sanitary &

Phytosanitary

measures

law,article 14

bans the

import of GM

seeds &

seedlings.

There is not yet a

clear

“Environmental

National Policy” in

which related

legislations are

incorporated.

- Some Rules &

Regulations

2000:

Regulations of

the genetically

modified foods

in the Kingdom

of Saudi

Arabia

Project of law

regulating

GMOs

-

GMOs grown

for Research

purposes - - - - - Genetic

engineering is

applied for

research only

Date Palm

GMOs grown

for commercial

Purposes - - There is

currently no

application or

production of

genetic

transformatio

- - There are no

GMOs grown

in open field at

commercial

level

-

82

n

Country/ Status

Of GMO

Legislation

Lebanon Libya Oman Qatar Saudi Arabia Tunisia UAE

Food Labeling - The regulatory

institutions require

provision of

genetically

modified organisms

(GMO) free

certificate from the

country of origin

for the imported

goods to be allowed

into the count

- Is required

by Law Is compulsory

by law - Labeling GM

is mandatory if

the GM content

is > 0.9%

Enforcement &

Monitoring

- - Importing all kinds

of seeds for

agricultural

production was

prohibited since

2006.

- - 2006:

Food

testing

Result

(40%

GMOs)

- No strict

monitorin

g - Inspection

at port of

entry

- Importation

of foods

made of

genetically

modified

animal

products by

the use of

biotechnolog

y is

Forbidden

- -

Source: (Participants presentations at the 1st International Workshop on Harmonaization of GMO Detection and Analysis in the Middle East &

North Africa Region “ MENA”) Dead Sea, 4-5 June 2012.

83

3.5.1 Current Status of bio-safety laws in Jordan

In 2010, the Jordanian population was reported at 6,181,000 million inhabitants and it is

expected to reach 7,945 in 2025 (Hashemite Kingdom of Jordan Department of

Statistics "DOS", 2013); this increase in population count will put pressure on natural

resources in the Kingdom which are already limited. Jordan is considered a deficit

country when it comes to food supply as its imports of food commodities still exceed its

exports by far. Moreover Jordan is a large net-importer of feedstuffs for livestock.

Jordan's agricultural trade account has been negative for decades, but in recent years the

deficit has increased sharply. In 1999 the deficit in food trade balance was around 350

million JOD; in 2007 it reached 918 million JOD, source: (Central Bank of Jordan,

Annual Reports). In Jordan the land suitable for cultivation is around 886,400 ha, or

around 10 percent of the total area of the country (FAO, 2005). The main annual crops

are vegetables, potatoes and cereals (wheat and barley). The National Strategy for

Agricultural Development document reported problems and constraints to agricultural

development; due to the continuing rise in food prices; and the impact caused by climate

change.

Agricultural development is an important environmental dimension because of its role

in maintaining biodiversity, Ground resources and water resources and their capacity to

regenerate and the continuation of the ecological balance which contributes to the

provision of the sustaining development requirements. Therefore, there is a close

relationship between agriculture and the environment, since any imbalance in one of

them will harm the other. As mentioned above, Jordan depends a lot on foreign trade to

cover the needs of its people from foodstuff, and so the issue of GM food and feed

84

including vegetables, fruits, and any other type of food which is GM must be taken very

seriously. Although Jordan has signed the Cartagena Protocol on biosafety in year 2000

and as mentioned it should have been entered into force in 2004 but still there is no

monitoring or tracking of the entry of these foods into the country.

Many farmers are already planting vegetables and fruits which the researcher believes

are modified; being tempted by the increased yield and less use of pesticides and

herbicides. Unfortunately, these farmers have a very limited or no knowledge of the

possible adverse effects on human health and the environment; like polluting organic

natural crops in our country, in addition to causing harm to other types of insects which

are not targeted (some insects are vital components in other animal and insect food

chain, the thing that may cause a decline in the number of some animal population).

Therefore, the agricultural sector must be well protected and monitored because it

works to maintain the natural resources of land, water and vegetation cover. This

contributes to the achievement of ecological balance and preserving biodiversity and

reversing desertification process and thus ensure conditions for sustainable

development.

Following the signing of the Cartagena Protocol, Jordan prepared and issued the

National Bio-safety Framework in 2004, and a proposed a By-Law for the bio-safety of

GMO which was published in the gazette in 2006. Recently, the Ministry of

Environment together with other concerned parties has prepared a law for bio-safety of

GMO. A brief description of these regulations will be presented in the following

section. Full regulations are present in Annex (7- A, B).

85

In 2008 Jordan food and Drug administration (JFDA) prepared a draft of non-binding

guidelines on biosafety, and until today these guidelines are not even published on the

JFDA website and are not put into force. Therefore, a serious decision must be taken

immediately to activate these guideline especially for the GM food that is used for

pharmaceutical purposes.

Table (0): Jordan status with regard to Cartagena Protocol treaty

Date of signature 2000-10-11

Date of ratification 2003-11-11

Date of entry into force 2004-02-09

Type of Document Number of

Records Date of Last update

Competent National Authority (Ministry of

Environment)

1 2008-10-21 06:23 UTC

Country's Decision or any other

Communication 0 -

Law, Regulation or Guideline

- Draft National Biosafety Framework

(Developed under the UNEP-GEF

Biosafety Project)

- Proposed By-Law for Biosafety of GMO

Issued in Accordance with Article No

(23) of the Law of Environment

No (1) See Annex (7-A)

2 2008-11-16 01:52 UTC

National Database or Website 1 2008-11-24 13:04 UTC

National Focal Point 1 2011-11-02 17:00 UTC

News 0 -

Report on Assignment 0 -

Risk Assessment 0 -

Reports on Implementation of the Protocol 1 2011-11-02 14:15 UTC

Ref: (

javascript:__doPostBack('ctl13$W21272$BTypeSearch','authority')

javascript:__doPostBack('ctl13$W21272$BTypeSearch','law')

javascript:__doPostBack('ctl13$W21272$BTypeSearch','nationalDatabase')

javascript:__doPostBack('ctl13$W21272$BTypeSearch','focalPoint')

http://bch.cbd.int/protocol/cpb_natreports.shtml?country=jo#natrep

86

Table (3.6.1) illustrate that the Ministry of Environment is the national authority

responsible for the management, follow up and implementation of the Cartagena

Protocol and all issues related to bio-safety. The latest national report was submitted in

February 2011. Several organizations participated in the preparation of this report:

Ministry of Environment, Ministry of Agriculture, National Center for Agriculture

Research and Extension, University of Jordan, Royal Scientific Society, Ministry of

Planning and International Cooperation, Food and Drugs Administration.

On the other hand, there are several independent institutions like universities or research

centers which are currently carrying out specific research subjects related to GMO, for

example the Royal Scientific Society has recently published two papers related to this

subject and these are (Al-Hmoud et al , 2010, Al-Rousan et al, 2010).

Through the researcher investigations it was found that The National Center for

Agricultural Research and Extension (NCARE) is capable of detecting the prevalence of

GM food and feed, it is also developing the capacity of its staff to be able to carry out

quantitative analysis (through using the real time PCR) i.e to be able to figure out the

percentage of the new genetic constructs (GM events) inserted into the plants. This is

very important in order to be able to enforce labeling or prevent totally the entry of

some products if the concentration exceeded a certain limit.

On the 30th

of January, 2012 the researcher has interviewed some employees from the

Ministry of Agriculture specifically from the phytosanitary measures. The aim of this

interview was to enquire on all the present regulations & laws on GM seeds, it was

found that there were no regulations at all. Even if these existed, since no entity tests

these GM seeds or plants, those regulations will have no value.

87

In Jordan there are several institutions both governmental and nongovernmental

responsible for the protection of the environment and human health such as: the

Ministry of Environment, the Ministry of Agriculture, Food and Drug Administration,

the Ministry of Health, NCARE, the Royal Scientific Society at El Hassan Science City,

in addition to many other universities and Research centers. Many of the governmental

institutions already have laws that could be linked to biosafety issues; for example: Law

of Environment (No. 52/2006), the temporary Law of Agriculture (No.44/2002), the law

for the protection of plant species (No24/2000) “This law related to the mechanism of

registration of new plant species and the rights for the person(s) who invented it.

The Law of Public Health (law No. 21/1971), which includes some articles that consider

food not suitable for human consumption if it contains any poisonous material or any

substance that can be harmful to humans or animals. The By-law on Hygiene and Food

Safety (law No. 8/1994): “In article 4/c, it is stated that the council has tasks to

formulate the general policies on food safety, selling and handling of imported food; in

addition to Article 74/c 2, 3, 4 and 5, which include important information for food

biosafety where plans, research, cooperation in this regard can be performed. Another

law is the law on descriptions and specifications (No.15/1994) where in article 4, it is

stated that Jordan Institution for Standards and Metrology (JISM)/Ministry of Trade and

Industry will depend on a national system for description and specification based on

recent scientific information. It also includes that the cooperation will work to provide

environmental, economical and health protection for people of Jordan through the

assurance that the commodities and other substances are compatible with the descriptive

criteria. Moreover the by-law on health quarantine in Aqaba port (No. 32/1972) Article

46 states that it is not allowed freeing any shipment of food or the raw materials of food

88

before it stands either by a certificate from the health department / source or by the

laboratory testing that it is healthy and safe (National Biosafety Framework, 2004).

3.5.2 Summary of Jordan Biosafety framework, Draft by law and

latest national report on the Implementation of the Cartagena

Protocol on Biosafety

The National Biosafety Framework was finalized and issued by the Ministry of

Environment in 2004 with the support of external Jordanian experts who represent the

public, academic and private sectors. The framework was funded by the Global

Environmental Facility (GEF) and facilitated by the United Nations Environmental

Program.

Despite the difference in the content of the biosafety framework among different

countries, it usually has similar components as: a governmental policy and a regulatory

regime for biosafety, a system to handle notifications or requests for authorization, a

system for follow up and monitoring etc.

The Jordanian Government Policy on biosafety aims to minimize as much as possible

the health risks expected from the consumption of GMOs or any of the modern

biotechnology products in order to protect human health, environment and the

biodiversity. Moreover, the government intends to regulate the transboundary

movement of the products resulting from biotechnology through establishing relevant

policy and regulatory system and management bodies. It also plans to establish a risk

assessment system which sets the risk levels and the guidelines which specifies the risk

89

assessment procedure. The government will also work to encourage research in this

field (Ministry of Environment, 2004).

Until 2006 Jordan did not have any regulations which deals with GMOs, and as a result

a draft by - law was finalized and published (Biosafety of Living Modified Organisms

(GMOs) and Products Resulting from Modern Biotechnology) this directive includes

eleven articles, where it is applied mainly on those GMOs that are transferred through

borders and others which may be of harm to humans and the environment. The main

aim of this directive is to guarantee a safe handling and trade of GMOs, it stresses on

labeling issues and focus on reducing the possible risk that may result from

biotechnology industry.

This by-law or directive also assigns a National Biosafety committee which is led by the

Minister of Environment; this committee involves experts from different institutions as:

Ministry of Environment, Ministry of agriculture, Ministry of Health, Food and Drug

Administration, National Center for Agricultural Research and Extension, Royal

Scientific Society, National Society for Consumer Protection, Jordan Institution for

Standards and Metrology, General Union of Farmers, Food Merchants Association, two

official universities which have facilities and offer services in the field of modern

biotechnology.

The latest Jordanian national report on the Implementation of the Cartagena Protocol on

Biosafety was submitted in October 2011, the report basically takes a form of a

questionnaire. This report was prepared by several organizations: Ministry of

Environment, Ministry of Agriculture, NCARE, University of Jordan, Royal Scientific

Society, Ministry of Planning and International Cooperation and Food and Drugs

Administration. In general, this report discusses Jordan commitment to all the articles in

90

the Cartagena protocol; for example, some questions inquire if Jordan has the technical

capacity to detect and identify GMOs, other questions ask if the country regulates the

trans-boundary movement, handling and use of (LMOs) which are pharmaceuticals. In

addition the report raises questions on whether Jordan has ever taken a decision on an

application / notification regarding intentional transboundary movements of LMOs for

intentional introduction into the environment, and the answer was that this has not

happened yet. The full report can be viewed at the following link

(http://bch.cbd.int/database/record.shtml?documentid=102659 )

According to article 20 of the Cartagena Protocol on Biosafety every member country

has to establish an information exchange center or what is called a Biosafety Clearing-

House (BCH), (http://bch.cbd.int/ ), for the purpose of facilitating the exchange of

information on GMOs, this will enable all the parties to comply with their obligations

under the Protocol. There is an international biosafety clearing house website where

everyone has access to several technical, environmental, scientific legal and capacity

building information all provided in 6 UN languages. For example if the user clicks on

“finding information” category, he/she can get comprehensive information on national

contacts, laws and regulations, country's decisions and other communications, list of

experts, GMOs, national reports, capacity-building organizations, the BCH Virtual

library.

In addition to this there is a national Jordanian Biosafety Clearing House

(http://jo.biosafetyclearinghouse.net) which is currently under construction; it serves as

a reference national database for all information on biosafety that is available in Jordan,

and this website is being developed and managed by the Ministry of Environment.

http://bch.cbd.int/database/record.shtml?documentid=102659

http://bch.cbd.int/protocol/

http://bch.cbd.int/

http://bch.cbd.int/database/decisions/

http://jo.biosafetyclearinghouse.net/

91

Discussion:

This research aimed at detecting and proving the existence and prevalence of GM food

and feed in the Jordanian market; furthermore one of the main goals was to examine the

awareness of Jordanians and determine their perception towards GM food products. The

study has also looked into the current status of the guidelines that control the entry and

trade of GM food in Jordan.

The statistical data collected from the Department of Statistic about the quantities of

maize imported by Jordan illustrates that Jordan imports significant amounts of maize

from all around the world. On the other hand, Jordan plants maize locally but in small

quantities, which is not sufficient to cover its needs); unfortunately it was also found

that some of the locally planted maize seeds is exported from abroad which was found

to be GM as well; therefore there is a pressing need to find alternatives to GM feed

crops such as locally grown non-GM feed crops or agricultural waste.

All the experiments that were carried out to detect the prevalence of GM products from

food or feed in the Jordanian market revealed that out of 40 maize samples collected, 29

were found to be GM i.e (72.5%). If we compare these results with the findings of an

earlier published study in Jordan (N.Al-Hmoud, 2010) which found that 18.18% of

maize used in production of feed were genetically modified and were unlabeled; we

conclude that within a couple of years the quantities of GM maize present in the

Jordanian market has increased dramatically. This indicates that great amounts of GM

maize are entering the Jordanian market without any restrictions.

Additionally a second DNA fragment of 390 bp, was found in the remaining 20 GM

maize sample; the band was not detected in wild type maize and control GM MON810

92

maize and MON863, which means that there are unauthorized genetic events in food

and feed maize samples in the Jordanian market. If we compare this finding with what

was mentioned earlier (that a new type of biotech maize called smart stacks was

released in USA and Canada in 2010), we conclude that the second fragment of 390 bp

may be one of these stacked maize generations.

The subject of GM food has been and is still under a great controversy for the last ten

years as several countries has banned or restricted its entry as a result of the possible

and unknown adverse health effects that may affect humans, animals and interfere with

the ecosystem and biodiversity. Throughout the investigation the researcher had the

chance to meet prominent figures in the field of biotechnology and other related

sciences such as prof. George Church (a professor of Genetics at Harvard Medical

School). Prof. Church together with Walter Gilbert developed the first direct genomic

sequencing method in 1984 and helped initiate the Human Genome Project in 1984. The

researcher had also the chance to meet Prof. Thomas C. Südhof (a German biochemist,

who studied medicine at the RWTH Aachen University , the Harvard University and at

the University of Göttingen). Currently Südhof is a professor at the Medical School of

Stanford University).

Luckily the researcher had the chance to ask both professors of their personal scientific

opinion about GM food and whether it is safe for human consumption or not and

surprisingly both of them had the same opinion were they both said that it is ok to eat it

and there is nothing wrong about it, as long as there is enough studies which proves that

it is safe and secure for humans as well as animals and that it causes no harm at all.

As mentioned earlier some scientists had found good evidence through their research

which proves that GM food does cause harmful health effects such as damaging

http://en.wikipedia.org/wiki/Harvard_Medical_School



http://en.wikipedia.org/wiki/Walter_Gilbert

http://en.wikipedia.org/wiki/Genomic_sequencing



http://en.wikipedia.org/wiki/Human_Genome_Project

http://de.wikipedia.org/wiki/RWTH_Aachen

http://de.wikipedia.org/wiki/Harvard_University

http://de.wikipedia.org/wiki/Universit%C3%A4t_G%C3%B6ttingen

http://de.wikipedia.org/wiki/Universit%C3%A4t_Stanford

93

immune systems, sterility, an increased potential for cancer and higher mortality rates.

Many of these studies as well as others not mentioned here found these facts some years

ago and due to the huge power and large influence of the biotech companies (which

currently make billions of dollars out of trading GM foods). These studies where

somehow stopped and prevented from being published in well known Journals. Only

recently the study of (Seralini et al., 2012) had the chance to be published, and made a

huge argument through the scientific community as well as the general public.

The results of the conducted survey which covered 400 participants from different

governmental and educational institutions throughout Jordan showed that the majority

of Jordanians have good knowledge about the nature of genetic material, but lack the

knowledge of some concepts related to biotechnology. Only 18 % of respondents said

that they know very well what GM food is, and 55 % have little information. Most of

the people who said they know what GM food is, only knew the reason behind

developing these products which is to increase yield, withstand harsh weather

conditions and counter diseases. However, out of the 18% very few really understood

what GM food is and that it involves transferring genes between different species. When

participants were asked about the impact of GM food on humans and the environment,

their answers showed that they are not sure whether it is harmful or useful. Another

important question was about the acceptance of GM food from religious and ethical

perspectives, the responses showed that the acceptance or rejection of GM food is

conditional, i.e it depends on the nature of the change (the kind of species it was taken

from) and the reason behind this change. 75.5 % of the survey sample stressed that it is

crucial to label GM food, and 80 % stated that the government must set strict laws

94

which strict and monitor the entry of GM food and feed. About 69% of the participants

do believe that genetic engineering helps farmers producing large amounts of crops.

By tracking the sources of maize imported to Jordan, it was found that the country

might have been importing and exporting GM food since 1994 or early nineties without

being aware of this because there hasn‟t been a monitoring system in place or testing

program for the food merchants being imported from abroad. Based on the information

given in table (3.1-A) and knowing that Jordan population count is around 6,181,000

million, the average quantity of maize imported from year 1994-2010 is equal to

(419,530.37 Ton / year), we can calculate the Average annual consumption per person

per year from corn by dividing this number by the population count, we get the

following figure 0.0678 Ton/person/year (assuming that the majority of people eat

corn), based on the results of this study which states that 72% of the tested samples

were GM then there is a high probability that Jordanians are consuming huge amounts

of GM corn, not mentioning the other types of vegetables.

International biotech companies are trying to escape from regulating and labeling their

GM products; claiming that the genetic engineering technology is substantially

equivalent to classical breeding, which means that if a GM food product resembles a

traditional product, then the GMO food can be deemed as safe as its counterpart and

thus it should not be regulated or labeled. However, once GM products are labeled it is

easy to trace any adverse health effects that may be caused by the consumption of these

foods. It is worth mentioning here that around five agrochemical corporations control

85% of our food chain from seeds; meaning that in the end, it is all about business for

them. Any claims against the GM products which belongs these companies will cause

95

them enormous financial losses if proved right, and thus these companies will work so

hard to defend their products and market them in every possible way.

In January of the year 2000, around 130 countries adopted the Cartagena Protocol on

Biosafety and Jordan was among these countries. In 2004 Jordan finalized the National

Bio-safety Framework and a draft By-Law for the Bio-safety of GMO which was

published in the gazette in 2006. In 2008 JFDA prepared a draft of non-binding

guidelines on Biosafety and until today these guidelines are not even published on the

JFDA website. Unfortunately Jordan and the majority of Arab and developing countries

do not yet have a strict control and monitoring system. Some of these countries do have

some regulations and have already signed the Cartagena Protocol on biosafety couple of

year ago; in spite of this it is worth mentioning that signing or ratifying the protocol

does not necessarily mean that the country is implementing all the articles and

obligations completely, rather some countries start to build a base through collecting

information, forming committees, preparing a draft by-law, law and a bio-safety

framework etc; sadly for some countries this process could take more than ten years

before activating or enforcing any of the protocol articles or the prepared laws.

Consequently this has caused the spread, entry and even planting of GM food, feed and

seeds in many developing and Arab countries, Jordan is being among them, without the

knowledge and consent of consumers or government officials.

96

Conclusions:

Experimental results have shown that out of 40 maize samples collected, 29 (72.5%)

were found to be genetically modified. Thus, it is concluded that unlabeled genetically

modified maize is widely spread in the Jordanian market without the government or the

public knowing about it. Moreover 20 GM maize samples (69%) were found to contain

genetic element of 390 bp in addition to 123 bp sequence and this indicate that

unauthorized genetic events exist in our food as well.

The results of Jordanians awareness towards GM products showed that out of the 400

people who were surveyed 18 % said that they know very well what genetically

modified food is. However out of this percent very few people gave the exact right

scientific answer. This result shows that the majority of the participants of the sample

are ignorant about genetically modified definition as well as its impact on human health

and the environment.

When asked about their religious and ethical views more than 45 % said their judgment

depends on the nature of the change i.e (the kind of species it was taken from) and the

reason behind this change. 75.5 % of the people stressed that it is very important to label

genetically modified food, and 80 % think that the government must enact strict law and

set regulations which control and monitor genetically modified products and prevent the

entry of unauthorized GM products.

97

In 2004, Jordan came out with a National Bio-safety Framework and a Proposed By-

Law for bio-safety of Genetically Modified Organisms which was published in gazette

in 2006. Currently, the Ministry of Environment in collaboration with specialists from

governmental, non-governmental organizations and universities have recently prepared

a bio-safety draft law which we hope to be put into force as soon as possible.

As a result of these findings, the issue of testing must be taken seriously; labeling and

regulating the entry of genetically modified food and feed to Jordan must be prioritized.

Moreover, all current legislations although few must enter into action. Thus, the

importance of traceability systems lies in their capability of recording a history of a

product and at the same time fulfils the purpose of marketing and health protection. It is

true that we may not be able to prevent their entry but at least we are putting this matter

under control and taking precautions against any adverse impacts that may arise.

98

Recommendations:

It is highly advised to ban the use, import and trade of GM food and feed products

since their impacts on human and the environment is still unknown.

There is an urgent need to create competent laboratories with the state of the art

equipment to conduct the necessary tests. This aims at the followings: determine

whether the products contain genetically modified elements, determine the type of

genetically modified event, determine the percentage content of genetically modified

organisms in feed and food grains, plants, animals, fish and all the products that there

may be doubts its proximity to genetically modified organisms.

Awareness campaigns should be organized by the Ministry of Environment and

NGOs to educate consumers about the potential impacts and risks of GM food and

feed products on human health and the environment, biodiversity and agriculture.

All imported seeds or food / feed products from abroad must be labeled and

accompanied with a certificate which officially state that they are either GMO free or

declare the percentage of modification if it is a GM product.

Our governments must be aware that GM food aid is another crucial front for the GM

corporations to force their products into the developing countries. Therefore, it is

highly advised that any shipment that enters the Jordanian borders as food aid shall

be tested if it is genetically modified or not.

It is worth noting that many of the GM products such as (Soya, Maize, Canola) are

also basic ingredients in many processed foods, so it is advised to monitor and check

if these are labeled whether they are genetically modified or not.

99

The responsible ministries must monitor and investigate all the activities and status

of the International biotech companies which are present in Jordan.

Ministry of Agriculture & NCARE must be more active in monitoring the types of

seeds planted by several farmers around the country, scientific research on the safety

of these seeds on human health and the environment should also be encouraged.

It is essential to develop a database for GM seeds, plants, animals, fish and micro-

organisms and exchange these information among different institutions.

It is advised to transform all provisions and regulation into laws since provisions and

regulations are not obligating and any party which breaks them is not held

accountable.

Activate and enforce the already existing national legal framework and all relevant

laws & regulations to address all aspects of bio-safety.

Developing a MENA network to exchange and strengthen collaboration with

European Comission/ Joint Research Center to enhance the capacity in GM detection

and analysis, and risk management.

Organic farming practices should be further researched and encouraged.

Our government must motivate and financially support farmers to encourage them to

grow all kinds of organic crops specially (Wheat, Barley, Rice etc….) which are the

most important for any nation to be self sufficient.

101

REFERENCES

1. Al Jebreen, D. (2010), Perception and Attitudes of Riyadh University Students

towards Products Derived from Genetically Modified Crops in Saudi Arabia.

Pakistan Journal of Biological Sciences, 13 (1): 28-33.

2. Al-Hayani, F. (2007 ), Muslim Perspectives on Genetic Modification. Biomedical

Ethics, Zygon, 42(1): 153-162.

3. Al Rousan, H,. Al Hmoud, N,. Al Hayek, B,. and Ibrahim, M. (2010), A Study on

The Occurrence of Genetically Modified Soybean and Maize Feed Products in the

Jordanian Market. Journal of Cell and Molecular Biology 8(2): 87-94

4. Amin, L., Sujak, F., Samian A., Haron, M., Mohamad, M. and Othman M. (2009),

Islamic Ethics and Modern Biotechnology. International Journal of the Malay

World and CivilisatiLoant , 27 (2): 285-296.

5. Amin, L., Azlan, A., Gausmian, M., Ahmad, J.,Samian, A., Haron, M. and Sidek,

N. (2010), Ethical Perception of Modern Biotechnology with Special Focus on

Genetically Modified Food Among Muslims in Malaysia. Journal of Molecular

Biology & Biotechnology, 18 (3): 359-367.

6. Bartlett, J. and Stirling D. (2003), A Short History of the Polymerase Chain

Reaction. PCR Protocols , 226: pp3-6.

7. Brunk, C. and Coward, H. (2009), Acceptable Genes? Religious Traditions

and Genetically Modified Foods, New York: State University of New York

Press, Albany.

102

8. Chern, W., Rickertsen, K., Tsuboi, N. and Fu, T (2002), Consumer Acceptance

and Willingness to Pay for Genetically Modified Vegetable Oil and Salmon: A

Multiple-Country Assessment. The Journal of Agrobiotechnology Management

& Economics , 5 (3): 105 -112.

9. Demirci, A. (2008), Perceptions and attitudes of geography teachers to

biotechnology: A study focusing on genetically modified (GM) foods, African

Journal of Biotechnology, African Journal of Biotechnology, 7 (23): 4321-

4327.

10. Department of Statistics 2011. www.dos.gov.jo

11. Elsanhoty, R., Ramadan, M. and Jany, K. (2011), DNA Extraction Methods for

Detecting Genetically Modified Foods : A Comparative Study . Food Chemistry,

126 (4):1883–1889.

12. Jermini, M and den Eede, GV. European Commission, Joint Research Centre

(2006), The analysis of food samples for the presence of genetically modified

organisms Report. Querci M,.

13. Frewera, L., Lassen, J., Kettlitz, B., Scholderer, J., Beekman, V. and Berdal G.,

(2004), Societal Aspects of Genetically Modified Foods, Food and Chemical

Toxicology, 42(7): 1181-1193.

14. Han, J. (2006), The Effect of Perceptions on Consumer Acceptance of

Genetically Modified (GM) Foods. Unpublished Doctor Dissertation, Louisiana

State University and Agricultural and Mechanical College, Baton

Rouge, Louisiana, USA.

http://www.dos.gov.jo/

http://en.wikipedia.org/wiki/Baton_Rouge,_Louisiana



http://en.wikipedia.org/wiki/Louisiana

103

15. Hellmich, R. (2008), The Present and Future Role of Insect-Resistant Genetically

Modified Maize in lPM. In Integration of Insect - Resistant Genetically Modified

Crops within lPM. Springer Netherlands, (5): 119-158.

16. Herrera, A. (2007), International Law & GMOS: Can the precautionary

principle protect the Biological Diversity?. 2011: 97-136.

17. Hu, R. (2007). Labeling of Genetically Modified Organisms and the

Producer's Negative Labeling Decision under a Voluntary Labeling Regime.

A Thesis Submitted to McGill University, Canada.

18. James, C. (2004), Preview: Global Status of Commercialized Biotech/GM

Crops: 2004. ISAAA Briefs, (Electronic Version) No. 32. ISAAA: Ithaca, NY.

19. Jensen, A. (2009), Testing for genetically modified organisms (GMOs): Past,

present and future perspectives. Biotechnology Advances (27): 1071–1082.

20. Joint Research Centre (JRC) (2004), Event-specific method for the quantitation

of maize line NK 603 using real-time PCR Validation Report, Community

Reference Laboratory for Gm food and Feed, European Commission.


of maize line MON 863 using real-time PCR Validation Report, Community

Reference Laboratory for Gm food and Feed, European Commission.

22. Joint Research Centre (JRC) (2006), CRL assessment on the validation of an

event specific method for the relative quantitation of maize line MON 810

DNA using real-time PCR as carried out by Federal Institute for Risk

Assessment (BfR), European Commission.

104


of maize line GA21 using real-time PCR Protocol, Syngenta Seeds S.A.S,

European Commission.

24. Jordan, T. C. (2011). The National survey “Knowledge, Attitudes and Practices

towards Cancer Prevention and Care in Jordan”. Amman, Jordan.

25. Kuiper, H. and Davies, H. (2010), The Safe Foods Risk Analysis Framework

suitable for GMOs? A case study. Food Control (21): 1662–1676.

26. Macherey-Nagel, Mn (2010), Genomic DNA from Plant User Manual, Rev. 04.

27. McHughen, A. (2000), Pandora's Picnic Basket: The Potential and Hazards of

Genetically Modified Foods. USA: Oxford University Press.

28. Ministry of Environment, (2004), National Biosafty Framework of Jordan,

Amman, Jordan.

29. Miraglia, M. Berdal, K. Brera, C. Corbisier, P Holst-Jensen, A. Kok, E Marvin,

H. Schimmel, H. Rentsch J. van Rie and J. Zagon, J. (2004), Detection and

traceability of genetically modified organisms in the food production chain. Food

and Chemical Toxicology , 42: 1157–1180.

30. National Agricultural Biotechnology Council (2001). Report, “Genetically

Modified Food and the Consumer". Ithaca, New York 14853.

31. Nill, Kimball R., (2002), Glossary of biotechnology terms. 3rd ed.. ISBN 1-

58716-122-http://gmo-crl.jrc.ec.europa.eu/gmomethods/

http://gmo-crl.jrc.ec.europa.eu/gmomethods/

105

32. Pachico, D. (2002), Attitudes toward genetically modified food in Colombia.

Proceedings of the 6th International ICABR, (pp. 155-217). Ravello, Itally.

33. Macherey-Nagel (2010), PCR clean-up Gel extraction User Manual,

NucleoSpin® Extract II, Rev10, Germany.

34. Pollack M. and Shaffer G. (2009), When Cooperation Fails the international

law and politics of genetically modified food . New York: Oxford University

Press Inc.

35. Rees, A. (2006), Genetically modified Food " a short guide for the Confused".

England: Chase Publishing Services Ltd.

36. Russel, S. (2001), In Vitro Amplification of DNA by the Polymerase Chain

Reaction. In Molecular Cloning : A Laboratory Manual, 3rd ed (p. chapter 8).

New York: Cold Spring Harbor.

37. Smith, J. (2003), Seeds of Deception Exposing Industry and Government Lies

about the Safety of Genetically Engineered Foods you’r Eating . Canada:

Chelsea Green Publishing.

38. Gilles-Eric Séralini, E. C. (2012). Long term toxicity of a Roundup herbicide and

a Roundup-tolerant genetically modified maize. Food and Chemical Toxicology.

10 (11):2986.

39. Institute of Ecology and Evolution of the Russian Academy of Science with

National Association for Gene Security (2010), Genetically Modified Soy

Linked to Sterility, Infant Mortality. A study undertaken by Russian biologist

Alexey V. Surov.

106

40. Tester, M. (2001), Depolrising the GM debate. New Phytologist , 149: 9-16.

41. Weasel, L. (2009), Food Fray" Inside the Controversy over Genetically

Modified Food". NewYork: AMACOM, a division of American Management

Association.

42. Wickson, F. (2004), Australia‟s Regulation Of Genetically Modified Crops: Are

We Risking Sustainability? Australian Journal of Emerging Technologies and

Society , 2(1):36-47.

43. Wolfenbarger, L.and Phifer, P. (2000), The ecological risks and benefits of

genetically engineered plants. Science , 290(5499):2088-93.

44. Zerbe, N. (2004), Feeding the famine? American food aid and the GMO debate in

Southern Africa. Food Policy , Scince Direct , 29:. 593–608.

45. Kaphengst, T,. El Benni, N,. Evans, C,. Finger, R., Herbert, S,. Morse, S. and

Stupak, N. (2010): Assessment of the economic performance of GM crops

worldwide. Report to the European Commission, March 2011.

Websites:

46. http://bch.cbd.int/

47. http://www.isaaa.org/

48. http://www.fao.org/docrep/003/X9892E/X9892e04.htm

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Wolfenbarger%20LL%22%5BAuthor%5D

http://bch.cbd.int/

http://www.isaaa.org/

http://www.fao.org/docrep/003/X9892E/X9892e04.htm

108

ANNEX (1)

(A): Detection of GM food training certificate at the molecular biology

laboratory of the University of Applied Sciences Northwestern

Switzerland (n/w)

110

(B): Equipments used in the laboratories of the School of Life

Sciences/Institute of Chemistry and Bio analytics/University of Applied

Sciences Northwestern Switzerland FHNW. (a) General overview of lab (b)

DNA extraction (c) PCR machine (d) Gel electrophoresis (e)

Documentation system (f) Real time PCR machine

(a) (b)

(c) (d)

(e) (f)

111

ANNEX (2) Quantities and country of origin of the imported yellow

maize to Jordan in different Years

Year 1994

Country of

Origin

Quantity of Maize

Imported

Kg /year

Price of Maize

Imported Quantity

(JOD)

Lebanon 45,500 7,570

Argentine 47,580,000 4,500,000

United States 201,420,730 19,074,249

Italy 63,000 9,200

China 49,223,400 4,783,000

India 40,000 10,740

Turkey 332,700 56,155

Total 298,705,330 28,440,914

Year 1995

Country of

Origin

Quantity of Maize

Imported

Kg /year

Price of Maize

Imported Quantity

(JOD)

South Africa 40,000 11,275

Argentine 49,800,000 4,871,000

United States 298,468,426 30,582,030

Total 348,308,426 35,464,305

Year 1996

Country of

Origin

Quantity of Maize

Imported

Kg /year

Price of Maize

Imported Quantity

(JOD)

United States 438,119,269 57,968,208

Argentine 3,678,900 434,712

Turkey 239,000 67,156

Total 442,037,169 58,470,076

Year 1997

112

Country of

Origin

Quantity of Maize Imported

Kg /year

Price of Maize Imported

Quantity (JOD)

Turkey 123,500 32,220

United States 81,166,122 8,488,870

Israel 65,000 6,890

Italy 44,000 7,877

Australia 28,575 5,520

Total 81,427,197 8,541,377

Year 1998

Country of

Origin


Kg /year


Quantity (JOD)

Ukraine 547,200 67,083

Hungary 34,956,090 3,140,015

Romania 32,000 4,585

Yugoslavia 13,373,480 1,170,077

Bulgaria 447,500 49,866

Total 49,356,270 4,431,626

Year 1999

Country of

Origin


Kg /year


Quantity (JOD)

Bulgaria 23,375,460 1,837,025

Australia 130,600 34,789

Ukraine 152,000 19,050

Turkey 28,000 3,959

Total 23,686,060 1,894,823

Year 2000

Country of

Origin


Kg /year


Quantity (JOD)

Argentina 338,378,349 28,596,363

USA 80,234,110 6,548,363

Canada 22,000 6,300

Bulgaria 14,959,790 1,336,355

Australia 129,000 30,225

Turkey 68,500 8,743


UAE 18,000 4,898

Total 433,874,249 36,546,872

113

Year 2001

Country of

Origin


Kg /year


Quantity (JOD)

Argentina 363,700,209 30,886,620

Brazil 40,100,000 3,283,588

USA 37,039,771 3,040,429

Turkey 182,650 35,546


Egypt 35,000 6,650

Total 441,293,277 37,312,998

Year 2002

Country of

Origin


Kg /year


Quantity (JOD)

Argentina 390,050,940 33,438,160

USA 48,469,223 4,626,256

Canada 21,504 5,563

Romania 3,500,000 280,782

Hungaria 26,882,671 2,156,595

Canada 21,504 5,563

Turkey 78,000 11,991


Lebanon 89,580 11,000

Iraq 187,065 16,152

Total 469,602,191 40,630,120

Year 2003

Country of

Origin


Kg /year


Quantity (JOD)

Argentina 402,139,492 40,124,233

USA 101,868,599 10,882,576

Brazil 8,684,570 802,205

Turkey 140,600 21,424


Egypt 60,000 8,382

Syria 16,285 3,205

Iraq 148,805 13,294

Total 513,098,351 51,870,996

114

Year 2004

Country of

Origin


Kg /year


Quantity (JOD)

Argentina 81,737,601 9,761,800

Brazil 8,684,570 920,265

USA 319,160,602 38,363,102

India 17,298,824 2,131,050

Egypt 254,500 35,817

Syria 39,915 9,485

Iraq 150,000 9,939

Total 427,326,012 51,231,458

Year 2005

Country of

Origin


Kg /year


Quantity (JOD)

Argentina 55,791,850 6,050,321

USA 353,478,710 38,592,216

Ukrane 18,297,480 1,964,752

India 45,724 10,756

Turkey 4,061,990 425,572

Egypt 317,800 51,418

Syria 174,695 35,705

Lebanon 1,500 1,025

Total 432,169,749 47,131,765

Year 2006

Country of

Origin


Kg /year


Quantity (JOD)

Argentina 58,255,160 6,376,077

Brazil 4,290,180 598,776

USA 375,484,119 40,945,462

Italy 43,000 8,315

Ukrane 16,499,733 1,520,307

Turkey 22,336,480 2,319,534

Egypt 102,500 23,057

Syria 197,750 40,893

Lebanon 2,834 1,894

Total 477,211,756 51,834,315

115

Year 2007

Country of

Origin


Kg /year


Quantity (JOD)

Lebanon 3,245 2,111

Egypt 136,600 30,622

Israel 558,660 143,993

USA 389,814,450 68,532,612

Brazil 21,558,315 3,493,270

Turkey 153,520 16,832

Syria 509,622 124,078

Argentina 27,324,390 4,403,361

Sudan 9,933,130 1,032,307

Total 449,991,932 77,779,186

Year 2008

Country of

Origin


Kg /year


Quantity (JOD)

Canda 9,284 4,441

Romania 11,984,100 3,088,993

Lebanon 5,940 5,962

Egypt 80,000 22,582

Israel 14,683,263 3,551,776

India 225,043,928 52,908,322

Croatia 6,134,290 1,132,470

United

Kingdom 3,581 8,871

Ukraine 4,157,860 1,071,889

Spain 7,600 14,567

Yugoslavia 16,263,420 4,193,008

USA 84,498,571 20,532,542

Bulgaria 7,554,940 1,947,870

Brazil 27,500,000 3,865,380

Syria 69,400 15,161

Argentina 66,125,976 14,693,336

Sudan 952,685 174,355

Hungary 11,997,410 2,862,883

Total 477,072,248 110,094,408

116

Year 2009

Country of

Origin


Kg /year


Quantity (JOD)

Uruguay 65,883,244 14,448,110

Paraguay 19,290,000 3,014,468

Hungary 2,305,180 594,305

Egypt 536,600 117,467

Argentina 65,883,244 14,448,110

Turkey 16,000 8,508

Bulgaria 20,598,330 5,310,265

USA 170,465,738 29,790,475

Spain 216,500 61,693

Ukraine 163,123,990 35,015,044

Moledooff 8,320,080 2,050,988

India 888,462 184,289

Israel 16,555,290 4,710,668

Romania 7,686,800 1,981,690

United Russia 30,126,915 7,880,637

Canada 18,946,928 4,899,147

Cuba 172,460 44,460

Total 591,015,761 124,560,324

Year 2009

Country of

Origin


Kg /year


Quantity (JOD)

Canada 13,293,320 3,695,970

United Russia 12,444,480 3,208,242

Romania 37,126,782 8,684,733

Egypt 361,303 85,154

Israel 25,540,215 7,208,848

India 594,292 151,478

Ethiopia 2,070,000 388,267

Ukraine 44,691,230 11,389,458

Spain 66,000 15,444

USA 177,826,962 38,570,755

Bulgaria 15,164,870 3,400,948

Brazil 15,830,910 3,406,000

Uruguay 26,238,654 4,172,424

Argentina 117,928,020 22,483,913

117

Paraguay 32,174,610 6,729,482

Muldoof 3,560,560 917,925

Total 524,912,208 114,509,041

Year 2010

Country of

Origin


Kg /year


Quantity (JOD)

Canada 13,293,320 3,695,970

United Russia 12,444,480 3,208,242

Romania 37,126,782 8,684,733

Egypt 361,303 85,154

Israel 25,540,215 7,208,848

India 594,292 151,478

Ethiopia 2,070,000 388,267

Ukraine 44,691,230 11,389,458

Spain 66,000 15,444

USA 177,826,962 38,570,755

Bulgaria 15,164,870 3,400,948

Brazil 15,830,910 3,406,000

Uruguay 26,238,654 4,172,424

Argentina 117,928,020 22,483,913

Paraguay 32,174,610 6,729,482

Muldoof 3,560,560 917,925

Total 524,912,208 114,509,041

118

ANNEX (3)

(A): Protocol for extraction of genomic DNA from plant

120

Reference: Genomic DNA from Plant User Manual NucleoSpin®, March 2010 / Rev.

04

121

(B): Protocol for DNA extraction from agarose gel.

123

Reference: PCR clean-up Gel extraction User Manual NucleoSpin®

Extract II, May 2010 / Rev. 10

Annex (4)

Sequencing results of the second band with 390bp length as

received from the company (A): Forward sequence result of the second band with 390

length of base pair

124

(B): Reverse sequence result of the second band with 390

length of base pair.

125

ANNEX (5)

(A): List of interviewee and visited organizations

The interviewees, organizations and institutions that were visited and the purpose of the

visit are shown in the following table.

List of interviewed organizations

Interviewee Organization Purpose of Visit

1. Dr. Hana Zakariya/

Poultry Nutrition

University of Jordan/ Department of

Agricultural

http://agriculture.ju.edu.jo/home.aspx

Collection of maize

samples, source: Jordan

Valley,

2. Mr. Kamal SARI/

Manager

DEBBANE/Agricultural CO.

http://www.debbanegroup.com/templates/c

ontrols/index.aspx

Structured interview to get

information on trade of

GM seeds in Jordan.

3. Zeena Al Ja‟ja‟/ Land

Scape Architect/Eco-

Management

The Arab Group of Protection of Nature

(APN)

Threats issues facing

farmers as a result of the

spread of GM seeds.

4. Mr. Hussain Shaheen,

Manaager of ……,

contact officer and

coordinator for biosafety

in Jordan

Ministry of Environment Review the current status

of Regulations and

Guidelines relevant to

GMOs in Jordan

http://agriculture.ju.edu.jo/home.aspx

http://www.debbanegroup.com/templates/controls/index.aspx

http://www.debbanegroup.com/templates/controls/index.aspx

126


5. Razan Zuayter/ General

Manager

Arab Group for Protection of Nature

(APN)

Get some Information on

their latest activities and

past events related to the

controversy carried out on

GM food in Jordan as well

as in the Middle east.

6. El Hassan Science City

Employees

Royal Scientific Society (Top

Management, Business Park,

Environmental Research Center, Energy

Research Center)

Disseminate and complete

the survey‟s forms that

measures RSS employees

awareness on GM food,

7. Jordan University for

Science & Technology

“JUST” Students

Jordan University of Science &

Technology/



measures students


8. PSUT Students Princess Sumaya University for

Technology



measures students


9. University of Jordan

Students

University of Jordan/ Agricultural &

Biology Department



measures students


10. JAEC Employees Jordan Atomic Energy Commission Disseminate and complete

the survey that measures

JAEC employees


11. Tafilla University

Students

Tafilla University Disseminate and complete

the survey that measures

students employees


12. MoEnv Employees Ministry of Environment Disseminate and fill the

survey forms that measures

MoEnv employees


13. Dr. Yousef Al

Tawalbeh/

Food & Drug Administration Disseminate and fill the

survey that measures

127


employees‟ awareness on

GM food, and to together

information on GM food

latest legislation in Jordan.

14.Ms. Jehan Hadad, “IS”,

Mr. Ameen Abu Sabha “IT

Department”

Royal Scientific Society/ Industrial studies

Division & IT Department

Get familiar with the SPSS

Statistical Analysis

program & download it on

my Personal PC

16. Ms Batoul Obaid,

Director of Techniques

Statistical & Methodologies

Department of Statistics Get her recommendation

on which software to use

for the Survey Analysis

and she advised me to use

the latest version of SPSS “

17. Eng. Eyad Saleh, Eng.

Osama Al Subaihee

Animal Production Department Visited 3 times, to get

Maize used as feed

samples for GM detection,

18. Dr. Mohammad Al-

Khraisha” Director of food

Control

Jordan Food & Drug Administration FDA Get information on latest

regulation on GMOs.

19. Dr. Hind Al Hammouri,

PHD. In Mathematics/

Measurement & Evaluation

Hashemite University Discuss the Survey

structure & analysis using

SPSS

20. Dr. Suzan Al Dura &

Dr. Sobhia Saifan Plant

Genetic Resources&

Molecular Genetics

National Center for Agricultural Research

and Extension (NCARE)

Discuss ongoing research

on GMOs, and current

regulations, and the

possibility of training on

the Real Time PCR which

is still New to them,

21. Mr.

MohammadKatbeh,”phytos

anitary Measures”, Dr.

Raeda Al Awamleh

Ministry of Agricultur To acquire laws regulating

GM seeds or GM

vegetables if there was any,

22. Mr. Jerias Abu Gazalle الكىيست االوجيليت المعمداويت Get the church views of the

http://www.ncare.gov.jo/OurNCAREPages/STAFFMENU/RelatedPages/sobhia%20saifan.htm

128


“ Evangelic Baptist Church “ concept of GM food and

whether it is permitted or

banned according to

biblical teachings.

Annex (6)

(A): Cartagena Protocol on Bio-safety,

Ratification List

135

Source: http://bch.cbd.int/protocol/parties/

http://bch.cbd.int/protocol/parties/

136

(B): Information on date of signature and the latest

communication of the Nagoya – Kuala Lumpur

Supplementary Protocol on Liability and Redress,

# Country Date of

signature

Date instrument of

rtf/acs deposited

Date of entry

into force

1 Antigua and Barbuda Aug 09, 2011

2 Austria May 11, 2011

3 Belgium Sep 20, 2011

4 Benin Oct 28, 2011

5 Brazil Mar 06, 2012

6 Bulgaria May 11, 2011

7 Cape Verde Sep 26, 2011

8 Central African Republic Mar 06, 2012

9 Chad Jan 31, 2012

10 Colombia Mar 07, 2011

11 Cyprus Dec 29, 2011

12 Czech Republic May 11, 2011

13 Denmark Mar 07, 2011

14 European Union May 11, 2011

15 Finland May 11, 2011

16 France May 11, 2011

17 Germany Sep 20, 2011

18 Guinea-Bissau Feb 01, 2012

19 Hungary May 11, 2011

20 India Oct 11, 2011

21 Ireland May 11, 2011

http://bch.cbd.int/protocol/parties/%20%20%20%20%20%20%20%20%20%20%20%20/about/countryprofile.shtml?country=ag

http://bch.cbd.int/protocol/parties/%20%20%20%20%20%20%20%20%20%20%20%20/about/countryprofile.shtml?country=at

http://bch.cbd.int/protocol/parties/%20%20%20%20%20%20%20%20%20%20%20%20/about/countryprofile.shtml?country=be

http://bch.cbd.int/protocol/parties/%20%20%20%20%20%20%20%20%20%20%20%20/about/countryprofile.shtml?country=bj

http://bch.cbd.int/protocol/parties/%20%20%20%20%20%20%20%20%20%20%20%20/about/countryprofile.shtml?country=br

http://bch.cbd.int/protocol/parties/%20%20%20%20%20%20%20%20%20%20%20%20/about/countryprofile.shtml?country=bg

http://bch.cbd.int/protocol/parties/%20%20%20%20%20%20%20%20%20%20%20%20/about/countryprofile.shtml?country=cv

http://bch.cbd.int/protocol/parties/%20%20%20%20%20%20%20%20%20%20%20%20/about/countryprofile.shtml?country=cf

http://bch.cbd.int/protocol/parties/%20%20%20%20%20%20%20%20%20%20%20%20/about/countryprofile.shtml?country=td

http://bch.cbd.int/protocol/parties/%20%20%20%20%20%20%20%20%20%20%20%20/about/countryprofile.shtml?country=co

http://bch.cbd.int/protocol/parties/%20%20%20%20%20%20%20%20%20%20%20%20/about/countryprofile.shtml?country=cy

http://bch.cbd.int/protocol/parties/%20%20%20%20%20%20%20%20%20%20%20%20/about/countryprofile.shtml?country=cz

http://bch.cbd.int/protocol/parties/%20%20%20%20%20%20%20%20%20%20%20%20/about/countryprofile.shtml?country=dk

http://bch.cbd.int/protocol/parties/%20%20%20%20%20%20%20%20%20%20%20%20/about/countryprofile.shtml?country=eur

http://bch.cbd.int/protocol/parties/%20%20%20%20%20%20%20%20%20%20%20%20/about/countryprofile.shtml?country=fi

http://bch.cbd.int/protocol/parties/%20%20%20%20%20%20%20%20%20%20%20%20/about/countryprofile.shtml?country=fr

http://bch.cbd.int/protocol/parties/%20%20%20%20%20%20%20%20%20%20%20%20/about/countryprofile.shtml?country=de

http://bch.cbd.int/protocol/parties/%20%20%20%20%20%20%20%20%20%20%20%20/about/countryprofile.shtml?country=gw

http://bch.cbd.int/protocol/parties/%20%20%20%20%20%20%20%20%20%20%20%20/about/countryprofile.shtml?country=hu

http://bch.cbd.int/protocol/parties/%20%20%20%20%20%20%20%20%20%20%20%20/about/countryprofile.shtml?country=in

http://bch.cbd.int/protocol/parties/%20%20%20%20%20%20%20%20%20%20%20%20/about/countryprofile.shtml?country=ie

137

22 Italy Jun 14, 2011

23 Japan Mar 02, 2012

24 Latvia May 11, 2011 Nov 30, 2011 RTF

25 Lithuania May 11, 2011

26 Luxembourg May 11, 2011

27 Madagascar Sep 22, 2011

28 Mauritania May 18, 2011

29 Mexico Mar 05, 2012

30 Mongolia Jan 26, 2012

31 Montenegro May 11, 2011

32 Mozambique Sep 26, 2011

33 Netherlands Mar 07, 2011

34 Nigeria Feb 01, 2012

35 Panama May 03, 2011

36 Peru May 04, 2011

37 Poland Sep 20, 2011

38 Portugal Sep 20, 2011

39 Republic of Moldova Jan 25, 2012

40 Romania May 11, 2011

41 Senegal Jan 26, 2012

42 Slovakia Jan 20, 2012

43 Slovenia May 11, 2011

44 Spain Jul 21, 2011

45 Sweden Mar 07, 2011

46 Switzerland May 11, 2011

47 Thailand Mar 06, 2012

48 Togo Sep 27, 2011

49 Tunisia May 11, 2011

50 Ukraine Jan 30, 2012

http://bch.cbd.int/protocol/parties/%20%20%20%20%20%20%20%20%20%20%20%20/about/countryprofile.shtml?country=it

http://bch.cbd.int/protocol/parties/%20%20%20%20%20%20%20%20%20%20%20%20/about/countryprofile.shtml?country=jp

http://bch.cbd.int/protocol/parties/%20%20%20%20%20%20%20%20%20%20%20%20/about/countryprofile.shtml?country=lv

http://bch.cbd.int/protocol/parties/%20%20%20%20%20%20%20%20%20%20%20%20/about/countryprofile.shtml?country=lt

http://bch.cbd.int/protocol/parties/%20%20%20%20%20%20%20%20%20%20%20%20/about/countryprofile.shtml?country=lu

http://bch.cbd.int/protocol/parties/%20%20%20%20%20%20%20%20%20%20%20%20/about/countryprofile.shtml?country=mg

http://bch.cbd.int/protocol/parties/%20%20%20%20%20%20%20%20%20%20%20%20/about/countryprofile.shtml?country=mr

http://bch.cbd.int/protocol/parties/%20%20%20%20%20%20%20%20%20%20%20%20/about/countryprofile.shtml?country=mx

http://bch.cbd.int/protocol/parties/%20%20%20%20%20%20%20%20%20%20%20%20/about/countryprofile.shtml?country=mn

http://bch.cbd.int/protocol/parties/%20%20%20%20%20%20%20%20%20%20%20%20/about/countryprofile.shtml?country=me

http://bch.cbd.int/protocol/parties/%20%20%20%20%20%20%20%20%20%20%20%20/about/countryprofile.shtml?country=mz

http://bch.cbd.int/protocol/parties/%20%20%20%20%20%20%20%20%20%20%20%20/about/countryprofile.shtml?country=nl

http://bch.cbd.int/protocol/parties/%20%20%20%20%20%20%20%20%20%20%20%20/about/countryprofile.shtml?country=ng

http://bch.cbd.int/protocol/parties/%20%20%20%20%20%20%20%20%20%20%20%20/about/countryprofile.shtml?country=pa

http://bch.cbd.int/protocol/parties/%20%20%20%20%20%20%20%20%20%20%20%20/about/countryprofile.shtml?country=pe

http://bch.cbd.int/protocol/parties/%20%20%20%20%20%20%20%20%20%20%20%20/about/countryprofile.shtml?country=pl

http://bch.cbd.int/protocol/parties/%20%20%20%20%20%20%20%20%20%20%20%20/about/countryprofile.shtml?country=pt

http://bch.cbd.int/protocol/parties/%20%20%20%20%20%20%20%20%20%20%20%20/about/countryprofile.shtml?country=md

http://bch.cbd.int/protocol/parties/%20%20%20%20%20%20%20%20%20%20%20%20/about/countryprofile.shtml?country=ro

http://bch.cbd.int/protocol/parties/%20%20%20%20%20%20%20%20%20%20%20%20/about/countryprofile.shtml?country=sn

http://bch.cbd.int/protocol/parties/%20%20%20%20%20%20%20%20%20%20%20%20/about/countryprofile.shtml?country=sk

http://bch.cbd.int/protocol/parties/%20%20%20%20%20%20%20%20%20%20%20%20/about/countryprofile.shtml?country=si

http://bch.cbd.int/protocol/parties/%20%20%20%20%20%20%20%20%20%20%20%20/about/countryprofile.shtml?country=es

http://bch.cbd.int/protocol/parties/%20%20%20%20%20%20%20%20%20%20%20%20/about/countryprofile.shtml?country=se

http://bch.cbd.int/protocol/parties/%20%20%20%20%20%20%20%20%20%20%20%20/about/countryprofile.shtml?country=ch

http://bch.cbd.int/protocol/parties/%20%20%20%20%20%20%20%20%20%20%20%20/about/countryprofile.shtml?country=th

http://bch.cbd.int/protocol/parties/%20%20%20%20%20%20%20%20%20%20%20%20/about/countryprofile.shtml?country=tg

http://bch.cbd.int/protocol/parties/%20%20%20%20%20%20%20%20%20%20%20%20/about/countryprofile.shtml?country=tn

http://bch.cbd.int/protocol/parties/%20%20%20%20%20%20%20%20%20%20%20%20/about/countryprofile.shtml?country=ua

138

51

United Kingdom of Great

Britain and Northern

Ireland

Feb 22, 2012

Source: http://bch.cbd.int/protocol/parties/#tab=1

ANNEX (7)

Survey Design & Results

(A): The Complete Survey on Genetically Modified Food in

English

Age: Gender:

Social Status: Educational Level:

Specialty: Job Description:

General Knowledge and Basics of biotechnology:

Q1. What do you think is the genetic material?

a) DNA

b) RNA

c) Protein

d) I don‟t know

Q2. What is the thing responsible for the genetic characteristics of any creature?

a) Genes

b) Cells

c) Enzymes

d) All the answers

e) None of the Above

Q3. What is the extent of your knowledge of the so-called genetic fingerprint?

a) Very good

b) I know a little about it

c) Only heard about it

d) I do not know anything about it

http://bch.cbd.int/protocol/parties/%20%20%20%20%20%20%20%20%20%20%20%20/about/countryprofile.shtml?country=gb



http://bch.cbd.int/protocol/parties/#tab=1

139

Q4. Do you know what gene therapy is?

a) I know very well

b) I have little information

c) I only heard about it

d) I have not heard about it before

Q5. Do you think that genetic engineering technology should be encouraged as a

means of for progress and development?

a) Yes I believe so strongly

b) No I do not think so

c) I have no idea

General Knowledge on Genetically Modified Food

Q6. Do you know what is genetically modified food or crops?

a) I know very well

b) I have little information

c) I only heard about it

d) I have not heard about this before

Q7. If the answer to the previous question is yes, what is the information you know

about this topic?

……………………………………………………………………………………………

……………………………………………………………………………………………

……………………………………....…..…………………..……………………………

…………………………………………………………………………….……...………

Q8. Do you think that there are ways to detect the genetically modified food and

crops?

a) Yes b) No c) I do not know

Q9. Do you think that genetically modified food or crops are:

a) Useful

b) Harmful

c) Neither useful nor harmful

d) I do not know

Q10. How safe or dangerous do you think the genetically modified food is?

a) Very dangerous

b) Very Safe

c) Neither dangerous nor safe

140

d) I don‟t know

Q11. Do you think that genetically modified food and feed is dangerous to:

a) Human health

b) Environment

c) Both of them

d) Is not dangerous at all

e) I don‟t know

Q12. Have you ever Purchased genetically modified food:

a) Yes

b) No

c) I don‟t know

Q13. How often do you look at the nutritional facts of food you purchase in terms of

genetically modified information?

a) Always

b) Sometimes

c) I never look

d) It‟s not important

Q14. Do you think that the role of media towards spreading awareness on this subject

is:

a) Effective and influential

b) Weak & limited

c) There is no role at all

Laws and Ethical standards related to Genetically Modified Food:

Q15. Do you think that genetic engineering with regard to the introduction of genes

from different organisms and injecting it into plants is religiously acceptable?

Yes, it‟s acceptable and nothing is wrong about it

it‟s not acceptable at all

it depends on the nature of the change and its causes

I have no idea

Q16. Do you think that genetic engineering with regard to the introduction of genes

from different organisms and injecting it into plants is morally acceptable?

Yes, it‟s acceptable and nothing is wrong about it

it‟s not acceptable at all

it depends on the nature of the change and its causes

I have no idea

Q17. Do you think that you may consume food if you know that it‟s genetically

modified?

Yes I will have it

No, I won‟t have it

I will try it

141

Q18. In your Opinion how important do you think is the Labeling of Genetically

Modified Food ?

Very Important

Not Important

Q19. Do you believe that the government shouldn‟t allow the entry of genetically

modified food and animal feed unless they are labeled and the percentage of

modification in them is known?

Yes, and it‟s of great importance

No, it‟s not importance

I have no idea

Q20. Do you think that the scientific research, laws and government systems have the

ability to track, examine, and impose control on the entry of Genetically

Modified Food and feed to the country?

Yes they have the capacity to do so

No they don‟t have the capacity to do so

I have no idea

Q21. Do you think that the government should take strict laws to prevent the entry of

genetically modified food and feed, before being tested and ensure quality?

Yes and this is of great importance

No, it is not important

I do not know

Q22. Do you think that the price of Genetically Modified food should be:

More expensive than the natural food

less than the natural food

Both at equal price

I do not know

Q23. are you willing to pay a higher amount in exchange for food that is not

genetically modified?

Yes

No

Q24. Do you think that genetic engineering help farmers to produce larger amounts of

crops more efficiently (i. e, less need for pesticides and fertilizers)?

Yes

No

I don‟t know

Q25. Do you think that genetically modified crops and foods is one of the important

solutions to meet the famines in the world?

142

Yes I believe this so strongly

No I don‟t think so at all

It may partially solve the problem

I do not know

143

Q26. Do you think that there are environmental risks ", for example pollution of

natural or organic crops resulting from planting and the spread of pollen of

genetically modified crops?

Yes I believe this

No I don‟t think so

I do not know

Q27. Do you think that genetically modified food that are sold for developing

countries is of lower quality than those sold in developed countries?

Yes, it is of lower quality

No it is of higher quality

both are of the same quality

I have no idea

Q28. Do you have any other comments or concerns?

144

(B): The complete Survey on Genetically Modified Food in Arabic

68 -58 57⃝-47 ⃝ 46-36 ⃝ 35-25 ⃝ 25-18 : لعمرا

: االختصبص⃝ متزوج ⃝ أعزب: اإلجتماعة الحالة ⃝أنثى ⃝ ذكر : الجنس

:العمل ووع⃝ علا دراسات ⃝ ماجستر ⃝ بكبلوريوس⃝ ثبووي :العلميت الدرجت

:الحوة التكنولوجا وأساسات العامة الثقافة

الوراثة؟ المادة ه ما برأك (1

DNA

RNA

بروتن

معروف غر

مخلوق؟ أي ف الجنة الخصائص عن المسؤول الشء هو ما (2

الجنات

الخالا

األنزمات

اإلجابات جمع

إجابة وال

الوراثة؟ بالبصمة سمى بما معرفتك مدى ه ما (3

جدا جدة

ما نوعا

فقط عنها سمعت

عنها شئا أعرف ال

الجن؟ العالج هو ما تعلم هل (4

جدا أعلم

قللة معلومات لدي


قبل من بها أسمع لم

والتطور؟ للتقدم كوسلة الوراثة الهندسة تكنولوجا تشجع جب أنه باعتقادك هل (5

بشدة ذلك أعتقد نعم

ذلك أعتقد ال

145

فكرة لدي لس

:وراثا المعدلة األغذة عن العامة الثقافة

وراثا؟ المعدلة المحاصل أو األغذة ه ما تعلم هل (6

جدا أعلم

قللة معلومات لدي


قبل من بها أسمع لم

الموضوع؟ هذا عن تعرفها الت المعلومات ه فما بنعم السابق السؤال على اإلجابة كانت إذا (7

……………………………………………………………………………………………

…………………………………....…..…………………..………………………………

……………………………………………………………………………………………

وراثا؟ المعدلة المحاصل و األغذة لفحص طرق هناك أن تعتقد هل (8

نعم

ال

أعرف ال

: ه وراثا المعدلة المحاصل أو األغذة أن تعتقد هل (9

نافعة

ضارة

ضارة وغر نافعة غر

أعرف ال

وراثا؟ المعدل الطعام خطورة أو سالمة مدى ماه (10

جدا خطر

جدا آمن

٢ أو ١ال

الأعرف

:على خطرا تشكل وراثا المعدلة المحاصل أو األعالف األغذة، بأن تعتقد هل (11

اإلنسان صحة

البئة

معا كالهما

ضرر أي لها لس

أعرف ال

146

؟ وراثا معدلة محاصل أو أطعمة اشترت أن لك سبق هل (12

نعم

ال

أعرف ال

معدلة كونها حث من شرائها قبل األطعمة محتوات إلى فها تنظر الت المرات عدد هو ما (13

وراثا؟

دائما

أحانا

أبدا أنظر ال

لذلك أهمة ال

:هو الحال الوقت ف الموضوع هذا عن التوعة نشر ف اإلعالم دور أن تعتقد هل (14

ومؤثر فعال

ومحدود ضعف

اإلطالق على له دور ال

:وراثا المعدلة باألغذة المتعلقة األخالقة والمعار القوانن النباتات ف وحقنها مختلفة كائنات من جنات بإدخال ختص بما الوراثة الهندسة بأن تعتقد هل (15

؟ دنا مقبول أمر هو

شء فه ولس مقبول نعم

أبدا مقبول غر

أسبابه و الحاصل التغر طبعة على عتمد


النباتات ف وحقنها مختلفة كائنات من جنات بإدخال ختص بما الوراثة الهندسة بأن تعتقد هل (16

أخالقا؟ مقبول أمر هو

شء فه ولس مقبول نعم

أبدا مقبول غر

أسبابه و الحاصل التغر طبعة على عتمد


وراثا ؟ معدل بأنه علمت إذا طعاما تستهلك قد بأنك تعتقد هل (17

سأتناوله نعم

أتناوله لن ال

سأجربه

147

المعدل وراثا؟ الغذاء عنونة أهمة مدى هو ما باعتقادك (18

جدا مهم

غرمهم

ما نوعا

إذا إال وراثا المعدلة األعالف أو األغذة بإدخال السماح عدم الحكومة على بأنه تعتقد هل (19

فها؟ لتعدل المئوة النسبة ومذكور كذلك بأنها معنونة كانت

كبرة أهمة ولذلك نعم

أهمة أة لذلك لس ال


وفرض فحص، تتبع، على القدرة الحكومة واألنظمة والقوانن العلم للبحث أن تعتقد هل (20

البلد؟ إلى المعدلة واألعالف األغذة دخول على رقابة

ذلك على القدرة لدها نعم

القدرة لدها لس ال


المعدلة األعالف و األغذة دخول تمنع صارمة قوانن اتخاذ الحكومة على بأن تعتقد هل (21

جودتها؟ من التأكد و فحصها تم أن قبل وراثا

كبرة أهمة لذلك نعم

أهمة لذلك لس ال

أعرف ال

:واألعالف األغذة

:تكون أن وراثا جب المعدل الطعام أسعار بأن تعتقد هل (22

الطعام الطبع من أغلى

الطبع الطعام من أقل

بالسعر متساوة

أعرف ال

وراثا؟ معدل غر طعام على الحصول مقابل أعلى مبلغ دفع على استعداد على أنت هل (23

نعم

ال

148

أي ) أعلى بكفاءة أكبر محاصل كمات بإنتاج المزارعن تفد الوراثة الهندسة بأن تعتقد هل (24

؟(األسمدة و للمبدات الحاجة تقل

نعم

ال

أعرف ال

ف المجاعات لسد المهمة الحلول أحد تشكل وراثا المعدلة واألطعمة المحاصل أن تعتقد هل (25

العالم؟

بشدة ذلك أعتقد نعم

أبدا ذلك أعتقد ال

جزئا المشكلة تحل قد ربما

أعرف ال

المعدلة بتلك العضوة أو الطبعة المحاصل تلوث مثال " بئة مخاطر هناك أن تعتقد هل (26

وراثا؟ المعدلة األعالف و المحاصل زراعة انتشار عن ناجمة " وراثا

ذلك أعتقد نعم

ذلك أعتقد ال

أعرف ال

تلك من جودة أقل ه النامة الدول ف المباعة وراثا المعدلة واألعالف األغذة أن تعتقد هل (27

؟ المتقدمة الدول ف المباعة

جودة أقل ه نعم

أعلى جودة ذات ه ال

الجودة بنفس كالهما


؟هل لدك أي مالحظات أخرى (28

……………………………………………………………………………………………

…………………………………....…..…………………..………………………………

……………………………………………………………………………………………

149

(C): Official Response of Department of Statistics on the methodology

of Survey Dissemination

From: Ghaida Khasawneh <[email protected]> To: "[email protected]" <[email protected]> Cc: Batoul Obaid <[email protected]> Sent: Tuesday, July 12, 2011 3:54 PM Subject: sample survey

االخت نوار المحترمة

تحة طبة

اشر الى الرسالة االلكترونة المرسلة من قبلك الى دائرة اإلحصاءات العامة حول المساعدة ف اختار عنة

لرسالة الماجستر الخاصة بك،

فرد من طالب الجامعات وموظف الجامعات والدوائر 400 وبعد مراجعة المرفقات فمكن اختار عنة حجمها

ومختلف ( سنة18الت تزد عن )الحكومة ف مدنة عمان، مع مراعاة توزع هذه العنة على مختلف االعمار

.حتى نضمن توزع العنة بشكل جد (من مستوى ثانوي فأعلى)المستوات التعلمة

مع االحترام

غداء خصاونة

رئس قسم العنات

150

(D):

Survey Results 1) Demographics

Gender %

Male 48.58

Female 51.42

Marital Status

Married 25.86

Single 74.14

Age

18- 25 63.7

151

25- 35 28.8

36-46 4.7

47-57 2.6

58 - 68 .3

Education

High School 1.58

Bachelor 82.36

Master 13.94

Higher Studies 2.12

152

Socio-demographic characteristics of participants

Percentages of Participants Age Categories

Age Category Frequency

(Number) Percent Valid Percent

Valid 18 - 25 219 54.8 63.7

25 -35 99 24.8 28.8

36 - 46 16 4.0 4.7

47 - 57 9 2.3 2.6

58 - 68 1 .3 .3

Total 344 86.0 100.0

Missing System (i.e

number of people

who didn‟t answer

this question)

56 14.0

Total 400 100.0

Percentages of Participants Gender

Percentages of Participants Martial Status

Marital Status Frequency Percent Valid Percent

Valid Single 281 70.3 74.14

Married 98 24.5 25.86

Missing 21 5.2

Total 400 100.0 100.0

Percentages of Participants different educational Level

Educational Level Frequency Percent Valid Percent

Valid High School 6 1.5 1.578

Bsc 313 78.3 82.36

Master 53 13.3 13.94

Higher Studies 8 2.0 2.12

Missing 20 4.9

Total 400 100.0 100.0

Gender Frequency Percent Valid Percent

Valid Male 188 47.0 48.58

Female 199 49.8 51.42

Missing System 13 3.2

Total 400 100.0 100.0

153

University Specialty Frequency Percent Valid Percent

Valid S Environmental Engineering 3 .8 .8

S Water & Environment 1 .3 .3

S Engineer 17 4.3 4.3

S Chemistry 34 8.5 8.5

S Chemical Engineering 21 5.3 5.3

Business Administration 11 2.8 2.8

S Computer information System 9 2.3 2.3

S Acounting 3 .8 .8

S Law 4 1.0 1.0

pharmacy 1 .3 .3

Management 4 1.0 1.0

Media 1 .3 .3

Financial Management 2 .5 .5

Business & Finance 2 .5 .5

S Mechatronics Engineering 1 .3 .3

Agricultural Engineering 2 .5 .5

Libraries 3 .8 .8

S physics 15 3.8 3.8

S Computer Engineering 7 1.8 1.8

S Biology 4 1.0 1.0

S Engineering Management 1 .3 .3

S Veterinarian 3 .8 .8

S nutrition 72 18.0 18.0

Agricultural Engineer 1 .3 .3

Animal Production 1 .3 .3

S Electrical engineering 7 1.8 1.8

S Soil & Irrigation 3 .8 .8

S Plant Production 5 1.3 1.3

S Medical Labs 16 4.0 4.0

S Biomedical Engineer 2 .5 .5

S Industrial Engineer 1 .3 .3

E Political Science 1 .3 .3

S Aviation Engineering 1 .3 .3

S Genetic Engineering 1 .3 .3

S Computer Science 8 2.0 2.0

E Applied English 1 .3 .3

S Networks Engineer 11 2.8 2.8

S Electrical Engineer 4 1.0 1.0

154

S Nursing 3 .8 .8

University Specialty Frequency Percent Valid Percent

S Science 4 1.0 1.0

S Food Science & Technology 1 .3 .3

S Agriculture 7 1.8 1.8

E Economics 5 1.3 1.3

S Mathematics 2 .5 .5

S software Engineering 9 2.3 2.3

Management Information System 1 .3 .3

Animation 1 .3 .3

Logistics 1 .3 .3

Arcitecture 3 .8 .8

Geology 1 .3 .3

Arabic Language 1 .3 .3

Child Education 1 .3 .3

S Nuclear Engineering 2 .5 .5

S Mechanical Engineering 13 3.3 3.3

E Environmental Science 1 .3 .3

Civil Engineering 5 1.3 1.3

Social Science

Missing

1

54

.3

13.5

.3

13.5

Total 400 100.0 100.0

2) General Knowledge and Basics of Biotechnology:

Q1. What do you think the genetic material is? Q2. What is the thing responsible for the

genetic characteristics?

Answers Frequency Percent Valid

Percent

valid DNA 379 94.8 96.2

RNA 3 .3 .76

Protein 5 .8 1.3

I don‟t

know

7

1.3 1.8

Missing

System

6 1.5

Total 400 100.0 100.0


Percent

Valid Genes 350 87.5 87.5

Cells 11 2.8 2.8

Enzymes 2 .5 .5

All the

answers

30 7.5 7.5

None of

the Above

7 1.8 1.8

Total 400 100.0 100.0

155

Q3. What is the extent of your knowledge of the

So-called Genetic fingerprint?

Q.4 Do you know what gene therapy is?

Q5. Do you think that GE technology should be encouraged as a means of

progress and development?

Answers Frequency Percent Valid Percent

Valid Yes I believe so strongly 285 71.3 71.6

No I do not think so 77 19.3 19.3

I have no idea 36 9.0 9.0

Total 398 99.5 100.0

Missing System 2 .5


Percent

Valid very good 95 23.8 23.8

I know a little

about it

171 42.8 42.9

only heard

about it

108 27.0 27.1

I do not know

anything about it

25 6.3 6.3

Total 399 99.8 100.0

Missing System 1 .3

Total 400 100.0


Percent

Valid I know very well 50 12.5 12.7

I have little

information

197 49.3 49.9

I only heard

about it

100 25.0 25.3

I have not heard

about this

before

48 12.0 12.2

Total 395 98.8 100.0


Total 400 100.0

156

(Summary)

Category 2: General Knowledge and Basics of Biotechnology Participants

Responses %

Q1. What do you think is the genetic material?

DNA 96.2

RNA .76

Protein 1.3

I don‟t know 1.8

Q2. What is responsible for the genetic characteristics?

Genes 87.5

Cells 2.8

Enzymes .5

All the answers 7.5

None of the Above 1.8

Q3. What is the extent of your knowledge of the so-called

genetic fingerprint?

very good 23.8

I know a little about it 42.9

only heard about it 27.1

I do not know anything about it 6.3

Q4. Do you know what gene Therapy is?

I know very well 12.7

I have little information 49.9

I only heard about it 25.3

I have not heard about it before 12.2

Q5. Do you think that genetic Engineering technology should be

encouraged as a means of for progress and development?

Yes I believe so strongly 71.6

157

No I do not think so 19.3

I have no idea 9.0

3) General Knowledge on Genetically Modified Food

Q.6 Do you know what is genetically modified food or crops?

Q.8 Do you think that there are ways to detect the genetically modified food and crops?

Q.9 Do you think that genetically modified food or crops are:


Valid I know very well 73 18.3 18.3

I have little

information

221 55.3 55.3

I only heard about it 85 21.3 21.3

I have not heard

about this before

21 5.3 5.3

Total 400 100.0 100.0


Valid Yes 255 63.8 64.4

No 17 4.3 4.3

I do not know 124 31.0 31.3

Total 396 99.0 100.0


Total 400 100.0


Valid Useful 127 31.8 32.6

Harmful 131 32.8 33.7

Neither useful

nor Harmful

50 12.5 12.9

I do not know 81 20.3 20.8

Total 389 97.3 100.0


Total 400 100.0

158

Q.10 How safe or Dangerous do you think the genetically modified food is?

Q.11 Do you think that genetically modified food and feed is dangerous to:

Q 12 .Have you ever Purchased genetically modified food:


Valid Yes 92 23.0 23.4

No 148 37.0 37.6

I don’t Know 154 38.5 39.1

Total 394 98.5 100.0

Frequency Percent Valid Percent

Valid Very dangerous 67 16.8 17.0

Very Safe 24 6.0 6.1

Neither

Dangerous nor

safe

119 29.8 30.3

I don’t know 183 45.8 46.6

Total 393 98.3 100.0


Total 400 100.0


Valid Human Health 42 10.5 10.6

Environment 24 6.0 6.1

Both of them 171 42.8 43.3

Is not dangerous

at all

44 11.0 11.1

I don’t know 114 28.5 28.9

Total 395 98.8 100.0


Total 400 100.0

159


Total 400 100.0

Q.13 How often do you look at the nutritional facts of food you purchase in terms of


Q.14 Do you think that the role of media towards spreading awareness on this subject is:


Valid Always 73 18.3 18.5

Sometimes 211 52.8 53.4

I Never Look 92 23.0 23.3

Its Not Important 19 4.8 4.8

Total 395 98.8 100.0


Total 400 100.0


Valid Effective and

influential

108 27.0 27.3

Weak & Limited 204 51.0 51.6

There is no role at

all

83 20.8 21.0

Total 395 98.8 100.0


Total 400 100.0

160

Category 3: General Knowledge on Genetically Modified Food Participants

Responses %

Q1. Do you know what is genetically modified food or crops?

I know very well 18.3

I have little information 55.3

I only heard about it 21.3

I have not heard about this before 5.3

If the answer to the previous question is yes, what is the information you know about

this topic?

Q2. Do you think that there are ways to detect the genetically modified food and crops?

Yes 64.4

No 4.3

I do not know 31.3

Q3. Do you think that genetically modified food or crops are useful or harmful?

Useful 32.6

Harmful 33.7

Neither useful nor Harmful 12.9

I do not know 20.8

Q4. How safe or Dangerous do you think the genetically modified food is?

Very dangerous 17.0

Very Safe 6.1

Neither Dangerous nor safe 30.3

161

( Summary)

I don‟t know 46.6

162

Continue….Category 3: General Knowledge on Genetically

Modified Food

Participants

Responses %

Q5. Do you think that genetically modified food and feed is dangerous to health

and environment? Human Health 10.6

Environment 6.1

Both of them 43.3

Is not dangerous at all 11.1

I don‟t know 28.9

Q6. Have you ever Purchased genetically modified food?

Yes 23.4

No 37.6

I don‟t Know 39.1

Q7. How often do you look at the nutritional facts of food you purchase in terms of


Always 18.5

Sometimes 53.4

I Never Look 23.3

It is Not Important 4.8

Q8. Do you think that the role of media towards spreading awareness on this subject is

effective or not?

Effective and influential 27.3

Weak & Limited 51.6

There is no role at all 21.0

163

4) Laws and Ethical standards related to Genetically Modified Food:

Q.15 Do you think that genetic engineering with regard to the introduction of genes

from different organisms and injecting it into plants is religiously acceptable?

Q.16 Do you think that genetic engineering with regard to the introduction of genes

from different organisms and injecting it into plants is morally acceptable?


Valid Yes, it’s acceptable and

nothing is wrong about it

75 18.8 19.3

it’s not acceptable at all 73 18.3 18.8

it depends on the nature of

the change and its causes

187 46.8 48.1


Total 389 97.3 100.0


Total 400 100.0


Valid Yes, it’s acceptable and

nothing is wrong about it

49 12.3 12.6

it’s not acceptable at all 59 14.8 15.1

it depends on the nature of

the change and its causes

175 43.8 44.9

I have no idea 107 26.8 27.4

Total 390 97.5 100.0


Total 400 100.0

164

Q. 17 Do you think that you may consume food if you know that it‟s genetically

modified?


Valid Yes I will have it 62 15.5 15.8

No, I won’t have it 163 40.8 41.6

I will try it 167 41.8 42.6

Total 392 98.0 100.0


Total 400 100.0

Q.18 In your Opinion how important do you think is the Labeling of Genetically

Modified Food?


Valid Very Important 302 75.5 77.8

Not Important 28 7.0 7.2

kind of 58 14.5 14.9

Total 388 97.0 100.0


Total 400 100.0

Q.19 Do you believe that the government shouldn‟t allow the entry of genetically

modified food and animal feed unless they are labeled and the percentage of

modification in them is known?


Valid Yes, and it’s of great

importance

314 78.5 80.1

No, it’s not importance 35 8.8 8.9


Total 392 98.0 100.0


Total 400 100.0

165

Q.20 Do you think that the scientific research, laws and government systems have the

ability to track, examines, and imposes control on the entry of Genetically Modified

Food and feed to the country?


Valid Yes they have the capacity

to do so

269 67.3 68.8

No they don’t have the

capacity to do so

65 16.3 16.6


Total 391 97.8 100.0


Q.21 Do you think that the government should take strict laws to prevent the entry of

genetically modified food and feed, before being tested and ensure quality?


Valid Yes and this is of great

importance

316 79.0 80.8

No, it is not important 32 8.0 8.2

I do not know 43 10.8 11.0

Total 391 97.8 100.0


Total 400 100.0

166

Summary

Category 4: Laws and Ethical standards related to Genetically

Modified Food:

Participants Responses

%

Q1. Do you think that genetic engineering is religiously acceptable?

Yes, it‟s acceptable and nothing is wrong about it 12.6

it‟s not acceptable at all 15.1

it depends on the nature of the change and its causes 44.9

I have no idea 27.4

Q2. Do you think that genetic engineering is morally acceptable?

Yes, it‟s acceptable and nothing is wrong about it 19.3

it‟s not acceptable at all 18.8

it depends on the nature of the change and its causes 48.1

I have no idea 13.9

Q3. Do you think that you may consume food if you know that it‟s genetically modified?

Yes I will have it 15.8

No, I won‟t have it 41.6

I will try it 42.6

Q4. In your Opinion how important do you think is the Labeling of Genetically Modified

Food?

Very Important 77.8

Not Important 7.2

kind of 14.9

Q5. Do you believe that the government shouldn‟t allow the entry of genetically

modified products unless they are labeled?

Yes, and it‟s of great importance 80.1

167

No, it‟s not importance 8.9

I have no idea 11.0

Continue…Category 4: Laws and Ethical standards related to

Genetically Modified Food:

Participants

Responses

%

Q6. Do you think that the scientific research, laws and government

systems have the ability to track, examine, and impose control on the

entry of Genetically Modified Food and feed to the country?

Yes they have the capacity to do so 68.8

No they don‟t have the capacity to do so 16.6

I have no idea 14.6

Q7. Do you think that the government should take strict laws to prevent

the entry of genetically modified food and feed, before being tested

and ensure quality?

Yes and this is of great importance 80.8

No, it is not important 8.2

I do not know 11.0

5) Food & Feed

Q.22 Do you think that the price of Genetically Modified food should be:


Valid More expensive than the

natural food

72 18.0 18.3

less than the natural food 151 37.8 38.3

Both at equal price 83 20.8 21.1

I do not know 88 22.0 22.3

Total 394 98.5 100.0


Total 400 100.0

168

Q23. Are you willing to pay a higher amount in exchange for food that is not genetically

modified?


Valid Yes 241 60.3 61.8

No 149 37.3 38.2

Total 390 97.5 100.0


Total 400 100.0

Q24. Do you think that genetic engineering help farmers to produce larger amounts of

crops more efficiently (i. e, less need for pesticides and fertilizers)?


Valid Yes 268 67.0 69.1

No 48 12.0 12.4

I don’t

know

72 18.0 18.6

Total 388 97.0 100.0


Total 400 100.0

Q.25 Do you think that genetically modified crops and foods is one of the important

solutions to meet the famines in the world?


Valid Yes I believe this so strongly 124 31.0 31.5

No I don’t think so at all 74 18.5 18.8

It may partially solve the

problem

167 41.8 42.4

I do not know 29 7.3 7.4

Total 394 98.5 100.0


Total 400 100.0

169

Q26. Do you think that there are environmental risks ", for example pollution of natural

or organic crops resulting from planting and the spread of pollen of genetically modified

crops?


Valid Yes I believe this 182 45.5 46.2

No I don’t think so 91 22.8 23.1

I do not know 121 30.3 30.7

Total 394 98.5 100.0


Total 400 100.0

Q.27 Do you think that genetically modified food that are sold for developing countries

is of lower quality than those sold in developed countries?


Valid Yes, it is of lower quality 207 51.8 52.9

No it is of higher quality 25 6.3 6.4

both are of the same quality 26 6.5 6.6

I have no idea 133 33.3 34.0

Total 391 97.8 100.0


Total 400 100.0

170

Summary

Category 5: Economical & Environmental Awareness of participants in GM Food &

feed

Q1. Do you think that the price of Genetically Modified food

should be:

More expensive than the natural food 18.3

less than the natural food 38.3

Both at equal price 21.1

I do not know 22.3

Q2. Are you willing to pay a higher amount in exchange for food that is not genetically

modified? Yes 61.8

No 38.2

Q3. Do you think that genetic engineering help farmers to

produce larger amounts of crops more efficiently (i. e, less

need for pesticides and fertilizers)?

Yes 69.1

No 12.4 I don‟t know 18.6

Continue….Category 5: Economical & Environmental

Awareness of participants in GM Food & feed

Q4. Do you think that genetically modified crops and foods is

one of the important solutions to meet the famines in the

world?

Yes I believe this so strongly 31.5

No I don‟t think so at all 18.8

It may partially solve the problem 42.4 I do not know 7.4

Q5. Do you think that there are environmental risks ", for

example pollution of natural or organic crops resulting

from planting and the spread of pollen of genetically

modified crops?

Yes I believe this 46.2 No I don‟t think so

I do not know 23.1

30.7

Q6. Do you think that genetically modified food that are sold

for developing countries is of lower quality than those sold

in developed countries?

171

Yes, it is of lower quality 52.9

No it is of higher quality 6.4 both are of the same quality 6.6 I have no idea 34.0

ANNEX( 8)

(A): Jordan By-Law for Bio-safety of Genetically Modified

Organisms

تعليمبث السالمت االحيبئيت للكبئىبث الحيت المحورة وراثيب الىبتجت عه

2006التقىيبث الحيويت الحديثت لسىت

1/10/2006 بتبريخ 4785 مه الجريدة الرسميت رقم 3832المىشور على الصفحت

2003 لسىت 1 مه قبوون حمبيت البيئت رقم 6 مه المبدة 1صبدر بموجب الفقرة

1المبدة

رؼ١بد اغالخ االؽ١بئ١خ ىبئبد اؾ١خ اؾسح ساص١ب زغبرب ابرغخ )رغ ز ازؼ١بد

. ، ٠ؼ ثب اػزجبسا ربس٠خ ششب ف اغش٠ذح اشع١خ (ػ ازم١بد اؾ٠١خ اؾذ٠ضخ

2المبدة

: ازؼش٠فبد

٠ى ىبد اؼجبساد ازب١خ ؽ١ضب سدد ف ز ازؼ١بد اؼب اخظظخ ب ادب ب

: رذي امش٠خ ػ غ١ش ره

.صاسح اج١ئخ : اصاسح

. ص٠ش اج١ئخ : اص٠ش

. ا١ ػب اصاسح : اال١ اؼب

172

. اغخ اؽ١خ غالخ االؽ١بئ١خ اشىخ فمب الؽىب ز ازؼ١بد : اغخ

. ام امظد ػجش اؾذد ا االسد : االعز١شاد

ا شخض اػزجبس ا ؽج١ؼ ٠م ثبعز١شاد اىبئ اؾ اؾس ساص١ب ا : اغزسد

. زغبر

. ام امظد ػجش اؾذد االسد : ازظذ٠ش

ا شخض اػزجبس ا ؽج١ؼ ٠م ثزظذ٠ش اىبئ اؾ اؾس ساص١ب ا : اظذس

. زغبر

ازجب٠ اساص ث١ اىبئبد اؾ١خ ث١ االاع ف١ب ث١ب اظزب : ازع اؾ١

. اج١ئ١خ

ا وبئ ث١ع لبدس ػ م ا ؼبػفخ ابدح اغ١١خ ، ثب ف ره اىبئبد : اىبئ اؾ

. اؼم١خ اف١شعبد اشجب اف١شعبد

. ادخبي اىبئبد اؾسح ساص١ب العاق ا ؾمي ازغبسة ف االسد : اطشػ

ا ػ١خ رز داخ شفك ا شؤ ا اث١خ بد٠خ اخش رشز ػ ا : االعزخذا اؼضي

وبئبد ؽ١خ ؾسح خبػؼخ زذاث١ش ؾذدح رؾذ ثظسح فؼبخ رالغب غ اج١ئخ

. اخبسع١خ ، رؾذ رؤص١شب ػ ره اج١ئخ

ازطج١مبد ازم١خ از ٠ز ثب اعزخذا رمببد االؽبع ا٠خ داخ : ازم١بد اؾ٠١خ اؾذ٠ضخ

االبث١ت ثب ف ره اؾم اجبشش اد داخ اخال٠ب اؼؼ١بد ا دظ اخال٠ب

ا ا رظجؼ خبسط فئزب ازظ١ف١خ ثؾ١ش رزغت ػ ؽاعض ازىبصش افغ١ع

. اطج١ؼ١خ ا اػبدح االئزالف

. اىبئبد ابرغخ اعزؼبي ازم١بد اؾ٠١خ اؾذ٠ضخ: االؽ١بء اؾسح ساص١ب ا

اىبئبد اؾسح ساص١ب

. ازغبد از رؾز ػ وبئبد ؾسح ١زخ ا ؽ١خ : زغبد اىبئبد اؾسح ساص١ب

اغد اجزخ الصاخ ا رم١ اخبؽش اؾزخ ابرغخ ػ ازمببد اؾ٠١خ : اغالخ االؽ١بئ١خ

. اؾذ٠ضخ زغبرب

رم١١ ذ رؤص١ش ا خطش اىبئبد اؼذخ ساص١ب ػ ازع اؾ١ اظؾخ : سرم١١ اخبؽ

. اج١ئخ وزه ااؽ االعزبػ١خ االلزظبد٠خ ام١ االخالل١خ

اؼ١خ از ٠ز ثب ازؼشف ػ اخبؽش ارخبر اعشاءاد ٠ز رطج١مب زم١ : اداسح اخبؽش

. اىب١خ ؽذس اخطش ا ذ ؼمي مجي

173

3المبدة

٠غش رطج١ك ز ازؼ١بد ػ ام ػجش اؾذد رذاي اعزخذا ع١غ اىبئبد اؾ١خ .أ

اؾسح ساص١ب زغبرب از لذ رط ػ آصبس ػبسح ثظ اعزذاخ اعزخذا ازع

. اؾ١ ، غ شاػبح اخبؽش ػ طؾخ االغب

: ال ٠غش رطج١ك ز ازؼ١بد ػ .ة

. ااد اظ١ذال١خ الغب .1

. (ازشاض٠ذ)اؼبثشح .2

. اعخ العزخذا اؼضي .3

. ا٠خ رظ١فبد اخش ٠ز اعزضبئب لج اغخ .4

4المبدة

: االذاف

: رذف ز ازؼ١بد ا

اغبخ ف ػب غز الئ اؾب٠خ ف غبي اب م ، بخ اعزخذا .1

. اىبئبد اؾ١خ ابشئخ ػ ازم١بد االؽ١بئ١خ اؾذ٠ضخ

.ازؤوذ اصاخ ا رخف١ف اخبؽش اؾزخ ابرغخ ػ ازىع١ب االؽ١بئ١خ زغبرب .2

. ص٠بدح غز ؽب٠خ اظؾخ اجشش٠خ اج١ئخ ف االسد .3

5المبدة

: اغخ اؽ١خ غالخ االؽ١بئ١خ

رشى اغخ ثشئبعخ اص٠ش ثؾ١ش رؼ خزظ١ ف غبالد خزفخ ف غبي ازمببد . أ

: اغالخ االؽ١بئ١خ ض١ ػ

. صاسح اج١ئخ .1

. صاسح اضساػخ .2

. اشوض اؽ جؾس اضساػ١خ م ازىع١ب .3

174

. اؤعغخ اؼبخ غزاء اذاء/ صاسح اظؾخ .4

. اغؼ١خ اؼ١خ اى١خ .5

. اغؼ١خ اؽ١خ ؾب٠خ اغزه .6

. ؤعغخ ااطفبد امب١٠ظ .7

. االرؾبد اؼب ضاسػ١ .8

. مبثخ رغبس ااد اغزائ١خ .9

. عبؼزب سع١زب ذ٠ب رغ١الد رمذبب ف غبي ازم١بد اؾ٠١خ اؾذ٠ضخ .10

ػذ ازبء اذح ٠م اص٠ش ، ٠ؼ١ب ذح عز١ فمؾ (10)اؼؼا اشبس ا١ب ف اجذ

. ثبعزجذاب ثآخش٠ ٠وال ثفظ اب

. ٠ؾك ص٠ش اػبفخ ا عخ ٠شاب بعجخ شبسوخ ثبػبي اغخ

تكون الوزارة ه نقطة االتصال الوطنة للسالمة االحائة ، وعمل مندوب الوزارة ف . ب

وقوم امن السر بدورة بتزود غرفة تبادل معلومات السالمة االحائة . اللجنة كامن سر لها

ف اتفاقة التنوع الحوي بجمع ما تم من قرارات على مستوى التشرعات والخبراء

. واالستراد والتصدر للكائنات الحة المحورة وراثا ومشتقاتها

تجتمع اللجنة مرة كل ثالثة اشهر وكلما دعت الحاجة لذلك وعتبر االجتماع قانونا بحضور .ج

. ثلث االعضاء وتصدر قراراتها بأغلبة اعضائها

. تشكل اللجان االستشارة الفنة من قبل الوزر وبتنسب من اللجنة كلما دعت الحاجة لذلك .د

ف حال اكتمال النصاب القانون للجنة فان اي قرار صدر عنها عتبر نافذا ولو تغب بعض .هـ

. االعضاء

6المبدة

: ب غؤ١بد اغخ اؽ١خ غالخ االؽ١بئ١خ

زؾم١ك االذاف اخبطخ ثز ازؼ١بد رم اغخ اؽ١خ غالخ االؽ١بئ١خ ثبزغ١ك ازؼب

: غ اغطبد راد اؼاللخ زف١ز اب اغؤ١بد ازب١خ

175

ػغ اغ١بعبد اؽ١خ رؾذ٠ذ االعشاءاد از رؾى اغالخ االؽ١بئ١خ ىبئبد اؾ١خ .أ

اؾسح ساص١ب ف اىخ خالي شش االسشبداد ابعجخ الرجبػب ػ اغز اؽ

رمذ٠ اشسح اف١خ غبد اؼ١خ اؼبذ اغئخ ػ رط٠ش رم١بد اغالخ االؽ١بئ١خ

. ف اىخ

رم١١ افائذ اشعح اخبؽش اىبخ رؤص١ش اعزخذا اىبئبد اؾسح ساص١ب ػ .ة

االغب اؾ١ا اجبد اعشاء شاعؼخ دس٠خ مب١٠ظ االب ازجؼخ ره زؤوذ ارجبع

. اسشبداد االب اىبف١خ

ثبء لذساد اغبد اؾى١خ اؤعغبد االوبد١٠خ اال١خ اؼ١خ ثزط٠ش ازم١بد اؾ٠١خ . ط

. ف االسد ػ اؽىب ز ازؼ١بد

ازغ١ك رغ١ االرظبي غ اظبد اذ١خ اؾ١خ رؾذ٠ش اؼبد اف١خ اؼ١خ .د

. اج١ئ١خ ازشش٠ؼ١خ غ زبثؼخ ازغ١شاد از لذ رطشأ ػ اغز١٠ اؾ اذ

رمذ٠ رمش٠ش ع ١ئبد اؾى١خ ٠زؼ ع١غ االشطخ از رخض ؽم اغالخ االؽ١بئ١خ .ـ

. ػ اغز اؾ

رشى١ غب خزفخ ف ؽم اغالخ االؽ١بئ١خ ف اؼبذ اخزفخ رض٠ذ ثبالسشبداد .

. اؼشس٠خ االص ارجبػب

رشغ١غ رؼض٠ض شبسوخ اغزغ اؾ ف ػ١خ طغ امشاس وزه رغ١ ط .ص

. ؼبد االصخ ػ ػ١بد اطشػ اخطؾ ىبئبد اؾ١خ اؾسح ساص١ب شزمبرب

. ازؤو١ذ ػ رافك رشش٠ؼبد االسد اخبطخ ثبغالخ االؽ١بئ١خ غ ض١الرب االل١١خ اؼب١خ .ػ

7المبدة

: االعز١شاد

ػ ع١غ ؽجبد االعز١شاد ىبئبد اؾسح ساص١ب شزمبرب ا ادخبب ج١ئخ ثشى .أ

. ز ازؼ١بد (1)مظد ا رؾز ػ االل ػ اؼبد ااسدح ف اشفك سل

ػ ع١غ ؽجبد االعز١شاد ىبئبد اؾ١خ اؾسح ساص١ب شزمبرب ا اعزخذاب .ة

وبغز٠خ ا وؤػالف ا زغ١ض ا رؾز ػ االل ػ اؼبد ااسدح ف اشفك سل

. ز ازؼ١بد (2)

رخؼغ اىبئبد اؾ١خ اؾسح ساص١ب شزمبرب ا ادخبب ج١ئخ ثشى مظد ا .ط

اعزخذاب وؤغز٠خ ا وؤػالف ا زغ١ض از عزغزسد الي ش ا ػ١خ رم١١ خبؽش

(. 1) اشفك سل (ن)ف ؽبي ػذ رطبثمب فمشح

176

٠زؾ اغزسد وفخ ػ١خ رم١١ اخبؽش ػ ا رز ػ١خ ازم١١ ؽغت ب اسد ف .د

. ز ازؼ١بد (3)اشفك سل

ػذ اعزال ؽجبد االعز١شاد ىبئبد اؾ١خ اؾسح ساص١ب ا شزمبرب لج اصاسح ، رم .ـ

. ثزض٠ذ اغبد راد اؼاللخ ثىبفخ اصبئك امذخ

رم و عخ خخ ثبزغ١ت ثمشاسب غخ اعزبدا ا دساعبرب اف١خ االصخ صبئك .

. امذخ لج اغخ اغزسدح

٠ؾك غخ ا رم ثطت ا٠خ ؼبد اػبف١خ رشاب ػشس٠خ خالي خبؽجخ اغزسد .ص

. خط١ب ثزه

ا .ػ . رمشس اغخ اافمخ ا ػذ اافمخ ػ االعز١شاد غ ث١ب االعجبة خط١ب

رؼزجش افمخ اغخ اخط١خ ثبالعز١شاد عضءا ال ٠زغضأ اساق اػزبد االعز١شاد ىبئبد .ؽ

اؾ١خ اؾسح ساص١ب شزمبرب ا ادخبب ج١ئخ ثشى مظد ا اعزخذاب وؤغز٠خ ا

. وؤػالف ا زغ١ض

ف ؽبي ػذ افمخ اغخ ، ٠ؾك ظذس ازمذ ثطت عذ٠ذ غبػ ثبالعز١شاد ػ اعبط .

رفش ؼبد عذ٠ذح رى زفشح ف اطت االي ثبء ػ ز اؼبد رم اغخ

. ثبػبدح اظش ثبطت اطذاس لشاسب ثبافمخ ا ػذ اافمخ

ػ اغزسد ا طبؽت اششع ا ٠ؼ اغخ ثؤ ؼبد عش٠خ ث١ اؼبد .ن

. امذخ غ رمذ٠ رجش٠ش ره ػذ اطت ػ اغخ ا رؾبفع ػ عش٠زب

8المبدة

: ازظذ٠ش

ف ؽبي رظذ٠ش ا اػبدح رظذ٠ش ا وبئبد ؽ١خ ؾسح ساص١ب اىخ ا ا دخ اخش

ثذف ادخبي ره اىبئبد ج١ئخ ثشى مظد ، رؼزجش اافمخ اخط١خ غخ اشع١خ ف ثذ

. االعز١شاد عضء ال ٠زغضأ اساق اػزبد ازظذ٠ش زه اجذ

9المبدة

: اغبد اخخ

رؼزجش اغبد اشع١خ ازب١خ اغبد اخخ ثبذساعبد اف١خ طجبد االعز١شاد ازظذ٠ش . أ

ىبئبد اؾ١خ اؾسح ساص١ب شزمبرب رم ثبزغ١ت ثمشاسب غخ ؽغت ب ج١ اصاء

: و ب

177

. ااد اغزخذخ الزبط اؾ١ا اجبر : صاسح اضساػخ. 1

اىبئبد اؾ١خ اؾسح ساص١ب از رصش ػ عالخ ازع اؾ١ : صاسح اج١ئخ. 2

. االغز٠خ اؼبفبد اغزائ١خ اخظظخ العزالن اجشش : اؤعغخ اؼبخ غزاء اذاء. 3

رم و عخ خخ اػال ثبػذاد ازؼ١بد اخبطخ ثب از رزفك اؽىب ز ازؼ١بد . ة

. ثؾ١ش ٠ز ػشػب الشاسب لج اغخ

10المبدة

: رم١١ اخبؽش

٠خؼغ رؤع١ظ ا شؤح ا ام١ب ثؤ شبؽ ف االسد العزخذا اؼضي ىبئبد اؾ١خ .أ

اؾسح ساص١ب ا اعزخذا ز اىبئبد وؤغز٠خ ا وؤػالف ا زغ١ض ا اافمخ اغجمخ

. غخ لذ رزؼ اافمخ اعشاء رم١١ خبؽش ؽغت ب رشا اغخ بعجب

ػذ اعزال اغخ اؽ١خ اؼ١خ ؽجبد اغبػ الداسح ا شافك ا اجذء ثؤ شبؽ راد . ة

ػاللخ ثبىبئبد اؾ١خ اؾسح ساص١ب غب٠بد االعزخذا اؼضي ا اعزخذاب وؤغز٠خ ا

. وؤػالف ا زغ١ض، ػ ز اغخ ا رم ثزؾ٠ وبفخ اصبئك ا اغخ ظش ف١ب

غخ ا رم ثطت ام١ب ثؼ١خ رم١١ اخبؽش ا ؽت ا٠خ ؼبد اػبف١خ خالي .ط

اىزبثخ خط١ب غخ اؼ١خ ف ؽبي ػذ افمخ اغخ ػ اطت رم وزه ثبخطبس اغخ

. ازمذخ ث ثزه خط١ب غ ث١ب االعجبة

غبؼبد االسد١خ شاوض اجؾس ازمذ ثطت اغبػ ثبعشاء ا٠خ شبؽبد خبطخ ثبىبئبد .د

اؾ١خ اؾسح ساص١ب ثؾ١ش رخؼغ شالجخ اغخ ػ ا رم ز اغبد ثزمذ٠ رمبس٠ش

. دس٠خ ب

ػ ع١غ اغبد اؽ١خ اؼبخ ف غبي اىبئبد اؾ١خ اؾسح ساص١ب ا رم ثبزذاث١ش .ـ

: االعشاءاد ازب١خ

. رؤع١ظ ظب اب غ االؽالق غ١ش امظد ىبئبد اؾ١خ اؾسح ساص١ب .1

. ػغ ظب اب غ ا ػ١خ م ػجش اؾذد ثشى غ١ش مظد .2

. رم١١ خبؽش الي ػ١خ اؽالق ال وبئ ؽ ؾس ساص١ب .3

. ػغ اعشاءاد طاسء ف ؽبي االؽالق غ١ش امظد .4

. ا اعشاءاد اخش رشاب اغخ ػشس٠خ .5

178

11المبدة

: ا٠خ ثطبلخ اج١ب

ػ و ظذس ا غزسد ا زؼب ؾ١ب ثبىبئبد اؾ١خ اؾسح ساص١ب شزمبرب ا ٠م

. ثػغ ثطبلخ اج١ب وب ج١ ادب

ال رؾز ػ / غشع اعزخذاب وؤغز٠خ ا وؤػالف ا زغ١ض ٠غت ػغ ػجبسح رؾز . أ

. وبئبد ؾسح ساص١ب زغبرب ال ٠شاد ادخبب لظذا ف اج١ئخ

ػشسح ث١ب ره ثػػ خالي رؾذ٠ذ ا٠خ - غشع ادخبب ج١ئخ ثشى مظد . ة

اغبد اخظبئض راد اظخ ا ؼبد ب ػاللخ ثبزذاي ا٢ ازخض٠ ام

االعزخذا عخ االرظبي ض٠ذ اؼبد ؽغت االلزؼبء اع ػا اغزسد

. اظذس

ازؾذ٠ذ ثػػ ازطجبد اخبطخ غالخ ازذاي ازخض٠ - غب٠بد االعزخذا اؼضي . ط

. ام االعزخذا وزه اؼبد اخبطخ ثبع ٠خ عخ االرظبي ض٠ذ اؼبد

. ػغ ا٠خ ث١ببد اػبف١خ رشاب اغخ ػشس٠خ . د

اذط خبذ اال٠شا

ص٠ش اج١ئخ

180

(B): Draft of Jordan Law for Bio-safety of Genetically

Modified Organisms

ا لب اغالخ األؽ١بئ١خغدح ي 2013غخ ( )سل ثشؤ ازغبد اؾسح ساص١ب

(1)مبدة

ا غخ ٠ؼ ( 2013 )٠غ زا امب لب اغالخ األؽ١بئ١خ ثشؤ ازغبد اؾسح ساص١ب

. ث اػزجبسا ربس٠خ شش ف اغش٠ذح اشع١خ

( 2) مبدة

٠ى ىبد اؼجبساد ازب١خ ؽ١ضب سدد ف زا امب اؼب اخظض ب أدب ب رذي

: امش٠خ ػ غ١ش ره

ا و وبئ ؽ عش رؼذ٠ ؽبل اساص ثؤعة خجش ال٠ز ػبدح : وبئ ؽ ؾس ساص١ب

ف اطج١ؼخ ٠خزشق اؾاعض اساص١خ اطج١ؼ١خ ث١ أاع اىبئبد اؾ١خ، عاء زظ ره

.خالي ازضاط اغغ أ االعغ

ا ا أ رؾز ػ١ب أ : ازغبد اؾسح ساص١ب ازغبد از رزى وبئبد ؾسح ساص١ب

.أعضاء ؽبلب اساص

.و رم١خ رشز ػ رم١بد رغزخذ وبئبد ؽ١خ أ أعضاء ب: ازم١بد األؽ١بئ١خ

.أ عضء اىبئ اؾ ٠ؾز ػ شفشر اساص١خ: ابدح اساص١خ

ا أ غػخ أ زظ ٠ؾز٠ : اإلؽالق اؼذ و ارظبي جبشش ث١ وبئ ؾس ساص١ب

ث١ اج١ئخ اإلغب، د ارخبر اؽز١بؽبد ؽبعخ رغ زا اإلرظبي ض اؾاعض ابد٠خ

.ثفشدب أ اؾاعض اى١١بئ١خ أ األؽ١بئ١خ

و إؽالق خطؾ زغبد ازؾس اساص ف اج١ئخ رؾذ ظشف رؾذ : اإلؽالق ازغش٠ج

ا، ره خال اعض و١١بئ١خ أ أؽ١بئ١خ أ ي ػ ازشبس اىبئبد اؾ١خ اؾسح ساص١ب

.رغ اعزشاس ره اىبئبد ف اج١ئخ

ا أ إلوضبس أ رخض٠ أ : اإلعزخذا اؼضي و ػ١خ اعزجبؽ زغبد ؾسح ساص١ب

اعزخذا أ م أ ازخض ره ازغبد ثؤعة ٠غ ارظبب ثبج١ئخ اإلغب

.خالي ؽاعض بد٠خ ثفشدب أ غ ؽاعض و١١بئ١خ أ أؽ١بئ١خ

.اج١ئخ از ٠ى ىبئ اؾ أ زبع اطي إ١ب: اج١ئخ ازم١خ

رم١١ اخبؽش ػ طؾخ اإلغب اج١ئخ ثب ف ره اىبئبد اؾ١خ : رم١١ اخبؽش اج١ئخ

ا ف اج١ئخ .أألخش، عشاء اؽالق ازغبد اؾسح ساص١ب

رزبثغ رشر١ت اغبد اساص١خ از رؼجش ػ طفخ أ طفبد ؾذدح : ا٠خ افشدح ا١ضح

ا .أدخذ ػ ازشو١ت اساص ىبئ ؽ و ٠ظجؼ ؾساا ساص١ب

ا ا ىبئ اؾ: اى اؾس ساص١ب .أ عضء ٠ؾز ػ اشفشح اساص١خ اؾسح ساص١ب

181

ثشروي لشؽبعخ ثشؤ اغالخ األؽ١بئ١خ ازبثغ إلرفبل١خ ازؼمخ ثبزع : اجشروي

.اج١ع

صاسح اج١ئخ : اصاسح

.ص٠ش اج١ئخ: اص٠ش

. أ١ ػب اصاسح: األ١ اؼب

.اغخ اؽ١خ غالخ األؽ١بئ١خ : اغخ

( 3)مبدة

: ٠ذف زا امب إ رؾم١ك ب ٠ؤر

ا ذ .1 رؾم١ك اغالخ ف رذاي اعزخذا اعز١شاد رظذ٠ش ازغبد اؾسح ساص١ب

إؽاللب اؼذ ف اج١ئخ رغت أ٠ اصبس عج١خ رشؤ أ ٠ى أ رشؤ ز١غخ زه ف اج١ئخ

.ثب ف ره اإلػشاس ثظؾخ اإلغب اىبئبد اؾ١خ األخش

شاػب األثؼبد ام١خ االلزظبد٠خ اظؾ١خ ازشرجخ ػ اإلؽالق امظد ثب ٠ؼ .2

.ؽفع اعزذا ازع األؽ١بئ ػ اغز اؽ

.ػب ازؼب ثؤلظ اعزفبدح ا رم١بد ازؾس اساص .3

ا ثشفبف١خ .4 .ر١غ١ش ازؼب غ اذي األخش ف اإلعزخذا اال زغبد اؾسح ساص١ب

ا غ١شب .5 ازؤو١ذ ػ ؽك اغزه ف اخز١بس ؽش ث١ ازغبد اؾسح ساص١ب

.ازغبد

ره ف إؽبس اؾفبظ ػ اغ١بدح اؽ١خ ػ ااسد اساص١خ اؼبسف ازم١ذ٠خ ػ

. اعزذاخ اعزخذاب ثب ٠غغ غ اغ١بعبد اإلعزشار١غ١بد اج١ئ١خ

( 4)مبدة

ا وزه ػ ازغبد اظؼخ رغش اؽىب زا امب ػ اىبئبد ازغبد اؾسح ساص١ب

ؼذح إلعزخذا اؼضي، ره إرا رغبصد اغت ا ثب ف١ب ا اشزمخ وبئبد ؾسح ساص١ب

ا ثب ٠زغك غ ازطساد اؼ١خ ف ؽشق ازؾب١ دلزب . از رؾذدب اغخ دس٠ب

( 5)مبدة

: ال رغش أؽىب زا امب ػ ب ٠ؤر

اجؾس اخزجش٠خ ازغبسة اؾم١خ اؼضخ، ب ٠زشرت ػ١ب رغشة وبئبد أ زغبد .1

ا رظذس ا ؽذاا ؼ١ب ا إ اج١ئخ، أ ف ؽبخ رغبص ؽغ ازظ اؾس ساص١ب ؾسح ساص١ب

ا ثؾ١ش ٠شاػ اإللزظبس ػ االعزخذا ألغشاع اجؾش اؼ، ٠ظذس ثزا اغخ دس٠ب

.ازؾذ٠ذ لشاس اص٠ش

182

رذاي أ اعز١شاد األد٠خ اجشش٠خ ازغخ ثزم١بد ازؾس اساص إرا وبذ ال رؾز ػ .2

.٠ى وشفب اد ع١١خ لبثخ ؼبػفخ

رغبسة ازم١ؼ اظبػ ف اإلغب أ اؾ١ا إرا وبذ ازم١خ اغزخذخ ال رشز ػ .3

.رم١بد ازؾس اساص

رظذس اغبد اؼ١خ ،و ف ؽذد إخزظبط ، امشاساد ازؼمخ ثزظ١ األس اشبس إ١ب [

.] ف ز ابدح

( 6)مبدة

رشؤ ف اصاسح غخ رغ اغخ اؽ١خ غالخ األؽ١بئ١خ ، ٠ظذس ثزشى١ب لشاس ( أ

. سئ١ظ اصساء ثبء ػ رغ١ت اص٠ش

: رؼ اغخ ف ػؼ٠زب أػؼبء زخظظ١ ٠ض اغبد ازب١خ (ة

صاسح اج١ئخ .1

اؤعغخ اؼبخ غزاء اذاء / صاسح اظؾخ .2

اشوض اؽ جؾش اإلسشبد اضساػ/ صاسح اضساػخ .3

ؤعغخ اطفبد امب١٠ظ / صاسح اظبػخ ازغبسح .4

عؼ١خ ؽب٠خ اغزه .5

أػؼبء اخجشاء ف غبالد اغالخ األؽ١بئ١خ ٠ششؾ اص٠ش ثبء ػ (أسثؼخ) .6

.رغ١ت األ١ اؼب

( 7)مبدة

: رخزض اغخ د غ١شب، ثب ٠ ( أ

إطذاس رشاخ١ض ثزذاي اىبئبد ازغبد اخبػؼخ ألؽىب زا امب أ اؽاللب .1

.أ إربؽزب إلرغبس أ اؼشع ف األعاق فك ؼب١٠ش رؾذدب اغخ

ا ثب .2 رؾذ٠ذ غت اؽزاء ازغبد اخبػؼخ ألؽىب زا امب ػ اد ؾسح ساص١ب

.٠زفك غ ازطساد اؼ١خ ف زا اغبي

ا ثب ٠زفك غ ازطساد اؼ١خ .3 رؾذ٠ذ أعة رزجغ شالجخ ازغبد اؾسح ساص١ب

.ف زا اغبي

ارخبر امشاساد ثشؤ إعشاء دساعبد زم١١ اخبؽش ف اج١ئخ ازم١خ لج اجذ ف .4

ؽت ازشخ١ض أعة إعشاء ره اذساعبد ثب ٠ؤخز ف األػزجبس ظشف اج١ئخ

.ازم١خ األبؽ اإلعزالو١خ اؼبداد اغبئذح

183

رؾذ٠ذ وفخ دساعبد رم١١ اخبؽش از لذ رض ؾظي ػ ازشاخ١ض، ره فك .5

ػ اغخ اإلعزششبد ثبذساعبد . األظخ ازؼ١بد اظبدسح ثعت زا امب

از رذ ف األسد ف شؽخ اجؾس اخجش٠خ ازغبسة اؾم١خ اؼضخ، وزه

.اؼب١٠ش ازع١١خ اظبدسح ػ اؤعغبد اذ١خ

. ز ابدح ( 3) (2)٠ظذس اص٠ش لشاساد ثشؤ ازؾذ٠ذ اشبس إ١ ف اجذ٠ (ة

( 8)مبدة

٠ؾظش ام١ب ثزذاي اىبئبد ازغبد اخبػؼخ ألؽىب زا امب أ إؽاللب أ إربؽزب ( أ

ا وب اذف ره إال ثؼذ اؾظي ػ رشخ١ض ثزه إلرغبس أ اؼشع ف األعاق أ٠ب

. اغخ

رؾذد ازؼ١بد اظبدسح ثعت زا امب ششؽ إعشاءاد اؾظي ػ ازشخ١ض (ة

.اشع امشسح

( 9)مبدة

إرا ب الزظش اؾبي ػ م اىبئبد أ ازغبد اخبػؼخ ألؽىب زا امب ػجش األسد ( أ

ثؤ٠خ ع١خ عبئ ام االخ ف١زؼ١ ػ اغخ ابلخ إخطبس أبخ اغخ (رشاض٠ذ)

ا ثبم ثؤعة إداسح اخبؽش ف ؽبالد اؾادس أعة ازبثؼخ ثب ٠زفك غ غجمب

. أؽىب اجشروي، رؾذد ازؼ١بد اظبدسح ثعت زا امب إعشاءاد ششؽ ام

٠زؾ طبؽت اشؾخ امخ اغؤ١خ ازشرجخ ػ األػشاس از رظ١ت اج١ئخ طؾخ ( ة

. اإلغب أ اىبئبد اؾ١خ األخش ز١غخ ام

ا غ ازغبد غ١ش اؾسح ف ع١خ ( ط ف ع١غ األؽاي ، ٠ؾظش م ازغبد اؾسح ساص١ب

. أ ؽب٠خ اؽذح غمخ شزشوخ

( 10)مبدة

رؼ١ اغخ ف أي إعزبع ب عىشربس٠خ ب، رز اعزال ؽجبد ازشخ١ض اشبس إ١ب ف ( أ

زا امب ؼشػب ػ اغخ، ػ١ب ل١ذ اطجبد ف عغ خبص ٠شؤ زا (7)ابدح

. اغشع، ٠ػؼ ف١ ربس٠خ عبػخ رم اطت اإلعشاءاد از إرخزد ثشؤب

رؾذد ازؼ١بد اظبدسح ثعت زا امب اإلعشاءاد از رزخز ثشؤ ز اطجبد ؽز ( ة

شؽخ ارخبر امشاس ثشؤب لج اغخ، وب رؾذد لاػذ اإلزضا ثبألؽىب اخبطخ

. ثبؼبد اغش٠خ اظص ػ١ب ف اجشروي

184

( 11)مبدة

رظذس اغخ لشاسب ثؼ ازشخ١ض أ ثشفؼ ثؤغج١خ صض األػؼبء، خالي بئز١ عجؼ١ (أ

ا ربس٠خ رمذ٠ اطت ب ف عج١ إطذاس لشاسب ارخبر اإلعشاءاد االر١خ : ٠ب

رشى١ غب فشػ١خ زخظظخ رخزض ثجؾش ب رىفب ث اغخ إلعزششبد ثشأ٠ب ف .1

.ارخبر لشاس ؼ ازشخ١ض أ سفؼ

.دػح أػؼبء غ١ش ض١ ف اغخ ، ره إلعزششبد ثبسائ .2

اإلعزششبد ثشأ اؽذ أ أوضش ام١ذ٠ ف عغ اخجشاء اظص ػ١ ف ابدح .3

. زا امب ( 12)

ػمذ عغبد اعزبع ػ١خ ض١ مطبػبد اغزغ راد االزب ، إلعزطالع اشأ ف .4

.ازظ ػع ؽت ازشخ١ض

.رى١ف ؽبت ازشخ١ض ثزمذ٠ أ٠خ ث١ببد أ ػ١بد إػبف١خ لذ رؾزبعب اغخ .5

.ازى١ف ثئعشاء دساعبد رم١١ اخبؽش اج١ئ١خ .6

ز ابدح ، اذح از ٠غزغشلب رمذ٠ (أ)ال ٠ذخ ف ؽغبة اذح اشبس إ١ب ف افمشح (ة

ث١ببد إػبف١خ رطجب اغخ مذ ؽت ازشخ١ض، وزه اذح از رزطجب دساعبد

. رم١١ اخبؽش اج١ئ١خ ػمذ عغبد إلعزطالع اشا اؼب

خطبة ط ػ١ ظؾة ثؼ [٠ز إخطبس ؽبت ازشخ١ض ثمشاس اغخ ثعت (ط

ا ربس٠خ اإلخطبس ، . ]اطي مذ اطت ؽك ازظ خالي صالص١ ٠ب

. رؾذد ازؼ١بد اظبدسح ثعت زا امب ششؽ إعشاءاد ازظ اجذ ف١ (د

( 12)مبدة

رشئ اغخ عغالا م١ذ اخجشاء ف غبي اغالخ األؽ١بئ١خ ف ازم١بد األؽ١بئ١خ إلعزؼبخ ( أ

رؾذد ازؼ١بد اظبدس ثعت زا . ثشأ٠ ف١ب رشا اغخ ب ٠زظ ثطجبد ازشخ١ض

امب ، إعشاءاد ام١ذ ف اغغ اششؽ ااعت رافشب ف اخجشاء اؤ١ م١ذ ف١،

. ٠ى ام١ذ ف اغغ ثبء ػ رشش١ؼ اغبد أ اصاساد اؼ١خ أ أػؼبء اغخ

رشئ اغخ عغالا م١ذ اخزجشاد اشعؼ١خ اؽ١خ ف غبالد دساعبد اغالخ األؽ١بئ١خ ( ة

ف ازىع١ب اؾ٠١خ اىشف ػ ؾز٠بد ازغبد األؽ١بئ١خ ىبد ؾسح

ا ا، ره إلعزؼبخ ث ف١ب رش اغخ اؾبعخ إ دساعز خجش٠ب رؾذد ازؼ١بد . ساص١ب

اظبدسح ثعت زا امب إعشاءاد ام١ذ ف اغغ اششؽ ااعت رافشب ف

. اؼب اشعؼ١خ اششؾخ م١ذ ف١

185

ا م١ذ ازشاخ١ض از ؾزب إلؽالق اؼذ، رؾذد ازؼ١بد (ط رشئ اغخ عغالا ػ١ب

. اظبدسح ثعت زا امب اج١ببد ااعت إصجبرب ف زا اغغ أعة إربؽز ؼبخ

186

( 13)مبدة

: ٠غت أ ٠زؼ ازشخ١ض از رظذس اغخ ب ٠ؤر

ا اغػ ث غشع اإلعزخذا اظشػ ث .و١خ ازظ اؾس ساص١ب

.ذح عش٠ب ازشخ١ض

.غبي اج١ئخ ازم١خ

.ؾز ثطبلبد ازؼش٠ف ابعجخ زؾم١ك اشفبف١خ اطثخ غزه

ا .ا٠خ افشدح ا١ضح زظ اؾس ساص١ب

.أعب١ت رزجغ ازظ عؾج ازذاي إرا ض األش

.اج١ببد از ٠ض إسفبلب ثغزذاد اشؾ

.أعب١ت زبثؼخ اإلؽالق لج طبؽت ازشخ١ض

ا .ؽذد اؾب٠خ از ٠ض رف١شب غزخذ ازغبد ابصخ غ١ش اؾسح ساص١ب

.أعب١ت إداسح اخبؽش ف ؽبالد اؾادس

( 14)مبدة

: ٠زض طبؽت ازشخ١ض ثب ٠ؤر ( أ

سل : ػغ ثطبلخ ىزثخ ثخؾ اػؼ مشء ػ ػجاد ازظ اشخض ث رزؼ .1

ازشخ١ض ششؽ إ عذد، ٠شبس ف اجطبلبد إ إؽزاء ازظ ػ ىبد أ

ا ا، ا٠خ افشدح ا١ضح ى ى ؾس ساص١ب .زغبد ؾسح ساص١ب

ارخبر ازذاث١ش از رغؼ ثزبثؼخ زبئظ اإلؽالق اخطؾ ثشى فظ ثب ف ره .2

.و١بد أبو اإلؽالق رؤص١ش ػ طؾخ اإلغب اج١ئخ

رزجغ ازظ ف دائشح ازذاي ثؤعة ٠ؼ ازؼشف ػ ازظ عؾج ازذاي إرا .3

.إلزؼذ اؼشسح

. رؾذد ازؼ١بد اظبدسح ثعت زا امب عبئ إعشاءاد رف١ز ز اإلزضابد ( ة

( 15)مبدة

غخ أ رؼذي ششؽ ازشخ١ض أ أ رمشس إغبئ ف أ لذ خالي فزشح عش٠ب إرا ( أ

رافشد ذ٠ب ؼبد عذ٠ذح لذ رش١ش إ اؽزبي ؽذس أػشاس ج١ئخ أ طؾخ األغب أ

. اىبئبد اؾ١خ األخش

ػ اغخ أ رخطش طبؽت ازشخ١ض ثبزؼذ٠ أ اإلغبء، ظبؽت ازشخ١ض ازظ ( ة

ا ربس٠خ إخطبس ثبمشاس ثعت خطبة ط ػ١ [لشاس اغخ خالي صالص١ ٠ب

، ]ظؾة ثؼ اطي

رػؼ ششؽ إعشاءاد ازط لشاس اغخ اجذ ف١ ، ثعت رؼ١بد رظذس (ط

. ثعت زا امب

187

( 16)مبدة

١ظ ف زا امب ب ٠ؾي د رطج١ك أ٠خ ػمثخ أشذ سد اض ػ١ب ف أ لب آخش بفز

. افؼي

( 17)مبدة

(20.000)ثغشاخ الرم ػ ( عاد3)ال رض٠ذ ػ (عخ)٠ؼبلت ثبغغ ذح ال رم ػ

ا ( 50,000)د٠بس ال رض٠ذ ػ د٠بس و اؽك ػذاا ػ خالف أؽىب زا امب وبئب

ا ازغبد اخبػؼخ ألؽىب زا امب ف اج١ئخ، إرا رشرت ػ زا ا أ زغب ؾساا ساص١ب

50,000)اإلؽالق إطبثخ إغب ثؼب غزذ٠خ رى اؼمثخ اغغ اشذد غشاخ ال رم ػ

، إرا رشرت ػ زا اإلؽالق فب اغب ، ف١ؼبلت ثبغغ ( د٠بس100,000) ال رغبص (د٠بس

. د٠بس( 250,000)ال رغبص ( د٠بس150,000)اؤثذ ثغشاخ ال رم ػ

ف ع١غ األؽاي ، ٠ؾى ثبظبدسح ثئعشاء دساعبد رم١١ االصبس ثئػبد اؾبي إ ب وب

ػ١ ػ فمخ اخبف، رؼبف ػمثخ اؼضي اظ١فخ إرا لؼذ اغش٠خ ظف أصبء أ

. ثغجت رؤد٠ز ظ١فز

( 18)مبدة

د٠بس ( 20,000)أ ثغشاخ الرم ػ (عز١)ال رض٠ذ ػ (عخ)٠ؼبلت ثبغغ ذح الرم ػ

: د٠بس و ( 40,000)الرض٠ذ ػ

لذ ث١ببد غ١ش طؾ١ؾخ أ ؼخ ؾظي ػ رشخ١ض ىبئبد أ زغبد خبػؼخ .1

.ألؽىب زا امب

٠زخز ازذاث١ش از رغؼ ثزبثؼخ اإلؽالق اؼذ ، ثب ف ره زبئظ اإلؽالق أبو رؤص١ش .2

.ػ طؾخ اإلغب

ا ألؽىب امب .3 .خبف ؽذد ازشخ١ض اظبدس ؽجمب

( 19)مبدة

( د٠بس20,000) ثغشا الرم ػ (عز١)ال رض٠ذ ػ (عخ)٠ؼبلت ثبغغ ذح ال رم ػ

د٠بس و ػشع ثذ رشخ١ض ف األعاق أ ج١غ أ ازذاي أ أل (40,000)الرض٠ذ ػ

. غشع اخش ، أؽذ ازغبد اخبػؼخ ألؽىب زا امب غ ػ ثزه

٠ؾى ثئغالق اشؤح از ر اؼشع ف١ب ظبدسح ازغبد اؼشػخ ثئعشاء رم١١ ا٢صبس

. ثئػبد اؾبي إ ب وب ػ١ ػ فمخ اخبف

188

( 20)مبدة

( 10,000)أ ثغشاخ ال رم ػ ( عخ)أشش ال رض٠ذ ػ (6)٠ؼبلت ثبغغ ذح ال رم ػ

ا ( 20,000)د٠بس ال رض٠ذ ػ د٠بس و رغجت ثغ١ش ػذ ف إؽالق وبئ ؽ ؾس ساص١ب

أ زظ خبػغ ألؽىب زا امب ف اج١ئخ، إرا رشرت ػ زا اإلؽالق إطبثخ إغب ثؼب

عاد ثغشاخ ال رم ػ (صالس )ال رض٠ذ ػ (عز١)غزذ٠خ ف١ؼبلت ثبغغ ذح ال رم ػ

د٠بس ، إرا رشرت ػ زا اإلؽالق فبح اغب ف١ؼبلت (40,000)ال رض٠ذ ػ ( د٠بس20.000)

ف . د٠بس (80,000)د٠بس ال رض٠ذ ػ (40,000)ثبغغ اؤثذ ثغشاخ از ال رم ػ

ع١غ األؽاي ٠ؾى ثبظبدسح ثئعشاء رم١١ األصش اج١ئ ثئػبدح اؾبي إ ب وب ػ١ ػ

. فمخ اخبف

( 21)مبدة

( 20,000)أثغشاخ ال رم ػ (عخ)أشش ال رض٠ذ ػ (عزخ)٠ؼبلت ثبغغ ذح الرم ػ

: د٠بس و ( 40,000)د٠بس ال رض٠ذ ػ

ؽشػ ج١غ أ زذاي أ أل غشع اخش ف األعاق أؽذ ازغبد اخبػؼخ ألؽىب زا .1

ا اج١ببد از رذي ػ١ غ ػ ثزه ا ث خب١ب ٠ؼبلت ثزاد اؼمثخ . امب شخظب

.و ػشع زا ازظ غ ػ ثزه

م وبئبد أ زغبد خبػؼخ ألؽىب زا امب ػجش اىخ ثؤ٠خ ع١خ وبذ لج إخطبس .2

(9)أبخ اغخ ثبم ثؤعة إداسح اخبؽش ف ؽبخ اؾادس اؼبسػخ فك ابدح

.زا امب

رؼب غ ازظ اشخض ث ثؼذ إزبء ذح عش٠ب ازشخ١ض أ ثؼذ إغبئ أ رؼذ٠ سغ .3

.إخطبس ثزه لج اغخ

٠ززجغ زبئظ إؽالق ازظ زذاي ثؤعة ٠ؼ ازؼشف ػ١ عؾج ازذاي إرا .4

.إلزؼذ اؼشسح

لب ثئعشاء ثؾس خجش٠خ أ رغبسة ؽم١خ ؼضخ ػ وبئبد أ زغبد خبػؼخ ألؽىب .5

.زا امب ثغت رزغبص ره از ؽذدرب اغخ

ف ع١غ األؽاي ٠ؾى ثبظبدسح ثئعشاء رم١ األصش اج١ئ ثئػبدح اؾبي إ ب وبذ ػ١

. ػ فمخ اخبف

ؾىخ أ رمشس ف ؽبالد اؼشسح إغبء ازشخ١ض ف اؾبالد امشسح ف افمشاد

(1)،(2)، (4 .)

189

( 22)مبدة

( 20,000)أ ثغشاخ الرم ػ (عخ)أشش ال رض٠ذ ػ (عزخ)٠ؼبلت ثبغغ ذح ال رم ػ

د٠بس و ؽبي د رى١ األشخبص اػ طفخ (40,000)د٠بس ال رض٠ذ ػ

ا ألؽىب زا امب ام١ب ثاعجبر ره ثؤ ؽش٠مخ وبذ . اؼبثطخ اؼذ١خ فمب

( 23)مبدة

ف األؽاي از رشرىت ف١ب اغش٠خ ثاعطخ شخض ؼ ٠ؼبلت اغؤي ػ اإلداسح افؼ١خ

شخض اؼ اخبف ثزاد اؼمثبد امشسح ػ األفؼبي از رشرىت خبفخ ألؽىب زا

. امب إرا صجذ ػ ثب وبذ اغش٠خ لذ لؼذ ثغجت إخال ثاعجبد ظ١فز

٠ى اشخض اإلػزجبس غؤالا ثبزؼب ػ افبء ثب ٠ؾى ث ػمثبد ب١خ

رؼ٠ؼبد إرا وبذ اغش٠خ از لؼذ خبفخ ألؽىب زا امب لذ أسرىجذ أؽذ اؼب١

. ثبع ظبؾ

( 24)مبدة

مبطذ زا امب ، ٠ؼ االشخبص ر اإلخزظبص از٠ ٠غ١ اص٠ش ثبء ػ رغ١ت

ى شخض . األ١ اؼب ، طفخ اؼبثطخ اؼذ١خ ؼب ازف١ز افؼبي ألؽىب زا امب

. ؽج١ؼ أ ؼ اؾك ف اإلثالؽ ػ ا٠خ خبفخ ألؽىب زا امب

( 25)مبدة

ى شخض ؽج١ؼ أ ؼ اؾك ف ازؼ٠غ اؼبدي ػ األػشاس از رؾك ث ازغبد

. اخبػؼخ ألؽىب زا امب

( 26) مبدة

. ٠غ أ ض ف أ رشش٠غ آخش ٠زؼبسع غ أؽىب زا امب

(27) مبدة

٠ظذس غظ اصساء األظخ االصخ زف١ز أؽىب امب ، وب ٠ظذس اصساء اخزظ و

. االصخ زف١ز أؽىب ازؼ١بد ف غبي اخزظبط ،

( 28) مبدة

190

. سئ١ظ اصساء اصساء ىف ثزف١ز أؽىب زا امب

Abstract (in the second language)

دراسة الوضع الحالي للقوانين المتعلقة بمنتجات الكائنات المعدلة وراثيا "" ومدى انتشارها في األردن

إعداد نوار الحسيني

مشرفال العبيدي دمحم عبد القادر إبراهيم الدكتوراألستاذ

المشرف المشارك نسرين ضيف هللا الحمودةرالدكتو

الملخص

هناك العدد من المنتجات المعدلة وراثا قد بدأت ف الظهور ف السوق األردن، وهذا ثر

وما ؟ أم ال الجنات المدخلة مسموح التداول بها هذهالسؤال عن أصل هذه المنتجات وما إذا كانت

وذلك ،هدف هذا البحث إلى التحقق عمقا ف هذه القضة حث هو سبب حدوث هذه الظاهرة؟

من خالل الكشف ف السوق األردن عن أكثر أنواع النباتات الت تم تعدلها وه الذرة سواء

مفهوم المنتجات نع كما سعى هذا البحث إلى قاس وع األردنن .״ا أم علف״كانت غذاءأ

المعدلة وراثا، والنظر ف الوضع الحال للقوانن واألنظمة وكذلك بحث وجهات النظر األخالقة

.والدنة مع الجمهور بخصوص هذا الموضوع

مراجعة المقاالت ذات الصلة والدراسات السابقة، وكذلك البحث عن وقد شملت منهجة البحث

هذا باإلضافة إلى جمع عنات الذرة من السوق وتنفذ .طرق شبكة اإلنترنت واألفالم الوثائقة

من القطاعن العام مع المختصن مقابالتاجراءاستبان وعمل /انشاءكم تم .التجارب المخبرة

.الخاص والعدد من المؤسسات الحكومة وغر الحكومة/

عنة 29 حوال ، فإن عنة ذرة تم جمعها40وقد أظهرت الفحوص المخبرة أنه من بن

عنة ذرة (٪69 )20تم العثور على فقد وعالوة على ذلك . أنها معدلة وراثاتوجد (72.5٪)

. غر مصرح بها ومعدلة وتحتوي على جنات مدخلة

191

٪ أجابوا أنهم 18 ، فإن نسبة شخص تم استطالعهم400وقد أظهرت نتائج االستبان أنه من بن

، كما تبن أن عددا قلل جدا من هؤالء قام بإعطاء األغذة المعدلة وراثاهة عرفون جدا ما

ممن ٪45 ، فإنوعندما سألوا عن وجهات نظرهم الدنة واألخالقة. اإلجابة العلمة الدققة

من أي كائن تم أخذ الجن ) أجابوا بأن حكمهم توقف على طبعة التغر شملهم االستطالع

.والسبب وراء هذا التغر (المنقول

أن حث أنه من المهم جدا عنونة األغذة المعدلة وراثا، من عنة الدراسة٪ 75.5ت أكدكما

دخول المنتجات المعدلة لمراقبةرصد ووضع قوانن صارمة معنة ب٪ عتقدون أن الحكومة80

.وراثا

وكذلك قام 2004 الوطنة عام حائةذكر أن االردن قام بوضع إطار للسالمة اإلبالومن الجدر

بوضع أنظمة للسالمة البولوجة للكائنات الحة المحورة وراثا حث تم نشرها ف الجردة

كما أن وزارة البئة و بالتعاون مع المختصن من جهات حكومة وشبه ،2006الرسمة عام

حكومة وغر حكومة وجامعات قامت مؤخرا بإعداد مسودة قانون السالمة اإلحائة والذي نأمل

.ف أقرب وقت حز التنفذ ه وضعأن تم

تم بحمد هللا

A STUDY ON THE GUIDELINES STATUS AND THE PREVALENCE OF GENETICALLY MODIFIED PRODUCTS IN JORDAN

Documents

Transcript of A STUDY ON THE GUIDELINES STATUS AND THE PREVALENCE OF GENETICALLY MODIFIED PRODUCTS IN JORDAN