A STUDY ON THE GUIDELINES STATUS AND THE
PREVALENCE OF GENETICALLY MODIFIED
PRODUCTS IN JORDAN
By
Nawar Tareq Kamal El Husseini
Supervisor
Prof. Mohammed Abdulkader Ibrahim Al-Obaide
Co- Supervisor
Dr. Nisreen Daifallah Al-Hmoud
This thesis was submitted in partial fulfillment of the requirements for the
Master’s Degree in Environmental Management and Technology
King Abdulla School for Graduate Studies and Scientific Research
Princess Sumaya University for Technology
May, 2013
ii
ACKNOWLEDGEMENT
I thank God who guided me all through this research and gave me the strength and
knowledge. I also thank deeply my supervisor Professor Mohammed Al-Obaide and my
co- supervisor Dr. Nisreen Al Hmoud for their patience, continuous support and
motivation to carry out this challenging research. I am also very grateful to Professor
Eric Kubler for giving me the chance to train at the FHNW (University of Applied
Sciences North Western Switzerland), labs. Furthermore I also want to express my
gratitude to the Royal Scientific Society/Biosafety Unit for offering me the opportunity
to carry out my experiments in their professional labs.
Most importantly I thank Princess Sumaya University of Technology (PSUT) and the
Environment Technology & Management faculty for their efforts, collaboration and
encouragement throughout my research and the whole master program.
I finally dedicate all the results and findings of my thesis to the relevant and concerned
stakeholders and officials in Jordan and I hope they can take all the recommendations
seriously and implement all the necessary actions to ensure better health and safer
environment for all.
iii
TABLE OF CONTENTS
COMMITTEE DECISION…………………………………………………………………ii
ACKNOWLEDGEMENT…………………………………………………………………iv
LIST OF TABLES………………………………………………………………………...iiiii
LIST OF FIGURES……………………………………………………………………...viii
LIST OF ABBREVIATIONS …………………………………………………………….x
LIST OF ANNEXES……………………………………………………………………...xii
ABSTRACT….…………………………………………………………………………..xiii
INTRODUCTION…………………………………………………………………………1
CHAPTERONE: LITERATURE REVIEW
1.1 What is genetically modified food…………………………………………………5
1.2 The historical background and global cultivation of genetically modified crops..…6
1.3 Public perceptions and consumers acceptance of genetically modified food
crops in different parts of the world…………………………………………… 10
1.4 Health risks,environmental impacts and biosafety of genetically modified food and
feed……………………………………………………………………………...…12
1.5 Ethical and religious views of biotechnology and genetically modified food…….16
1.6 Laws and regulations controlling the prevalence of genetically modified food and
feed………………………………………………………………………………...18
CHAPTER 2: RESEARCH METHODOLOGY
2.1 Prevalence of genetically modified maize in Jordan………………………………23
2.1.1 Collection of maize samples from Jordanian market….………………………23
2.1.2 Samples pretreatment……………………………………………………….....24
2.1.3 Lab procedure for extraction of genomic DNA from plant. ………………….27
2.1.4 Determination of DNA purity and concentration:…………………………… 28
2.1.5 DNA amplification by qualitative Polymerase Chain Reaction (PCR)……… 28
2.1.6 Gel electrophoresis…………………………………………………………….30
2.2 Examining Jordanians awareness regarding the different issues of genetically
modified food and feed…………………………………………………………...33
2.2.1 Survey methodology………………………………………………………..…33
2.2.2 Data entry and processing……………………………………………………..35
iv
2.3 Assessing the current status of laws and regulations controlling genetically
modified food and feed in Jordan…………………………………………………36
CHAPTER 3: RESULTS & DISCUSSION
3.1 Local production of maize………………………………………………………...37
3.2 Incidence of 123 bp and 390 bp DNA fragments in genetically modified maize...43
3.3 Sequencing results of genetically modified maize with second band…………….45
3.3.1 Alignment sequence analysis…………………………………………………….47
3.3.2 Genetic event of genetically modified maize……………………………………48
3.4 Results of survey analysis………………………………………………………....52
3.5 Major findings of laws and regulations governing genetically modified food and
feed………………………………………………………………………………...76
3.5.1 Current status of bio-safety laws in Jordan……………………………………83
3.5.2 Summary of Jordan biosafety framework, draft by law and latest national report
on the implementation of the Cartagena Protocol on
Biosafety…………………......................................................................................88
Discussion……………………………………………………………………………...…91
Conclusions and Recommendations……………………………………………………...96
References ………………………………………………….……………………….…..100
Annexes………………………………………………………………………………….107
Arabic Abstract………………………………………………………………………..…178
v
LIST OF TABLES
NUMBER TABLE CAPTION PAGE
1.6 EU Biotech Regulations. 20
2.1.5 – A
Sequences of primers used in PCR amplification
experiments and sizes in Base pairs (bp) of PCR
amplified DNA fragments.
30
2.2.1 Numbers of surveys carried out in different
organizations around Jordan.
34
3.1-A Total quantities and price of yellow maize imported from
different countries around the world from 1994 -2010. 38
3.1-B Self-Sufficiency Ratio (SSR) of maize, Jordan, 2002 –
2010. 39
3.1- C Biotec Mega Countries. 41
3.1-D Jordan imports of maize from different countries between
1994 -2010. 42
3.2
Incidence of 123 bp and 390 bp DNA fragments in
maize (food and feed) samples and country of origin, +
and – indicate presence and absence of DNA fragments
respectively.
46
3.3 The amplified DNA sequences obtained from 390 bp
DNA sequence.
49
3.3.1
Sizes in base pairs (bp) of PCR amplified DNA
fragments when using specific primers for detection of
GM maize MON810/JBU.
51
3.5 Current status of GMO regulations in different Arab
Countries. 79
0 Jordan status with regard to Cartagena Protocol treaty. 85
vi
LIST OF FIGURES
NUMBER FIGURE CAPTION PAGE
1.1 The composition of the new genetically modified
(GM) DNA construct.
6
1.2-A Major Cultivation of GM crops. 8
1.2-B Estimated number of farmers cultivating GM crops
worldwide.
9
23.12.1.3
Experimental procedure for extraction of genomic
DNA from plant.
26
2.1.4
Determination of DNA concentration using a
spectrophotometer and an Eppendorf
Biophotometer.
28
2.1.5 Graphic illustration of a section of the GM maize
cassette with the CaMV 35S-promoter and the
maize hsp70 intron, and relative position of primers
mg1,mg2,mg3 and mg4.
32
3.13.1
Total production of yellow maize in Jordan between
1994- 2010.
37
3.2-A
Agarose gel electrophoresis revealing incidence of
123 bp and 390 bp DNA fragments in extracted
DNA from standard maize MON810/JBU1.
44
3.2-B Agarose gel electrophoresis for the detection of
amplified PCR products of maize samples.
45
3.3.1 The matching sequence of second sequence 390 bp
(V3) which matches a plant transformation vector
PSITEII-8C1.
47
3.3.2-A Agarose gel electrophoresis for the detection of
amplified nested products for standard maize
MON810/JBU1.
49
3.3.2-B Agarose gel electrophoresis for the detection of
amplified PCR products with p35S (F,R) for
standard maize MON810/JBU1.
49
3.3.2-C Agarose gel electrophoresis for the detection of
amplified PCR products.
50
vii
NUMBER FIGURE CAPTION PAGE
2.3 3.4 - A Pie charts of participants demonstrating socio-
demographic characteristics: (A) age, (B) gender,
(C) marital Status, (d) educational background, (e)
the university major specialty and (F) educational
level.
53
3.4 - B General awareness of participants on basics of
biotechnology.
55
3.4 – C
General knowledge of participants on genetically
modified Food.
59
3.4 – D Participants‟ perception on laws and ethical
standards governing GM food.
66
3.4 – E Economical and environmental awareness of
participants in GM food & feed.
70
viii
LIST OFABBREVIATION
ARM Antibiotic Resistant Marker
BT Bacillus Thuringiensis Toxin
BLAST Basic Local Alignment Search Tool
BC Before Christ
DNA Deoxyribonucleic Acid
CBD Convention on Biological Diversity
DNTP Deoxynucleotide Triphosphates ("building blocks" for DNA)
DOS Department of statistics
EFSA European Food Safety Authority
EPA Environmental Protection Agency
EU European Union
FAO Food and Agricultural Organization
FDA Food and Drug Administration
GMO Genetically Modified Organism
g The force of gravity, (1 g is equal to the force of gravity at the
Earth's surface, which is 9.8 meters per second).
Ha Hectare
JAEC Jordan Atomic Energy Center
JBU1 Jordan Bio-safety Unit
JFDA Jordan Food and Drug Administration
LMOs Living Modified Organisms
Mha Million hectare
Nm Nanometers, (measurement unit of wave length)
NCBI National Center for Biotechnology information
ix
MoEnv Ministry of Environment
MON Monsanto
NCARE National Center for Agricultural Research & Extension
NGO Non Governmental Organization
PCR Polymerase Chain Reaction
PC Binding Buffer
PE Elution Buffer
PL1 Lysis Buffer
PL2 Lysis Buffer
PW1 Wash Buffer
PW2 Wash Buffer
USA United States of America
UV Ultra Violet
RSS Royal Scientific Society
SSR Self Sufficiency Ratio
SPSS Statistical package for social science
X Concentration of Suspension
TAE Tris base Acetic acid and EDTA
x
LIST OF ANNEXES
NUMBER ANNEX TITLE PAGE
1
A: Detection of GM Food Training Certificate in the
Molecular Biology Laboratory of the University of
Applied Sciences Northwestern Switzerland (N/W)
107
B: Equipments used in the laboratories of the School
of Life Sciences/Institute of Chemistry and Bio
analytics/University of Applied Sciences
Northwestern Switzerland FHNW.
108
2 Quantities and country of origin of the imported
yellow maize to Jordan in different years
109
3
A: Protocol for extraction of genomic DNA from
plant
116
B: Protocol for extraction of genomic DNA from
agarose gel
121
4
A: Forward Sequencing of the second band with
390 bp length.
122
B: Reverse sequencing of the second band with
390bp length.
120
5 List of interviewee and visited organizations 123
6
A: Ratification list of Cartagena Protocol on
Biosafety
126
B: Ratification list of Nagoya – Kuala Lumpur
Protocol on Biosafety
131
7
A: The complete survey on genetically modified
food in English.
133
B: The complete survey on genetically modified
food in Arabic
138
C: Official response of department of statistics on
the methodology of survey dissemination.
143
D: Survey results 144
8
A: Jordan By-Law for bio-safety of genetically
modified organisms (2006)
163
B: Draft of Jordan Law for bio-safety of genetically
modified organisms (2013)
171
xi
A STUDY ON THE GUIDELINES STATUS AND THE
PREVALENCE OF GENETICALLY MODIFIED PRODUCTS IN
JORDAN
By
Nawar El Husseini
Supervisor
Prof. Mohammed Abdulkader Ibrahim Al-Obaide
Co- Supervisor
Dr. Nisreen Daifallah Al-Hmoud
ABSTRACT
Genetically modified (GM) crops are providing supply for ever increasing demand
of food and feed; however, there are concerns about their biosafety. Many unlabeled
genetically modified products have started to appear in the Jordanian market, this raise a
question about the origin of these products and whether the genetic events are
authorized. This research study intends to investigate this issue in-depth as it aims at the
detection of GM maize food and feed in the Jordanian Market. It also seeks to examine
Jordanians awareness towards GM products, and look into the current status of laws and
regulations as well as examine the ethical and religious views of the public regarding
this subject.
The research methodology included reviewing related articles and previous
studies, looking through the internet and documentaries, and most importantly
collecting maize samples from the market and carrying out lab experiments for
detection of maize GM products. This was followed by developing a survey and
interviewing people from public/ private sectors and several governmental & non-
governmental institutions.
Experimental results have shown that out of 40 maize samples collected 29
(72.5%) were found to be genetically modified. Moreover 20 GM maize samples (69%)
were found to contain genetic element of 390 bp in addition to 123 bp sequence. The
results showed that the primer pair normally used to amplify a 123 bp DNA fragment of
the standard CaMV P-35S promoter also amplified a 390 bp DNA fragment in GM
maize.
xii
The results of Jordanians awareness towards GM products showed that out of the
400 people who were surveyed 18 % said that they know very well what genetically
modified food is. However out of this percent very few people gave the exact right
scientific answer. When asked about their religious and ethical views more than 45 %
said their judgment depends on the nature of the change i.e (the kind of species it was
taken from) and the reason behind this change. 75.5 % of the people stressed that it is
very important to label genetically modified food, and 80 % think that the government
must enact strict law and set regulations which control and monitor the genetically
modified products (GM) products and prevent the entry of unauthorized GM products.
In 2004, Jordan came out with a National Bio-safety Framework and a Proposed
By-Law for bio-safety of Genetically Modified Organisms which was published in
gazette in 2006. Recently, the Ministry of Environment in collaboration with specialists
from governmental, non-governmental organizations and universities has prepared a
bio-safety law which we hope to be put into force as soon as possible.
1
Introduction
This thesis intends to discuss the “Guidelines Status and the Prevalence of Genetically
Modified Products in Jordan”. The real reason behind choosing this topic was first a
personal interest in the field of genetics and the DNA which withholds countless
number of hidden secrets that is still waiting to be revealed until this day. Moreover the
researcher was motivated to investigate the new emerging molecular biotechnologies
and their impact on the environment, food supply, and our health. This in addition to the
desire to raise the awareness and improve Jordanians understanding of the pros and cons
of the spread and consumption of genetically modified (GM) food, as well as to
improve and alert the local government to examine, monitor and control the plantation
and entry of such products to Jordan without the public knowledge or consent.
The first insertion of bacterial gene into a plant appeared in 1983. Later on and in 1994
was the first production of GM tomato, which entered the USA market (Jensen, 2009).
Switzerland was one of the first countries to place a labelling law for GM food, in 1998
the European Union had stopped the approval of new GM crops for import or
cultivation on European soils (Weasel, 2009).
Many previous studies have pointed out that gene technology is under great
controversy, which has started in Europe in the 1980s and is still problematic until this
day in many parts of the world. Other studies revealed that around 58 % of Americans
are unaware of the difference between the GM and normal foods. (Jebreen, 2010)
The Cartagena Protocol on bio-safety recognized the growing public concerns of GMOs
risks to human health and biodiversity. In this respect, several studies on the bio-safety
2
issue of GM crops showed negative effects on health. A recent study showed the risk of
feeding experimental animals with commercialized GM maize. The negative effects
were mostly associated with kidney, heart, adrenal glands, spleen, hematopoietic system
and liver (Seralini et al., 2012).
On the other hand some scientists support this technology and think that it is a new
science, which aims to increasing yields, strengthening resistance to diseases, pests and
herbicides, shortening crops maturation time, engineering new products and improving
growing techniques which will eventually increase food security for the growing
population. This in addition to that GMOs could be used in scientific and medical
research.
Accordingly, this study intends to investigate the prevalence of GM maize which is
present in the Jordanian market. It also seeks to examine Jordanians awareness
regarding the different issues of GM food and feed and measure their knowledge and
understanding of this subject. Additionally, it will assess the current laws and
regulations that control GM food and feed entry, plantation and consumption in Jordan.
Finally, the study aspires to research the ethical and different religious views of GM
food and feed.
In order to achieve the above goals, the research had begun with the collection of maize
food and feed samples from Jordanian market, followed by lab experiments to detect the
presence of GM products. Secondly, a survey was developed to tackle many aspects,
such as public background of biotechnology, GM food, laws and moral standards
related to GM food and feed. These surveys were then disseminated to several
institutions in different regions of Jordan (Amman, Irbid and Tafilah). Additionally,
there were several structured and semi structured interviews with several key persons
3
from public and private sectors in Jordan in order to acquire more information on the
current status of the regulatory system regarding the GM products entry and trade as
well as to understand how governmental institutions act in response to the presence of
such products.
Problem Statement
The Conflict of the Study
There has been lately a great controversy surrounding Genetic Engineering Technology
as a result of many factors; as the lack of in-depth and comprehensive expertise in that
specific field, the spread of GM food and feed without the knowledge of the public,
insufficient laboratory testing, and absence of bindings laws that hold all parties who
trade and deal with these products accountable.
Many scientific researches carried out worldwide show that the impacts of such
products may be harmful to human health and the environment. Other researches point
out to the fact that the impact is still unknown; conversely some researches state that
GM products are useful and have no harm at all. This as well as many uncertainties and
ambiguities that encircle this technology.
Goals of the Study
This study aims to detect the occurrence of GM maize from food and feed which are not
labeled in the Jordanian Market. It also seeks to examine Jordanians awareness towards
GM products and assess their knowledge concerning different issues related to
consumption, trade, regulations, religious and ethical views through a survey
questionnaire; the specific survey‟s objectives were to:
4
- Provide baseline data that will help guide future researchers to understand the
population trend towards dealing with GM products.
- Assess the Jordanians knowledge on GM products and their prevalence and measure
the degree of public acceptance of the appearance and spread of GM products in their
daily diet.
- Explore participants understanding about the risk factors associated with the
consumption of GM food.
- Provide recommendations about the high priority issues that must be dealt with to
protect the health and safety of humans and their environment.
Furthermore, one of these research goals is to study the current status of laws and
regulations that should control GM food and feed entry, plantation and consumption in
Jordan. Moreover, this study has also looked into ethical and some religious views
against the consumption of GM food and feed.
The Major Drive behind the Study
The primary motive that encouraged the researcher to carry out this study stemmed
from the personal interest in the mysteries of the genome which carries numerous
numbers of recipes that forms humans, animals, plants, bacteria, viruses and many other
living organisms on earth. This tiny little nano-molecule called DNA withholds
countless number of hidden secrets that is still waiting to be unfolded till this day.
Additionally, the desire to improve our country‟s system to monitor, control and
efficiently manage the entry of GM products together with all the facts that were
mentioned in the two above sections created a very strong driving force to perform this
research.
5
Chapter 1 Literature Review
1.1 What genetically modified food is
Genetic Engineering (GE) is a selective deliberate process of transferring a gene or
genes that has a certain desirable trait from one species and then moving it to another
unrelated species. In other words, it is a manipulation and alteration of the genetic
material (constitution) of an organism in such a way as to allow it to produce different
(foreign) proteins. Some other words often applicable to the same process are gene
splicing, gene manipulation, or recombinant deoxyribonucleic acid (DNA) technology
(Rees, 2006). For example a gene could be transferred from bacteria or animal to plants
to gain required property; a gene responsible for conferring antifreeze property in
Flounder (an ocean-dwelling flatfish species that is found in coastal lagoons and
estuaries of the Northern Atlantic and Pacific Oceans) was transferred to a tomato so it
can gain its antifreeze properties (McHughen, 2000). Another example is the transfer of
a gene coding for Bacillus thuringiensis (BT) toxin from a soil bacterium and moving it
into a potato genome, so it can produce its own pesticide (Smith, 2003).
Accordingly, the process of genetic engineering involves first selecting the DNA
segment that has the desired trait, then taking it out from the donor species (like bacteria
or other organisms as mentioned in the above examples), cloning it inside bacterial
vector, and then transferring it to the genomic DNA of the new host like maize, tomato,
potato or to any other organism. The transferred gene is within new DNA construct
which is associated with what is called a promoter and marker gene, Figure (1.1).
Marker gene is necessary in order to give a signal for the successful insertion of the new
gene into the plant or target organism. The promoter sequence is required to express its
desire trait in the new host. Consequently, the strategy for development of GM plants
6
includes adding useful characteristics such as herbicide tolerance and insect and virus
resistance (Hu, 2007).
Figure (1.1): The composition of the new GM DNA construct.
There are several techniques that are used to insert the new construct into the host's
DNA in the host‟s genomic DNA. These techniques use vectors (plasmid, virus or
transposon) for the DNA insertion into host‟s genome (Miragliaa, 2004).
As a result of insertion of the foreign DNA by the genetic engineering technology,
DNA sequences from bacteria, viruses, animal and plants DNA can be transfered into
host‟s genome. It is seen as acceptable and natural for genetic information to be
transferred vertically among the same species from generation to generation. However,
it is not usual or normal to transfer DNA horizontally between different species or
kingdoms (Wickson, 2004).
1.2 The historical background and global cultivation of GM crops
The beginning of agricultural activity took place in the Mediterranean region long time
ago at about 11,000 BC; grains were the first crops to be planted. Mesopotamian
developed a method of breeding of various cereal crops. Currently, about nine grain
crops (rice, wheat, maize, sorghum, millet rye, barley, common bean, soybean and
groundnut) provide about 80% of the plant nutrients used by humans (CABI Publishing,
2009).
Genetic engineering had first appeared in the early 1970s, as with the advancement of
science. Scientists knew that with the intelligent methods they had developed they may
Marker Gene Promoter Transgene Terminator
7
be able to move sequences of the DNA and transfer it from one species to another
(Weasel, 2009). In 1983, the first plant transformation appeared
Which was the insertion of bacterial gene in tobacco, nonfood plant. The first field
experiment was undertaken in 1986. This was followed by economic production in the
year 1992 in china. In 1994, the first modified food tomato “FlavrSavr“entered the
market in the USA (Hu, 2007).
In 1996, the first commercial genetically-modified maize”Bt Corn” (corn modified with
a bacterium gene to give it insect resistance) was planted in the United States. In the
same year, Roundup Ready Soybeans (soybeans resistant to Roundup herbicide) started
to be grown as well (Halford, 2003).
In 1997 GM maize has started to spread from USA to Canada. Now it is being grown in
13 countries occupying more than 35 million hectares i.e. 24% of area worldwide
(Hellmich et al., 2008). However among all the GMO varieties, soybeans remain the
most common GMO plant (Hu, 2007).
Following these successes of GM Crops, the DNA technology was adopted so quickly
to develop new genetically modified (GM) plants that by 1999 more than 40 genetic
modifications related to 13 different crops had been approved and produced in 12
countries, as well as distributed among other countries through international trade
(Kaphengst et al., 2011).
On the other hand, public opposition against GM food in Europe led to the introduction
of strict regulations, consequently only few countries were able to grow GM crops. The
following crops: soybean, cotton, maize and rapeseed occupied more than 143 million
hectare in 23 countries in 2007.
It is worth noting that there are around 29 countries planting GM crops; out of these, 19
are developing countries and 10 are industrialized countries, Figure (1.2-A). For the last
8
Figure (1.2-A): Major Cultivation of (GM) crops.
Other biotech countries: 0.3 mha (Australia, Bulgaria, Colombia, Germany, Honduras,
India, Indonesia, Mexico, Philippines, Romania, Spain and Uruguay)
(Source: http://news.bbc.co.uk/2/hi/science/nature/3711507.stm)
15 years, farmers have been planting biotech crops on an area as large as the United
States. 48% of global GM crops are planted by developing countries which will very
soon overtake the industrial countries in total hectares. In 2010, the number of farmers
who have adopted this technology reached 1.5 million which summed up to 15.4 million
farmers worldwide Figure (1.2-B); 90 % of these farmers (poor - small resource) are
from developing countries (James, 2010).
9
Figure (1.2-B): Estimated number of farmers cultivating GM crops worldwide
In the year 2010, BT maize and AM-flora high quality potato was grown by eight
European countries, AM-flora is considered as the first EU approval for planting GM
crops in thirteen years (James, 2010).
A new feature „stacked traits „has lately appeared in GM crops, US has the largest
hectares of the stacked traits. For example a new type of biotech maize called smart
stacks was released in USA and Canada in 2010, these stacks contains eight genes
conferring resistance to two pests plus herbicide tolerance (James, 2010). Many people
believed that biotech crops contribute to food and feed fiber security, helps to save the
land and also alleviate poverty and hunger; moreover, it reduces agricultural
environmental footprint. On the other hand, many others are totally against the
plantation of such crops because they believe that it might have a harmful, unknown and
long term impact on human health and on the environment.
10
1.3 Public perceptions and consumers acceptance of GM food & crops
in different parts of the world
The major argument related to gene technology had first appeared in Europe in the
1980s during the industrial application of gene technology just before the
commercialization stage of genetically engineered products. Later on, many studies had
found that the major driver for the acceptability or rejection of certain emerging
technologies such as GM foods is the public risk perceptions and fears, although these
have not yet been integrated within the regulatory system (Frewera, 2004).
In the United States, some studies found that Americans were somehow addicted to the
consumption of corn and soy although they did not know that they were eating GM
products added to processed food in so many products. Thus, it is not that Americans
are not concerned about GM food but it is the fact that they are not well informed about
it (Weasel, 2009). Some studies revealed that 58% of Americans were ignorant towards
the difference between the GM and normal foods.
A study conducted in Europe concluded that consumers are concerned about most of the
unknown risk that comes with the consumption of GM products (Gaskell et al., 2004).
On the other hand, in Colombia for example it was found that around 66% of
populations were willing to purchase GM foods due to lack of high quality food
(Pachico, 2002). One research found that 90% of Nigerians had good knowledge of GM
products but worried about the ethical issues associated with genetic engineering
technology (Kushwala et al., 2004). In Zambia, one of the major reasons behind
refusing GM food aid was the fear that they would contaminate the country‟s own non-
GM seed stock (Weasel, 2009).
In October 2002, the governments of Zimbabwe, Zambia, Mozambique and Malawi
refused a US food aid shipment as they had suspected the presence of GM maize. Many
11
of South Africans believes that such kind of aid is not about or it has a little to do with
the issue of famine at all; instead it aims to promote the adoption of genetically
engineered crops in South Africa, and thus expanding the market access of transnational
corporations and undermining local smallholder production and as a result causing
greater food insecurity on the Continent (Zerbe, 2004).
Onyango, 2004 (as cited in Jebreen, 2010), reported that the moment consumers are
fully aware of the GM food risk their readiness to purchase such products greatly
diminish.
On the other hand, people who support biotechnology claim that genetic modification of
crops is not a new technology since traditional plant breeding programs is used to
altering the genes of crop plants for thousands of years (Tester, 2001).
Supporters of biotechnology who come primarily from United States as well as from
other countries considered to be GM exporters, like Canada, Australia, and Argentina
accused their opponents of allowing millions of Africans to starve because of their
refusal and skepticism about the risks of consuming GM foods (Zerbe, 2004).
Some of the reasons behind the acceptance of GM food among consumers are poverty
and lack of sufficient knowledge of the products. In developing countries positive
opinions toward GM foods came as a result of urgent needs for food availability and its
nutritional content (Jebreen, 2010). Other attractive feature that may convince
consumers to purchase GM foods is its price, packaging, availability or the convenience
of its preparation (Frewera, 2004).
On the other hand, Mathew and Huffman 2001 (as cited in Jebreen, 2010) reported that
the opposition of GM foods may be due to ethical reasons, health concerns, possible
environmental impacts and trade worries; the opinions of people also varies from one
12
country to another. In most cases, proper information about the GM products has a
valuable role in people attitudes (Jebreen, 2010).
Nowadays the majority of food sold in our regional grocery stores contains GM food
ingredients without the consent or knowledge of people. As many people say, we are
now in the middle of the biggest feeding experiment in history (Smith, 2003).
1.4 Health risks, environmental impacts and biosafety of GM food
and feed
It was found that there are some advantages & disadvantages that might impact the
environment as a result of using GM crops that are insect-resistant for example. This
applies to genetically engineered BT crop which has a soil bacterium (Bacillus
thuringiensis) gene that is capable of protecting itself from a certain insect without the
use of any insecticide, but this not only harms the target insect it also harms other types
of useful insects such as monarch larvae. Knowing that some insects are vital and
crucial components in other animal and insect food chain, this can cause a decline in the
number of some animal population. Thus, we conclude that we should search for other
options that reduce the use of pesticides and preserve the environment at the same time
(Amin, 2009).
Another finding related to the example mentioned earlier about the gene transferred
from the flounder fish into a tomato or strawberry in order to gain the antifreeze
properties. This would benefit farmers and merchants; however in order to do this an
artificially constructed vectors is used to multiply copies of genes, and in some cases, to
carry and smuggle genes into cells. This kind of insertion may have a harmful effect
(Al-Hayani, 2007).
In the United States, GM potatoes that had a gene from a soil bacterium similar to
Bacillus anthrax are all officially classified as pesticides by the US Environmental
13
Protection Agency (EPA). However, the US Food and Drug Administration (FDA) have
declared that they consider GM crops to be safe and that they offer similar nutritional
value as their natural counterparts. This declaration is considered as a basis in US policy
which permitted millions of acres of GM food to be planted, sold and eaten without
prior safety testing (Smith, 2003).
Pusztai, as reported in (Smith, 2003) found shocking results during his research on GM
potatoes; he noticed that rats which were fed on GM Potatoes suffered from a damaged
immune system, due to a slow response of white blood cells compared to those in rats
fed on non-GM potato. Organs like spleen and thymus were somehow damaged; the rats
fed on GM potato had smaller, less developed brains, livers and testicles. Other rats had
enlarged tissues, including the pancreas and intestines. In addition, structural changes
and proliferation of cells in the stomach and intestines, this may indicate an increased
probability of getting cancer. Adding to this, the nutritional content of some GM
potatoes which were different from their non- GM parent lines.
A recent research investigated health risks by using hamsters to study the effects of GM
food, the scientists found that in the second generation of hamsters the growth rate was
lower and sexual maturity was delayed compared to natural conditions. This in addition
to that the mortality rate for hamsters that ate GM Soy was five times higher than the
hamsters who did not eat soy. What is also shocking is that all the third generation of
GM soy eating hamsters were sterile (unproductive) and also experienced hair growing
inside their mouths (Surov, 2010).
Recent results demonstrated the harmful effects of GM maize on mice when fed for two
years in comparison with mice fed on non-GM maize. For example Females developed
large mammary tumors and all treated groups died 2–3 times more than controls, and
more rapidly, Biochemistry data confirmed very significant kidney chronic deficiencies
14
.(Seralini et al., 2012).
Monsanto (which is one of the world‟s largest multinational agricultural biotechnology
corporations and is also a leading producer of genetically engineered seeds) intellectual
property protection rules do not allow farmers to keep, store or replant the seed from
their harvest which is considered an old conventional practice in agriculture. This forces
farmers to keep returning to the source each year paying each time to get the seeds for
planting. Many farmers were also attacked by such corporations when GM plants were
found on their fields without purchasing agreements (Weasel, 2009).
If we recall the process of genetic engineering and the means by which the new DNA
construct is transferred either physical (e.g. gene gun or electroporation) or biological
(e.g. agrobacterium), it was found that the exact location where the new construct gene
is inserted in to the genome is not controlled. This randomness has raised many
questions and worries on how might this impact the organism‟s overall genetic
structure, function and response. One possible effect might be the pleiotropic effect
which may result in new interactions with the host organism genetic code producing
unintended effects and not just the desired trait, another effect is the effect where the
new inserted gene is silenced (Wickson, 2004).
The silencing of a gene may occur if the new construct gene ends up right in the middle
of the original gene, this happened in an experiment and the mouse embryos ended up
dying, this means that silencing of native genes may have many unpredictable
outcomes. During the testimony of Michael Hansen of the consumer union in front of
the Environmental Protection Agency (EPA) of USA, he warned that if genetic
engineering turned off a native gene which is responsible for preventing the expression
of a certain toxin, this may cause the level of that toxin to increase (Smith, 2003)37.
15
It is also worthy to mention that nowadays GM testing of crops covers important
agronomic and nutritional traits; however, it may not detect other changes that may
occur in the plant‟s secondary metabolism, and this means that we still lack experience
and data on what ecological interactions may arise coming to a conclusion that the
impact of GM crops on the environment is considered an area with a high degree of
scientific uncertainty and even ignorance (Wolfenbarger, 2000).
Other scientists say that genetic engineering is a hit and miss issue. Genes might be
transferred in the wrong way or several copies may spread through the plant genome;
they may be inserted inside other genes damaging their function or activity; as a result
the whole genetic makeup may become unstable with unknown results, and as
mentioned earlier genes might switch on or off unexpectedly with unpredictable
impacts. Instability of DNA is considered a familiar feature in genetic engineering; in
about thirty surveyed companies which are developing GM crops, all had observed this
event (Smith, 2003).
There are other serious concerns from many scientists that when humans and animals
consume GM food, an Antibiotic Resistant Marker (ARM) (which is used to find out
what cells of the thousands that exist on the plate have the foreign gene in their DNA)
might transfer into the bacteria that is found in the digestive system; if this occurs, it
might cause a new and dangerous antibiotic resistant diseases. This is one of the major
reasons why the British Medical Association called for a moratorium on GM foods
(Smith, 2003). 37
It is also believed that those who will benefit the most from the spread of GM products
are the multinational biotechnology companies which are currently being backed up and
supported by mass media that is trying hard to convince the world that GM products is
16
the miracle that will solve the world famine, lower the dependence on pesticides and
cure diseases of humankind (Kuiper, 2010).
1.5 Ethical and religious views of biotechnology and GM food
The reason behind ethical opposition of GM food revolves around the harm it may
cause to humans, living things, the environment or biodiversity; it may also extends to
unjustified pain to animals used in research and production.
Some Researchers say that it is difficult to know if harms outweigh potential benefits
for GM food unless research, field tests and data analysis is conducted to come out with
a scientifically informed assessment.
One of the arguments that drive GM supporters to encourage biotechnology is that it has
humanitarian goals such as ending hunger; on the other hand, GM opponents perceive
biotechnology as unnatural (National Agricultural Biotechnology Council Report,
2001).
In times before the year 1999, people did not relate crop biotechnology with impacts on
the environment or on endangered species; however in that specific year, there were
some reports that BT crops may harm monarch butterflies; this news has awakened
people on the possible adverse effects of GM crops on wild species for the first time
(Smith, 2003).
Opponents of GM food view it as a threat to the environment and to other non-
transgenic crops as the GM plants may contaminate organic or non-transgeneic crops,
by pollen drift or by mixing up with the original seed supply.
17
Some people think that transferring genes horizontally or between species is something
that we should not do. They believe that if this happens then its the end of nature, they
say that we shouldn‟t play in this matter; it is not only about ethics, it is about moral
principles of protecting the environment.
In the United States for example, one of the ethical principles used to win over
American consumers in favor of GM food is to convince them that it is the only solution
for solving the world hunger problem and feed the world (Coward, 2009).
People who criticized biotechnology noted that transgenic crops is being used in the
production of drugs as well as industrial products; they believe that these products must
be controlled or even restricted to limit the environmental exposure to human health
hazards (Coward, 2009).
In Islam for example, ethics were mentioned in Quran (the holy book of muslims) and
through Prophet Mohammad (peace be upon him) teachings in the Hadith or Sunnah. In
Islam, ethic is classified into three parts: ethical issues related to Allah, ethics among
human beings, and ethics related to living things. There is a proverb that we muslims
believe in and that is “Religion is all about how you treat others”. It is expected to
practice these ethics and any muslim who does not follow them or harm others will be
punished, or has to compensate those who were harmed (Al-Hayani, 2007).
Some muslims believe that genetic engineering is about manipulating creatures and
interfering with Allah creation; in Quran, Allah has stated that he is the only one who
can create everything and has the power to control everything in the universe, (Al Imran
3:190). There is another verse which says that humans cannot create something as
perfect as Allah great creations, as God is the maker and has all the knowledge and
secrets of things that no human will ever have the ability or the capability to produce
18
anything that is healthy, complete and perfect. This verse is: “O men! Here is a parable
set forth! Listen to it! Those on whom, besides Allah, ye call, cannot create (even) a fly,
if they all met together for the purpose! and if the fly should snatch away anything from
them, they would have no power to release it from the fly. Feeble are those who petition
and those whom they petition!” (Al-Qur‟an, Al Hajj 22:73). However, it is worth
mentioning that there is no creation in GM technology, it is kind of manipulation.
Another aspect of biotechnology for muslims is the source of the gene if it was taken
from forbidden animal food such as swine, this can only be found out through lab
testing (Amin, 2009).
Christianity people‟s attitudes vary from those who support such advancement to those
who are totally against it, and there are others who stand in between. The Old Testament
(Romans 14:17) mentioned that “The kingdom of God is not about eating and drinking
but righteousness, Peace and Joy in the Holy Spirit”. (Coward, 2009). This means that
in developing GM food, biotech companies must ensure the safety and security of its
products through comprehensive research prior to releasing it in the market.
1.6 Laws & regulations controlling the prevalence of GM food and
feed
Back in 1995, Switzerland was one of the first countries in the world to institute a
labeling law of GM products. During 1996 the first shipments of GM maize and soy
bean reached the European shores coming from the US, this has triggered several
environmental and consumer groups to protest against the technology the thing that
attracted a widespread of media attention (Weasel, 2009).
In 1998, the European Union had bunged the approval of new GM crops for import or
cultivation on European soils. In the year after, five EU countries announced the
19
prohibition of GM crops awaiting for the policy makers to set regulations that would
require traceability and labeling of all GM products. Switzerland on the other hand was
free from EU constraints as it had its own GM labeling policy which was already in
effect.
On the 29th
of January 2000, more than 130 countries (Jordan was among these
countries) adopted the Cartagena Protocol on Biosafety; this protocol is considered as
an international agreement which aims to ensure the safe handling, transport and use of
living modified organisms (LMOs/GMOs) resulting from modern biotechnology that
may have adverse effects on biological diversity, taking also into account risks to
human health. This agreement entered into force on 11th
of September 2003 (Weasel,
2009).
One great advancement towards regulating GMOs in Europe was the establishment of
the European Food Safety Authority (EFSA) in January 2002 and it is based in Parma,
Italy. This authority consists of 21 scientific experts from several European research
bodies, universities and risk assessment institutions. Some of the EFSA responsibilities
includes coming out with guiding documents for risk assessment of GMOs, using
animal feeding trials for testing of whole GM/ food/feed, post-market environmental
monitoring in addition to many other duties (Kuipera, 2010).
Furthermore, a new legal framework was designed by the European Commission to deal
with bio safety problems. This framework covers the whole food/feed chain, it also
incorporate procedures for the authorization of GMOs; this framework includes several
actors as the European Commission, EFSA, competent authorities of member states and
regulatory and standing committees of EU member states‟ representatives, and the
councils of ministers. The process follows what is called the comitology rule and this
refers to the committee system which oversees the delegated acts implemented by the
20
European Commission. However, this system is known to be complex, demand
extensive timeframes, and decision-making lacks transparency and decisiveness in
making final decisions. Today the European Union requires labeling on all GM foods
containing transgenic material (Kuipera, 2010).
The EU present legislation in relation to genetically modified organisms (GMOs)
control topics as environmental aspects and food and feed safety, measures for
commercialization and labeling terms (Miragliaa, 2004). Table (1.6) shows key events
in EU biotech regulations.
Table (3.51.6 ): EU Biotech Regulations.
Year Key Events in EU Biotech regulations
January, 2000 White Paper (clarifies the issue and background) on food safety
January, 2000 Communication on the precautionary principle
January, 2000 Cartagena Protocol on Biosafety adopted
March, 2001 Council and EP adopt directive 2001/18, replacing 90/ 220 on
deliberate release of GMOs
January, 2002 Establishment of European food safety Authority
May,2003 US launches WTO complain over EU regulation of GMO
September, 2003 Council and EP adopt regulation 1830/2003 on GM food and feed
September, 2003 Council and EP adopt regulation 1829/2003 on GM food and feed
April, 2004 Entry into force of regulations 1829/2003 and 1830/2003
May, 2004 Commission ends moratorium with approval of Bt-11 Maize
May, 2005 Commission orientation debate, decision to press ahead with new
approvals- challenge member state bans.
June, 2005 Environment council rejects commission efforts to overturn
national safeguard bans
September, 2006 WTO ruling in EC biotech dispute
July, 2007 Member state fails to agree on approval of GM potato for
cultivation
November, 2007 EU environment commissioner Dimas proposes to deny approval
of two GM maize varieties for cultivation
January, 2008 France announces new national ban on MON810
May, 2008 Removal of Austrian safeguard ban on sale of two varieties
commission delays approval of seven new varieties pending new
studies
21
Year Key Events in EU Biotech regulations
July, 2008 French EU presidency announces creation of group to consider
strengthening EU regulations on GMOs
Source: (Pollack and shaffer, 2009)
In Australia for example, ethical committees and community consultation does exist
within Australia‟s regulatory framework. However, these entities have no influence over
the decision making process as the other scientific experts committees and this is caused
by the type of approach selected which denies the concept of a social risk (which is
defined as the risks of negative impacts on social structure or the violation of basic
moral beliefs) (Wickson, 2004).
Regarding to labeling policies, in the United States GM food labeling is considered
voluntary; however, in Japan and Europe it is mandatory. It was found that labeling of
GM food may cause the increase in the consumers‟ rejection of GM food (Abdel-
Mawgood, 2006 as cited in (Jebreen, 2010)). It is believed by many scientists that it is
necessary to specify the GM content on the product in order to give consumers the
freedom of whether to buy the product or not (Jebreen, 2010).
One of the greatest responsibilities of governments toward their people is to design a
holistic regulatory framework for GM crops considering scientific, social, ethical and
religious aspects; this will for sure guarantee a safer and healthier environment for the
people. It will also control the spread of such products, and thus minimize their possible
negative impacts on the biological and social environments (Wickson, 2004).
22
Chapter 2 Research Methodology
This Chapter includes an overview and description of the approach that was followed in
performing this research study. A clear picture on the means of data gathering
techniques is given such as lab experiments, surveying, interviewing, etc. Moreover, a
section is dedicated to present data analysis methods that were used to obtain the most
important findings and conclusions.
The initial investigation began by carrying out a lot of background reading and literature
review of subjects related to GM products prevalence in different parts of the world and
the conflicts that came out as a result. This was an on-going process, and this initial
reading influenced the selection of the study focus; and contributed to the formation of
research objectives.
This research utilized quantitative and qualitative methods for data gathering. For
example the literature review, the analysis of relevant documents, as well as the semi-
structured interviews are all considered qualitative methods. Whereas, structured
interview, collection of public perception through surveys, and maize samples analysis
in the laboratory are all form of quantitative methods.
There are several reasons behind the detection of GMOs, one of these is to measure to
what extent GMOs are spread among food and feed in a certain market like the
Jordanian market. It could also be used to reveal unauthorized products (Holst-Jensen,
2009). Detection of GMOs is necessary as well to acquire certification of purity and
identity crop material, which is an approach, used to distinguish between GM and non-
modified crop products (Elsanhoty, 2010).
23
Simple methods are usually used to test for a single trait or GMO event, alternatively
multiple or combination of methods are required to detect the presence of multiple
events. The entry of unauthorized GMOs is considered one of the biggest challenges
these days especially for those countries that lack any laws, regulations or a well
structured framework to control the entry of GM food (Holst-Jensen, 2009).
2.1 Prevalence of genetically modified maize in Jordan
2.1.1 Collection of maize samples from Jordanian market
Quantities of maize grown in Jordan as well as the quantities imported from abroad and
the prices associated with them were obtained from Department of Statistics Annex (2).
The collected data were summarized and presented in a bar chart in order to enable the
audience to observe the trend in the quantity grown locally and that which is imported
from abroad through time. Usually in a bar chart the categories (which represent the
years 1994-2010) are shown along the horizontal axis and the frequencies (which are
the costs) are indicated on the vertical axis. Additionally all the interviews that were
undertaken were interpreted and all the relevant information was extracted and recorded
in this research.
A total of forty commercial maize products were obtained during the period of study.
These were obtained from different outdoor markets, supermarkets, bakeries and
Animal Wealth department of Amman, Jordan. Standard maize samples, genetically
non-modified (ERM-BF413a) and GM MON 810 maize (BF413f) were obtained from
Dr. Eric Kubler. These samples were originally purchased from European Commission,
DG JRC and IRMM, Belgium. MON810/JBU1 was obtained from the Biosafety Unit-
RSS.
24
General equipments used:
Following equipment were used in this study: 1.5 ml microcentrifuge tubes
(NucleoSpin®Plant II), Disposable tips, Manual pipettes, Microcentrifuge (RIBO-
SPAIN eppendorf), Analytical Balance (KERN AL J 220-4), Vortex Mixer, (KMC-
1300 V, Vision Scientific), Heating block (dry bath incubator),Grinder, Themocycler
(PCR, VERITI with 96 wells), Electrophoresis system (MIDI plus-1 horizintal gel
system model:ME10-7), Power supply (MS major science, MP- 300 V),
Transilluminator and documentation system (compact UV tables type SNGLE, ECX-
20-M), Eppendorf Biophotometer, Infrared oven, Fridge (4oC), Freezer (-20
oC),
Googles and a Micropippete).
2.1.2 Samples pretreatment
Grinding of corn samples
Corn samples were finely grounded using a small electrical grinder with three blades;
this step is considered necessary as the plant tissue is very robust and the lysis
procedure later on will be most effective with a well homogenized sample. The grinder
was carefully cleaned using soup and water, and then washed by ethanol (three times);
afterwards, by hypochlorite (three times), and finally the grinder was washed with
double distilled water. Cleaning of grinder was carried out to ensure sterility and avoid
cross contamination among different samples.
All samples were kept inside sterile small plastic bottles and labeled with all
information including number of sample, country of origin and date of collection.
25
2.1.3 Lab procedure for extraction of genomic DNA from plant
DNA was extracted from ground corn samples by using the kit method. The extracted
DNA was kept at -20 °C until it was used for further molecular tests. The procedure for
extraction of DNA from maize samples was as indicated by supplier in Annex (3-A).
(NucleoSpin® Plant II kit from MACHEREY-NAGEL (MN) Switzerland).
The kit contains the following solutions: Lysis Buffer PL1, Lysis Buffer PL2,
Precipitation Buffer PL3, Binding Buffer PC, Wash Buffer PW1, Wash Buffer PW2,
Elution buffer PE, RNase. Some of these solutions (PW2, RNase) need to be prepared
as follows before conducting molecular analysis experiment: first 100 ml of ethanol (96-
100%) was added to Wash Buffer PW2, then 600 µl of H2O was also added to RNase A,
which was then divided into small aliquots and stored at -20 C°. After that Elution
Buffer PE was Preheated to 70 °C.
DNA extraction was carried out as followes: Around 100 mg dry weight of
homogenized corn sample was transferred to an eppendorf tube (1.5 ml) where 400 µl
of cell lysis Buffer PL1 was added; this buffer contains chaotropic salts, denaturing
agents, and detergents. The mixture is then vortexed and 10 µl of RNase A is added and
mixed, after that the suspension is incubated for 10 minutes at 65C° in a heating block
(Figure 2.1.3). The following step was for the filtration and clarification of crude lysate
where a new collection tube (2 ml) was prepared and a violet ring “NucleoSpin Filter”
was placed into that tube. The lysate was then loaded onto the column and centrifuged
for 2 minutes at 11,000 x g, the clear flow-through was then collected and the
NucleoSpin filter was discarded.
26
(a) (b)
(c) (d)
(e)
Figure (2.1.3): Experimental procedure for extraction of genomic DNA from
plant. (a) Balance (b) Eppendorf tube (c) Heating block (d) Spinfuge (e)
Microcentrifuge
27
In order to adjust DNA binding conditions, 450 µl of the buffer PC is added to the
clear flow from the previous step and mixed thoroughly by pipeting up and down
five times or by vortexing. Around 700 µl of the sample was then loaded to a
NucleoSpin Plant II Column “green ring” that was placed into a new collection
tube (2ml). Then it is centrifuged for 1 minute at 11,000 x g, where the flow-
through was discarded. The next step aims to wash and dry Silica Membrane; in
the first wash 400 µl Buffer PW1 was added to the NucleoSpin Plant II Column
and then it was centrifuged for 1 minute at 11,000 x g and the flow through was
also discarded, the second wash was the same as the first one but with the addition
of 700 µl of Buffer PW2, the third wash was performed similarly but with the
addition of 200 µl Buffer PW2 and then centrifuged for 2 minutes at 11,000 x g in
order to remove wash buffer and dry the silica membrane completely.
The preceding step aims to elute DNA, where the NucleoSpin Plant II Column
from the previous step was placed into a new 1.5 ml microcentrifuge tube. 50 µl
from the PE Buffer (70°C) was loaded on to the membrane and then the
NucleoSpin Plant II Column was incubated for 5 minutes at 70°C. Finally the
sample is centrifuged for 1 minute at 11,000 x g to elute the DNA. This step was
repeated with another 50 µl Buffer PE and eluted into the same tube.
Finally the extracted DNA was kept at -20 C° until it was used for subsequent steps.
28
2.1.4 Determination of DNA purity and concentration:
The concentration of the extracted DNA was measured at 260 nm against a blank using
a spectrophotometer/ an Eppendorf Biophotometer. (Figure (2.1.4)). The ratio
A260/A280 was used to estimate the purity of extracted DNA in “ηg/µL”. A number of
measurements were conducted to determine DNA purity for some samples results
varied between 10.7- 48.6 ηg/µL.
(a) (b)
2.1.5 DNA amplification by qualitative Polymerase Chain Reaction (PCR)
After the extraction of DNA from maize samples, and in order to detect the presence of
GM in the 40 maize samples collected from the Jordanian market, Polymerse Chain
Reaction PCR analysis were carried out by using specific primers.
Table (2.1.5-A) shows the sequences of primers used in the study. Primer pair p35S-cf3
forward and p35S-cr4 reverse were used to amplify the 35S promoter CaAM35S; whereas
the genetic event MON 810 maize was identified by using the specific primer pairs
Figure (2.1.4): Determination of DNA concentration using: (a)
spectrophotometer and (b) an Eppendorf Biophotometer
29
mg1/mg2 and mg3/mg4. Other primers which were used to identify the genetic events are
also shown in the table, for the details see the result section.
Table (2.1.5-A): Sequences of primers used in PCR amplification experiments and sizes in base pairs
(bp) of PCR amplified DNA fragments.
Primers Sequence ( 5´ - 3´)
Length of
amplified
sequence
CaMV 35S promoter
p35S-cf3, F:
p35S-cr4, R:
CCACGTCTTCAAAGCAAGTGG
TCCTCTCCAAATGAAATGAACTTCC 123
MON 810 specific (nested PCR)
mg1
mg2
TATCTCCACTGACGTAAGGGATGAC
TGCCCTATAACACCAACATGTGCTT 401
MON 810 specific (nested PCR)
mg3
mg4
ACTATCCTTCGCAAGACCCTTCCTC
GCATTCAGAGAAACGTGGCAGTAAC 149
MON 810 new
(F )
(R)
TCG AAG GAC GAA GGA CTC TAA CGT
GCC ACC TTC CTT TTC CAC TAT CTT
-
MON 863 Primer
(F )
(R)
GTAGGATCGGAAAGCTTGGTAC
TGTTACGGCCTAAATGCTGAACT 84
NK 603 Primer
(F )
(R)
ATG AAT GAC CTC GAG TAAGCTTGT TAA
AAG AGA TAA CAG GAT CCACTCAAACACT 108
MON 88017 Primer
(F )
(R)
GAG CAG GACCTG CAG AAGCT
TCC GGA GTTGACCATCCA 95
Primer GA21
(F )
(R)
CGT TAT GCT AAT TGC AAC TTTAGAACA
GCG ATC CTC CTCGCG TT 101
390new REV 1
REV 2
AGC TGG GCA ATG GAA TCC GAG
TGG AAT CCG AGG TTT CCG
-
PCR reaction mixture
The PCR amplifications were performed and each PCR reaction mixture (50 μl final
volume) contained: 5 μl of 10x PCR Buffer, 5 μl of 25 mM MgCl2, 0.25 μl of Taq DNA
polymerase from the Top Taq TM PCR kit (Qiagen/Germany), 2.5 μl of 16 mM dNTPs
(Promega/Germany), 1.25 μl of a 20 μM solution of each primer, 32.75 μl nucleasefree
water and 2 μl of extracted DNA (10.7- 48.6 ngMl-1), (Querci et al., 2006).
30
Amplification of CaMV 35S region
The conditions for PCR amplifications experiments for CaMV 35S promoter primers
used for detection of GM maize food and feed products were: 3 minutes initial
denaturation at 95ºC followed by 50 cycles of 25 s denaturation at 95 ºC, 30 s annealing
at 62ºC, 45 s extension at 72ºC and a final 7 minutes extension at 72 ºC.
Nested PCR
The amplification conditions of nested PCR experiments were carried out according to
the standard protocols (Querci et al., 2006). Parameters for PCR amplifications
experiments for specific primers mg1/mg2 and mg3/mg4 used for detection of specific
genetic event of MON810 GM maize (Figure 2.1.5) were: 3 minutes initial denaturation
at 95ºC followed by (35 cycles for mg1/mg2 and 40 cycles for mg3/mg4) of 45 s
denaturation at 95ºC, 50 s annealing at 60ºC, 50 s extension at 72ºC and a final 3
minutes extension at 72ºC.
2.1.6 Gel Electrophoresis
Agarose gel (1.0 %) containing ethiduim bromide with final concentration of 0.5 µg/ml
were prepared in 1X TAE buffer. Samples of DNA were mixed with 1/5 volume of
loading buffer and added to the well on the gel. Generally, the gel buffer was added up
to the level of horizontal gel surface and gels were run for 1 hour at 3-5 v/cm. DNA
bands were visualized by UV illumination at 366 nm wavelength on UV illuminator
(Sambrook and Russell, 2001).
31
Figure (2.1.5): Graphic illustration of a section of the GM maize cassette with the CaMV 35S-promoter and
the maize hsp70 intron, and relative position of primers mg1,mg2,mg3 and mg4. (Querci, 2006)
Sequencing of the 390 bp DNA fragment
The large DNA fragment of 390 bp was extracted and purified from agarose gel by
using the PCR clean-up gel extraction according to the protocol described by the
manufacture (NucleoSpin ® Extract ll Kit purchased from MACHEREY-NAGEL,
Germany). The 390 bp fragment was removed from the agarose gel, weighed and
transferred to a clean sterilized tube. Two hundred ml of NT buffer was added, the
sample was then incubated at 50 °C for 10 minutes and vortexed for 2 to 3 minutes until
the gel slice was completely dissolved. The obtained solution was placed in Nucleospin
extract II column and the extraction of the fragment was continued according to the
recommended procedure. The extracted DNA was kept at -70 C° until further use.
Frozen samples of extracted DNA were then sent to Synergene Biotech GmbH
(Schlieren /Switzerland) for DNA sequencing.
32
Analysis of the DNA sequences
The complement strand for the reverse primer p35S-cr4 was obtained by using the tool
in (http://www.cellbiol.com/scripts/complement/reverse_complement_sequence.html).
The Basic Local Alignment Search Tool (BLAST) of the NCBI website
(http://blast.ncbi.nlm.nih.gov/Blast.cgi) was searched for the source of 390 bp sequence.
2.2 Examining Jordanians awareness on different issues of GM Food
and Feed
One of the other foremost important goals of this study was to examine Jordanians
awareness regarding the different issues of GM food and feed, and measure their
knowledge and understanding of this subject.
2.2.1 Survey methodology
During the preparation of the survey, a literature review was undertaken to study the
approach followed in previous surveys on similar subjects. The design of the
questionnaire was based on the indicators reported in the reviewed papers (Chern et al.,
(2002); Jebreen (2010); Frewera (2004); Han (2006); Demirci (2008)), discussion with
the supervisors and Dr Hind Al Hammouri, specialist in measurement and evaluation
from the Hashemite University. The survey included 34 indicators/questions which
were designed to determine the extent of people knowledge and acceptance of GM food.
Thirty of them were closed ended and four indicators were open ended. It was decided
to compile each group of indicators/questions with a similar topic under a specific
theme (category). Consequently, the questions in the survey were compiled under five
different themes/categories based on the questions content and subjects; these themes
are: Socio-demographic characteristics of participants (theme with 6 indicators),
33
biotechnology background of surveyed individuals (five indicators/questions), public
background of GM food (nine indicators/questions), laws and ethical issues related to
GM food and feed (seven questions), and economical and environmental awareness of
participants in GM food and feed (seven indicators). The five categories and 34
indicators are shown in Annex (6-A) (questionnaire is presented in Arabic and English).
Ms Gaida Al- Khasawneh from the Department of Statistics was consulted regarding
choosing a representative sample for the survey to obtain most accurate opinions and
perceptions of Jordanians towards GM food. It was agreed to disseminate 400 survey
forms to several university students and/or employees and governmental departments
employees, where all should be above 18 years old and from different educational levels
(High School Certificate and above); Annex (7-C). Based on the recommendation from
the Department of Statistics, the 400 survey forms were disseminated to Ministry of
Environment, 5 universities and 2 research centers; Table (2.2.1). These were in “Irbid”
(North), Amman (Middle), and “Al Tafila” (South).
Table (2.2.1): Numbers of surveys carried out in different organizations around Jordan.
Name of Organization Surveyed Number of completed surveys
1. El Hassan Science City /Royal Scientific
Society (RSS) 61
2. Jordan Atomic Energy Commission (JAEC) 35
3. Ministry of Environment (MoEnv) 21
4. Jordan Food and Drug Administration (JFDA) 15
5. University of Jordan 52
6. Princess Sumaya University for Technology
(PSUT) 38
7. German Jordan University 7
8. Jordan University of Science & Technology
(JUST) (in the north of Jordan). 100
34
9. Al Tafila University ( in the south of Jordan) 71
Total 400
2.2.2 Data entry and processing
Following the completion of the survey, the 400 questionnaires were numbered from 1
to 400. The indicators of the survey were analyzed using the SPSS (Statistical package
for social science) version 19 software and employing descriptive statistics i.e
frequencies procedure which provides statistics and graphical displays that are useful
for describing many types of variables. In order to regulate the data entry process and
set the variables, each indicator in the survey beginning with demographics was given a
number and then is recorded in what is called the variable view sheet in the SPSS
software. Each numbered indicator/question is then labeled i.e., the whole question is
recorded and all the multiple choice answers related to this question are assigned values
from 0 to 4 depending on how many answers there are per indicator, then the indicators
are labeled; for example for the question of Gender the two choices are: 0: Male and 1:
Female etc. After inserting all the survey questions and answers in the variable view
sheet, the responses of 400 participants will be inserted in the data view sheet.
Descriptive frequencies were used for analysis and to describe the basic features of the
data. In addition, graphs and figures were used to provide a visual summary of the
findings. The graphical displays included pie charts which are considered a good tool
for assessing the relative frequencies of each category, and a bar chart which helps to
visually compare the relative frequencies.
35
2.3 Assessing the current status of laws and regulations controlling
genetically modified food and feed in Jordan
An important part of the study is to investigate the current laws and regulations which
control the GM food and feed in Jordan. This was achieved by conducting structured
and semi structured interviews with several key persons from public, private sectors and
governmental sectors in Jordan; i.e., ministries, research centers, universities, NGOs etc.
During the structured interviews several issues related to the research subject were
discussed. Through an organized set of questions to get basic understanding on
qualitative matters such as: The current status of food and feed testing and types of tests
in Jordan, and whether there is a monitoring system of imported food and feed. Other
questions inquired about the existing laws, regulations or provisions regarding GM food
and feed and if these are activated or not. There were also semi-structured interviews;
these included general discussions on the GM products to get information of people‟s
knowledge and their acceptance and attitude towards this issue. Annex 5-A shows the
list of interviewee and visited organizations.
36
Chapter 3
Results
3.1 Local production of maize
According to the information collected from the Department of Statistics on the 17th
of
November 2011, the amounts of yellow maize produced locally in Jordan during the
period 1994-2010 are shown in Figure (3.1).
Figure (3.1): Total production of yellow maize in Jordan during the period 1994-
2010.
The local production of yellow maize crop is mainly used as food for humans and the
left over may be used as animal feed, and since the need of yellow maize as animal feed
is huge and could not be secured by local production, Jordan has been importing large
quantities of yellow maize from different countries around the world to be consumed as
animal feed to cover its deficiency in this product. Table (3.1-A) show quantities and
37
prices of the imported yellow maize from countries all over the world during the period
1994 to 2010.
Table: (3.1-A) Total quantities and price of yellow maize imported from different countries around the
world during the period 1994 -2010
Year of
Import Total quantity of maize imported
Ton /year
Price of maize
imported
(JOD)
1994 329,266.26 28,440,914
1995 383,944.32 35,464,305
1996 487,262.57 58,470,076
1997 89,758.12 8,541,377
1998 54,405.97 4,431,626
1999 26,054.666 1,894,823
2000 477,261.67 36,546,872
2001 485,422.60 37,312,998
2002 516,562.41 40,630,120
2003 564,408.19 51,870,996
2004 470,058.61 51,231,458
2005 475,386.72 47,131,765
2006 524,932.93 51,834,315
2007 494,991.12 77,779,186
2008 524,779.47 110,094,408
2009 650,117.33 124,560,324
2010 577,403.43 114,509,041
Total 7,132,016.39
880,744,604
Source: Department of Statistics (DOS), 2011
Table (3.1-A) shows that for 16 years and during the period 1994 and 2010, Jordan
imported 7,132,016 Ton of yellow maize, and had incurred the government of Jordan
around 880,744,604 Million JOD, and these are indeed considerably huge numbers.
38
These amounts are imported each year from different countries all over the world such
as (Canada, United Russia, Romania, Egypt, Israel, India, Ethiopia, Ukraine, Spain,
USA, Bulgaria, Brazil Uruguay, Lebanon, Argentina, Paraguay, Muldoof, Turkey,
South Africa, Egypt, Syria, Iraq etc…..), Annex (2).
Table (3.1-B); show that there is a wide gap between exports and imports of maize in
Jordan. It is quite clear that imports exceeds exports and this is reflected in the Self
Sufficiency Ratio (SSR) which demonstrates the ability of Jordan or any country to
grow its own food and become economically independent and not need any aid or
support to survive and cover the needs of its own people. To be more specific the self-
sufficiency ratio expresses the magnitude of production in relation to domestic
utilization i.e. it is calculated as follows SSR = Production / (Production + imports –
exports) X 100, source (FAO).
Table (3.1-B): Self-Sufficiency Ratio (SSR) of maize in Jordan between 2002-2010
Year SSR % Exports
(Ton)
Imports
(Ton)
Production (Ton)
2002 2.9 0.00 469,624 13,800
2003 2.0 0.00 513,098 10,700
2004 3.4 1062 427,326 14,800
2005 6.7 677 430,182 30,783
2006 3.0 6,263 477,212 14452
2007 3.8 2,366 449,992 17,781
2008 1.6 1,877 477,072 7,835
2009 3.9 31,950 525,211 19,754
2010 5.3 5,083 525,238 29,006
Source: Department of Statistics, Jordan (2011)
39
The figures shown in table (3.1-B) demonstrate the importance of working on
innovative ideas to increase the production of yellow maize in Jordan. Accordingly, all
concerned parties (governmental organizations, universities and NGOs) should work
Closely in research projects to come out with solutions to increase maize production.
Moreover, the production could be increased by intensifying local plantation of maize
for animal feed, or by searching for alternatives local resources of yellow maize used for
feed which serves the same purpose as maize. This issue should be prioritized when
setting strategic plans of ministries of Agriculture or Environment or any other relevant
entity since around 86 % of maize planted in the United States is GM and around 26%
of maize planted and traded worldwide is considered genetically modified (Nass, 2010).
If we compare both tables below we notice that the countries shaded in grey in table 3.1-
D) are all present in tables (3.1-C); this means that there is a high probability that Jordan
might have been importing GM food since 1994 or early nineties without being aware
of this because there has been no monitoring system or testing program for the food
merchants being imported from abroad.
40
Table 3.1-C): Biotec Mega Countries
Rank Country Area (Million
Hectares)
Biotech crops
1 USA 66.8 Maize, Soybean, Cotton, Canola,
Sugar beat, alfalfa, Papaya,
Squash
2 Brazil 25.4 Soybean, Maize, Cotton
3 Argentina 22.9 Soybean, Maize, Cotton
4 India 9.4 Cotton
5 Canada 8.8 Canola, Maize, Soybean, Sugar
beats
6 China 3.5 Cotton, Papaya, Poplar, tomato,
Sweet Pepper
7 Paraguay 2.6 Soybean
8 Pakistan 2.4 Cotton
9 South Africa 2.2 Maize, Soybean, Cotton
10 Uruguay 1.1 Soybean, Maize
11 Bolivia 0.9 Soybean
12 Australia 0.7 Cotton, Canola
13 Philippines 0.5 Maize
14 Myanmar 0.3 Cotton
15 Burkina Faso 0.3 Cotton
16 Spain 0.1 Maize
17 Mexico 0.1 Cotton, Soybean
18 Colombia < 0.1 Cotton
19 Chile < 0.1 Maize, Soybean, Canola
20 Honduras < 0.1 Maize
21 Portugal < 0.1 Maize
22 Czech Republic < 0.1 Maize, Potato
23 Poland < 0.1 Maize
24 Egypt < 0.1 Maize
25 Slovakia < 0.1 Maize
26 Costa Rica < 0.1 Cotton, Soy Bean
27 Romania < 0.1 Maize
28 Sweden < 0.1 Potato
29 Germany < 0.1 Potato
Total 148
Source: (James, 2010)
41
Table (3.1-D): Jordan imports of maize from different countries between 1994 -2010
1994 1995 1996 1997 1998 1999 2000 2001 2002
Lebanon South
Africa
United
States
Turkey Ukraine Bulgaria Argentina Argentina Argentina
Argentine Argentine Argentine United
States
Hungary Australia USA Brazil USA
United
States
United
States
Turkey Israel Romania Ukraine Canada USA Canada
Italy - - Italy Yugoslavia Turkey Bulgaria Turkey Romania
China - - Australia Bulgaria - Australia South
Africa
Hungaria
India - - - - - Turkey Egypt Canada
Turkey - - - - - South
Africa
- Turkey
- - - - - - UAE - South
Africa - - - - - - - - Lebanon - - - - - - - - Iraq
42
Source: Department of Statistic (www.dos.gov.jo), 2002
2003 2004 2005 2006 2007 2008 2009 2010
Argentina Argentina Argentina Argentina Lebanon Canada Canada Canada
USA Brazil
USA Brazil
Egypt Romania United
Russia
United
Russia
Brazil USA Ukrane USA Israel Lebanon Romania Romania
Turkey India India Italy USA Egypt Egypt Egypt
South Africa Egypt Turkey Ukrane Brazil Israel Israel Israel
Egypt Syria Egypt Turkey Turkey India India India
Syria Iraq Syria Egypt Syria Croatia Ethiopia Ethiopia
Iraq -
Lebanon Syria
Argentina United
Kingdom
Ukraine Ukraine
- - - Lebanon Sudan Ukraine Spain Spain - - - - - Spain USA USA - - - - - Yugoslavia Bulgaria Bulgaria - - - - - USA Brazil Brazil - - - - - Bulgaria Uruguay Uruguay - - - - - Brazil Argentina Argentina - - - - - Syria Paraguay Paraguay - - - - - Argentina Muldoof Muldoof - - - - - Sudan - -
- - - - - Hungary - -
43
3.2 Incidence of 123 bp and 390 bp DNA fragments in genetically
modified maize
Biosafety Unit at RSS started in 2008 monitoring GM maize and soybean. The primer
pair (p35S-cf3, forward and p35S-cr4, reverse) was used to amplify a 123 bp fragment of
the standard 35S promoter (CaM35S) for detection of GM maize samples collected from
local markets. Moreover, these studies showed the amplification of second DNA
fragment of 390 bp in some samples (Al-Hmoud et al., 2010; Al-Rousan et al., 2010).
In the current investigation, the tested maize samples which originate from different
countries around the world were subjected to molecular analysis with the above
mentioned primers. 19 of purchased maize samples were used for human consumption
and 21 of maize samples were used as animal feed. Samples were obtained between
January 2011 and March 2012. The origins of samples were: Argentina, Bulgaria,
Canada, Israel, Jordan, Romania, Syria, Ukraine and USA.
Out of 40 maize samples tested, 29 samples (72.5 %) were found to be carrier of
CaAM35S suggesting that they contained genetically modified maize. Furthermore, the
results showed that 9 maize samples out of the 29 (31%) revealed only a single DNA
fragment of 123 bp which was amplified by the 35S promoter specific primers. On the
other hand, the remaining 20 maize samples contain a second DNA fragment of 390 bp
which was also amplified by p35S (Table 3.2, Figure 3.2 A-B). The 390 bp DNA
fragment was not detected in wild type maize (ERM-BF413a) and control GM maize
[MON810 maize (BF413f) and MON863 (ERM-BF416d)]. The researcher carried out
further work to investigate the nature of the genetic element of 390 bp.
44
Figure ( 3.2-A): Agarose gel (1%) electrophoresis revealing 123 bp and 390 bp
DNA fragments in extracted DNA from standard local maize MON810/JBU1.
Table (3.2): Incidence of 123 bp and 390 bp DNA fragments in maize food and feed samples and
country of origin, (+) and (–) indicate presence and absence of DNA fragments respectively.
Type of maize Country of
origin
No. of
samples
123 bp
(GM indicator)
390 bp
(Gateway
Vector)
Food
Egypt 1 1 (+) 1 (+)
Italy 1 1 (+) 1 (+)
Jordan 13 12 (+)
1 (+)
12 (+)
1 (-)
Syria 1 1 (+) 1 (-)
USA 4 1 (+)
1 (+)
2 (-)
1 (+)
1 (-)
2 (-)
Feed
Argentina 1 1 (+) 1 (-)
Bulgaria 3 1 (+)
1 (+)
1 (-)
1 (+)
1 (-)
1 (-)
Canada 1 1 (+) 1 (+)
India 2 2 (-) 2 (-)
Israel 6 3 (-)
1 (+)
2 (+)
3 (-)
1 (-)
2 (+)
Romania 4 2 (-)
2 (+)
2 (-)
2 (-)
Ukraine 2 1 (-)
1 (+)
1 (-)
1 (-)
USA 1 1 (+) 1 (+)
Total number
of samples
- 40 29 (+)
11 (-)
20 (+)
20 (-)
123 bp
390 bp
50
100
150
0
1350
200
400
123 bp
390 bp
50
100 150
0
1350
200
400
45
Figure (3.2-B): Agarose gel (1.5%) electrophoresis for the detection of
amplified PCR products for maize samples
3.3 Sequencing Results of genetically modified maize with second Band
The large identified DNA fragment of 390 bp was extracted and purified from agarose
gel by using the PCR clean-up gel extraction kit as mentioned in materials and methods
section. The isolated DNA fragment was then sequenced by Synergene Biotech GmbH
(Schlieren/Switzerland). Annex (4-A, B) show the sequencing results as received from
the company.
The results of sequencing of 390 bp DNA fragment which was obtained by the specific
primer p35S-cf3, F (V1), primer p35S-cr4, R(V2a) and the reverse sequence
complement of primer p35S-cr4, R (V2c) are shown in the Table (3.3).
The same table shows the reverse sequence complement of V2a which is designated as
V2b and the sequence (V3) which was constructed from the combination of the two
sequences V1 and V2b; taking into the account the sequences of forward primer (p35S-
cf3) and reverse complement of backward primer V2c.
Ladder -ve 2 3 6 7 8 9 11 12 13 14 15
100bp
50bp
390bp
50bp 400bp
50bp 123 bp
46
Table (3.3): The amplified DNA sequences obtained from 390 bp DNA fragment. V1 (amplification product
of p35S-cf3, F), V2a (amplification product of p35S-cr4, R), V2b (reverse complement of V2a, V2b (reverse
complement of p35S-cr4, R) and V3 (constructed sequence from V1 and V2b sequences). V3 sequence is used
in the BLAST and MATLAB Bioinformatics analysis.
Sequences of amplified 390 bp fragment (5’ 3’)
Length of
Sequence sequence
V1
AAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAA
AGGCCATCGTTGAAGATGCCTCTGCCGACAGTGGTCCCAAAGATGG
ACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAAC
CACGTCTTCAAAGCAAGTGGATTGATGTGATATCTCCACTGACGTA
AGGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTA
TATAAGGAAGTTCATTTCATTTGGAGAGGAAG
260 bp
V2a
CTTGCGAGGATAGTGGGATTGTGCGTCATCCCTTACGTCAGTGGAG
ATATCACATCAATCCACTTGCTTTGAAGACGTGGTTGGAACGTCTTC
TTTTTCCACGATGCTCCTCGTGGGTGGGGGTCCATCTTTGGGACCAC
TGTCGGCAGAGGCATCTTCAACGATGGCCTTTCCTTTATCGCAATGA
TGGCATTTGTAGGAGCCACCTTCCTTTTCCACTATCTTCACAATAAA
GTGACAGATAGCTGGGCAATGGAATCCGAGGAGGTTTCCGGATATT
ACCCTTTGTTGAAAAGTCTCAATCGGACCATCACATCAATCCACTTG
CTTGAAAGACGTGGA
342 bp
V2b
TCCACGTCTTTCAAGCAAGTGGATTGATGTGATGGTCCGATTGAGA
CTTTTCAACAAAGGGTAATATCCGGAAACCTCCTCGGATTCCATTG
CCCAGCTATCTGTCACTTTATTGTGAAGATAGTGGAAAAGGAAGGT
GGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCCATCGTTG
AAGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCAC
GAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAA
GCAAGTGGATTGATGTGATATCTCCACTGACGTAAGGGATGACGCA
CAATCCCACTATCCTCGCAAG
343 bp
V2c AAGTTCATTTCATTTGGAGAGGA 23 bp
V3
TCCACGTCTTTCAAGCAAGTGGATTGATGTGATGGTCCGATTGAGA
CTTTTCAACAAAGGGTAATATCCGGAAACCTCCTCGGATTCCATTG
CCCAGCTATCTGTCACTTTATTGTGAAGATAGTGGAAAAGGAAGGT
GGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCCATCGTTG
AAGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCAC
GAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAA
GCAAGTGGATTGATGTGATATCTCCACTGACGTAAGGGATGACGCA
CAATCCCACTATCCTCGCAAGACCCTTCCTCTATATAAGGAAGTTCA
TTTCATTTGGAGAGGAAG
386 bp
47
3.3.1 Alignment sequence analysis
The sequence V3 was copied to the NCBI website:
(http://blast.ncbi.nlm.nih.gov/Blast.cgi) in order to search for the source of 390 bp
sequence, NCBI website was used since it finds regions of local similarity between
sequences. The website contains tools which compares nucleotide or protein sequences
to sequence databases and calculates the statistical significance of matches. BLAST can
also help to identify members of gene families. It was found that the sequence (V3)
represent or match a Plant transformation vector PSITEII-8C1, which has the following
sequence (Figure 3.3.1):
Figure (3.3.1): The matching sequence of second band 390 bp (V3) which
represent or match a plant transformation vector PSITEII-8C1. Source:
(http://blast.ncbi.nlm.nih.gov/Blast.cgi)
181 tacccataat agctgtttgc caaccggtca acatgtggag cacgacacac ttgtctactc
241 caaaaatatc aaagatacag tctcagaaga ccaaagggca attgagactt ttcaacaaag
301 ggtaatatcc ggaaacctcc tcggattcca ttgcccagct atctgtcact ttattgtgaa
361 gatagtggaa aaggaaggtg gctcctacaa atgccatcat tgcgataaag gaaaggccat
421 cgttgaagat gcctctgccg acagtggtcc caaagatgga cccccaccca cgaggagcat
481 cgtggaaaaa gaagacgttc caaccacgtc ttcaaagcaa gtggattgat gtgataacat
541 ggtggagcac gacacacttg tctactccaa aaatatcaaa gatacagtct cagaagacca
601 aagggcaatt gagacttttc aacaaagggt aatatccgga aacctcctcg gattccattg
661 cccagctatc tgtcacttta ttgtgaagat agtggaaaag gaaggtggct cctacaaatg
721 ccatcattgc gataaaggaa aggccatcgt tgaagatgcc tctgccgaca gtggtcccaa
781 agatggaccc ccacccacga ggagcatcgt ggaaaaagaa gacgttccaa ccacgtcttc
841 aaagcaagtg gattgatgtg atatctccac tgacgtaagg gatgacgcac aatcccacta
901 tccttcgcaa gacccttcct ctatataagg aagttcattt catttggaga ggacgtcgag
961 agttctcaac acaacatata caaaacaaac gaatctcaag caatcaagca ttctacttct
1021 attgcagcaa tttaaatcat ttcttttaaa gcaaaagcaa ttttctgaaa attttcacca
1081 tttacgaacg atagccatgg ggccggccat gagtgtgatt aaaccagaca tgaagatcaa
P35s-cf3 (f)
forward
primer
Reverse
complement
of P35s-cr4
(R) Reverse
primer
P35s-cf3 (f)
forward
primer
Sequence of the second band (390 base pair)
found in Plant transformation vector
PSITEII-8C1
48
The DNA sequence which starts from the base pair 500 to 954 (each letter is counted as
one base pair; the number in the beginning of the line to the left is taken like 481 until
the first letter in the forward primer P35S-cf3 (f) which counts to 500. If we look to line
901 we notice that at 930 base pair the reverse complement of P35s-cr4 (R) of reverse
primer which ends at 954, if we subtract 954 from 500 we get 454 which should be the
length of the product we sent for sequencing. But the one we sent for sequencing was
390 bp, we can justify this since our product is found at 696 bp, and from 607 until 954
there is 347 bp but we have additional 39 bp so we end up with 386 bp (≈390).
3.3.2 Genetic event of genetically modified maize
Further PCR experiments were undertaken in order to identify the specific event carrying
the 390 bp amplified fragment. Figure (3.3.2-A) shows the results of nested PCR analysis
of identified GM maize MON810/JBU1 carrying the large DNA sequence. Primers mg1,
mg2 were used to amplify DNA fragment equivalent to 401 bp, then this DNA fragment
was amplified by mg2, mg3; mg3, mg4; mg1, mg4 the products were of 330bp,149bp,
274bp, respectively. This technique was found effective for the detection of a specific
transgenic (MON810) event. Theoretical basis of the obtained results of nested PCR
experiment is demonstrated in Figure (2.1.5); it is possible to indicate that the tested GM
maize contained the hsp70 exon1/intron1 region of maize MON810.
Terminator
49
Figure (3.3.2-A) Agarose gel electrophoresis for the detection of amplified nested
products for maize MON810/JBU1, Lane 1: Ladder; Lane 2: 401 bp sequence
identified by mg1, mg2 primers; Lane 3: 330bp sequence identified by mg2, mg3
primers; Lane 4: 149 bp sequence identified by mg3, mg4 primers. Lane 5: 274 bp
sequence identified by mg1, mg4 primers. Electrophoresis was performed on 1.5%
agarose gel and run with 3 volt cm-1
.
Furthermore, the second band of 390 bp that has appeared with the P35S primers is still
unknown; Figure (3.3.2-B) is part of a series of PCR experiments, which aims to
investigate the origin of the 390 bp sequence detected by 35S Primers.
Figure (3.3.2-B) Agarose gel electrophoresis for the detection of amplified PCR
products with p35S (F, R) for maize MON810/JBU1. Lane 1: Ladder; Lane 2:
390bp & 123bp sequences identified by p35S primers; Lane 3: Duplicate of
previous sample; Lane 4: 123 bp sequence identified by p35S primers with MON
863 maize. Lane 5: Duplicate of previous sample. Electrophoresis was performed
on 1.5% agarose gel and run with 3 volt cm-1
.
This PCR experiment was conducted to investigate the origin of 390bp second band that
appeared in maize MON810/JBU; it was compared to the maize event MON 863 in lane
4. However, as shown in the figure above, MON 863 gave only one band (123bp) with
1 2 3 4
5
401bp 330
bp 149
bp
274bp
1 2 3 4 5
390bp 123bp
123bp
50
P35S primers; thus, the maize MON810/JBU1 is not the MON 863 event.
Consequently, the investigation was continued in a similar manner.
Figure (3.3.2-C): Agarose gel electrophoresis for the detection of amplified PCR
products. Lane 1: Ladder; Lane 2: maize MON810/JBU1 with Mon 863 (F,R);
Lane 3: Duplicate of previous sample; Lane 4: maize MON810/JBU1 with Mon 880
(F, R); Lane 5: Duplicate of previous sample; Lane 6: maize MON810/JBU1 with
NK 603 (F, R); Lane 7: Duplicate of previous sample, Lane 8: maize
MON810/JBU1 with LY038 (F, R); Lane 9: Duplicate of previous sample; Lane 10:
maize MON810/JBU1 with GA21 (F, R); Lane 11:Duplicate of previous sample.
This experiment is part of a series PCR experiments that intends to investigate the
second band in the maize MON810/JBU1. Figure (3.3.2-C) shows a band with 95bp in
size (Lane 4), and a band of 70 bp size (Lane 6); NK 603 (F,R) should give 108bp band.
Therefore, the Maize MON810/JBU1 may be a second generation/ hybrid between Mon
880, NK 603 and MON 810 Table (3.3.1). Although the assumption that the sample
might be infected by a virus is also possible.
1 2 3 4 5 6 7 8 9 10 11
95b
p 70b
p
51
Table (3.3.1): Sizes in base pairs (bp) of PCR amplified DNA fragments when using
specific primers for detection of GM maize MON810/JBU1
Primers Amplified DNA fragment
detected in this study
CaMV 35S promoter
p35S-cf3, F:
p35S-cr4, R:
Detected
MON 810 specific (nested PCR)
mg1
mg2
Detected
MON 810 specific (nested PCR)
mg3
mg4
Detected
MON 863 Primer
(F)
(R)
Not detected
NK 603 Primer
(F)
(R)
Not detected
MON 88017 Primer
(F)
(R)
Detected
Primer GA21
(F)
(R)
Not detected
52
3.4 Results of survey analysis
During this study, a survey was conducted to test the awareness, perception and
attitudes of 400 people toward GM food and feed products. An assessment was
conducted according to the individual‟s response towards GM products based on five
categories of indicators/questions. The Arabic and English versions of the questionnaire
are shown in Annex (6-A, B). The SPSS analysis of the data is shown in Annex (6-D).
The results of the investigation of first category “socio-demographic characteristics of
participants” are shown in Figure (3.4 – A) and Annex (6-D (1)), looking at Figure
(3.4 – A) shows that the larger 219 participants (63.7%) were in the age group 18-25
years, 99 participants (28.8%) were in the age group 25-35 years, (4.7%) of participants
were within the age group (36-46) years old; whereas the percentage of age category 58-
68 years was 0.3 % of participants; Figure (3.4 – A) “A”). In addition, the figure shows
that the number of male and female participants in the survey were almost the same.
The study included 188 males (48.58%) and 199 females (51.42%); Figure (3.4 – A)
“B”). Moreover, the survey demonstrated that the majority of the participants were
holders of bachelor degree (82.4%) and the population sample included wide range of
specializations, e.g., engineering, business, social science and other specializations.;
there were engineers, graduates in the fields of Chemistry, Environment, Geology,
Information Systems, Biology, Physics, Nutrition, Pharmacy etc. There were also
specialties in management, business administration, accounting, law, media, libraries,
English, Arabic, political science, economics, logistics, child education, etceteras. The
detailed numbers of participants are shown in Annex (6-D 1).
The figures below represent the analysis of the 27 questions in the survey, where the x-
axis represents the multiple choice answers and the y-axis represent the frequency i.e.
53
(number of respondents who answered the question), the frequencies reflected as
percentages are presented on each figure as well.
(A)
2.6
(B)
63.7 % 28.8%
4.7 %
2.6 %
0.3 %
54
(C)
(D)
Figure (3.4 - A): Socio-demographic characteristics of participants. (A) Age, (B)
Gender, (C) University major specialty (D) Educational level.
Figure (3.4 – B) below reveals that the majority of the participants (around 96.2 %) gave
the right answer for the question in part (A) which is about participants‟ knowledge of
DNA. Similarly, the correct answers for the question in part (B) what is responsible for
1.6 %
82.4 %
14 %
2 %
55
the genetic characteristics were around 87.4 %. On the other hand, when participants
were questioned about genetic fingerprint part (C) and gene therapy part (D) the results
indicated that most of respondents have little information about these subjects. Thus, we
conclude that the majority of the participants of the study are well educated in terms of
their general background information on the nature of genetic material nevertheless they
lack knowledge of more specifics detailed facts and concepts related to biotechnology.
The answers for the question in part (E) indicate that the majority of participants (71.6
%) illustrate genetic Engineering technology should be encouraged as a mean of
progress and development.
(A)
DNA
96.2 %
0.7 % 1.3 % 1.8 %
57
(D)
(E)
Figure (3.4 - B): General awareness of participants on basics of biotechnology.
23.8%
42.9%
27 %
6.3%
71.6 %
19.3% 9.1%
58
Figure (3.4 – C) demonstrate that nearly 55.3 % of participants have limited knowledge
about GMO while (21.1%), of respondents heard only about it. And 18.3 % knows very
well what the GM food is. Those who had the knowledge about GM technology were
asked to write down their understanding. Only 7.5 % answered this question; very few
people gave the exact right answer scientifically, others gave a general answer. Some of
the responses mentioned that the reason behind producing GM food is to get higher
quality and quantity products, improve the appearance, change the color, and the taste
and to be able to counter certain diseases, or to improve a specific inherited trait, also to
plant the crop that can withstand harsh conditions like high temperature and salinity
and/or be available in any season. Some participants think that GM food is a food that
has been genetically altered i.e. through manipulating the genes of foods without the
addition of any external source. Others think that GM technique is the same as natural
breeding i.e. it is a cross breeding between two similar plants; some respondents believe
that GM technology is about taking out undesired genes and replacing them with the
desired ones. The response for the question in part (B) indicate that 64.4% of the
participants believe that there are methods to detect the GM food; however a very small
percentage (4.3%) of respondents thought that there are no methods/techniques to detect
these GM foods. Concerning the perspective of participants regarding the impact of GM
food and feed products and whether they have positive or negative effect. Answers for
this question show that the participants are not certain about the impact of these
products on human health and the environment. Question in part (D) is similar to the
previous one and the pattern of participant‟s answers assures the same findings that
people are not sure whether GM food is useful or harmful.
59
On the other hand (43.3 %) of responses indicate that GMO may have harmful impact
on human health and the environment, while about 28.9% of respondents do not know
anything about this subject. Question in part (E)
In the question in part (F), 53.4 % of the participants mentioned that they read the
nutritional facts on the food products some times, 18.5 % of the survey sample, always
read the facts and 23.3 % never look at any information written on the product.
Almost 51.6 % of the survey sample believes that the role of media in promoting the
awareness about GM food and feed products is weak and limited. While 27.3 % of
participants think its effective and 21.1 % believe that there is no role for the media at
all (part G).
The response for the question in part (H) show that 23.4 % of participants purchase GM
products, while 37.6 % indicate that they have never purchased GM products.
Conversely 39 % of respondents admit that they do not know if they ever purchased
GM food or not.
(A)
18.3 %
55.3 %
21.1%
5.3 %
63
(H)
Figure (3.4 – C): General knowledge of participants on genetically
modified Food
Figure (3.4 - C): General knowledge of participants on genetically modified food
Figure (3.4 – D) shows participants response and their perception about laws and ethical
standards governing GM food. Participants, responses to questions in part (A) and (b)
reveals that they perceive the religious and ethical beliefs in a very similar manner as in
both questions the higher percent of respondents said that the acceptance or rejection of
GM food is conditional, i.e it depends on the nature of the change (from which species
was it taken) and the cause of this change. For example some participants mentioned
that they may consume GM food after checking its source and the type of modification
that was performed.
These answers were also compatible with other answers that were given by religious
men (Islam & Christianity); when interviewed and asked about the religions view about
consuming GM food a priest from the Evangelical Baptist Church was interviewed and
asked to express the church views towards consuming GM food; he said that by
engineering such a food we interfere with the laws of creation because God has created
23.4 %
37.6 %
39 %
?
64
everything in the most perfect and complete form to serve and benefit humanity. He also
stressed on the real intent behind producing this kind of food and if it was only for
money and profit; if this was the case, then it is not ethical as loving money is the root
of all evil he said. Conversely, if the goal of producing GM food was to improve
humanity then it is authorized with the condition of performing intensive research to
prove its safety for humans & animals consumption and that it has no risk of causing
any harm to the environment. Otherwise, if some research found GM food to be harmful
to humans or animals then it is not permitted to produce it or trade it.
Another interview was carried out with Dr. Jameela Al Refaii (Assistant Professor) from
the Islamic Religious studies department at the University of Jordan to demonstrate
Islamic perspective of GM food. Dr. Jameela stressed that Islamic Sharea‟a supports
and encourages scientific research and development which aims to improve people lives
and serve humanity. She continued that one of Share‟a‟s aspirations is to preserve the
five necessities which are: Religion, the self, the mind, generations and money; There
are many Verses in Quran as well as in Hadeeth that mentions that humans should not
come up with anything that brings harm to themselves, to others, to animals or to the
environment. Therefore, if this technology was proved to cause any harm to human
health or other living creatures then its prohibited to continue with it; conversely, if it
was proven to be beneficial and has a potential of improving human lives and the
environment then scientists should make the best use of it. Keeping in mind that usually
any manipulation or tampering with nature leads to unpleasant results. Furthermore,
Quran has clearly stated that Allah is the only creator who is able to create everything
and has all the power to control everything in this world (Al Imran 3: 190). In this
Surah, Allah demonstrates an example of men who are non believers, where Allah
65
challenges them by saying that they are unable to create anything even as small as an
insect (a fly for example) even if all the scientists have gathered to do so. They have no
ability or the power to create something without the permission of Allah. Some people
claim that through genetic engineering they are able to manipulate living things, despite
of these claims Allah has mentioned in the Quran that that humans cannot create
something as perfect as Allah‟s creation: “O men! Here is a parable set forth! Listen to
it! Those on whom, besides Allah, ye call, cannot create (even) a fly, if they all met
together for the purpose! and if the fly should snatch away anything from them, they
would have no power to release it from the fly. Feeble are those who petition and those
whom they petition!” (al-Qur‟an, al Hajj 22: 73) (Amin, 2009).
Concerning the consumption of GM food, 41.58% of participants expressed their
rejection to purchase or consume GM products. 42.6% said they will try it. However,
15.82% of respondents agreed to purchase it and have no problem with consuming such
food, question in part (C).
On the other hand, 77.8% of the survey sample believes that it is very important to label
the GM food; while, only 7.2% thinks that it is not crucial, based on the responses to
question in part (D). Consequently, the responses to the questions in part (F) and (G)
illustrate that 80.8 % of the participants of the study believe that it is of great importance
that the government should take strict laws to prevent the entry of GM food and feed
and they believe that the already established system (scientific, regulatory and
legislative) has the capability to monitor the access to GM food and feed products.
69
(G)
Figure (3.4 – D): Participants perception on laws and ethical standards
governing GM food.
Figure (3.4 – E) below represents the awareness of participants related to the
economical and environmental impact of GM food and feed products. In response to the
question in part (A), the highest percentage of participants said that the price of GM
food must be less than the non- GM food. In part (B) 61.8 % of the survey sample said
that they are willing to pay higher price for food if it will be non-GM.
The majority of respondents to the question in part (C), 69 % believe that genetic
engineering help farmers to produce large amounts of crops more efficiently and with
better quality. 42.4 % of the survey sample said that GM food may partially solve the
famine of the world; 31.4 % believe strongly that GM food will solve the famine of the
world; however, 18.8% of the participants do not believe that GM food is the solution,
based on the answers for the question part (D).
The question in part (E) shows that 46.2 % of respondents think that there are
environmental risks associated with the plantation of GM crops, 23.1 % do not think
80.8 %
8.2 % 11 %
70
that this is true and, 30.7% of participants do not know the right answer for this
question.
On the other hand, and based on the responses to the question in part (F), 53 % of
participants believe that GM food sold to developing countries is of lower quality than
that sold to developed countries, 34 % of respondents have no idea.
(A)
(B)
(B)
18.3 %
38.3 %
21.1 % 22.3 %
61.8 %
38.2 %
72
(E)
(F)
Figure (3.4 – E): Economical and environmental awareness of participants in
GM food and feed.
53 %
6.4 % 6.6 %
34 %
46.2 %
23.1 %
30.7 %
73
In the last question of the survey (no.28), which was an open ended question, the
participants were asked if they have any additional comments or fears that they would
like to mention. Around 62 (15.5 %) out of 400 participants answered this question;
some of the answers highlighted/ outlined the impact of GM technologies on human and
plants; as Allah has created them perfectly and they should stay as they are. In addition
and since GM food price shall be more expensive than the other non-GM food. Some
participants stressed on the importance of the role of media in raising the awareness
about this subject, and that currently the role of media is not present at all. Furthermore,
there was a recommendation for farmers to focus on increasing agricultural activities
specially organic farming. Some argued that the responsibility and role of the Ministry
of Agriculture is somehow absent because the ministry does not prevent the spread of
GM products that may cause cancer.
On the other hand, many believe that GM food may be safe if many tests have been
carried out that focus on long term effects on humans and the environment, i.e a lot of
research must be carried out on these products before releasing them into the
environment. Moreover, there should be authorized accredited labs that test random
samples from the market, and prove if it was GM product or not. Some participants
argued that if the genetic modifications were only among the same plant species then
that is considered a good improvement; however, if the modification came from
different species from animals to plants then it‟s not acceptable.
Unfortunately, there are insufficient studies and information for the public on the risk
and health impact of GM products on humans, animals and the environment as this kind
of research is still in its early stages.
74
There were opinions that support the plantation of GM crops in the developing countries
in order to help the country to be self sufficient and lower the imports as much as
possible, also they said that GM food may contribute to ending hunger in the world. It
was mentioned that testing, monitoring and tracking of GM products as well as traces of
pesticides in foods is very important. Furthermore, any entity which imports GM food
must first investigate more on the source of the product and if the country of origin
where these products came from do have this technology or not, then decide whether to
allow the entry or not. Some mentioned that there should be specific regulations that
deal with the safety and security of GM food, they also stressed on the importance of
labeling of GM food and said that it is crucial and is considered as one of the consumer
rights.
Moreover, a number of participants in the survey feared that human beings are being
used as rats for experimenting the quality of such products without the consent of
people specially those who live in poor and developing countries. In Addition, there are
many fears that people are consuming GM food without their knowledge about it.
Then again a few respondents are worried about any potential impact of what is called
genes interaction. Several people said that GM food may cause cancer, mental illness
and sterility, or new disease that no one knows about. There is also a strong belief that
this technology alters the natural genetic traits that Allah has created in creatures and
that they may cause negative impacts which may not appear now but may appear later
on in the future generations; some had said that even if there was a very low possibility
of 1% of bad health impacts of GM foods on the humans and the natural environment,
then there is no need at all for it.
75
Some recommended to sell GM food at higher prices than non-GM food in order to
poor people not to buy them, and that they should be sold in specific places, some
people have never heard about this topic at all.
Respondents of the survey‟s questionnaire thought that awareness activities must be
more active in informing the public of the nature and risks of the spread of GM
products, as sooner or later this technology and GM products will be part of our daily
lives so what we must do is to make sure that the product is safe through extra research.
In addition, there are fears that the goal of this technology is only to gain more money
by farmers and business men that is why governments must monitor farms and protect
the public from fraud. There were also many concerns that genetic engineering
technology may interfere with religious and moral values.
Many have stressed on the true intent behind producing GM food; if the goal was to
improve these crops or foods and sell them in a similar price of other non-GM food, and
at the same time to ensure that it is safe for humans and animals to consume them, then
this type of food is accepted. Conversely, many reject this type of genetic engineering
completely and prefer organic food over GM food.
There were important recommendations to disseminate the results of this study over a
wide range of public since more than 70 % of the population have never heard of GM
food.
76
3.5 Major findings of laws and regulations governing genetically
modified food and feed
As mentioned in the result section (3.2) about the occurrence of GM food and feed in
Jordan, it is important to control GM products by regulations and Laws; this issue must
be seriously and immediately dealt with, as the researcher personally believe that the
spread of GM products might have an impact on human health, environment and the
biodiversity in Jordan.
One of the primary international agreements which is considered legally binding is the
Cartagena Protocol on biosafety, this agreement was adopted in year 2000 by 130
countries (Jordan was among those countries); it is regarded as a supplementary
agreement to the Convention on Biological Diversity (CBD) which entered into force on
11 September 2003. It aims at governing the movements of living modified organisms
(LMOs) resulting from modern biotechnology from one country to another. Today the
number of countries signing this protocol increased to 162, Bahrain, Morocco and
Somalia were one of the new countries which ratified this protocol (Weasel, 2009);
Annex (6-A).
The Cartagena Protocol is based on the precautionary principle which relies on
anticipatory action in the absence of definite scientific evidence, i.e. when there is
considerable loss of biological diversity, lack of full scientific certainty should not be
taken as a reason to delay measures that minimize or prevent such a threat. The
inclusion of this principle in the GMO argument has caused debate especially for the big
77
GMO producers as US, Canada, Argentina who objected to the World Trade
Organization, claiming that the precautionary principle includes unnecessary obstacles
to trade their GM products (Herrera, 2007).
It is also worth noting that despite that 162 countries signed this agreement this does not
mean that all these countries follow all the regulations and abide to them 100%
(http://bch.cbd.int/protocol/supplementary/).
On October, 16th
, 2010, a new treaty was adopted by the world community called “the
Nagoya – Kuala Lumpur Supplementary Protocol on Liability and Redress to the
Cartagena Protocol on Biosafety”; this treaty includes international rules and procedure
on liability and redress for damage to biodiversity resulting from living modified
organisms. To be liable means to be accountable and able to compensate the damage
caused by an action of a specific organization, entity or a person. The new treaty was
open for signature at the United Nations Headquarters in New York from 7th
of March
2011 to 6th
of March 2012; it was expected to enter into force 90 days after being
ratified by at least 40 Parties to the Cartagena Protocol on Biosafety. Until today, there
are around 51 countries who have already signed this treaty, Annex (6-B).
In Europe, the new community regulations regarding the GM food indicate that labeling
is compulsory if the concentration of GM material is higher than 0.9%. (Elsanhoty,
2010). Based on the performed lab experiments and the findings reported in this
research, a new transgenic event was found which is the 390 bp DNA sequence; this
reveals the urgent need to investigate the degree of prevalance of such events in the
Jordanian market, and to enforce stringent laws to control the entry of such prodcuts to
our country.
78
Current status of GMO regulations in different Arab countries
Table (3.5) shows the GMO regulations status in different arab countries, to which
illustrates that the majority of countries have signed and ratified the Cartagena Protocol
(CPB) between the year 2000-2012; however, only few countries have develped their
biosafty framwork as (Egypt, Jordan, Lebanon and Libya), the rest of the countries have
no biosafty framework in place yet. Regarding the existance of laws and regulations,
some countries do have either a by-law or a draft law. Unfortunatly, there is no
implementation of any of these regulations at all, none of them is activated yet, i.e no
party is held laible or acountable if they import, trade, or plant GMO. One of the reasons
for this is that in some countries there is no accredited labs or qualified staff which are
cabable of testing the GMO products yet, another important reason is that if the GMO
laws were implemented and enforced this might casue the uproot of a billion dollar
industry (biotech companies). It should be mentioned that these companies are currently
getting enourmouse profits out of the spread of GMO seeds/ crops all over the world,
they also have a huge power which may affect the decigions of many governmental
entities; thus, the implementation of such laws will diffently hinder their progress. It
might even cause enourmouse loses for these companies which are alreay spread in
several arab and developing countries without any restrictions.
79
Table (3.5): Current status of GMO regulations in different Arab Countries
Country/ Status
of GMO
Legislation
Bahrain Egypt Iraq Jordan Kuwait
Ratification on
International
Treaties
1996: CBD
2012: Cartagena
Protocol (CPB)
1994: CBD
2003:Cartagena Protocol
(CPB)
2009: CBD
1996: CBD
2004: Cartagena
Protocol (CPB)
Recently a
memorandum on the
ratification of
biosafety protocol
was sent to the
Administration of
Legal Advice and
Legislation
Biosafety
Framework
-
Exist from the beginning
of nineties
-
The National Biosafety
framework was
formulated by the
ministry of
Environment in year
2004
-
Legislation
Regulations &
Laws
People importing,
exporting or growing
genetically modified or
contaminated crops
would
face a minimum of three
months in jail, or a more
severe punishment
1997: Requiring approval
by the
SCFS for the import of
GMOs for food.
Prepared a draft
of national
legislation on
Biosafety (draft
Biosafety law of
Living Modified
Organisms and
their products)
There is a Proposed
By-Law for Bio-safety
of Genetically
Modified Organisms
which was published in
the gazette in 2006.
In 2008 Jordan food &
Drug administration
(JFDA) established a
draft of non-buiding
guidelines on Biosafety
-
80
Country/ Status of GMO
Legislation
Bahrain Egypt Iraq Jordan Kuwait
GMOs grown for
Research purposes - Contained use,
experimental
releases
- Present -
GMOs grown for
commercial Purposes - Products intended
for food *
- - -
Registration of New GMO
seeds - 1998: set a protocol
for GM food
Registration**
- - -
Food Labeling No Labeling Not applied - - -
Enforcement &
Monitoring
NO routine testing
of imported
products for
presence GMO
Not Applied - - -
81
Continue…. Table (3.5 ): Current status of GMO regulations in differner Arab Countries
Country/ Status
Of GMO
Legislation
Lebanon Libya Oman Qatar Saudi Arabia Tunisia UAE
Ratification on
International
Treaties
2008 :
Cartagena
Protocol
(CPB)
2001: CBD
2005: Cartagena
Protocol (CPB)
1994: CBD
2000:
Cartagena
Protocol
(CPB)
2007:
Cartagena
Protocol
(CPB)
2007:Accessio
n of Cartagena
Protocol (CPB)
1992: CBD
2003:
Cartagena
Protocol (CPB)
-
Biosafety
Framework - In 2005
Lebanon
developed
its NBF
- In 2008: Libya
has completed its
National
Biosafety
Framework
- Not Existing - - - -
Legislation
Regulations &
Laws
Sanitary &
Phytosanitary
measures
law,article 14
bans the
import of GM
seeds &
seedlings.
There is not yet a
clear
“Environmental
National Policy” in
which related
legislations are
incorporated.
- Some Rules &
Regulations
2000:
Regulations of
the genetically
modified foods
in the Kingdom
of Saudi
Arabia
Project of law
regulating
GMOs
-
GMOs grown
for Research
purposes - - - - - Genetic
engineering is
applied for
research only
Date Palm
GMOs grown
for commercial
Purposes - - There is
currently no
application or
production of
genetic
transformatio
- - There are no
GMOs grown
in open field at
commercial
level
-
82
n
Country/ Status
Of GMO
Legislation
Lebanon Libya Oman Qatar Saudi Arabia Tunisia UAE
Food Labeling - The regulatory
institutions require
provision of
genetically
modified organisms
(GMO) free
certificate from the
country of origin
for the imported
goods to be allowed
into the count
- Is required
by Law Is compulsory
by law - Labeling GM
is mandatory if
the GM content
is > 0.9%
Enforcement &
Monitoring
- - Importing all kinds
of seeds for
agricultural
production was
prohibited since
2006.
- - 2006:
Food
testing
Result
(40%
GMOs)
- No strict
monitorin
g - Inspection
at port of
entry
- Importation
of foods
made of
genetically
modified
animal
products by
the use of
biotechnolog
y is
Forbidden
- -
Source: (Participants presentations at the 1st International Workshop on Harmonaization of GMO Detection and Analysis in the Middle East &
North Africa Region “ MENA”) Dead Sea, 4-5 June 2012.
83
3.5.1 Current Status of bio-safety laws in Jordan
In 2010, the Jordanian population was reported at 6,181,000 million inhabitants and it is
expected to reach 7,945 in 2025 (Hashemite Kingdom of Jordan Department of
Statistics "DOS", 2013); this increase in population count will put pressure on natural
resources in the Kingdom which are already limited. Jordan is considered a deficit
country when it comes to food supply as its imports of food commodities still exceed its
exports by far. Moreover Jordan is a large net-importer of feedstuffs for livestock.
Jordan's agricultural trade account has been negative for decades, but in recent years the
deficit has increased sharply. In 1999 the deficit in food trade balance was around 350
million JOD; in 2007 it reached 918 million JOD, source: (Central Bank of Jordan,
Annual Reports). In Jordan the land suitable for cultivation is around 886,400 ha, or
around 10 percent of the total area of the country (FAO, 2005). The main annual crops
are vegetables, potatoes and cereals (wheat and barley). The National Strategy for
Agricultural Development document reported problems and constraints to agricultural
development; due to the continuing rise in food prices; and the impact caused by climate
change.
Agricultural development is an important environmental dimension because of its role
in maintaining biodiversity, Ground resources and water resources and their capacity to
regenerate and the continuation of the ecological balance which contributes to the
provision of the sustaining development requirements. Therefore, there is a close
relationship between agriculture and the environment, since any imbalance in one of
them will harm the other. As mentioned above, Jordan depends a lot on foreign trade to
cover the needs of its people from foodstuff, and so the issue of GM food and feed
84
including vegetables, fruits, and any other type of food which is GM must be taken very
seriously. Although Jordan has signed the Cartagena Protocol on biosafety in year 2000
and as mentioned it should have been entered into force in 2004 but still there is no
monitoring or tracking of the entry of these foods into the country.
Many farmers are already planting vegetables and fruits which the researcher believes
are modified; being tempted by the increased yield and less use of pesticides and
herbicides. Unfortunately, these farmers have a very limited or no knowledge of the
possible adverse effects on human health and the environment; like polluting organic
natural crops in our country, in addition to causing harm to other types of insects which
are not targeted (some insects are vital components in other animal and insect food
chain, the thing that may cause a decline in the number of some animal population).
Therefore, the agricultural sector must be well protected and monitored because it
works to maintain the natural resources of land, water and vegetation cover. This
contributes to the achievement of ecological balance and preserving biodiversity and
reversing desertification process and thus ensure conditions for sustainable
development.
Following the signing of the Cartagena Protocol, Jordan prepared and issued the
National Bio-safety Framework in 2004, and a proposed a By-Law for the bio-safety of
GMO which was published in the gazette in 2006. Recently, the Ministry of
Environment together with other concerned parties has prepared a law for bio-safety of
GMO. A brief description of these regulations will be presented in the following
section. Full regulations are present in Annex (7- A, B).
85
In 2008 Jordan food and Drug administration (JFDA) prepared a draft of non-binding
guidelines on biosafety, and until today these guidelines are not even published on the
JFDA website and are not put into force. Therefore, a serious decision must be taken
immediately to activate these guideline especially for the GM food that is used for
pharmaceutical purposes.
Table (0): Jordan status with regard to Cartagena Protocol treaty
Date of signature 2000-10-11
Date of ratification 2003-11-11
Date of entry into force 2004-02-09
Type of Document Number of
Records Date of Last update
Competent National Authority (Ministry of
Environment)
1 2008-10-21 06:23 UTC
Country's Decision or any other
Communication 0 -
Law, Regulation or Guideline
- Draft National Biosafety Framework
(Developed under the UNEP-GEF
Biosafety Project)
- Proposed By-Law for Biosafety of GMO
Issued in Accordance with Article No
(23) of the Law of Environment
No (1) See Annex (7-A)
2 2008-11-16 01:52 UTC
National Database or Website 1 2008-11-24 13:04 UTC
National Focal Point 1 2011-11-02 17:00 UTC
News 0 -
Report on Assignment 0 -
Risk Assessment 0 -
Reports on Implementation of the Protocol 1 2011-11-02 14:15 UTC
Ref: (
86
Table (3.6.1) illustrate that the Ministry of Environment is the national authority
responsible for the management, follow up and implementation of the Cartagena
Protocol and all issues related to bio-safety. The latest national report was submitted in
February 2011. Several organizations participated in the preparation of this report:
Ministry of Environment, Ministry of Agriculture, National Center for Agriculture
Research and Extension, University of Jordan, Royal Scientific Society, Ministry of
Planning and International Cooperation, Food and Drugs Administration.
On the other hand, there are several independent institutions like universities or research
centers which are currently carrying out specific research subjects related to GMO, for
example the Royal Scientific Society has recently published two papers related to this
subject and these are (Al-Hmoud et al , 2010, Al-Rousan et al, 2010).
Through the researcher investigations it was found that The National Center for
Agricultural Research and Extension (NCARE) is capable of detecting the prevalence of
GM food and feed, it is also developing the capacity of its staff to be able to carry out
quantitative analysis (through using the real time PCR) i.e to be able to figure out the
percentage of the new genetic constructs (GM events) inserted into the plants. This is
very important in order to be able to enforce labeling or prevent totally the entry of
some products if the concentration exceeded a certain limit.
On the 30th
of January, 2012 the researcher has interviewed some employees from the
Ministry of Agriculture specifically from the phytosanitary measures. The aim of this
interview was to enquire on all the present regulations & laws on GM seeds, it was
found that there were no regulations at all. Even if these existed, since no entity tests
these GM seeds or plants, those regulations will have no value.
87
In Jordan there are several institutions both governmental and nongovernmental
responsible for the protection of the environment and human health such as: the
Ministry of Environment, the Ministry of Agriculture, Food and Drug Administration,
the Ministry of Health, NCARE, the Royal Scientific Society at El Hassan Science City,
in addition to many other universities and Research centers. Many of the governmental
institutions already have laws that could be linked to biosafety issues; for example: Law
of Environment (No. 52/2006), the temporary Law of Agriculture (No.44/2002), the law
for the protection of plant species (No24/2000) “This law related to the mechanism of
registration of new plant species and the rights for the person(s) who invented it.
The Law of Public Health (law No. 21/1971), which includes some articles that consider
food not suitable for human consumption if it contains any poisonous material or any
substance that can be harmful to humans or animals. The By-law on Hygiene and Food
Safety (law No. 8/1994): “In article 4/c, it is stated that the council has tasks to
formulate the general policies on food safety, selling and handling of imported food; in
addition to Article 74/c 2, 3, 4 and 5, which include important information for food
biosafety where plans, research, cooperation in this regard can be performed. Another
law is the law on descriptions and specifications (No.15/1994) where in article 4, it is
stated that Jordan Institution for Standards and Metrology (JISM)/Ministry of Trade and
Industry will depend on a national system for description and specification based on
recent scientific information. It also includes that the cooperation will work to provide
environmental, economical and health protection for people of Jordan through the
assurance that the commodities and other substances are compatible with the descriptive
criteria. Moreover the by-law on health quarantine in Aqaba port (No. 32/1972) Article
46 states that it is not allowed freeing any shipment of food or the raw materials of food
88
before it stands either by a certificate from the health department / source or by the
laboratory testing that it is healthy and safe (National Biosafety Framework, 2004).
3.5.2 Summary of Jordan Biosafety framework, Draft by law and
latest national report on the Implementation of the Cartagena
Protocol on Biosafety
The National Biosafety Framework was finalized and issued by the Ministry of
Environment in 2004 with the support of external Jordanian experts who represent the
public, academic and private sectors. The framework was funded by the Global
Environmental Facility (GEF) and facilitated by the United Nations Environmental
Program.
Despite the difference in the content of the biosafety framework among different
countries, it usually has similar components as: a governmental policy and a regulatory
regime for biosafety, a system to handle notifications or requests for authorization, a
system for follow up and monitoring etc.
The Jordanian Government Policy on biosafety aims to minimize as much as possible
the health risks expected from the consumption of GMOs or any of the modern
biotechnology products in order to protect human health, environment and the
biodiversity. Moreover, the government intends to regulate the transboundary
movement of the products resulting from biotechnology through establishing relevant
policy and regulatory system and management bodies. It also plans to establish a risk
assessment system which sets the risk levels and the guidelines which specifies the risk
89
assessment procedure. The government will also work to encourage research in this
field (Ministry of Environment, 2004).
Until 2006 Jordan did not have any regulations which deals with GMOs, and as a result
a draft by - law was finalized and published (Biosafety of Living Modified Organisms
(GMOs) and Products Resulting from Modern Biotechnology) this directive includes
eleven articles, where it is applied mainly on those GMOs that are transferred through
borders and others which may be of harm to humans and the environment. The main
aim of this directive is to guarantee a safe handling and trade of GMOs, it stresses on
labeling issues and focus on reducing the possible risk that may result from
biotechnology industry.
This by-law or directive also assigns a National Biosafety committee which is led by the
Minister of Environment; this committee involves experts from different institutions as:
Ministry of Environment, Ministry of agriculture, Ministry of Health, Food and Drug
Administration, National Center for Agricultural Research and Extension, Royal
Scientific Society, National Society for Consumer Protection, Jordan Institution for
Standards and Metrology, General Union of Farmers, Food Merchants Association, two
official universities which have facilities and offer services in the field of modern
biotechnology.
The latest Jordanian national report on the Implementation of the Cartagena Protocol on
Biosafety was submitted in October 2011, the report basically takes a form of a
questionnaire. This report was prepared by several organizations: Ministry of
Environment, Ministry of Agriculture, NCARE, University of Jordan, Royal Scientific
Society, Ministry of Planning and International Cooperation and Food and Drugs
Administration. In general, this report discusses Jordan commitment to all the articles in
90
the Cartagena protocol; for example, some questions inquire if Jordan has the technical
capacity to detect and identify GMOs, other questions ask if the country regulates the
trans-boundary movement, handling and use of (LMOs) which are pharmaceuticals. In
addition the report raises questions on whether Jordan has ever taken a decision on an
application / notification regarding intentional transboundary movements of LMOs for
intentional introduction into the environment, and the answer was that this has not
happened yet. The full report can be viewed at the following link
(http://bch.cbd.int/database/record.shtml?documentid=102659 )
According to article 20 of the Cartagena Protocol on Biosafety every member country
has to establish an information exchange center or what is called a Biosafety Clearing-
House (BCH), (http://bch.cbd.int/ ), for the purpose of facilitating the exchange of
information on GMOs, this will enable all the parties to comply with their obligations
under the Protocol. There is an international biosafety clearing house website where
everyone has access to several technical, environmental, scientific legal and capacity
building information all provided in 6 UN languages. For example if the user clicks on
“finding information” category, he/she can get comprehensive information on national
contacts, laws and regulations, country's decisions and other communications, list of
experts, GMOs, national reports, capacity-building organizations, the BCH Virtual
library.
In addition to this there is a national Jordanian Biosafety Clearing House
(http://jo.biosafetyclearinghouse.net) which is currently under construction; it serves as
a reference national database for all information on biosafety that is available in Jordan,
and this website is being developed and managed by the Ministry of Environment.
91
Discussion:
This research aimed at detecting and proving the existence and prevalence of GM food
and feed in the Jordanian market; furthermore one of the main goals was to examine the
awareness of Jordanians and determine their perception towards GM food products. The
study has also looked into the current status of the guidelines that control the entry and
trade of GM food in Jordan.
The statistical data collected from the Department of Statistic about the quantities of
maize imported by Jordan illustrates that Jordan imports significant amounts of maize
from all around the world. On the other hand, Jordan plants maize locally but in small
quantities, which is not sufficient to cover its needs); unfortunately it was also found
that some of the locally planted maize seeds is exported from abroad which was found
to be GM as well; therefore there is a pressing need to find alternatives to GM feed
crops such as locally grown non-GM feed crops or agricultural waste.
All the experiments that were carried out to detect the prevalence of GM products from
food or feed in the Jordanian market revealed that out of 40 maize samples collected, 29
were found to be GM i.e (72.5%). If we compare these results with the findings of an
earlier published study in Jordan (N.Al-Hmoud, 2010) which found that 18.18% of
maize used in production of feed were genetically modified and were unlabeled; we
conclude that within a couple of years the quantities of GM maize present in the
Jordanian market has increased dramatically. This indicates that great amounts of GM
maize are entering the Jordanian market without any restrictions.
Additionally a second DNA fragment of 390 bp, was found in the remaining 20 GM
maize sample; the band was not detected in wild type maize and control GM MON810
92
maize and MON863, which means that there are unauthorized genetic events in food
and feed maize samples in the Jordanian market. If we compare this finding with what
was mentioned earlier (that a new type of biotech maize called smart stacks was
released in USA and Canada in 2010), we conclude that the second fragment of 390 bp
may be one of these stacked maize generations.
The subject of GM food has been and is still under a great controversy for the last ten
years as several countries has banned or restricted its entry as a result of the possible
and unknown adverse health effects that may affect humans, animals and interfere with
the ecosystem and biodiversity. Throughout the investigation the researcher had the
chance to meet prominent figures in the field of biotechnology and other related
sciences such as prof. George Church (a professor of Genetics at Harvard Medical
School). Prof. Church together with Walter Gilbert developed the first direct genomic
sequencing method in 1984 and helped initiate the Human Genome Project in 1984. The
researcher had also the chance to meet Prof. Thomas C. Südhof (a German biochemist,
who studied medicine at the RWTH Aachen University , the Harvard University and at
the University of Göttingen). Currently Südhof is a professor at the Medical School of
Stanford University).
Luckily the researcher had the chance to ask both professors of their personal scientific
opinion about GM food and whether it is safe for human consumption or not and
surprisingly both of them had the same opinion were they both said that it is ok to eat it
and there is nothing wrong about it, as long as there is enough studies which proves that
it is safe and secure for humans as well as animals and that it causes no harm at all.
As mentioned earlier some scientists had found good evidence through their research
which proves that GM food does cause harmful health effects such as damaging
93
immune systems, sterility, an increased potential for cancer and higher mortality rates.
Many of these studies as well as others not mentioned here found these facts some years
ago and due to the huge power and large influence of the biotech companies (which
currently make billions of dollars out of trading GM foods). These studies where
somehow stopped and prevented from being published in well known Journals. Only
recently the study of (Seralini et al., 2012) had the chance to be published, and made a
huge argument through the scientific community as well as the general public.
The results of the conducted survey which covered 400 participants from different
governmental and educational institutions throughout Jordan showed that the majority
of Jordanians have good knowledge about the nature of genetic material, but lack the
knowledge of some concepts related to biotechnology. Only 18 % of respondents said
that they know very well what GM food is, and 55 % have little information. Most of
the people who said they know what GM food is, only knew the reason behind
developing these products which is to increase yield, withstand harsh weather
conditions and counter diseases. However, out of the 18% very few really understood
what GM food is and that it involves transferring genes between different species. When
participants were asked about the impact of GM food on humans and the environment,
their answers showed that they are not sure whether it is harmful or useful. Another
important question was about the acceptance of GM food from religious and ethical
perspectives, the responses showed that the acceptance or rejection of GM food is
conditional, i.e it depends on the nature of the change (the kind of species it was taken
from) and the reason behind this change. 75.5 % of the survey sample stressed that it is
crucial to label GM food, and 80 % stated that the government must set strict laws
94
which strict and monitor the entry of GM food and feed. About 69% of the participants
do believe that genetic engineering helps farmers producing large amounts of crops.
By tracking the sources of maize imported to Jordan, it was found that the country
might have been importing and exporting GM food since 1994 or early nineties without
being aware of this because there hasn‟t been a monitoring system in place or testing
program for the food merchants being imported from abroad. Based on the information
given in table (3.1-A) and knowing that Jordan population count is around 6,181,000
million, the average quantity of maize imported from year 1994-2010 is equal to
(419,530.37 Ton / year), we can calculate the Average annual consumption per person
per year from corn by dividing this number by the population count, we get the
following figure 0.0678 Ton/person/year (assuming that the majority of people eat
corn), based on the results of this study which states that 72% of the tested samples
were GM then there is a high probability that Jordanians are consuming huge amounts
of GM corn, not mentioning the other types of vegetables.
International biotech companies are trying to escape from regulating and labeling their
GM products; claiming that the genetic engineering technology is substantially
equivalent to classical breeding, which means that if a GM food product resembles a
traditional product, then the GMO food can be deemed as safe as its counterpart and
thus it should not be regulated or labeled. However, once GM products are labeled it is
easy to trace any adverse health effects that may be caused by the consumption of these
foods. It is worth mentioning here that around five agrochemical corporations control
85% of our food chain from seeds; meaning that in the end, it is all about business for
them. Any claims against the GM products which belongs these companies will cause
95
them enormous financial losses if proved right, and thus these companies will work so
hard to defend their products and market them in every possible way.
In January of the year 2000, around 130 countries adopted the Cartagena Protocol on
Biosafety and Jordan was among these countries. In 2004 Jordan finalized the National
Bio-safety Framework and a draft By-Law for the Bio-safety of GMO which was
published in the gazette in 2006. In 2008 JFDA prepared a draft of non-binding
guidelines on Biosafety and until today these guidelines are not even published on the
JFDA website. Unfortunately Jordan and the majority of Arab and developing countries
do not yet have a strict control and monitoring system. Some of these countries do have
some regulations and have already signed the Cartagena Protocol on biosafety couple of
year ago; in spite of this it is worth mentioning that signing or ratifying the protocol
does not necessarily mean that the country is implementing all the articles and
obligations completely, rather some countries start to build a base through collecting
information, forming committees, preparing a draft by-law, law and a bio-safety
framework etc; sadly for some countries this process could take more than ten years
before activating or enforcing any of the protocol articles or the prepared laws.
Consequently this has caused the spread, entry and even planting of GM food, feed and
seeds in many developing and Arab countries, Jordan is being among them, without the
knowledge and consent of consumers or government officials.
96
Conclusions:
Experimental results have shown that out of 40 maize samples collected, 29 (72.5%)
were found to be genetically modified. Thus, it is concluded that unlabeled genetically
modified maize is widely spread in the Jordanian market without the government or the
public knowing about it. Moreover 20 GM maize samples (69%) were found to contain
genetic element of 390 bp in addition to 123 bp sequence and this indicate that
unauthorized genetic events exist in our food as well.
The results of Jordanians awareness towards GM products showed that out of the 400
people who were surveyed 18 % said that they know very well what genetically
modified food is. However out of this percent very few people gave the exact right
scientific answer. This result shows that the majority of the participants of the sample
are ignorant about genetically modified definition as well as its impact on human health
and the environment.
When asked about their religious and ethical views more than 45 % said their judgment
depends on the nature of the change i.e (the kind of species it was taken from) and the
reason behind this change. 75.5 % of the people stressed that it is very important to label
genetically modified food, and 80 % think that the government must enact strict law and
set regulations which control and monitor genetically modified products and prevent the
entry of unauthorized GM products.
97
In 2004, Jordan came out with a National Bio-safety Framework and a Proposed By-
Law for bio-safety of Genetically Modified Organisms which was published in gazette
in 2006. Currently, the Ministry of Environment in collaboration with specialists from
governmental, non-governmental organizations and universities have recently prepared
a bio-safety draft law which we hope to be put into force as soon as possible.
As a result of these findings, the issue of testing must be taken seriously; labeling and
regulating the entry of genetically modified food and feed to Jordan must be prioritized.
Moreover, all current legislations although few must enter into action. Thus, the
importance of traceability systems lies in their capability of recording a history of a
product and at the same time fulfils the purpose of marketing and health protection. It is
true that we may not be able to prevent their entry but at least we are putting this matter
under control and taking precautions against any adverse impacts that may arise.
98
Recommendations:
It is highly advised to ban the use, import and trade of GM food and feed products
since their impacts on human and the environment is still unknown.
There is an urgent need to create competent laboratories with the state of the art
equipment to conduct the necessary tests. This aims at the followings: determine
whether the products contain genetically modified elements, determine the type of
genetically modified event, determine the percentage content of genetically modified
organisms in feed and food grains, plants, animals, fish and all the products that there
may be doubts its proximity to genetically modified organisms.
Awareness campaigns should be organized by the Ministry of Environment and
NGOs to educate consumers about the potential impacts and risks of GM food and
feed products on human health and the environment, biodiversity and agriculture.
All imported seeds or food / feed products from abroad must be labeled and
accompanied with a certificate which officially state that they are either GMO free or
declare the percentage of modification if it is a GM product.
Our governments must be aware that GM food aid is another crucial front for the GM
corporations to force their products into the developing countries. Therefore, it is
highly advised that any shipment that enters the Jordanian borders as food aid shall
be tested if it is genetically modified or not.
It is worth noting that many of the GM products such as (Soya, Maize, Canola) are
also basic ingredients in many processed foods, so it is advised to monitor and check
if these are labeled whether they are genetically modified or not.
99
The responsible ministries must monitor and investigate all the activities and status
of the International biotech companies which are present in Jordan.
Ministry of Agriculture & NCARE must be more active in monitoring the types of
seeds planted by several farmers around the country, scientific research on the safety
of these seeds on human health and the environment should also be encouraged.
It is essential to develop a database for GM seeds, plants, animals, fish and micro-
organisms and exchange these information among different institutions.
It is advised to transform all provisions and regulation into laws since provisions and
regulations are not obligating and any party which breaks them is not held
accountable.
Activate and enforce the already existing national legal framework and all relevant
laws & regulations to address all aspects of bio-safety.
Developing a MENA network to exchange and strengthen collaboration with
European Comission/ Joint Research Center to enhance the capacity in GM detection
and analysis, and risk management.
Organic farming practices should be further researched and encouraged.
Our government must motivate and financially support farmers to encourage them to
grow all kinds of organic crops specially (Wheat, Barley, Rice etc….) which are the
most important for any nation to be self sufficient.
101
REFERENCES
1. Al Jebreen, D. (2010), Perception and Attitudes of Riyadh University Students
towards Products Derived from Genetically Modified Crops in Saudi Arabia.
Pakistan Journal of Biological Sciences, 13 (1): 28-33.
2. Al-Hayani, F. (2007 ), Muslim Perspectives on Genetic Modification. Biomedical
Ethics, Zygon, 42(1): 153-162.
3. Al Rousan, H,. Al Hmoud, N,. Al Hayek, B,. and Ibrahim, M. (2010), A Study on
The Occurrence of Genetically Modified Soybean and Maize Feed Products in the
Jordanian Market. Journal of Cell and Molecular Biology 8(2): 87-94
4. Amin, L., Sujak, F., Samian A., Haron, M., Mohamad, M. and Othman M. (2009),
Islamic Ethics and Modern Biotechnology. International Journal of the Malay
World and CivilisatiLoant , 27 (2): 285-296.
5. Amin, L., Azlan, A., Gausmian, M., Ahmad, J.,Samian, A., Haron, M. and Sidek,
N. (2010), Ethical Perception of Modern Biotechnology with Special Focus on
Genetically Modified Food Among Muslims in Malaysia. Journal of Molecular
Biology & Biotechnology, 18 (3): 359-367.
6. Bartlett, J. and Stirling D. (2003), A Short History of the Polymerase Chain
Reaction. PCR Protocols , 226: pp3-6.
7. Brunk, C. and Coward, H. (2009), Acceptable Genes? Religious Traditions
and Genetically Modified Foods, New York: State University of New York
Press, Albany.
102
8. Chern, W., Rickertsen, K., Tsuboi, N. and Fu, T (2002), Consumer Acceptance
and Willingness to Pay for Genetically Modified Vegetable Oil and Salmon: A
Multiple-Country Assessment. The Journal of Agrobiotechnology Management
& Economics , 5 (3): 105 -112.
9. Demirci, A. (2008), Perceptions and attitudes of geography teachers to
biotechnology: A study focusing on genetically modified (GM) foods, African
Journal of Biotechnology, African Journal of Biotechnology, 7 (23): 4321-
4327.
10. Department of Statistics 2011. www.dos.gov.jo
11. Elsanhoty, R., Ramadan, M. and Jany, K. (2011), DNA Extraction Methods for
Detecting Genetically Modified Foods : A Comparative Study . Food Chemistry,
126 (4):1883–1889.
12. Jermini, M and den Eede, GV. European Commission, Joint Research Centre
(2006), The analysis of food samples for the presence of genetically modified
organisms Report. Querci M,.
13. Frewera, L., Lassen, J., Kettlitz, B., Scholderer, J., Beekman, V. and Berdal G.,
(2004), Societal Aspects of Genetically Modified Foods, Food and Chemical
Toxicology, 42(7): 1181-1193.
14. Han, J. (2006), The Effect of Perceptions on Consumer Acceptance of
Genetically Modified (GM) Foods. Unpublished Doctor Dissertation, Louisiana
State University and Agricultural and Mechanical College, Baton
Rouge, Louisiana, USA.
103
15. Hellmich, R. (2008), The Present and Future Role of Insect-Resistant Genetically
Modified Maize in lPM. In Integration of Insect - Resistant Genetically Modified
Crops within lPM. Springer Netherlands, (5): 119-158.
16. Herrera, A. (2007), International Law & GMOS: Can the precautionary
principle protect the Biological Diversity?. 2011: 97-136.
17. Hu, R. (2007). Labeling of Genetically Modified Organisms and the
Producer's Negative Labeling Decision under a Voluntary Labeling Regime.
A Thesis Submitted to McGill University, Canada.
18. James, C. (2004), Preview: Global Status of Commercialized Biotech/GM
Crops: 2004. ISAAA Briefs, (Electronic Version) No. 32. ISAAA: Ithaca, NY.
19. Jensen, A. (2009), Testing for genetically modified organisms (GMOs): Past,
present and future perspectives. Biotechnology Advances (27): 1071–1082.
20. Joint Research Centre (JRC) (2004), Event-specific method for the quantitation
of maize line NK 603 using real-time PCR Validation Report, Community
Reference Laboratory for Gm food and Feed, European Commission.
21. Joint Research Centre (JRC) (2005), Event-specific method for the quantitation
of maize line MON 863 using real-time PCR Validation Report, Community
Reference Laboratory for Gm food and Feed, European Commission.
22. Joint Research Centre (JRC) (2006), CRL assessment on the validation of an
event specific method for the relative quantitation of maize line MON 810
DNA using real-time PCR as carried out by Federal Institute for Risk
Assessment (BfR), European Commission.
104
23. Joint Research Centre (JRC) (2010), Event-specific method for the quantitation
of maize line GA21 using real-time PCR Protocol, Syngenta Seeds S.A.S,
European Commission.
24. Jordan, T. C. (2011). The National survey “Knowledge, Attitudes and Practices
towards Cancer Prevention and Care in Jordan”. Amman, Jordan.
25. Kuiper, H. and Davies, H. (2010), The Safe Foods Risk Analysis Framework
suitable for GMOs? A case study. Food Control (21): 1662–1676.
26. Macherey-Nagel, Mn (2010), Genomic DNA from Plant User Manual, Rev. 04.
27. McHughen, A. (2000), Pandora's Picnic Basket: The Potential and Hazards of
Genetically Modified Foods. USA: Oxford University Press.
28. Ministry of Environment, (2004), National Biosafty Framework of Jordan,
Amman, Jordan.
29. Miraglia, M. Berdal, K. Brera, C. Corbisier, P Holst-Jensen, A. Kok, E Marvin,
H. Schimmel, H. Rentsch J. van Rie and J. Zagon, J. (2004), Detection and
traceability of genetically modified organisms in the food production chain. Food
and Chemical Toxicology , 42: 1157–1180.
30. National Agricultural Biotechnology Council (2001). Report, “Genetically
Modified Food and the Consumer". Ithaca, New York 14853.
31. Nill, Kimball R., (2002), Glossary of biotechnology terms. 3rd ed.. ISBN 1-
58716-122-http://gmo-crl.jrc.ec.europa.eu/gmomethods/
105
32. Pachico, D. (2002), Attitudes toward genetically modified food in Colombia.
Proceedings of the 6th International ICABR, (pp. 155-217). Ravello, Itally.
33. Macherey-Nagel (2010), PCR clean-up Gel extraction User Manual,
NucleoSpin® Extract II, Rev10, Germany.
34. Pollack M. and Shaffer G. (2009), When Cooperation Fails the international
law and politics of genetically modified food . New York: Oxford University
Press Inc.
35. Rees, A. (2006), Genetically modified Food " a short guide for the Confused".
England: Chase Publishing Services Ltd.
36. Russel, S. (2001), In Vitro Amplification of DNA by the Polymerase Chain
Reaction. In Molecular Cloning : A Laboratory Manual, 3rd ed (p. chapter 8).
New York: Cold Spring Harbor.
37. Smith, J. (2003), Seeds of Deception Exposing Industry and Government Lies
about the Safety of Genetically Engineered Foods you’r Eating . Canada:
Chelsea Green Publishing.
38. Gilles-Eric Séralini, E. C. (2012). Long term toxicity of a Roundup herbicide and
a Roundup-tolerant genetically modified maize. Food and Chemical Toxicology.
10 (11):2986.
39. Institute of Ecology and Evolution of the Russian Academy of Science with
National Association for Gene Security (2010), Genetically Modified Soy
Linked to Sterility, Infant Mortality. A study undertaken by Russian biologist
Alexey V. Surov.
106
40. Tester, M. (2001), Depolrising the GM debate. New Phytologist , 149: 9-16.
41. Weasel, L. (2009), Food Fray" Inside the Controversy over Genetically
Modified Food". NewYork: AMACOM, a division of American Management
Association.
42. Wickson, F. (2004), Australia‟s Regulation Of Genetically Modified Crops: Are
We Risking Sustainability? Australian Journal of Emerging Technologies and
Society , 2(1):36-47.
43. Wolfenbarger, L.and Phifer, P. (2000), The ecological risks and benefits of
genetically engineered plants. Science , 290(5499):2088-93.
44. Zerbe, N. (2004), Feeding the famine? American food aid and the GMO debate in
Southern Africa. Food Policy , Scince Direct , 29:. 593–608.
45. Kaphengst, T,. El Benni, N,. Evans, C,. Finger, R., Herbert, S,. Morse, S. and
Stupak, N. (2010): Assessment of the economic performance of GM crops
worldwide. Report to the European Commission, March 2011.
Websites:
46. http://bch.cbd.int/
47. http://www.isaaa.org/
48. http://www.fao.org/docrep/003/X9892E/X9892e04.htm
108
ANNEX (1)
(A): Detection of GM food training certificate at the molecular biology
laboratory of the University of Applied Sciences Northwestern
Switzerland (n/w)
110
(B): Equipments used in the laboratories of the School of Life
Sciences/Institute of Chemistry and Bio analytics/University of Applied
Sciences Northwestern Switzerland FHNW. (a) General overview of lab (b)
DNA extraction (c) PCR machine (d) Gel electrophoresis (e)
Documentation system (f) Real time PCR machine
(a) (b)
(c) (d)
(e) (f)
111
ANNEX (2) Quantities and country of origin of the imported yellow
maize to Jordan in different Years
Year 1994
Country of
Origin
Quantity of Maize
Imported
Kg /year
Price of Maize
Imported Quantity
(JOD)
Lebanon 45,500 7,570
Argentine 47,580,000 4,500,000
United States 201,420,730 19,074,249
Italy 63,000 9,200
China 49,223,400 4,783,000
India 40,000 10,740
Turkey 332,700 56,155
Total 298,705,330 28,440,914
Year 1995
Country of
Origin
Quantity of Maize
Imported
Kg /year
Price of Maize
Imported Quantity
(JOD)
South Africa 40,000 11,275
Argentine 49,800,000 4,871,000
United States 298,468,426 30,582,030
Total 348,308,426 35,464,305
Year 1996
Country of
Origin
Quantity of Maize
Imported
Kg /year
Price of Maize
Imported Quantity
(JOD)
United States 438,119,269 57,968,208
Argentine 3,678,900 434,712
Turkey 239,000 67,156
Total 442,037,169 58,470,076
Year 1997
112
Country of
Origin
Quantity of Maize Imported
Kg /year
Price of Maize Imported
Quantity (JOD)
Turkey 123,500 32,220
United States 81,166,122 8,488,870
Israel 65,000 6,890
Italy 44,000 7,877
Australia 28,575 5,520
Total 81,427,197 8,541,377
Year 1998
Country of
Origin
Quantity of Maize Imported
Kg /year
Price of Maize Imported
Quantity (JOD)
Ukraine 547,200 67,083
Hungary 34,956,090 3,140,015
Romania 32,000 4,585
Yugoslavia 13,373,480 1,170,077
Bulgaria 447,500 49,866
Total 49,356,270 4,431,626
Year 1999
Country of
Origin
Quantity of Maize Imported
Kg /year
Price of Maize Imported
Quantity (JOD)
Bulgaria 23,375,460 1,837,025
Australia 130,600 34,789
Ukraine 152,000 19,050
Turkey 28,000 3,959
Total 23,686,060 1,894,823
Year 2000
Country of
Origin
Quantity of Maize Imported
Kg /year
Price of Maize Imported
Quantity (JOD)
Argentina 338,378,349 28,596,363
USA 80,234,110 6,548,363
Canada 22,000 6,300
Bulgaria 14,959,790 1,336,355
Australia 129,000 30,225
Turkey 68,500 8,743
South Africa 64,500 15,625
UAE 18,000 4,898
Total 433,874,249 36,546,872
113
Year 2001
Country of
Origin
Quantity of Maize Imported
Kg /year
Price of Maize Imported
Quantity (JOD)
Argentina 363,700,209 30,886,620
Brazil 40,100,000 3,283,588
USA 37,039,771 3,040,429
Turkey 182,650 35,546
South Africa 235,647 60,165
Egypt 35,000 6,650
Total 441,293,277 37,312,998
Year 2002
Country of
Origin
Quantity of Maize Imported
Kg /year
Price of Maize Imported
Quantity (JOD)
Argentina 390,050,940 33,438,160
USA 48,469,223 4,626,256
Canada 21,504 5,563
Romania 3,500,000 280,782
Hungaria 26,882,671 2,156,595
Canada 21,504 5,563
Turkey 78,000 11,991
South Africa 301,704 78,058
Lebanon 89,580 11,000
Iraq 187,065 16,152
Total 469,602,191 40,630,120
Year 2003
Country of
Origin
Quantity of Maize Imported
Kg /year
Price of Maize Imported
Quantity (JOD)
Argentina 402,139,492 40,124,233
USA 101,868,599 10,882,576
Brazil 8,684,570 802,205
Turkey 140,600 21,424
South Africa 40,000 15,677
Egypt 60,000 8,382
Syria 16,285 3,205
Iraq 148,805 13,294
Total 513,098,351 51,870,996
114
Year 2004
Country of
Origin
Quantity of Maize Imported
Kg /year
Price of Maize Imported
Quantity (JOD)
Argentina 81,737,601 9,761,800
Brazil 8,684,570 920,265
USA 319,160,602 38,363,102
India 17,298,824 2,131,050
Egypt 254,500 35,817
Syria 39,915 9,485
Iraq 150,000 9,939
Total 427,326,012 51,231,458
Year 2005
Country of
Origin
Quantity of Maize Imported
Kg /year
Price of Maize Imported
Quantity (JOD)
Argentina 55,791,850 6,050,321
USA 353,478,710 38,592,216
Ukrane 18,297,480 1,964,752
India 45,724 10,756
Turkey 4,061,990 425,572
Egypt 317,800 51,418
Syria 174,695 35,705
Lebanon 1,500 1,025
Total 432,169,749 47,131,765
Year 2006
Country of
Origin
Quantity of Maize Imported
Kg /year
Price of Maize Imported
Quantity (JOD)
Argentina 58,255,160 6,376,077
Brazil 4,290,180 598,776
USA 375,484,119 40,945,462
Italy 43,000 8,315
Ukrane 16,499,733 1,520,307
Turkey 22,336,480 2,319,534
Egypt 102,500 23,057
Syria 197,750 40,893
Lebanon 2,834 1,894
Total 477,211,756 51,834,315
115
Year 2007
Country of
Origin
Quantity of Maize Imported
Kg /year
Price of Maize Imported
Quantity (JOD)
Lebanon 3,245 2,111
Egypt 136,600 30,622
Israel 558,660 143,993
USA 389,814,450 68,532,612
Brazil 21,558,315 3,493,270
Turkey 153,520 16,832
Syria 509,622 124,078
Argentina 27,324,390 4,403,361
Sudan 9,933,130 1,032,307
Total 449,991,932 77,779,186
Year 2008
Country of
Origin
Quantity of Maize Imported
Kg /year
Price of Maize Imported
Quantity (JOD)
Canda 9,284 4,441
Romania 11,984,100 3,088,993
Lebanon 5,940 5,962
Egypt 80,000 22,582
Israel 14,683,263 3,551,776
India 225,043,928 52,908,322
Croatia 6,134,290 1,132,470
United
Kingdom 3,581 8,871
Ukraine 4,157,860 1,071,889
Spain 7,600 14,567
Yugoslavia 16,263,420 4,193,008
USA 84,498,571 20,532,542
Bulgaria 7,554,940 1,947,870
Brazil 27,500,000 3,865,380
Syria 69,400 15,161
Argentina 66,125,976 14,693,336
Sudan 952,685 174,355
Hungary 11,997,410 2,862,883
Total 477,072,248 110,094,408
116
Year 2009
Country of
Origin
Quantity of Maize Imported
Kg /year
Price of Maize Imported
Quantity (JOD)
Uruguay 65,883,244 14,448,110
Paraguay 19,290,000 3,014,468
Hungary 2,305,180 594,305
Egypt 536,600 117,467
Argentina 65,883,244 14,448,110
Turkey 16,000 8,508
Bulgaria 20,598,330 5,310,265
USA 170,465,738 29,790,475
Spain 216,500 61,693
Ukraine 163,123,990 35,015,044
Moledooff 8,320,080 2,050,988
India 888,462 184,289
Israel 16,555,290 4,710,668
Romania 7,686,800 1,981,690
United Russia 30,126,915 7,880,637
Canada 18,946,928 4,899,147
Cuba 172,460 44,460
Total 591,015,761 124,560,324
Year 2009
Country of
Origin
Quantity of Maize Imported
Kg /year
Price of Maize Imported
Quantity (JOD)
Canada 13,293,320 3,695,970
United Russia 12,444,480 3,208,242
Romania 37,126,782 8,684,733
Egypt 361,303 85,154
Israel 25,540,215 7,208,848
India 594,292 151,478
Ethiopia 2,070,000 388,267
Ukraine 44,691,230 11,389,458
Spain 66,000 15,444
USA 177,826,962 38,570,755
Bulgaria 15,164,870 3,400,948
Brazil 15,830,910 3,406,000
Uruguay 26,238,654 4,172,424
Argentina 117,928,020 22,483,913
117
Paraguay 32,174,610 6,729,482
Muldoof 3,560,560 917,925
Total 524,912,208 114,509,041
Year 2010
Country of
Origin
Quantity of Maize Imported
Kg /year
Price of Maize Imported
Quantity (JOD)
Canada 13,293,320 3,695,970
United Russia 12,444,480 3,208,242
Romania 37,126,782 8,684,733
Egypt 361,303 85,154
Israel 25,540,215 7,208,848
India 594,292 151,478
Ethiopia 2,070,000 388,267
Ukraine 44,691,230 11,389,458
Spain 66,000 15,444
USA 177,826,962 38,570,755
Bulgaria 15,164,870 3,400,948
Brazil 15,830,910 3,406,000
Uruguay 26,238,654 4,172,424
Argentina 117,928,020 22,483,913
Paraguay 32,174,610 6,729,482
Muldoof 3,560,560 917,925
Total 524,912,208 114,509,041
123
Reference: PCR clean-up Gel extraction User Manual NucleoSpin®
Extract II, May 2010 / Rev. 10
Annex (4)
Sequencing results of the second band with 390bp length as
received from the company (A): Forward sequence result of the second band with 390
length of base pair
125
ANNEX (5)
(A): List of interviewee and visited organizations
The interviewees, organizations and institutions that were visited and the purpose of the
visit are shown in the following table.
List of interviewed organizations
Interviewee Organization Purpose of Visit
1. Dr. Hana Zakariya/
Poultry Nutrition
University of Jordan/ Department of
Agricultural
http://agriculture.ju.edu.jo/home.aspx
Collection of maize
samples, source: Jordan
Valley,
2. Mr. Kamal SARI/
Manager
DEBBANE/Agricultural CO.
http://www.debbanegroup.com/templates/c
ontrols/index.aspx
Structured interview to get
information on trade of
GM seeds in Jordan.
3. Zeena Al Ja‟ja‟/ Land
Scape Architect/Eco-
Management
The Arab Group of Protection of Nature
(APN)
Threats issues facing
farmers as a result of the
spread of GM seeds.
4. Mr. Hussain Shaheen,
Manaager of ……,
contact officer and
coordinator for biosafety
in Jordan
Ministry of Environment Review the current status
of Regulations and
Guidelines relevant to
GMOs in Jordan
126
Interviewee Organization Purpose of Visit
5. Razan Zuayter/ General
Manager
Arab Group for Protection of Nature
(APN)
Get some Information on
their latest activities and
past events related to the
controversy carried out on
GM food in Jordan as well
as in the Middle east.
6. El Hassan Science City
Employees
Royal Scientific Society (Top
Management, Business Park,
Environmental Research Center, Energy
Research Center)
Disseminate and complete
the survey‟s forms that
measures RSS employees
awareness on GM food,
7. Jordan University for
Science & Technology
“JUST” Students
Jordan University of Science &
Technology/
Disseminate and complete
the survey‟s forms that
measures students
awareness on GM food,
8. PSUT Students Princess Sumaya University for
Technology
Disseminate and complete
the survey‟s forms that
measures students
awareness on GM food,
9. University of Jordan
Students
University of Jordan/ Agricultural &
Biology Department
Disseminate and complete
the survey‟s forms that
measures students
awareness on GM food,
10. JAEC Employees Jordan Atomic Energy Commission Disseminate and complete
the survey that measures
JAEC employees
awareness on GM food,
11. Tafilla University
Students
Tafilla University Disseminate and complete
the survey that measures
students employees
awareness on GM food,
12. MoEnv Employees Ministry of Environment Disseminate and fill the
survey forms that measures
MoEnv employees
awareness on GM food,
13. Dr. Yousef Al
Tawalbeh/
Food & Drug Administration Disseminate and fill the
survey that measures
127
Interviewee Organization Purpose of Visit
employees‟ awareness on
GM food, and to together
information on GM food
latest legislation in Jordan.
14.Ms. Jehan Hadad, “IS”,
Mr. Ameen Abu Sabha “IT
Department”
Royal Scientific Society/ Industrial studies
Division & IT Department
Get familiar with the SPSS
Statistical Analysis
program & download it on
my Personal PC
16. Ms Batoul Obaid,
Director of Techniques
Statistical & Methodologies
Department of Statistics Get her recommendation
on which software to use
for the Survey Analysis
and she advised me to use
the latest version of SPSS “
17. Eng. Eyad Saleh, Eng.
Osama Al Subaihee
Animal Production Department Visited 3 times, to get
Maize used as feed
samples for GM detection,
18. Dr. Mohammad Al-
Khraisha” Director of food
Control
Jordan Food & Drug Administration FDA Get information on latest
regulation on GMOs.
19. Dr. Hind Al Hammouri,
PHD. In Mathematics/
Measurement & Evaluation
Hashemite University Discuss the Survey
structure & analysis using
SPSS
20. Dr. Suzan Al Dura &
Dr. Sobhia Saifan Plant
Genetic Resources&
Molecular Genetics
National Center for Agricultural Research
and Extension (NCARE)
Discuss ongoing research
on GMOs, and current
regulations, and the
possibility of training on
the Real Time PCR which
is still New to them,
21. Mr.
MohammadKatbeh,”phytos
anitary Measures”, Dr.
Raeda Al Awamleh
Ministry of Agricultur To acquire laws regulating
GM seeds or GM
vegetables if there was any,
22. Mr. Jerias Abu Gazalle الكىيست االوجيليت المعمداويت Get the church views of the
128
Interviewee Organization Purpose of Visit
“ Evangelic Baptist Church “ concept of GM food and
whether it is permitted or
banned according to
biblical teachings.
Annex (6)
(A): Cartagena Protocol on Bio-safety,
Ratification List
136
(B): Information on date of signature and the latest
communication of the Nagoya – Kuala Lumpur
Supplementary Protocol on Liability and Redress,
# Country Date of
signature
Date instrument of
rtf/acs deposited
Date of entry
into force
1 Antigua and Barbuda Aug 09, 2011
2 Austria May 11, 2011
3 Belgium Sep 20, 2011
4 Benin Oct 28, 2011
5 Brazil Mar 06, 2012
6 Bulgaria May 11, 2011
7 Cape Verde Sep 26, 2011
8 Central African Republic Mar 06, 2012
9 Chad Jan 31, 2012
10 Colombia Mar 07, 2011
11 Cyprus Dec 29, 2011
12 Czech Republic May 11, 2011
13 Denmark Mar 07, 2011
14 European Union May 11, 2011
15 Finland May 11, 2011
16 France May 11, 2011
17 Germany Sep 20, 2011
18 Guinea-Bissau Feb 01, 2012
19 Hungary May 11, 2011
20 India Oct 11, 2011
21 Ireland May 11, 2011
137
22 Italy Jun 14, 2011
23 Japan Mar 02, 2012
24 Latvia May 11, 2011 Nov 30, 2011 RTF
25 Lithuania May 11, 2011
26 Luxembourg May 11, 2011
27 Madagascar Sep 22, 2011
28 Mauritania May 18, 2011
29 Mexico Mar 05, 2012
30 Mongolia Jan 26, 2012
31 Montenegro May 11, 2011
32 Mozambique Sep 26, 2011
33 Netherlands Mar 07, 2011
34 Nigeria Feb 01, 2012
35 Panama May 03, 2011
36 Peru May 04, 2011
37 Poland Sep 20, 2011
38 Portugal Sep 20, 2011
39 Republic of Moldova Jan 25, 2012
40 Romania May 11, 2011
41 Senegal Jan 26, 2012
42 Slovakia Jan 20, 2012
43 Slovenia May 11, 2011
44 Spain Jul 21, 2011
45 Sweden Mar 07, 2011
46 Switzerland May 11, 2011
47 Thailand Mar 06, 2012
48 Togo Sep 27, 2011
49 Tunisia May 11, 2011
50 Ukraine Jan 30, 2012
138
51
United Kingdom of Great
Britain and Northern
Ireland
Feb 22, 2012
Source: http://bch.cbd.int/protocol/parties/#tab=1
ANNEX (7)
Survey Design & Results
(A): The Complete Survey on Genetically Modified Food in
English
Age: Gender:
Social Status: Educational Level:
Specialty: Job Description:
General Knowledge and Basics of biotechnology:
Q1. What do you think is the genetic material?
a) DNA
b) RNA
c) Protein
d) I don‟t know
Q2. What is the thing responsible for the genetic characteristics of any creature?
a) Genes
b) Cells
c) Enzymes
d) All the answers
e) None of the Above
Q3. What is the extent of your knowledge of the so-called genetic fingerprint?
a) Very good
b) I know a little about it
c) Only heard about it
d) I do not know anything about it
139
Q4. Do you know what gene therapy is?
a) I know very well
b) I have little information
c) I only heard about it
d) I have not heard about it before
Q5. Do you think that genetic engineering technology should be encouraged as a
means of for progress and development?
a) Yes I believe so strongly
b) No I do not think so
c) I have no idea
General Knowledge on Genetically Modified Food
Q6. Do you know what is genetically modified food or crops?
a) I know very well
b) I have little information
c) I only heard about it
d) I have not heard about this before
Q7. If the answer to the previous question is yes, what is the information you know
about this topic?
……………………………………………………………………………………………
……………………………………………………………………………………………
……………………………………....…..…………………..……………………………
…………………………………………………………………………….……...………
Q8. Do you think that there are ways to detect the genetically modified food and
crops?
a) Yes b) No c) I do not know
Q9. Do you think that genetically modified food or crops are:
a) Useful
b) Harmful
c) Neither useful nor harmful
d) I do not know
Q10. How safe or dangerous do you think the genetically modified food is?
a) Very dangerous
b) Very Safe
c) Neither dangerous nor safe
140
d) I don‟t know
Q11. Do you think that genetically modified food and feed is dangerous to:
a) Human health
b) Environment
c) Both of them
d) Is not dangerous at all
e) I don‟t know
Q12. Have you ever Purchased genetically modified food:
a) Yes
b) No
c) I don‟t know
Q13. How often do you look at the nutritional facts of food you purchase in terms of
genetically modified information?
a) Always
b) Sometimes
c) I never look
d) It‟s not important
Q14. Do you think that the role of media towards spreading awareness on this subject
is:
a) Effective and influential
b) Weak & limited
c) There is no role at all
Laws and Ethical standards related to Genetically Modified Food:
Q15. Do you think that genetic engineering with regard to the introduction of genes
from different organisms and injecting it into plants is religiously acceptable?
Yes, it‟s acceptable and nothing is wrong about it
it‟s not acceptable at all
it depends on the nature of the change and its causes
I have no idea
Q16. Do you think that genetic engineering with regard to the introduction of genes
from different organisms and injecting it into plants is morally acceptable?
Yes, it‟s acceptable and nothing is wrong about it
it‟s not acceptable at all
it depends on the nature of the change and its causes
I have no idea
Q17. Do you think that you may consume food if you know that it‟s genetically
modified?
Yes I will have it
No, I won‟t have it
I will try it
141
Q18. In your Opinion how important do you think is the Labeling of Genetically
Modified Food ?
Very Important
Not Important
Q19. Do you believe that the government shouldn‟t allow the entry of genetically
modified food and animal feed unless they are labeled and the percentage of
modification in them is known?
Yes, and it‟s of great importance
No, it‟s not importance
I have no idea
Q20. Do you think that the scientific research, laws and government systems have the
ability to track, examine, and impose control on the entry of Genetically
Modified Food and feed to the country?
Yes they have the capacity to do so
No they don‟t have the capacity to do so
I have no idea
Q21. Do you think that the government should take strict laws to prevent the entry of
genetically modified food and feed, before being tested and ensure quality?
Yes and this is of great importance
No, it is not important
I do not know
Q22. Do you think that the price of Genetically Modified food should be:
More expensive than the natural food
less than the natural food
Both at equal price
I do not know
Q23. are you willing to pay a higher amount in exchange for food that is not
genetically modified?
Yes
No
Q24. Do you think that genetic engineering help farmers to produce larger amounts of
crops more efficiently (i. e, less need for pesticides and fertilizers)?
Yes
No
I don‟t know
Q25. Do you think that genetically modified crops and foods is one of the important
solutions to meet the famines in the world?
142
Yes I believe this so strongly
No I don‟t think so at all
It may partially solve the problem
I do not know
143
Q26. Do you think that there are environmental risks ", for example pollution of
natural or organic crops resulting from planting and the spread of pollen of
genetically modified crops?
Yes I believe this
No I don‟t think so
I do not know
Q27. Do you think that genetically modified food that are sold for developing
countries is of lower quality than those sold in developed countries?
Yes, it is of lower quality
No it is of higher quality
both are of the same quality
I have no idea
Q28. Do you have any other comments or concerns?
144
(B): The complete Survey on Genetically Modified Food in Arabic
68 -58 57⃝-47 ⃝ 46-36 ⃝ 35-25 ⃝ 25-18 : لعمرا
: االختصبص⃝ متزوج ⃝ أعزب: اإلجتماعة الحالة ⃝أنثى ⃝ ذكر : الجنس
:العمل ووع⃝ علا دراسات ⃝ ماجستر ⃝ بكبلوريوس⃝ ثبووي :العلميت الدرجت
:الحوة التكنولوجا وأساسات العامة الثقافة
الوراثة؟ المادة ه ما برأك (1
DNA
RNA
بروتن
معروف غر
مخلوق؟ أي ف الجنة الخصائص عن المسؤول الشء هو ما (2
الجنات
الخالا
األنزمات
اإلجابات جمع
إجابة وال
الوراثة؟ بالبصمة سمى بما معرفتك مدى ه ما (3
جدا جدة
ما نوعا
فقط عنها سمعت
عنها شئا أعرف ال
الجن؟ العالج هو ما تعلم هل (4
جدا أعلم
قللة معلومات لدي
فقط عنها سمعت
قبل من بها أسمع لم
والتطور؟ للتقدم كوسلة الوراثة الهندسة تكنولوجا تشجع جب أنه باعتقادك هل (5
بشدة ذلك أعتقد نعم
ذلك أعتقد ال
145
فكرة لدي لس
:وراثا المعدلة األغذة عن العامة الثقافة
وراثا؟ المعدلة المحاصل أو األغذة ه ما تعلم هل (6
جدا أعلم
قللة معلومات لدي
فقط عنها سمعت
قبل من بها أسمع لم
الموضوع؟ هذا عن تعرفها الت المعلومات ه فما بنعم السابق السؤال على اإلجابة كانت إذا (7
……………………………………………………………………………………………
…………………………………....…..…………………..………………………………
……………………………………………………………………………………………
وراثا؟ المعدلة المحاصل و األغذة لفحص طرق هناك أن تعتقد هل (8
نعم
ال
أعرف ال
: ه وراثا المعدلة المحاصل أو األغذة أن تعتقد هل (9
نافعة
ضارة
ضارة وغر نافعة غر
أعرف ال
وراثا؟ المعدل الطعام خطورة أو سالمة مدى ماه (10
جدا خطر
جدا آمن
٢ أو ١ال
الأعرف
:على خطرا تشكل وراثا المعدلة المحاصل أو األعالف األغذة، بأن تعتقد هل (11
اإلنسان صحة
البئة
معا كالهما
ضرر أي لها لس
أعرف ال
146
؟ وراثا معدلة محاصل أو أطعمة اشترت أن لك سبق هل (12
نعم
ال
أعرف ال
معدلة كونها حث من شرائها قبل األطعمة محتوات إلى فها تنظر الت المرات عدد هو ما (13
وراثا؟
دائما
أحانا
أبدا أنظر ال
لذلك أهمة ال
:هو الحال الوقت ف الموضوع هذا عن التوعة نشر ف اإلعالم دور أن تعتقد هل (14
ومؤثر فعال
ومحدود ضعف
اإلطالق على له دور ال
:وراثا المعدلة باألغذة المتعلقة األخالقة والمعار القوانن النباتات ف وحقنها مختلفة كائنات من جنات بإدخال ختص بما الوراثة الهندسة بأن تعتقد هل (15
؟ دنا مقبول أمر هو
شء فه ولس مقبول نعم
أبدا مقبول غر
أسبابه و الحاصل التغر طبعة على عتمد
فكرة لدي لس
النباتات ف وحقنها مختلفة كائنات من جنات بإدخال ختص بما الوراثة الهندسة بأن تعتقد هل (16
أخالقا؟ مقبول أمر هو
شء فه ولس مقبول نعم
أبدا مقبول غر
أسبابه و الحاصل التغر طبعة على عتمد
فكرة لدي لس
وراثا ؟ معدل بأنه علمت إذا طعاما تستهلك قد بأنك تعتقد هل (17
سأتناوله نعم
أتناوله لن ال
سأجربه
147
المعدل وراثا؟ الغذاء عنونة أهمة مدى هو ما باعتقادك (18
جدا مهم
غرمهم
ما نوعا
إذا إال وراثا المعدلة األعالف أو األغذة بإدخال السماح عدم الحكومة على بأنه تعتقد هل (19
فها؟ لتعدل المئوة النسبة ومذكور كذلك بأنها معنونة كانت
كبرة أهمة ولذلك نعم
أهمة أة لذلك لس ال
فكرة لدي لس
وفرض فحص، تتبع، على القدرة الحكومة واألنظمة والقوانن العلم للبحث أن تعتقد هل (20
البلد؟ إلى المعدلة واألعالف األغذة دخول على رقابة
ذلك على القدرة لدها نعم
القدرة لدها لس ال
فكرة لدي لس
المعدلة األعالف و األغذة دخول تمنع صارمة قوانن اتخاذ الحكومة على بأن تعتقد هل (21
جودتها؟ من التأكد و فحصها تم أن قبل وراثا
كبرة أهمة لذلك نعم
أهمة لذلك لس ال
أعرف ال
:واألعالف األغذة
:تكون أن وراثا جب المعدل الطعام أسعار بأن تعتقد هل (22
الطعام الطبع من أغلى
الطبع الطعام من أقل
بالسعر متساوة
أعرف ال
وراثا؟ معدل غر طعام على الحصول مقابل أعلى مبلغ دفع على استعداد على أنت هل (23
نعم
ال
148
أي ) أعلى بكفاءة أكبر محاصل كمات بإنتاج المزارعن تفد الوراثة الهندسة بأن تعتقد هل (24
؟(األسمدة و للمبدات الحاجة تقل
نعم
ال
أعرف ال
ف المجاعات لسد المهمة الحلول أحد تشكل وراثا المعدلة واألطعمة المحاصل أن تعتقد هل (25
العالم؟
بشدة ذلك أعتقد نعم
أبدا ذلك أعتقد ال
جزئا المشكلة تحل قد ربما
أعرف ال
المعدلة بتلك العضوة أو الطبعة المحاصل تلوث مثال " بئة مخاطر هناك أن تعتقد هل (26
وراثا؟ المعدلة األعالف و المحاصل زراعة انتشار عن ناجمة " وراثا
ذلك أعتقد نعم
ذلك أعتقد ال
أعرف ال
تلك من جودة أقل ه النامة الدول ف المباعة وراثا المعدلة واألعالف األغذة أن تعتقد هل (27
؟ المتقدمة الدول ف المباعة
جودة أقل ه نعم
أعلى جودة ذات ه ال
الجودة بنفس كالهما
فكرة لدي لس
؟هل لدك أي مالحظات أخرى (28
……………………………………………………………………………………………
…………………………………....…..…………………..………………………………
……………………………………………………………………………………………
149
(C): Official Response of Department of Statistics on the methodology
of Survey Dissemination
From: Ghaida Khasawneh <[email protected]> To: "[email protected]" <[email protected]> Cc: Batoul Obaid <[email protected]> Sent: Tuesday, July 12, 2011 3:54 PM Subject: sample survey
االخت نوار المحترمة
تحة طبة
اشر الى الرسالة االلكترونة المرسلة من قبلك الى دائرة اإلحصاءات العامة حول المساعدة ف اختار عنة
لرسالة الماجستر الخاصة بك،
فرد من طالب الجامعات وموظف الجامعات والدوائر 400 وبعد مراجعة المرفقات فمكن اختار عنة حجمها
ومختلف ( سنة18الت تزد عن )الحكومة ف مدنة عمان، مع مراعاة توزع هذه العنة على مختلف االعمار
.حتى نضمن توزع العنة بشكل جد (من مستوى ثانوي فأعلى)المستوات التعلمة
مع االحترام
غداء خصاونة
رئس قسم العنات
150
(D):
Survey Results 1) Demographics
Gender %
Male 48.58
Female 51.42
Marital Status
Married 25.86
Single 74.14
Age
18- 25 63.7
151
25- 35 28.8
36-46 4.7
47-57 2.6
58 - 68 .3
Education
High School 1.58
Bachelor 82.36
Master 13.94
Higher Studies 2.12
152
Socio-demographic characteristics of participants
Percentages of Participants Age Categories
Age Category Frequency
(Number) Percent Valid Percent
Valid 18 - 25 219 54.8 63.7
25 -35 99 24.8 28.8
36 - 46 16 4.0 4.7
47 - 57 9 2.3 2.6
58 - 68 1 .3 .3
Total 344 86.0 100.0
Missing System (i.e
number of people
who didn‟t answer
this question)
56 14.0
Total 400 100.0
Percentages of Participants Gender
Percentages of Participants Martial Status
Marital Status Frequency Percent Valid Percent
Valid Single 281 70.3 74.14
Married 98 24.5 25.86
Missing 21 5.2
Total 400 100.0 100.0
Percentages of Participants different educational Level
Educational Level Frequency Percent Valid Percent
Valid High School 6 1.5 1.578
Bsc 313 78.3 82.36
Master 53 13.3 13.94
Higher Studies 8 2.0 2.12
Missing 20 4.9
Total 400 100.0 100.0
Gender Frequency Percent Valid Percent
Valid Male 188 47.0 48.58
Female 199 49.8 51.42
Missing System 13 3.2
Total 400 100.0 100.0
153
University Specialty Frequency Percent Valid Percent
Valid S Environmental Engineering 3 .8 .8
S Water & Environment 1 .3 .3
S Engineer 17 4.3 4.3
S Chemistry 34 8.5 8.5
S Chemical Engineering 21 5.3 5.3
Business Administration 11 2.8 2.8
S Computer information System 9 2.3 2.3
S Acounting 3 .8 .8
S Law 4 1.0 1.0
pharmacy 1 .3 .3
Management 4 1.0 1.0
Media 1 .3 .3
Financial Management 2 .5 .5
Business & Finance 2 .5 .5
S Mechatronics Engineering 1 .3 .3
Agricultural Engineering 2 .5 .5
Libraries 3 .8 .8
S physics 15 3.8 3.8
S Computer Engineering 7 1.8 1.8
S Biology 4 1.0 1.0
S Engineering Management 1 .3 .3
S Veterinarian 3 .8 .8
S nutrition 72 18.0 18.0
Agricultural Engineer 1 .3 .3
Animal Production 1 .3 .3
S Electrical engineering 7 1.8 1.8
S Soil & Irrigation 3 .8 .8
S Plant Production 5 1.3 1.3
S Medical Labs 16 4.0 4.0
S Biomedical Engineer 2 .5 .5
S Industrial Engineer 1 .3 .3
E Political Science 1 .3 .3
S Aviation Engineering 1 .3 .3
S Genetic Engineering 1 .3 .3
S Computer Science 8 2.0 2.0
E Applied English 1 .3 .3
S Networks Engineer 11 2.8 2.8
S Electrical Engineer 4 1.0 1.0
154
S Nursing 3 .8 .8
University Specialty Frequency Percent Valid Percent
S Science 4 1.0 1.0
S Food Science & Technology 1 .3 .3
S Agriculture 7 1.8 1.8
E Economics 5 1.3 1.3
S Mathematics 2 .5 .5
S software Engineering 9 2.3 2.3
Management Information System 1 .3 .3
Animation 1 .3 .3
Logistics 1 .3 .3
Arcitecture 3 .8 .8
Geology 1 .3 .3
Arabic Language 1 .3 .3
Child Education 1 .3 .3
S Nuclear Engineering 2 .5 .5
S Mechanical Engineering 13 3.3 3.3
E Environmental Science 1 .3 .3
Civil Engineering 5 1.3 1.3
Social Science
Missing
1
54
.3
13.5
.3
13.5
Total 400 100.0 100.0
2) General Knowledge and Basics of Biotechnology:
Q1. What do you think the genetic material is? Q2. What is the thing responsible for the
genetic characteristics?
Answers Frequency Percent Valid
Percent
valid DNA 379 94.8 96.2
RNA 3 .3 .76
Protein 5 .8 1.3
I don‟t
know
7
1.3 1.8
Missing
System
6 1.5
Total 400 100.0 100.0
Answers Frequency Percent Valid
Percent
Valid Genes 350 87.5 87.5
Cells 11 2.8 2.8
Enzymes 2 .5 .5
All the
answers
30 7.5 7.5
None of
the Above
7 1.8 1.8
Total 400 100.0 100.0
155
Q3. What is the extent of your knowledge of the
So-called Genetic fingerprint?
Q.4 Do you know what gene therapy is?
Q5. Do you think that GE technology should be encouraged as a means of
progress and development?
Answers Frequency Percent Valid Percent
Valid Yes I believe so strongly 285 71.3 71.6
No I do not think so 77 19.3 19.3
I have no idea 36 9.0 9.0
Total 398 99.5 100.0
Missing System 2 .5
Answers Frequency Percent Valid
Percent
Valid very good 95 23.8 23.8
I know a little
about it
171 42.8 42.9
only heard
about it
108 27.0 27.1
I do not know
anything about it
25 6.3 6.3
Total 399 99.8 100.0
Missing System 1 .3
Total 400 100.0
Answers Frequency Percent Valid
Percent
Valid I know very well 50 12.5 12.7
I have little
information
197 49.3 49.9
I only heard
about it
100 25.0 25.3
I have not heard
about this
before
48 12.0 12.2
Total 395 98.8 100.0
Missing System 5 1.3
Total 400 100.0
156
(Summary)
Category 2: General Knowledge and Basics of Biotechnology Participants
Responses %
Q1. What do you think is the genetic material?
DNA 96.2
RNA .76
Protein 1.3
I don‟t know 1.8
Q2. What is responsible for the genetic characteristics?
Genes 87.5
Cells 2.8
Enzymes .5
All the answers 7.5
None of the Above 1.8
Q3. What is the extent of your knowledge of the so-called
genetic fingerprint?
very good 23.8
I know a little about it 42.9
only heard about it 27.1
I do not know anything about it 6.3
Q4. Do you know what gene Therapy is?
I know very well 12.7
I have little information 49.9
I only heard about it 25.3
I have not heard about it before 12.2
Q5. Do you think that genetic Engineering technology should be
encouraged as a means of for progress and development?
Yes I believe so strongly 71.6
157
No I do not think so 19.3
I have no idea 9.0
3) General Knowledge on Genetically Modified Food
Q.6 Do you know what is genetically modified food or crops?
Q.8 Do you think that there are ways to detect the genetically modified food and crops?
Q.9 Do you think that genetically modified food or crops are:
Answers Frequency Percent Valid Percent
Valid I know very well 73 18.3 18.3
I have little
information
221 55.3 55.3
I only heard about it 85 21.3 21.3
I have not heard
about this before
21 5.3 5.3
Total 400 100.0 100.0
Answers Frequency Percent Valid Percent
Valid Yes 255 63.8 64.4
No 17 4.3 4.3
I do not know 124 31.0 31.3
Total 396 99.0 100.0
Missing System 4 1.0
Total 400 100.0
Answers Frequency Percent Valid Percent
Valid Useful 127 31.8 32.6
Harmful 131 32.8 33.7
Neither useful
nor Harmful
50 12.5 12.9
I do not know 81 20.3 20.8
Total 389 97.3 100.0
Missing System 11 2.8
Total 400 100.0
158
Q.10 How safe or Dangerous do you think the genetically modified food is?
Q.11 Do you think that genetically modified food and feed is dangerous to:
Q 12 .Have you ever Purchased genetically modified food:
Answers Frequency Percent Valid Percent
Valid Yes 92 23.0 23.4
No 148 37.0 37.6
I don’t Know 154 38.5 39.1
Total 394 98.5 100.0
Frequency Percent Valid Percent
Valid Very dangerous 67 16.8 17.0
Very Safe 24 6.0 6.1
Neither
Dangerous nor
safe
119 29.8 30.3
I don’t know 183 45.8 46.6
Total 393 98.3 100.0
Missing System 7 1.8
Total 400 100.0
Answers Frequency Percent Valid Percent
Valid Human Health 42 10.5 10.6
Environment 24 6.0 6.1
Both of them 171 42.8 43.3
Is not dangerous
at all
44 11.0 11.1
I don’t know 114 28.5 28.9
Total 395 98.8 100.0
Missing System 5 1.3
Total 400 100.0
159
Missing System 6 1.5
Total 400 100.0
Q.13 How often do you look at the nutritional facts of food you purchase in terms of
genetically modified information?
Q.14 Do you think that the role of media towards spreading awareness on this subject is:
Answers Frequency Percent Valid Percent
Valid Always 73 18.3 18.5
Sometimes 211 52.8 53.4
I Never Look 92 23.0 23.3
Its Not Important 19 4.8 4.8
Total 395 98.8 100.0
Missing System 5 1.3
Total 400 100.0
Answers Frequency Percent Valid Percent
Valid Effective and
influential
108 27.0 27.3
Weak & Limited 204 51.0 51.6
There is no role at
all
83 20.8 21.0
Total 395 98.8 100.0
Missing System 5 1.3
Total 400 100.0
160
Category 3: General Knowledge on Genetically Modified Food Participants
Responses %
Q1. Do you know what is genetically modified food or crops?
I know very well 18.3
I have little information 55.3
I only heard about it 21.3
I have not heard about this before 5.3
If the answer to the previous question is yes, what is the information you know about
this topic?
Q2. Do you think that there are ways to detect the genetically modified food and crops?
Yes 64.4
No 4.3
I do not know 31.3
Q3. Do you think that genetically modified food or crops are useful or harmful?
Useful 32.6
Harmful 33.7
Neither useful nor Harmful 12.9
I do not know 20.8
Q4. How safe or Dangerous do you think the genetically modified food is?
Very dangerous 17.0
Very Safe 6.1
Neither Dangerous nor safe 30.3
162
Continue….Category 3: General Knowledge on Genetically
Modified Food
Participants
Responses %
Q5. Do you think that genetically modified food and feed is dangerous to health
and environment? Human Health 10.6
Environment 6.1
Both of them 43.3
Is not dangerous at all 11.1
I don‟t know 28.9
Q6. Have you ever Purchased genetically modified food?
Yes 23.4
No 37.6
I don‟t Know 39.1
Q7. How often do you look at the nutritional facts of food you purchase in terms of
genetically modified information?
Always 18.5
Sometimes 53.4
I Never Look 23.3
It is Not Important 4.8
Q8. Do you think that the role of media towards spreading awareness on this subject is
effective or not?
Effective and influential 27.3
Weak & Limited 51.6
There is no role at all 21.0
163
4) Laws and Ethical standards related to Genetically Modified Food:
Q.15 Do you think that genetic engineering with regard to the introduction of genes
from different organisms and injecting it into plants is religiously acceptable?
Q.16 Do you think that genetic engineering with regard to the introduction of genes
from different organisms and injecting it into plants is morally acceptable?
Answers Frequency Percent Valid Percent
Valid Yes, it’s acceptable and
nothing is wrong about it
75 18.8 19.3
it’s not acceptable at all 73 18.3 18.8
it depends on the nature of
the change and its causes
187 46.8 48.1
I have no idea 54 13.5 13.9
Total 389 97.3 100.0
Missing System 11 2.8
Total 400 100.0
Answers Frequency Percent Valid Percent
Valid Yes, it’s acceptable and
nothing is wrong about it
49 12.3 12.6
it’s not acceptable at all 59 14.8 15.1
it depends on the nature of
the change and its causes
175 43.8 44.9
I have no idea 107 26.8 27.4
Total 390 97.5 100.0
Missing System 10 2.5
Total 400 100.0
164
Q. 17 Do you think that you may consume food if you know that it‟s genetically
modified?
Answers Frequency Percent Valid Percent
Valid Yes I will have it 62 15.5 15.8
No, I won’t have it 163 40.8 41.6
I will try it 167 41.8 42.6
Total 392 98.0 100.0
Missing System 8 2.0
Total 400 100.0
Q.18 In your Opinion how important do you think is the Labeling of Genetically
Modified Food?
Answers Frequency Percent Valid Percent
Valid Very Important 302 75.5 77.8
Not Important 28 7.0 7.2
kind of 58 14.5 14.9
Total 388 97.0 100.0
Missing System 12 3.0
Total 400 100.0
Q.19 Do you believe that the government shouldn‟t allow the entry of genetically
modified food and animal feed unless they are labeled and the percentage of
modification in them is known?
Answers Frequency Percent Valid Percent
Valid Yes, and it’s of great
importance
314 78.5 80.1
No, it’s not importance 35 8.8 8.9
I have no idea 43 10.8 11.0
Total 392 98.0 100.0
Missing System 8 2.0
Total 400 100.0
165
Q.20 Do you think that the scientific research, laws and government systems have the
ability to track, examines, and imposes control on the entry of Genetically Modified
Food and feed to the country?
Answers Frequency Percent Valid Percent
Valid Yes they have the capacity
to do so
269 67.3 68.8
No they don’t have the
capacity to do so
65 16.3 16.6
I have no idea 57 14.3 14.6
Total 391 97.8 100.0
Missing System 9 2.3
Q.21 Do you think that the government should take strict laws to prevent the entry of
genetically modified food and feed, before being tested and ensure quality?
Answers Frequency Percent Valid Percent
Valid Yes and this is of great
importance
316 79.0 80.8
No, it is not important 32 8.0 8.2
I do not know 43 10.8 11.0
Total 391 97.8 100.0
Missing System 9 2.3
Total 400 100.0
166
Summary
Category 4: Laws and Ethical standards related to Genetically
Modified Food:
Participants Responses
%
Q1. Do you think that genetic engineering is religiously acceptable?
Yes, it‟s acceptable and nothing is wrong about it 12.6
it‟s not acceptable at all 15.1
it depends on the nature of the change and its causes 44.9
I have no idea 27.4
Q2. Do you think that genetic engineering is morally acceptable?
Yes, it‟s acceptable and nothing is wrong about it 19.3
it‟s not acceptable at all 18.8
it depends on the nature of the change and its causes 48.1
I have no idea 13.9
Q3. Do you think that you may consume food if you know that it‟s genetically modified?
Yes I will have it 15.8
No, I won‟t have it 41.6
I will try it 42.6
Q4. In your Opinion how important do you think is the Labeling of Genetically Modified
Food?
Very Important 77.8
Not Important 7.2
kind of 14.9
Q5. Do you believe that the government shouldn‟t allow the entry of genetically
modified products unless they are labeled?
Yes, and it‟s of great importance 80.1
167
No, it‟s not importance 8.9
I have no idea 11.0
Continue…Category 4: Laws and Ethical standards related to
Genetically Modified Food:
Participants
Responses
%
Q6. Do you think that the scientific research, laws and government
systems have the ability to track, examine, and impose control on the
entry of Genetically Modified Food and feed to the country?
Yes they have the capacity to do so 68.8
No they don‟t have the capacity to do so 16.6
I have no idea 14.6
Q7. Do you think that the government should take strict laws to prevent
the entry of genetically modified food and feed, before being tested
and ensure quality?
Yes and this is of great importance 80.8
No, it is not important 8.2
I do not know 11.0
5) Food & Feed
Q.22 Do you think that the price of Genetically Modified food should be:
Answers Frequency Percent Valid Percent
Valid More expensive than the
natural food
72 18.0 18.3
less than the natural food 151 37.8 38.3
Both at equal price 83 20.8 21.1
I do not know 88 22.0 22.3
Total 394 98.5 100.0
Missing System 6 1.5
Total 400 100.0
168
Q23. Are you willing to pay a higher amount in exchange for food that is not genetically
modified?
Answers Frequency Percent Valid Percent
Valid Yes 241 60.3 61.8
No 149 37.3 38.2
Total 390 97.5 100.0
Missing System 10 2.5
Total 400 100.0
Q24. Do you think that genetic engineering help farmers to produce larger amounts of
crops more efficiently (i. e, less need for pesticides and fertilizers)?
Answers Frequency Percent Valid Percent
Valid Yes 268 67.0 69.1
No 48 12.0 12.4
I don’t
know
72 18.0 18.6
Total 388 97.0 100.0
Missing System 12 3.0
Total 400 100.0
Q.25 Do you think that genetically modified crops and foods is one of the important
solutions to meet the famines in the world?
Answers Frequency Percent Valid Percent
Valid Yes I believe this so strongly 124 31.0 31.5
No I don’t think so at all 74 18.5 18.8
It may partially solve the
problem
167 41.8 42.4
I do not know 29 7.3 7.4
Total 394 98.5 100.0
Missing System 6 1.5
Total 400 100.0
169
Q26. Do you think that there are environmental risks ", for example pollution of natural
or organic crops resulting from planting and the spread of pollen of genetically modified
crops?
Answers Frequency Percent Valid Percent
Valid Yes I believe this 182 45.5 46.2
No I don’t think so 91 22.8 23.1
I do not know 121 30.3 30.7
Total 394 98.5 100.0
Missing System 6 1.5
Total 400 100.0
Q.27 Do you think that genetically modified food that are sold for developing countries
is of lower quality than those sold in developed countries?
Answers Frequency Percent Valid Percent
Valid Yes, it is of lower quality 207 51.8 52.9
No it is of higher quality 25 6.3 6.4
both are of the same quality 26 6.5 6.6
I have no idea 133 33.3 34.0
Total 391 97.8 100.0
Missing System 9 2.3
Total 400 100.0
170
Summary
Category 5: Economical & Environmental Awareness of participants in GM Food &
feed
Q1. Do you think that the price of Genetically Modified food
should be:
More expensive than the natural food 18.3
less than the natural food 38.3
Both at equal price 21.1
I do not know 22.3
Q2. Are you willing to pay a higher amount in exchange for food that is not genetically
modified? Yes 61.8
No 38.2
Q3. Do you think that genetic engineering help farmers to
produce larger amounts of crops more efficiently (i. e, less
need for pesticides and fertilizers)?
Yes 69.1
No 12.4 I don‟t know 18.6
Continue….Category 5: Economical & Environmental
Awareness of participants in GM Food & feed
Q4. Do you think that genetically modified crops and foods is
one of the important solutions to meet the famines in the
world?
Yes I believe this so strongly 31.5
No I don‟t think so at all 18.8
It may partially solve the problem 42.4 I do not know 7.4
Q5. Do you think that there are environmental risks ", for
example pollution of natural or organic crops resulting
from planting and the spread of pollen of genetically
modified crops?
Yes I believe this 46.2 No I don‟t think so
I do not know 23.1
30.7
Q6. Do you think that genetically modified food that are sold
for developing countries is of lower quality than those sold
in developed countries?
171
Yes, it is of lower quality 52.9
No it is of higher quality 6.4 both are of the same quality 6.6 I have no idea 34.0
ANNEX( 8)
(A): Jordan By-Law for Bio-safety of Genetically Modified
Organisms
تعليمبث السالمت االحيبئيت للكبئىبث الحيت المحورة وراثيب الىبتجت عه
2006التقىيبث الحيويت الحديثت لسىت
1/10/2006 بتبريخ 4785 مه الجريدة الرسميت رقم 3832المىشور على الصفحت
2003 لسىت 1 مه قبوون حمبيت البيئت رقم 6 مه المبدة 1صبدر بموجب الفقرة
1المبدة
رؼ١بد اغالخ االؽ١بئ١خ ىبئبد اؾ١خ اؾسح ساص١ب زغبرب ابرغخ )رغ ز ازؼ١بد
. ، ٠ؼ ثب اػزجبسا ربس٠خ ششب ف اغش٠ذح اشع١خ (ػ ازم١بد اؾ٠١خ اؾذ٠ضخ
2المبدة
: ازؼش٠فبد
٠ى ىبد اؼجبساد ازب١خ ؽ١ضب سدد ف ز ازؼ١بد اؼب اخظظخ ب ادب ب
: رذي امش٠خ ػ غ١ش ره
.صاسح اج١ئخ : اصاسح
. ص٠ش اج١ئخ : اص٠ش
. ا١ ػب اصاسح : اال١ اؼب
172
. اغخ اؽ١خ غالخ االؽ١بئ١خ اشىخ فمب الؽىب ز ازؼ١بد : اغخ
. ام امظد ػجش اؾذد ا االسد : االعز١شاد
ا شخض اػزجبس ا ؽج١ؼ ٠م ثبعز١شاد اىبئ اؾ اؾس ساص١ب ا : اغزسد
. زغبر
. ام امظد ػجش اؾذد االسد : ازظذ٠ش
ا شخض اػزجبس ا ؽج١ؼ ٠م ثزظذ٠ش اىبئ اؾ اؾس ساص١ب ا : اظذس
. زغبر
ازجب٠ اساص ث١ اىبئبد اؾ١خ ث١ االاع ف١ب ث١ب اظزب : ازع اؾ١
. اج١ئ١خ
ا وبئ ث١ع لبدس ػ م ا ؼبػفخ ابدح اغ١١خ ، ثب ف ره اىبئبد : اىبئ اؾ
. اؼم١خ اف١شعبد اشجب اف١شعبد
. ادخبي اىبئبد اؾسح ساص١ب العاق ا ؾمي ازغبسة ف االسد : اطشػ
ا ػ١خ رز داخ شفك ا شؤ ا اث١خ بد٠خ اخش رشز ػ ا : االعزخذا اؼضي
وبئبد ؽ١خ ؾسح خبػؼخ زذاث١ش ؾذدح رؾذ ثظسح فؼبخ رالغب غ اج١ئخ
. اخبسع١خ ، رؾذ رؤص١شب ػ ره اج١ئخ
ازطج١مبد ازم١خ از ٠ز ثب اعزخذا رمببد االؽبع ا٠خ داخ : ازم١بد اؾ٠١خ اؾذ٠ضخ
االبث١ت ثب ف ره اؾم اجبشش اد داخ اخال٠ب اؼؼ١بد ا دظ اخال٠ب
ا ا رظجؼ خبسط فئزب ازظ١ف١خ ثؾ١ش رزغت ػ ؽاعض ازىبصش افغ١ع
. اطج١ؼ١خ ا اػبدح االئزالف
. اىبئبد ابرغخ اعزؼبي ازم١بد اؾ٠١خ اؾذ٠ضخ: االؽ١بء اؾسح ساص١ب ا
اىبئبد اؾسح ساص١ب
. ازغبد از رؾز ػ وبئبد ؾسح ١زخ ا ؽ١خ : زغبد اىبئبد اؾسح ساص١ب
اغد اجزخ الصاخ ا رم١ اخبؽش اؾزخ ابرغخ ػ ازمببد اؾ٠١خ : اغالخ االؽ١بئ١خ
. اؾذ٠ضخ زغبرب
رم١١ ذ رؤص١ش ا خطش اىبئبد اؼذخ ساص١ب ػ ازع اؾ١ اظؾخ : سرم١١ اخبؽ
. اج١ئخ وزه ااؽ االعزبػ١خ االلزظبد٠خ ام١ االخالل١خ
اؼ١خ از ٠ز ثب ازؼشف ػ اخبؽش ارخبر اعشاءاد ٠ز رطج١مب زم١ : اداسح اخبؽش
. اىب١خ ؽذس اخطش ا ذ ؼمي مجي
173
3المبدة
٠غش رطج١ك ز ازؼ١بد ػ ام ػجش اؾذد رذاي اعزخذا ع١غ اىبئبد اؾ١خ .أ
اؾسح ساص١ب زغبرب از لذ رط ػ آصبس ػبسح ثظ اعزذاخ اعزخذا ازع
. اؾ١ ، غ شاػبح اخبؽش ػ طؾخ االغب
: ال ٠غش رطج١ك ز ازؼ١بد ػ .ة
. ااد اظ١ذال١خ الغب .1
. (ازشاض٠ذ)اؼبثشح .2
. اعخ العزخذا اؼضي .3
. ا٠خ رظ١فبد اخش ٠ز اعزضبئب لج اغخ .4
4المبدة
: االذاف
: رذف ز ازؼ١بد ا
اغبخ ف ػب غز الئ اؾب٠خ ف غبي اب م ، بخ اعزخذا .1
. اىبئبد اؾ١خ ابشئخ ػ ازم١بد االؽ١بئ١خ اؾذ٠ضخ
.ازؤوذ اصاخ ا رخف١ف اخبؽش اؾزخ ابرغخ ػ ازىع١ب االؽ١بئ١خ زغبرب .2
. ص٠بدح غز ؽب٠خ اظؾخ اجشش٠خ اج١ئخ ف االسد .3
5المبدة
: اغخ اؽ١خ غالخ االؽ١بئ١خ
رشى اغخ ثشئبعخ اص٠ش ثؾ١ش رؼ خزظ١ ف غبالد خزفخ ف غبي ازمببد . أ
: اغالخ االؽ١بئ١خ ض١ ػ
. صاسح اج١ئخ .1
. صاسح اضساػخ .2
. اشوض اؽ جؾس اضساػ١خ م ازىع١ب .3
174
. اؤعغخ اؼبخ غزاء اذاء/ صاسح اظؾخ .4
. اغؼ١خ اؼ١خ اى١خ .5
. اغؼ١خ اؽ١خ ؾب٠خ اغزه .6
. ؤعغخ ااطفبد امب١٠ظ .7
. االرؾبد اؼب ضاسػ١ .8
. مبثخ رغبس ااد اغزائ١خ .9
. عبؼزب سع١زب ذ٠ب رغ١الد رمذبب ف غبي ازم١بد اؾ٠١خ اؾذ٠ضخ .10
ػذ ازبء اذح ٠م اص٠ش ، ٠ؼ١ب ذح عز١ فمؾ (10)اؼؼا اشبس ا١ب ف اجذ
. ثبعزجذاب ثآخش٠ ٠وال ثفظ اب
. ٠ؾك ص٠ش اػبفخ ا عخ ٠شاب بعجخ شبسوخ ثبػبي اغخ
تكون الوزارة ه نقطة االتصال الوطنة للسالمة االحائة ، وعمل مندوب الوزارة ف . ب
وقوم امن السر بدورة بتزود غرفة تبادل معلومات السالمة االحائة . اللجنة كامن سر لها
ف اتفاقة التنوع الحوي بجمع ما تم من قرارات على مستوى التشرعات والخبراء
. واالستراد والتصدر للكائنات الحة المحورة وراثا ومشتقاتها
تجتمع اللجنة مرة كل ثالثة اشهر وكلما دعت الحاجة لذلك وعتبر االجتماع قانونا بحضور .ج
. ثلث االعضاء وتصدر قراراتها بأغلبة اعضائها
. تشكل اللجان االستشارة الفنة من قبل الوزر وبتنسب من اللجنة كلما دعت الحاجة لذلك .د
ف حال اكتمال النصاب القانون للجنة فان اي قرار صدر عنها عتبر نافذا ولو تغب بعض .هـ
. االعضاء
6المبدة
: ب غؤ١بد اغخ اؽ١خ غالخ االؽ١بئ١خ
زؾم١ك االذاف اخبطخ ثز ازؼ١بد رم اغخ اؽ١خ غالخ االؽ١بئ١خ ثبزغ١ك ازؼب
: غ اغطبد راد اؼاللخ زف١ز اب اغؤ١بد ازب١خ
175
ػغ اغ١بعبد اؽ١خ رؾذ٠ذ االعشاءاد از رؾى اغالخ االؽ١بئ١خ ىبئبد اؾ١خ .أ
اؾسح ساص١ب ف اىخ خالي شش االسشبداد ابعجخ الرجبػب ػ اغز اؽ
رمذ٠ اشسح اف١خ غبد اؼ١خ اؼبذ اغئخ ػ رط٠ش رم١بد اغالخ االؽ١بئ١خ
. ف اىخ
رم١١ افائذ اشعح اخبؽش اىبخ رؤص١ش اعزخذا اىبئبد اؾسح ساص١ب ػ .ة
االغب اؾ١ا اجبد اعشاء شاعؼخ دس٠خ مب١٠ظ االب ازجؼخ ره زؤوذ ارجبع
. اسشبداد االب اىبف١خ
ثبء لذساد اغبد اؾى١خ اؤعغبد االوبد١٠خ اال١خ اؼ١خ ثزط٠ش ازم١بد اؾ٠١خ . ط
. ف االسد ػ اؽىب ز ازؼ١بد
ازغ١ك رغ١ االرظبي غ اظبد اذ١خ اؾ١خ رؾذ٠ش اؼبد اف١خ اؼ١خ .د
. اج١ئ١خ ازشش٠ؼ١خ غ زبثؼخ ازغ١شاد از لذ رطشأ ػ اغز١٠ اؾ اذ
رمذ٠ رمش٠ش ع ١ئبد اؾى١خ ٠زؼ ع١غ االشطخ از رخض ؽم اغالخ االؽ١بئ١خ .ـ
. ػ اغز اؾ
رشى١ غب خزفخ ف ؽم اغالخ االؽ١بئ١خ ف اؼبذ اخزفخ رض٠ذ ثبالسشبداد .
. اؼشس٠خ االص ارجبػب
رشغ١غ رؼض٠ض شبسوخ اغزغ اؾ ف ػ١خ طغ امشاس وزه رغ١ ط .ص
. ؼبد االصخ ػ ػ١بد اطشػ اخطؾ ىبئبد اؾ١خ اؾسح ساص١ب شزمبرب
. ازؤو١ذ ػ رافك رشش٠ؼبد االسد اخبطخ ثبغالخ االؽ١بئ١خ غ ض١الرب االل١١خ اؼب١خ .ػ
7المبدة
: االعز١شاد
ػ ع١غ ؽجبد االعز١شاد ىبئبد اؾسح ساص١ب شزمبرب ا ادخبب ج١ئخ ثشى .أ
. ز ازؼ١بد (1)مظد ا رؾز ػ االل ػ اؼبد ااسدح ف اشفك سل
ػ ع١غ ؽجبد االعز١شاد ىبئبد اؾ١خ اؾسح ساص١ب شزمبرب ا اعزخذاب .ة
وبغز٠خ ا وؤػالف ا زغ١ض ا رؾز ػ االل ػ اؼبد ااسدح ف اشفك سل
. ز ازؼ١بد (2)
رخؼغ اىبئبد اؾ١خ اؾسح ساص١ب شزمبرب ا ادخبب ج١ئخ ثشى مظد ا .ط
اعزخذاب وؤغز٠خ ا وؤػالف ا زغ١ض از عزغزسد الي ش ا ػ١خ رم١١ خبؽش
(. 1) اشفك سل (ن)ف ؽبي ػذ رطبثمب فمشح
176
٠زؾ اغزسد وفخ ػ١خ رم١١ اخبؽش ػ ا رز ػ١خ ازم١١ ؽغت ب اسد ف .د
. ز ازؼ١بد (3)اشفك سل
ػذ اعزال ؽجبد االعز١شاد ىبئبد اؾ١خ اؾسح ساص١ب ا شزمبرب لج اصاسح ، رم .ـ
. ثزض٠ذ اغبد راد اؼاللخ ثىبفخ اصبئك امذخ
رم و عخ خخ ثبزغ١ت ثمشاسب غخ اعزبدا ا دساعبرب اف١خ االصخ صبئك .
. امذخ لج اغخ اغزسدح
٠ؾك غخ ا رم ثطت ا٠خ ؼبد اػبف١خ رشاب ػشس٠خ خالي خبؽجخ اغزسد .ص
. خط١ب ثزه
ا .ػ . رمشس اغخ اافمخ ا ػذ اافمخ ػ االعز١شاد غ ث١ب االعجبة خط١ب
رؼزجش افمخ اغخ اخط١خ ثبالعز١شاد عضءا ال ٠زغضأ اساق اػزبد االعز١شاد ىبئبد .ؽ
اؾ١خ اؾسح ساص١ب شزمبرب ا ادخبب ج١ئخ ثشى مظد ا اعزخذاب وؤغز٠خ ا
. وؤػالف ا زغ١ض
ف ؽبي ػذ افمخ اغخ ، ٠ؾك ظذس ازمذ ثطت عذ٠ذ غبػ ثبالعز١شاد ػ اعبط .
رفش ؼبد عذ٠ذح رى زفشح ف اطت االي ثبء ػ ز اؼبد رم اغخ
. ثبػبدح اظش ثبطت اطذاس لشاسب ثبافمخ ا ػذ اافمخ
ػ اغزسد ا طبؽت اششع ا ٠ؼ اغخ ثؤ ؼبد عش٠خ ث١ اؼبد .ن
. امذخ غ رمذ٠ رجش٠ش ره ػذ اطت ػ اغخ ا رؾبفع ػ عش٠زب
8المبدة
: ازظذ٠ش
ف ؽبي رظذ٠ش ا اػبدح رظذ٠ش ا وبئبد ؽ١خ ؾسح ساص١ب اىخ ا ا دخ اخش
ثذف ادخبي ره اىبئبد ج١ئخ ثشى مظد ، رؼزجش اافمخ اخط١خ غخ اشع١خ ف ثذ
. االعز١شاد عضء ال ٠زغضأ اساق اػزبد ازظذ٠ش زه اجذ
9المبدة
: اغبد اخخ
رؼزجش اغبد اشع١خ ازب١خ اغبد اخخ ثبذساعبد اف١خ طجبد االعز١شاد ازظذ٠ش . أ
ىبئبد اؾ١خ اؾسح ساص١ب شزمبرب رم ثبزغ١ت ثمشاسب غخ ؽغت ب ج١ اصاء
: و ب
177
. ااد اغزخذخ الزبط اؾ١ا اجبر : صاسح اضساػخ. 1
اىبئبد اؾ١خ اؾسح ساص١ب از رصش ػ عالخ ازع اؾ١ : صاسح اج١ئخ. 2
. االغز٠خ اؼبفبد اغزائ١خ اخظظخ العزالن اجشش : اؤعغخ اؼبخ غزاء اذاء. 3
رم و عخ خخ اػال ثبػذاد ازؼ١بد اخبطخ ثب از رزفك اؽىب ز ازؼ١بد . ة
. ثؾ١ش ٠ز ػشػب الشاسب لج اغخ
10المبدة
: رم١١ اخبؽش
٠خؼغ رؤع١ظ ا شؤح ا ام١ب ثؤ شبؽ ف االسد العزخذا اؼضي ىبئبد اؾ١خ .أ
اؾسح ساص١ب ا اعزخذا ز اىبئبد وؤغز٠خ ا وؤػالف ا زغ١ض ا اافمخ اغجمخ
. غخ لذ رزؼ اافمخ اعشاء رم١١ خبؽش ؽغت ب رشا اغخ بعجب
ػذ اعزال اغخ اؽ١خ اؼ١خ ؽجبد اغبػ الداسح ا شافك ا اجذء ثؤ شبؽ راد . ة
ػاللخ ثبىبئبد اؾ١خ اؾسح ساص١ب غب٠بد االعزخذا اؼضي ا اعزخذاب وؤغز٠خ ا
. وؤػالف ا زغ١ض، ػ ز اغخ ا رم ثزؾ٠ وبفخ اصبئك ا اغخ ظش ف١ب
غخ ا رم ثطت ام١ب ثؼ١خ رم١١ اخبؽش ا ؽت ا٠خ ؼبد اػبف١خ خالي .ط
اىزبثخ خط١ب غخ اؼ١خ ف ؽبي ػذ افمخ اغخ ػ اطت رم وزه ثبخطبس اغخ
. ازمذخ ث ثزه خط١ب غ ث١ب االعجبة
غبؼبد االسد١خ شاوض اجؾس ازمذ ثطت اغبػ ثبعشاء ا٠خ شبؽبد خبطخ ثبىبئبد .د
اؾ١خ اؾسح ساص١ب ثؾ١ش رخؼغ شالجخ اغخ ػ ا رم ز اغبد ثزمذ٠ رمبس٠ش
. دس٠خ ب
ػ ع١غ اغبد اؽ١خ اؼبخ ف غبي اىبئبد اؾ١خ اؾسح ساص١ب ا رم ثبزذاث١ش .ـ
: االعشاءاد ازب١خ
. رؤع١ظ ظب اب غ االؽالق غ١ش امظد ىبئبد اؾ١خ اؾسح ساص١ب .1
. ػغ ظب اب غ ا ػ١خ م ػجش اؾذد ثشى غ١ش مظد .2
. رم١١ خبؽش الي ػ١خ اؽالق ال وبئ ؽ ؾس ساص١ب .3
. ػغ اعشاءاد طاسء ف ؽبي االؽالق غ١ش امظد .4
. ا اعشاءاد اخش رشاب اغخ ػشس٠خ .5
178
11المبدة
: ا٠خ ثطبلخ اج١ب
ػ و ظذس ا غزسد ا زؼب ؾ١ب ثبىبئبد اؾ١خ اؾسح ساص١ب شزمبرب ا ٠م
. ثػغ ثطبلخ اج١ب وب ج١ ادب
ال رؾز ػ / غشع اعزخذاب وؤغز٠خ ا وؤػالف ا زغ١ض ٠غت ػغ ػجبسح رؾز . أ
. وبئبد ؾسح ساص١ب زغبرب ال ٠شاد ادخبب لظذا ف اج١ئخ
ػشسح ث١ب ره ثػػ خالي رؾذ٠ذ ا٠خ - غشع ادخبب ج١ئخ ثشى مظد . ة
اغبد اخظبئض راد اظخ ا ؼبد ب ػاللخ ثبزذاي ا٢ ازخض٠ ام
االعزخذا عخ االرظبي ض٠ذ اؼبد ؽغت االلزؼبء اع ػا اغزسد
. اظذس
ازؾذ٠ذ ثػػ ازطجبد اخبطخ غالخ ازذاي ازخض٠ - غب٠بد االعزخذا اؼضي . ط
. ام االعزخذا وزه اؼبد اخبطخ ثبع ٠خ عخ االرظبي ض٠ذ اؼبد
. ػغ ا٠خ ث١ببد اػبف١خ رشاب اغخ ػشس٠خ . د
اذط خبذ اال٠شا
ص٠ش اج١ئخ
180
(B): Draft of Jordan Law for Bio-safety of Genetically
Modified Organisms
ا لب اغالخ األؽ١بئ١خغدح ي 2013غخ ( )سل ثشؤ ازغبد اؾسح ساص١ب
(1)مبدة
ا غخ ٠ؼ ( 2013 )٠غ زا امب لب اغالخ األؽ١بئ١خ ثشؤ ازغبد اؾسح ساص١ب
. ث اػزجبسا ربس٠خ شش ف اغش٠ذح اشع١خ
( 2) مبدة
٠ى ىبد اؼجبساد ازب١خ ؽ١ضب سدد ف زا امب اؼب اخظض ب أدب ب رذي
: امش٠خ ػ غ١ش ره
ا و وبئ ؽ عش رؼذ٠ ؽبل اساص ثؤعة خجش ال٠ز ػبدح : وبئ ؽ ؾس ساص١ب
ف اطج١ؼخ ٠خزشق اؾاعض اساص١خ اطج١ؼ١خ ث١ أاع اىبئبد اؾ١خ، عاء زظ ره
.خالي ازضاط اغغ أ االعغ
ا ا أ رؾز ػ١ب أ : ازغبد اؾسح ساص١ب ازغبد از رزى وبئبد ؾسح ساص١ب
.أعضاء ؽبلب اساص
.و رم١خ رشز ػ رم١بد رغزخذ وبئبد ؽ١خ أ أعضاء ب: ازم١بد األؽ١بئ١خ
.أ عضء اىبئ اؾ ٠ؾز ػ شفشر اساص١خ: ابدح اساص١خ
ا أ غػخ أ زظ ٠ؾز٠ : اإلؽالق اؼذ و ارظبي جبشش ث١ وبئ ؾس ساص١ب
ث١ اج١ئخ اإلغب، د ارخبر اؽز١بؽبد ؽبعخ رغ زا اإلرظبي ض اؾاعض ابد٠خ
.ثفشدب أ اؾاعض اى١١بئ١خ أ األؽ١بئ١خ
و إؽالق خطؾ زغبد ازؾس اساص ف اج١ئخ رؾذ ظشف رؾذ : اإلؽالق ازغش٠ج
ا، ره خال اعض و١١بئ١خ أ أؽ١بئ١خ أ ي ػ ازشبس اىبئبد اؾ١خ اؾسح ساص١ب
.رغ اعزشاس ره اىبئبد ف اج١ئخ
ا أ إلوضبس أ رخض٠ أ : اإلعزخذا اؼضي و ػ١خ اعزجبؽ زغبد ؾسح ساص١ب
اعزخذا أ م أ ازخض ره ازغبد ثؤعة ٠غ ارظبب ثبج١ئخ اإلغب
.خالي ؽاعض بد٠خ ثفشدب أ غ ؽاعض و١١بئ١خ أ أؽ١بئ١خ
.اج١ئخ از ٠ى ىبئ اؾ أ زبع اطي إ١ب: اج١ئخ ازم١خ
رم١١ اخبؽش ػ طؾخ اإلغب اج١ئخ ثب ف ره اىبئبد اؾ١خ : رم١١ اخبؽش اج١ئخ
ا ف اج١ئخ .أألخش، عشاء اؽالق ازغبد اؾسح ساص١ب
رزبثغ رشر١ت اغبد اساص١خ از رؼجش ػ طفخ أ طفبد ؾذدح : ا٠خ افشدح ا١ضح
ا .أدخذ ػ ازشو١ت اساص ىبئ ؽ و ٠ظجؼ ؾساا ساص١ب
ا ا ىبئ اؾ: اى اؾس ساص١ب .أ عضء ٠ؾز ػ اشفشح اساص١خ اؾسح ساص١ب
181
ثشروي لشؽبعخ ثشؤ اغالخ األؽ١بئ١خ ازبثغ إلرفبل١خ ازؼمخ ثبزع : اجشروي
.اج١ع
صاسح اج١ئخ : اصاسح
.ص٠ش اج١ئخ: اص٠ش
. أ١ ػب اصاسح: األ١ اؼب
.اغخ اؽ١خ غالخ األؽ١بئ١خ : اغخ
( 3)مبدة
: ٠ذف زا امب إ رؾم١ك ب ٠ؤر
ا ذ .1 رؾم١ك اغالخ ف رذاي اعزخذا اعز١شاد رظذ٠ش ازغبد اؾسح ساص١ب
إؽاللب اؼذ ف اج١ئخ رغت أ٠ اصبس عج١خ رشؤ أ ٠ى أ رشؤ ز١غخ زه ف اج١ئخ
.ثب ف ره اإلػشاس ثظؾخ اإلغب اىبئبد اؾ١خ األخش
شاػب األثؼبد ام١خ االلزظبد٠خ اظؾ١خ ازشرجخ ػ اإلؽالق امظد ثب ٠ؼ .2
.ؽفع اعزذا ازع األؽ١بئ ػ اغز اؽ
.ػب ازؼب ثؤلظ اعزفبدح ا رم١بد ازؾس اساص .3
ا ثشفبف١خ .4 .ر١غ١ش ازؼب غ اذي األخش ف اإلعزخذا اال زغبد اؾسح ساص١ب
ا غ١شب .5 ازؤو١ذ ػ ؽك اغزه ف اخز١بس ؽش ث١ ازغبد اؾسح ساص١ب
.ازغبد
ره ف إؽبس اؾفبظ ػ اغ١بدح اؽ١خ ػ ااسد اساص١خ اؼبسف ازم١ذ٠خ ػ
. اعزذاخ اعزخذاب ثب ٠غغ غ اغ١بعبد اإلعزشار١غ١بد اج١ئ١خ
( 4)مبدة
ا وزه ػ ازغبد اظؼخ رغش اؽىب زا امب ػ اىبئبد ازغبد اؾسح ساص١ب
ؼذح إلعزخذا اؼضي، ره إرا رغبصد اغت ا ثب ف١ب ا اشزمخ وبئبد ؾسح ساص١ب
ا ثب ٠زغك غ ازطساد اؼ١خ ف ؽشق ازؾب١ دلزب . از رؾذدب اغخ دس٠ب
( 5)مبدة
: ال رغش أؽىب زا امب ػ ب ٠ؤر
اجؾس اخزجش٠خ ازغبسة اؾم١خ اؼضخ، ب ٠زشرت ػ١ب رغشة وبئبد أ زغبد .1
ا رظذس ا ؽذاا ؼ١ب ا إ اج١ئخ، أ ف ؽبخ رغبص ؽغ ازظ اؾس ساص١ب ؾسح ساص١ب
ا ثؾ١ش ٠شاػ اإللزظبس ػ االعزخذا ألغشاع اجؾش اؼ، ٠ظذس ثزا اغخ دس٠ب
.ازؾذ٠ذ لشاس اص٠ش
182
رذاي أ اعز١شاد األد٠خ اجشش٠خ ازغخ ثزم١بد ازؾس اساص إرا وبذ ال رؾز ػ .2
.٠ى وشفب اد ع١١خ لبثخ ؼبػفخ
رغبسة ازم١ؼ اظبػ ف اإلغب أ اؾ١ا إرا وبذ ازم١خ اغزخذخ ال رشز ػ .3
.رم١بد ازؾس اساص
رظذس اغبد اؼ١خ ،و ف ؽذد إخزظبط ، امشاساد ازؼمخ ثزظ١ األس اشبس إ١ب [
.] ف ز ابدح
( 6)مبدة
رشؤ ف اصاسح غخ رغ اغخ اؽ١خ غالخ األؽ١بئ١خ ، ٠ظذس ثزشى١ب لشاس ( أ
. سئ١ظ اصساء ثبء ػ رغ١ت اص٠ش
: رؼ اغخ ف ػؼ٠زب أػؼبء زخظظ١ ٠ض اغبد ازب١خ (ة
صاسح اج١ئخ .1
اؤعغخ اؼبخ غزاء اذاء / صاسح اظؾخ .2
اشوض اؽ جؾش اإلسشبد اضساػ/ صاسح اضساػخ .3
ؤعغخ اطفبد امب١٠ظ / صاسح اظبػخ ازغبسح .4
عؼ١خ ؽب٠خ اغزه .5
أػؼبء اخجشاء ف غبالد اغالخ األؽ١بئ١خ ٠ششؾ اص٠ش ثبء ػ (أسثؼخ) .6
.رغ١ت األ١ اؼب
( 7)مبدة
: رخزض اغخ د غ١شب، ثب ٠ ( أ
إطذاس رشاخ١ض ثزذاي اىبئبد ازغبد اخبػؼخ ألؽىب زا امب أ اؽاللب .1
.أ إربؽزب إلرغبس أ اؼشع ف األعاق فك ؼب١٠ش رؾذدب اغخ
ا ثب .2 رؾذ٠ذ غت اؽزاء ازغبد اخبػؼخ ألؽىب زا امب ػ اد ؾسح ساص١ب
.٠زفك غ ازطساد اؼ١خ ف زا اغبي
ا ثب ٠زفك غ ازطساد اؼ١خ .3 رؾذ٠ذ أعة رزجغ شالجخ ازغبد اؾسح ساص١ب
.ف زا اغبي
ارخبر امشاساد ثشؤ إعشاء دساعبد زم١١ اخبؽش ف اج١ئخ ازم١خ لج اجذ ف .4
ؽت ازشخ١ض أعة إعشاء ره اذساعبد ثب ٠ؤخز ف األػزجبس ظشف اج١ئخ
.ازم١خ األبؽ اإلعزالو١خ اؼبداد اغبئذح
183
رؾذ٠ذ وفخ دساعبد رم١١ اخبؽش از لذ رض ؾظي ػ ازشاخ١ض، ره فك .5
ػ اغخ اإلعزششبد ثبذساعبد . األظخ ازؼ١بد اظبدسح ثعت زا امب
از رذ ف األسد ف شؽخ اجؾس اخجش٠خ ازغبسة اؾم١خ اؼضخ، وزه
.اؼب١٠ش ازع١١خ اظبدسح ػ اؤعغبد اذ١خ
. ز ابدح ( 3) (2)٠ظذس اص٠ش لشاساد ثشؤ ازؾذ٠ذ اشبس إ١ ف اجذ٠ (ة
( 8)مبدة
٠ؾظش ام١ب ثزذاي اىبئبد ازغبد اخبػؼخ ألؽىب زا امب أ إؽاللب أ إربؽزب ( أ
ا وب اذف ره إال ثؼذ اؾظي ػ رشخ١ض ثزه إلرغبس أ اؼشع ف األعاق أ٠ب
. اغخ
رؾذد ازؼ١بد اظبدسح ثعت زا امب ششؽ إعشاءاد اؾظي ػ ازشخ١ض (ة
.اشع امشسح
( 9)مبدة
إرا ب الزظش اؾبي ػ م اىبئبد أ ازغبد اخبػؼخ ألؽىب زا امب ػجش األسد ( أ
ثؤ٠خ ع١خ عبئ ام االخ ف١زؼ١ ػ اغخ ابلخ إخطبس أبخ اغخ (رشاض٠ذ)
ا ثبم ثؤعة إداسح اخبؽش ف ؽبالد اؾادس أعة ازبثؼخ ثب ٠زفك غ غجمب
. أؽىب اجشروي، رؾذد ازؼ١بد اظبدسح ثعت زا امب إعشاءاد ششؽ ام
٠زؾ طبؽت اشؾخ امخ اغؤ١خ ازشرجخ ػ األػشاس از رظ١ت اج١ئخ طؾخ ( ة
. اإلغب أ اىبئبد اؾ١خ األخش ز١غخ ام
ا غ ازغبد غ١ش اؾسح ف ع١خ ( ط ف ع١غ األؽاي ، ٠ؾظش م ازغبد اؾسح ساص١ب
. أ ؽب٠خ اؽذح غمخ شزشوخ
( 10)مبدة
رؼ١ اغخ ف أي إعزبع ب عىشربس٠خ ب، رز اعزال ؽجبد ازشخ١ض اشبس إ١ب ف ( أ
زا امب ؼشػب ػ اغخ، ػ١ب ل١ذ اطجبد ف عغ خبص ٠شؤ زا (7)ابدح
. اغشع، ٠ػؼ ف١ ربس٠خ عبػخ رم اطت اإلعشاءاد از إرخزد ثشؤب
رؾذد ازؼ١بد اظبدسح ثعت زا امب اإلعشاءاد از رزخز ثشؤ ز اطجبد ؽز ( ة
شؽخ ارخبر امشاس ثشؤب لج اغخ، وب رؾذد لاػذ اإلزضا ثبألؽىب اخبطخ
. ثبؼبد اغش٠خ اظص ػ١ب ف اجشروي
184
( 11)مبدة
رظذس اغخ لشاسب ثؼ ازشخ١ض أ ثشفؼ ثؤغج١خ صض األػؼبء، خالي بئز١ عجؼ١ (أ
ا ربس٠خ رمذ٠ اطت ب ف عج١ إطذاس لشاسب ارخبر اإلعشاءاد االر١خ : ٠ب
رشى١ غب فشػ١خ زخظظخ رخزض ثجؾش ب رىفب ث اغخ إلعزششبد ثشأ٠ب ف .1
.ارخبر لشاس ؼ ازشخ١ض أ سفؼ
.دػح أػؼبء غ١ش ض١ ف اغخ ، ره إلعزششبد ثبسائ .2
اإلعزششبد ثشأ اؽذ أ أوضش ام١ذ٠ ف عغ اخجشاء اظص ػ١ ف ابدح .3
. زا امب ( 12)
ػمذ عغبد اعزبع ػ١خ ض١ مطبػبد اغزغ راد االزب ، إلعزطالع اشأ ف .4
.ازظ ػع ؽت ازشخ١ض
.رى١ف ؽبت ازشخ١ض ثزمذ٠ أ٠خ ث١ببد أ ػ١بد إػبف١خ لذ رؾزبعب اغخ .5
.ازى١ف ثئعشاء دساعبد رم١١ اخبؽش اج١ئ١خ .6
ز ابدح ، اذح از ٠غزغشلب رمذ٠ (أ)ال ٠ذخ ف ؽغبة اذح اشبس إ١ب ف افمشح (ة
ث١ببد إػبف١خ رطجب اغخ مذ ؽت ازشخ١ض، وزه اذح از رزطجب دساعبد
. رم١١ اخبؽش اج١ئ١خ ػمذ عغبد إلعزطالع اشا اؼب
خطبة ط ػ١ ظؾة ثؼ [٠ز إخطبس ؽبت ازشخ١ض ثمشاس اغخ ثعت (ط
ا ربس٠خ اإلخطبس ، . ]اطي مذ اطت ؽك ازظ خالي صالص١ ٠ب
. رؾذد ازؼ١بد اظبدسح ثعت زا امب ششؽ إعشاءاد ازظ اجذ ف١ (د
( 12)مبدة
رشئ اغخ عغالا م١ذ اخجشاء ف غبي اغالخ األؽ١بئ١خ ف ازم١بد األؽ١بئ١خ إلعزؼبخ ( أ
رؾذد ازؼ١بد اظبدس ثعت زا . ثشأ٠ ف١ب رشا اغخ ب ٠زظ ثطجبد ازشخ١ض
امب ، إعشاءاد ام١ذ ف اغغ اششؽ ااعت رافشب ف اخجشاء اؤ١ م١ذ ف١،
. ٠ى ام١ذ ف اغغ ثبء ػ رشش١ؼ اغبد أ اصاساد اؼ١خ أ أػؼبء اغخ
رشئ اغخ عغالا م١ذ اخزجشاد اشعؼ١خ اؽ١خ ف غبالد دساعبد اغالخ األؽ١بئ١خ ( ة
ف ازىع١ب اؾ٠١خ اىشف ػ ؾز٠بد ازغبد األؽ١بئ١خ ىبد ؾسح
ا ا، ره إلعزؼبخ ث ف١ب رش اغخ اؾبعخ إ دساعز خجش٠ب رؾذد ازؼ١بد . ساص١ب
اظبدسح ثعت زا امب إعشاءاد ام١ذ ف اغغ اششؽ ااعت رافشب ف
. اؼب اشعؼ١خ اششؾخ م١ذ ف١
185
ا م١ذ ازشاخ١ض از ؾزب إلؽالق اؼذ، رؾذد ازؼ١بد (ط رشئ اغخ عغالا ػ١ب
. اظبدسح ثعت زا امب اج١ببد ااعت إصجبرب ف زا اغغ أعة إربؽز ؼبخ
186
( 13)مبدة
: ٠غت أ ٠زؼ ازشخ١ض از رظذس اغخ ب ٠ؤر
ا اغػ ث غشع اإلعزخذا اظشػ ث .و١خ ازظ اؾس ساص١ب
.ذح عش٠ب ازشخ١ض
.غبي اج١ئخ ازم١خ
.ؾز ثطبلبد ازؼش٠ف ابعجخ زؾم١ك اشفبف١خ اطثخ غزه
ا .ا٠خ افشدح ا١ضح زظ اؾس ساص١ب
.أعب١ت رزجغ ازظ عؾج ازذاي إرا ض األش
.اج١ببد از ٠ض إسفبلب ثغزذاد اشؾ
.أعب١ت زبثؼخ اإلؽالق لج طبؽت ازشخ١ض
ا .ؽذد اؾب٠خ از ٠ض رف١شب غزخذ ازغبد ابصخ غ١ش اؾسح ساص١ب
.أعب١ت إداسح اخبؽش ف ؽبالد اؾادس
( 14)مبدة
: ٠زض طبؽت ازشخ١ض ثب ٠ؤر ( أ
سل : ػغ ثطبلخ ىزثخ ثخؾ اػؼ مشء ػ ػجاد ازظ اشخض ث رزؼ .1
ازشخ١ض ششؽ إ عذد، ٠شبس ف اجطبلبد إ إؽزاء ازظ ػ ىبد أ
ا ا، ا٠خ افشدح ا١ضح ى ى ؾس ساص١ب .زغبد ؾسح ساص١ب
ارخبر ازذاث١ش از رغؼ ثزبثؼخ زبئظ اإلؽالق اخطؾ ثشى فظ ثب ف ره .2
.و١بد أبو اإلؽالق رؤص١ش ػ طؾخ اإلغب اج١ئخ
رزجغ ازظ ف دائشح ازذاي ثؤعة ٠ؼ ازؼشف ػ ازظ عؾج ازذاي إرا .3
.إلزؼذ اؼشسح
. رؾذد ازؼ١بد اظبدسح ثعت زا امب عبئ إعشاءاد رف١ز ز اإلزضابد ( ة
( 15)مبدة
غخ أ رؼذي ششؽ ازشخ١ض أ أ رمشس إغبئ ف أ لذ خالي فزشح عش٠ب إرا ( أ
رافشد ذ٠ب ؼبد عذ٠ذح لذ رش١ش إ اؽزبي ؽذس أػشاس ج١ئخ أ طؾخ األغب أ
. اىبئبد اؾ١خ األخش
ػ اغخ أ رخطش طبؽت ازشخ١ض ثبزؼذ٠ أ اإلغبء، ظبؽت ازشخ١ض ازظ ( ة
ا ربس٠خ إخطبس ثبمشاس ثعت خطبة ط ػ١ [لشاس اغخ خالي صالص١ ٠ب
، ]ظؾة ثؼ اطي
رػؼ ششؽ إعشاءاد ازط لشاس اغخ اجذ ف١ ، ثعت رؼ١بد رظذس (ط
. ثعت زا امب
187
( 16)مبدة
١ظ ف زا امب ب ٠ؾي د رطج١ك أ٠خ ػمثخ أشذ سد اض ػ١ب ف أ لب آخش بفز
. افؼي
( 17)مبدة
(20.000)ثغشاخ الرم ػ ( عاد3)ال رض٠ذ ػ (عخ)٠ؼبلت ثبغغ ذح ال رم ػ
ا ( 50,000)د٠بس ال رض٠ذ ػ د٠بس و اؽك ػذاا ػ خالف أؽىب زا امب وبئب
ا ازغبد اخبػؼخ ألؽىب زا امب ف اج١ئخ، إرا رشرت ػ زا ا أ زغب ؾساا ساص١ب
50,000)اإلؽالق إطبثخ إغب ثؼب غزذ٠خ رى اؼمثخ اغغ اشذد غشاخ ال رم ػ
، إرا رشرت ػ زا اإلؽالق فب اغب ، ف١ؼبلت ثبغغ ( د٠بس100,000) ال رغبص (د٠بس
. د٠بس( 250,000)ال رغبص ( د٠بس150,000)اؤثذ ثغشاخ ال رم ػ
ف ع١غ األؽاي ، ٠ؾى ثبظبدسح ثئعشاء دساعبد رم١١ االصبس ثئػبد اؾبي إ ب وب
ػ١ ػ فمخ اخبف، رؼبف ػمثخ اؼضي اظ١فخ إرا لؼذ اغش٠خ ظف أصبء أ
. ثغجت رؤد٠ز ظ١فز
( 18)مبدة
د٠بس ( 20,000)أ ثغشاخ الرم ػ (عز١)ال رض٠ذ ػ (عخ)٠ؼبلت ثبغغ ذح الرم ػ
: د٠بس و ( 40,000)الرض٠ذ ػ
لذ ث١ببد غ١ش طؾ١ؾخ أ ؼخ ؾظي ػ رشخ١ض ىبئبد أ زغبد خبػؼخ .1
.ألؽىب زا امب
٠زخز ازذاث١ش از رغؼ ثزبثؼخ اإلؽالق اؼذ ، ثب ف ره زبئظ اإلؽالق أبو رؤص١ش .2
.ػ طؾخ اإلغب
ا ألؽىب امب .3 .خبف ؽذد ازشخ١ض اظبدس ؽجمب
( 19)مبدة
( د٠بس20,000) ثغشا الرم ػ (عز١)ال رض٠ذ ػ (عخ)٠ؼبلت ثبغغ ذح ال رم ػ
د٠بس و ػشع ثذ رشخ١ض ف األعاق أ ج١غ أ ازذاي أ أل (40,000)الرض٠ذ ػ
. غشع اخش ، أؽذ ازغبد اخبػؼخ ألؽىب زا امب غ ػ ثزه
٠ؾى ثئغالق اشؤح از ر اؼشع ف١ب ظبدسح ازغبد اؼشػخ ثئعشاء رم١١ ا٢صبس
. ثئػبد اؾبي إ ب وب ػ١ ػ فمخ اخبف
188
( 20)مبدة
( 10,000)أ ثغشاخ ال رم ػ ( عخ)أشش ال رض٠ذ ػ (6)٠ؼبلت ثبغغ ذح ال رم ػ
ا ( 20,000)د٠بس ال رض٠ذ ػ د٠بس و رغجت ثغ١ش ػذ ف إؽالق وبئ ؽ ؾس ساص١ب
أ زظ خبػغ ألؽىب زا امب ف اج١ئخ، إرا رشرت ػ زا اإلؽالق إطبثخ إغب ثؼب
عاد ثغشاخ ال رم ػ (صالس )ال رض٠ذ ػ (عز١)غزذ٠خ ف١ؼبلت ثبغغ ذح ال رم ػ
د٠بس ، إرا رشرت ػ زا اإلؽالق فبح اغب ف١ؼبلت (40,000)ال رض٠ذ ػ ( د٠بس20.000)
ف . د٠بس (80,000)د٠بس ال رض٠ذ ػ (40,000)ثبغغ اؤثذ ثغشاخ از ال رم ػ
ع١غ األؽاي ٠ؾى ثبظبدسح ثئعشاء رم١١ األصش اج١ئ ثئػبدح اؾبي إ ب وب ػ١ ػ
. فمخ اخبف
( 21)مبدة
( 20,000)أثغشاخ ال رم ػ (عخ)أشش ال رض٠ذ ػ (عزخ)٠ؼبلت ثبغغ ذح الرم ػ
: د٠بس و ( 40,000)د٠بس ال رض٠ذ ػ
ؽشػ ج١غ أ زذاي أ أل غشع اخش ف األعاق أؽذ ازغبد اخبػؼخ ألؽىب زا .1
ا اج١ببد از رذي ػ١ غ ػ ثزه ا ث خب١ب ٠ؼبلت ثزاد اؼمثخ . امب شخظب
.و ػشع زا ازظ غ ػ ثزه
م وبئبد أ زغبد خبػؼخ ألؽىب زا امب ػجش اىخ ثؤ٠خ ع١خ وبذ لج إخطبس .2
(9)أبخ اغخ ثبم ثؤعة إداسح اخبؽش ف ؽبخ اؾادس اؼبسػخ فك ابدح
.زا امب
رؼب غ ازظ اشخض ث ثؼذ إزبء ذح عش٠ب ازشخ١ض أ ثؼذ إغبئ أ رؼذ٠ سغ .3
.إخطبس ثزه لج اغخ
٠ززجغ زبئظ إؽالق ازظ زذاي ثؤعة ٠ؼ ازؼشف ػ١ عؾج ازذاي إرا .4
.إلزؼذ اؼشسح
لب ثئعشاء ثؾس خجش٠خ أ رغبسة ؽم١خ ؼضخ ػ وبئبد أ زغبد خبػؼخ ألؽىب .5
.زا امب ثغت رزغبص ره از ؽذدرب اغخ
ف ع١غ األؽاي ٠ؾى ثبظبدسح ثئعشاء رم١ األصش اج١ئ ثئػبدح اؾبي إ ب وبذ ػ١
. ػ فمخ اخبف
ؾىخ أ رمشس ف ؽبالد اؼشسح إغبء ازشخ١ض ف اؾبالد امشسح ف افمشاد
(1)،(2)، (4 .)
189
( 22)مبدة
( 20,000)أ ثغشاخ الرم ػ (عخ)أشش ال رض٠ذ ػ (عزخ)٠ؼبلت ثبغغ ذح ال رم ػ
د٠بس و ؽبي د رى١ األشخبص اػ طفخ (40,000)د٠بس ال رض٠ذ ػ
ا ألؽىب زا امب ام١ب ثاعجبر ره ثؤ ؽش٠مخ وبذ . اؼبثطخ اؼذ١خ فمب
( 23)مبدة
ف األؽاي از رشرىت ف١ب اغش٠خ ثاعطخ شخض ؼ ٠ؼبلت اغؤي ػ اإلداسح افؼ١خ
شخض اؼ اخبف ثزاد اؼمثبد امشسح ػ األفؼبي از رشرىت خبفخ ألؽىب زا
. امب إرا صجذ ػ ثب وبذ اغش٠خ لذ لؼذ ثغجت إخال ثاعجبد ظ١فز
٠ى اشخض اإلػزجبس غؤالا ثبزؼب ػ افبء ثب ٠ؾى ث ػمثبد ب١خ
رؼ٠ؼبد إرا وبذ اغش٠خ از لؼذ خبفخ ألؽىب زا امب لذ أسرىجذ أؽذ اؼب١
. ثبع ظبؾ
( 24)مبدة
مبطذ زا امب ، ٠ؼ االشخبص ر اإلخزظبص از٠ ٠غ١ اص٠ش ثبء ػ رغ١ت
ى شخض . األ١ اؼب ، طفخ اؼبثطخ اؼذ١خ ؼب ازف١ز افؼبي ألؽىب زا امب
. ؽج١ؼ أ ؼ اؾك ف اإلثالؽ ػ ا٠خ خبفخ ألؽىب زا امب
( 25)مبدة
ى شخض ؽج١ؼ أ ؼ اؾك ف ازؼ٠غ اؼبدي ػ األػشاس از رؾك ث ازغبد
. اخبػؼخ ألؽىب زا امب
( 26) مبدة
. ٠غ أ ض ف أ رشش٠غ آخش ٠زؼبسع غ أؽىب زا امب
(27) مبدة
٠ظذس غظ اصساء األظخ االصخ زف١ز أؽىب امب ، وب ٠ظذس اصساء اخزظ و
. االصخ زف١ز أؽىب ازؼ١بد ف غبي اخزظبط ،
( 28) مبدة
190
. سئ١ظ اصساء اصساء ىف ثزف١ز أؽىب زا امب
Abstract (in the second language)
دراسة الوضع الحالي للقوانين المتعلقة بمنتجات الكائنات المعدلة وراثيا "" ومدى انتشارها في األردن
إعداد نوار الحسيني
مشرفال العبيدي دمحم عبد القادر إبراهيم الدكتوراألستاذ
المشرف المشارك نسرين ضيف هللا الحمودةرالدكتو
الملخص
هناك العدد من المنتجات المعدلة وراثا قد بدأت ف الظهور ف السوق األردن، وهذا ثر
وما ؟ أم ال الجنات المدخلة مسموح التداول بها هذهالسؤال عن أصل هذه المنتجات وما إذا كانت
وذلك ،هدف هذا البحث إلى التحقق عمقا ف هذه القضة حث هو سبب حدوث هذه الظاهرة؟
من خالل الكشف ف السوق األردن عن أكثر أنواع النباتات الت تم تعدلها وه الذرة سواء
مفهوم المنتجات نع كما سعى هذا البحث إلى قاس وع األردنن .״ا أم علف״كانت غذاءأ
المعدلة وراثا، والنظر ف الوضع الحال للقوانن واألنظمة وكذلك بحث وجهات النظر األخالقة
.والدنة مع الجمهور بخصوص هذا الموضوع
مراجعة المقاالت ذات الصلة والدراسات السابقة، وكذلك البحث عن وقد شملت منهجة البحث
هذا باإلضافة إلى جمع عنات الذرة من السوق وتنفذ .طرق شبكة اإلنترنت واألفالم الوثائقة
من القطاعن العام مع المختصن مقابالتاجراءاستبان وعمل /انشاءكم تم .التجارب المخبرة
.الخاص والعدد من المؤسسات الحكومة وغر الحكومة/
عنة 29 حوال ، فإن عنة ذرة تم جمعها40وقد أظهرت الفحوص المخبرة أنه من بن
عنة ذرة (٪69 )20تم العثور على فقد وعالوة على ذلك . أنها معدلة وراثاتوجد (72.5٪)
. غر مصرح بها ومعدلة وتحتوي على جنات مدخلة
191
٪ أجابوا أنهم 18 ، فإن نسبة شخص تم استطالعهم400وقد أظهرت نتائج االستبان أنه من بن
، كما تبن أن عددا قلل جدا من هؤالء قام بإعطاء األغذة المعدلة وراثاهة عرفون جدا ما
ممن ٪45 ، فإنوعندما سألوا عن وجهات نظرهم الدنة واألخالقة. اإلجابة العلمة الدققة
من أي كائن تم أخذ الجن ) أجابوا بأن حكمهم توقف على طبعة التغر شملهم االستطالع
.والسبب وراء هذا التغر (المنقول
أن حث أنه من المهم جدا عنونة األغذة المعدلة وراثا، من عنة الدراسة٪ 75.5ت أكدكما
دخول المنتجات المعدلة لمراقبةرصد ووضع قوانن صارمة معنة ب٪ عتقدون أن الحكومة80
.وراثا
وكذلك قام 2004 الوطنة عام حائةذكر أن االردن قام بوضع إطار للسالمة اإلبالومن الجدر
بوضع أنظمة للسالمة البولوجة للكائنات الحة المحورة وراثا حث تم نشرها ف الجردة
كما أن وزارة البئة و بالتعاون مع المختصن من جهات حكومة وشبه ،2006الرسمة عام
حكومة وغر حكومة وجامعات قامت مؤخرا بإعداد مسودة قانون السالمة اإلحائة والذي نأمل
.ف أقرب وقت حز التنفذ ه وضعأن تم
تم بحمد هللا
Top Related