Jungia sellowii suppresses the carrageenan-induced inflammatory response in the mouse model of...

RESEARCH ARTICLE

Jungia sellowii suppresses the carrageenan-induced inflammatoryresponse in the mouse model of pleurisy

Marina Nader • Geison Vicente • Julia Salvan da Rosa • Tamires Cardoso Lima •

Alyne Machado Barbosa • Alan Diego Conceicao Santos • Andersson Barison •

Eduardo Monguilhott Dalmarco • Maique Weber Biavatti • Tania Silvia Frode

Received: 25 May 2014 / Accepted: 17 June 2014

� Springer Basel 2014

Abstract This study was conducted to explore the anti-

inflammatory effect of Jungia sellowii (Asteraceae) using a

murine model of pleurisy induced by carrageenan (Cg).

This plant is used in southern Brazil to treat inflammatory

diseases. J. sellowii leaves were extracted with ethanol/

water to obtain the crude extract (CE), which was frac-

tionated with different solvents, yielding n-hexane (Hex),

dichloromethane (DCM), ethyl acetate (EtOAc) and n-

butanol (BuOH) fractions, and aqueous fraction (Aq). The

major compounds succinic acid (SA) and lactic acid (LA)

were isolated from Aq fraction, and their structures were

determined by 1H and 13C NMR. Pleurisy was induced by

Cg (Saleh et al. 1996). The leukocytes, exudation, myelo-

peroxidase (MPO) and adenosine–deaminase (ADA)

activities, metabolites of nitric oxide (NOx) levels, protein

levels and mRNA expression for interleukin 1 beta (IL-1b),

tumour necrosis factor alpha (TNF-a), interleukin 17A

(IL17A) and inducible of nitric oxide synthase (iNOs), and

p65 protein phosphorylation (NF-jB) were analysed 4 h

after pleurisy induction. Animals pre-treated with CE,

BuOH, Aq, SA, or LA inhibited leukocytes, exudation,

MPO and ADA activities, NOx, IL-1b, TNF-a, and IL-17A

levels, and the mRNA expression for IL-1b, TNF-a, IL-

17A, iNOS, and p65 protein phosphorylation (NF-jB)

(p \ 0.05). Our study demonstrated that J. sellowii can

protect against inflammation induced by Cg by decreasing

the leukocytes and exudation. Its effects are related to the

decrease of either proinflammatory cytokines and/or NOx.

The isolated compounds SA and LA may play an important

role in this anti-inflammatory action by inhibiting all the

studied parameters. The anti-inflammatory properties of

these compounds are due to the downregulation of NF-jB.

Keywords Jungia sellowii �Anti-inflammatory properties �Pleurisy induced by carrageenan � NF-kappa B �Lactic acid � Succinic acid

Introduction

There is increasing interest in the biological activities of

plant extracts, especially those related to their uses in tra-

ditional medicine. Latin America, including Brazil holds a

great number of underexploited and largely unknown plant

varieties. These plants have nutritional and/or medicinal

properties (NRC 1989; De-La-Cruz et al 2007). Traditional

use of these plants by native population has guaranteed

conservation of many species.

Jungia is a genus from the Asteraceae family, which

comprises shrubs, lianas and herbs and is widespread from

M. Nader � G. Vicente � J. S. da Rosa � E. M. Dalmarco �T. S. Frode (&)

Department of Clinical Analysis, Center of Health Sciences,

Federal University of Santa Catarina (UFSC), Campus

Universitario-Trindade, Florianopolis, Santa Catarina

88040-970, Brazil

e-mail: tania.frode@ufsc.br

T. C. Lima � A. M. Barbosa � M. W. Biavatti

Department of Pharmaceutical Sciences, Center of Health

Sciences, Federal University of Santa Catarina (UFSC), Campus

Universitario-Trindade, Florianopolis, Santa Catarina

88040-970, Brazil

A. D. C. Santos � A. Barison

Department of Chemistry, Centre of Mathematical Sciences,

Federal University of Parana (UFPR), Curitiba, Parana

81531990, Brazil

Inflammopharmacol

DOI 10.1007/s10787-014-0210-3 Inflammopharmacology

North and Central America to South America, including

southern Brazil. The species Jungia sellowii less. (J. sel-

lowii) is also found in the South Brasil, state of Santa

Catarina (Katinas et al. 2008; Marchant et al. 2002).

The leaves, stems and flowers from Jungia paniculata

(J. paniculata) are used to disinfect external cuts and to

treat urinary tract inflammation, amigdalitis, tonsillitis,

stomach ulcers, nephritis and haemorrhoids, as well as an

antibacterial agent in traditional medicine in South Amer-

ica (De-La-Cruz et al. 2007; Hammond et al. 1998;

Rehecho et al. 2011). Additionally, the leaves and stems

from J. paniculata are used as a depurative of blood in

traditional medicine in South America (Goleniowski et al.

2006).

There are few pharmacological studies of anti-inflam-

matory effects of Jungia except for that described by

Casado et al. (2010), who demonstrated the anti-inflam-

matory and antioxidant effects of J. paniculata, a plant

used as topical anti-inflammatory herb in traditional med-

icine in South America. In that study the effect of the herb

was associated with the presence of polyphenols and

flavonoids.

Phytochemical analysis in our laboratory identified two

carboxylic acids, succinic acid (SA) and lactic acid (LA)

that were isolated from the aqueous fraction of the leaf

extract of J. sellowii.

In particular, LA can inhibit the inflammatory response

by decreasing interleukin-6 (IL-6) and tumour necrosis

factor-a (TNF-a) messenger ribonucleic acid (mRNA)

levels. Also LA prevented the activation of nuclear factor

NF-Kappa B (NF-jB) in these experiments (Jiang et al.

2013; Liu et al. 2011a, b; Xu et al. 2013).

However, thus far, the effect of J. sellowii as an anti-

inflammatory herb as indicated by its use in Brazilian tra-

ditional medicine has not been investigated. No scientific

study regarding this species was found in the literature to

support its use.

Taking into consideration: (1) the importance of the

regulation of cytokines and other mediators in inflamma-

tory diseases; (2) the increasing use of herbs to treat

inflammation; and (3) the relative lack of studies focusing

on the anti-inflammatory mechanism of action of plants

used as anti-inflammatory agents in traditional medicine. In

this study, the anti-inflammatory potential of J. sellowii

was explored in a murine model of pleurisy induced by

carrageenan (Cg).

This study tried to demonstrate the impact and the

possible mechanism of the anti-inflammatory action of the

crude extract (CE) of J. sellowii, its derived fractions and

isolated compounds on several proinflammatory parame-

ters. The following parameters were studied: leukocyte

content, degree of exudation, myeloperoxidase (MPO) and

adenosine-deaminase (ADA) activities, nitric oxide

metabolites (NOx), interleukin-1b (IL-1b), TNF-a and

interleukin-17A (IL-17A) levels and the mRNA expression

of all studied cytokines. Also the mRNA expression of

inducible nitric oxide synthase (iNOS) was analysed. Fur-

thermore, we investigated the effect of the isolated

compounds (SA and LA) on p65 protein phosphorylation

[p-p65 Nuclear factor NF-kappa B (NF-jB)].

Materials and methods

Plant material

The leaves of J. Sellowii were collected in Rio Negr-

inho, Santa Catarina, Brazil, in March 2012. Plant

identification was performed by the botanist Dr. Ademir

Reis from the botany department at the Federal Uni-

versity of Santa Catarina, and a voucher specimen (RB

number 537.991) is preserved in the Jardim Botanico at

Rio de Janeiro, Brazil.

Drugs and reagents

The following drugs and reagents used were purchased

from Sigma Chemical Co. (St Louis, MO, USA): carra-

geenan (degree IV), human neutrophil myeloperoxidase,

indomethacin, adenosine, Evans blue dye, ortho-dianisi-

dinedihydrochloride (3,30dimethoxybenzidine), phenol,

sulphanilamide, sodium azide, sodium nitroprussiate,

naphthylethylendiamidedihydrochloride, phosphoric acid,

vanadium chloride III and all primers. Dexamethasone

was purchased from Ache Pharmaceutical Laboratories

S.A. (Sao Paulo, SP, Brazil). Sodium hydrogen phos-

phate, zinc sulphate and hydrogen peroxide were

purchased from Vetec (Rio de Janeiro, RJ, Brazil).

Sodium hydroxide was purchased from Reagen (Rio de

Janeiro, RJ, Brazil). Turk–May–Grunwald dye was

obtained from Newprov (Pinhais, PR, Brazil), and

Giemsa dye was obtained from Laborclin (Pinhais, PR,

Brazil). ELISA kits for mouse IL-1b, TNF-a, IL-17A and

the Insta One Phospho-NF-jB p-65 (Ser536) were

obtained from IBL Immuno Biological Laboratories Co.,

Ltd. (Fujioka-city, Gunma, Japan), BD Biosciences

Pharmingen (San Diego, CA, USA) and eBioscience, Inc.

(San Diego, CA, USA), respectively. PCR-grade agarose

was purchased from Laboratorios Conda (Torrejon de

Ardoz, Madri, Spain), and Brazol� and ethidium bromide

were purchased from LGC Biotecnologia (Cotia, SP,

Brazil). DNase grade I� and the RevertAid H Minus First

Strand cDNA synthesis kit were purchased from Fer-

mentas (Burlington, Ontario, Canada). All other reagents

used were of analytical grade and obtained from several

commercial sources.

M. Nader et al.

Extraction and isolation

Fresh leaves of J. Sellowii (1.77 kg) were extracted

exhaustively at room temperature with ethanol and water

(3 L, 50:50, v/v) for 30 days. After evaporation of the

solvent under reduced pressure using a Rotavapor� R-210

(BuchiLabortechnik AG, Flawil, Switzerland), 65.9 g of

the hydro-alcoholic crude extract (CE) from J. sellowii was

obtained. This CE was then dissolved in water (600 mL)

and partitioned with solvents of increasing polarity,

yielding n-hexane (Hex: 0.414 g), dichloromethane (DCM:

0.973 g), ethyl acetate (EtOAc: 0. 590 g) and n-butanol

(BuOH: 0.574 g) fractions, as well as a residual aqueous

fraction (Aq) that was lyophilised to give a hygroscopic

solid matrix (31.9 g). An aliquot of this solid (9.5 g) was

solubilized in water and subjected to vacuum liquid chro-

matography (VLC) using RP-18 silica (230–400 mesh)

(Lichroprep Merck, Darmstadt, Germany). Elution was

carried out using different gradients of water and methanol

(100:0, 70:30, 50:50, 30:70, and 0:100), yielding five sub-

fractions (A, B, C, D and E, 100 mL each). Sub-fraction E

(0.185 g) presented a good chromatographic profile and

was partly soluble in methanol (20 mL), then filtered using

a C-18 cartridge (Varian ChemElut, CA, USA) to retain

non-polar compounds. Subsequently, the eluted sub-frac-

tion (0.154 g) was purified in a Sephadex LH-20 column

(GE Healthcare, UK) using acetone–methanol (1:1) as

eluent. 27 sub-fractions of 20 mL were obtained (Fig. 1).

Thin layer chromatography was performed, and sub-frac-

tions 10–14 and 24–27 exhibited the same chemical

pattern, so they were reunited, affording lactic acid (LA:

33.4 mg) and succinic acid (SA: 9.1 mg), respectively.

Characterisation of the isolated compounds

1H and 13C NMR spectra were obtained using a high-res-

olution Bruker AVANCE-400 MHz NMR spectrometer

(Bruker, Fremont, CA, USA), at a frequency of 400 MHz

for 1H and 100 MHz for 13C. Deuterium oxide (D2O) was

used as a solvent and tetramethylsilane (TMS) as a

chemical shift reference. The isolated compounds LA and

SA presented a spectral grade purity superior to 99 %.

Lactic acid

Colourless liquid. 1H NMR: d1.25 (d, J = 7 Hz, H-1), 4.22

(q, J = 7 Hz, H-2). 13C NMR: d 21.9 (C-1), 69.6 (C-2),

182.4 (C-3).

Succinic acid

White solid.1H NMR: d 2.47 (s, H-2 and H-3). 13C NMR: d34.4 (C-2 and C-3), 181.2 (C-1 and C-4).

Animals

One-month-old female Swiss mice weighing 18–21 g

were randomly divided into the following 13 groups of

five animals each: 1 = negative control group =

received only an intrapleural injection of sterile saline

(0.9 % NaCl, i.pl.), 2 = vehicle control group =

receive only an intrapleural injection of sterile saline

(0.9 % NaCl) plus dimethylsulfoxide (10 %),

3 = positive control group = received only Cg (1 %)

dissolved in 0.9 % NaCl administered intrapleurally

(i.pl.), 4 and 5 = reference anti-inflammatory drugs

groups = received an intraperitoneal (i.p.) injection of

dexamethasone (Dex: 0.5 mg/kg) or indomethacin

(Indo: 5 mg/kg, i.p.) 30 min before Cg, and groups

6–13 each received an intraperitoneal injection of dif-

ferent doses of CE, its derived fractions (Hex, DCM,

EtOAc, BuOH, and Aq) or isolated compounds (SA,

LA) 30 min before Cg. In order to dissolve the low

polarity of fractions (Hex, DCM and EtOAc) a maxi-

mum of 10 % of dimethylsulfoxide was added to the

fraction solution (0.9 % NaCl). The animals were

housed under standardised conditions (room tempera-

ture of 21 ± 2 �C, with 12 h alternating periods of

light and darkness and 50–60 % humidity) and had free

access to a standard mouse diet and water. This study

was approved by the Committee for Ethics in Animal

Research at Federal University of Santa Catarina

(license no. PP00757) and the experiments were per-

formed in accordance with the principles stated in the

Guide for Care and Use of Laboratory Animals

[National Council of Animal Experimentation Control

(COSEA)].

Induction of pleurisy

Pleurisy was induced by a single intrapleural injection of

0.1 mL 1 % Cg (diluted in 0.9 % NaCl), as previously

described by Saleh et al. (1996). After 4 h, animals were

euthanised with an overdose of pentobarbital (180 mg/kg,

i.p.). The thoracic cavity was exposed and washed with

1.0 mL sterile phosphate buffered saline [PBS, pH 7.6,

composition: NaCl (130 mmol); Na2HPO4 (5 mmol);

KH2PO4 (1 mmol), and distilled water (1,000 mL) con-

taining heparin (20 IU/mL)]. The fluid leakage was

collected for further quantification of total and differential

leukocyte content, degree of exudation, MPO and ADA

activities, as well as NOx and cytokine (IL-1b, TNF-a and

IL-17A) levels. Lung tissue samples were collected for

further the analysis of IL-1b, TNF-a, IL-17A, iNOS

mRNA expression and the measurement of p65 protein

phosphorylation (p-p65 NF-jB).

Jungia sellowii suppresses the carrageenan-induced inflammatory

Experimental protocol

To determine the doses of the plant material to be

used in subsequent experiments, dose–response curves

of the CE, its derived fractions and isolated com-

pounds were performed. Therefore, different groups of

animals were treated with different doses of CE

(10–50 mg/kg, i.p.), Hex (25–50 mg/kg, i.p.), DCM

(25–50 mg/kg, i.p.), EtOAc (25–50 mg/kg, i.p.), BuOH

(10–50 mg/kg, i.p.), Aq (1–25 mg/kg, i.p.), SA

(0.5–2.5 mg/kg, i.p.) or LA (0.5–2.5 mg/kg, i.p.), 0.5 h

prior to pleurisy induction. The total and differential

leukocyte content and the degree of exudation were

analysed after 4 h.

Based on the results of single doses of the plant material,

which were able to significantly inhibit the leukocyte

content and the degree of exudation, doses were selected

for each group (CE: 25 mg/kg, BuOH: 25 mg/kg, Aq:

5 mg/kg, SA: 1 mg/kg and LA: 1 mg/kg) to evaluate the

effect of the herb on MPO and ADA activities and NOx, IL-

1b, TNF-a, and IL-17A levels, IL-1b, TNF-a, IL-17A and

iNOS mRNA expression levels and p65 protein phos-

phorylation (p-p65 NF-jB). All parameters were analysed

4 h after pleurisy induction.

Fig. 1 Flow diagram of the

extraction process of Jungia

sellowii leaves. VLC vacuum

liquid chromatography

M. Nader et al.

Determination of leukocyte content and degree

of exudation

After euthanising the animals with an overdose of anaes-

thetic and exposing the pleural cavity, the fluid leakage was

collected for the analysis of total and differential leukocyte

content and the degree of exudation. The total leukocyte

count was performed in a veterinarian automatic counter

adjusted to mouse parameters (MINDRAY, BC-2800 Vet,

Nanshan, Shenzhen, China), and the cytospin preparations

were stained using May–Grunwald–Giemsa dye for the

differential count (Saleh et al. 1996).

The animals were injected with 0.2 mL Evans blue dye

(25 mg/kg) by the intravenous route 10 min before

receiving the herb treatment to evaluate the degree of

exudation. The concentration of the dye was determined by

interpolation from a standard Evans blue dye curve

(0.01–50 lg/mL) by colorimetric measurements at 620 nm

on an enzyme-linked immunosorbent assay (ELISA) plate

reader (OrganonTeknika, Roseland, NJ, USA).

Determination of MPO and ADA activities

The determination of MPO and ADA activities was con-

ducted in accordance with previously described

methodology (Giusti and Galanti 1984; Rao et al. 1993). In

both in-house assays, the concentration of the enzymes in

samples of the fluid leakage from the pleural cavity was

estimated by interpolation from a standard curve by col-

orimetric measurements at 450 and 630 nm, respectively,

on an ELISA plate reader (OrganonTecknica, Roseland,

NJ, USA).

Determination of NOx levels

The amount of nitrite (NO2-) and nitrate (NO3

-), as

indicators of NO production, was determined in samples

from the fluid leakage from the pleural cavity by the Griess

method (Green et al. 1982). The concentration of metab-

olites was determined by interpolation from a standard

curve of sodium nitrite (0–150 lM) by colorimetric mea-

surements at 540 nm on an ELISA plate reader

(OrganonTecknika, Roseland, NJ, USA).

Determinations of IL-1b, TNF-a and IL-17A levels

To quantify the proinflammatory cytokines (IL-1b, TNF-aand IL-17A) in the fluid leakage from the pleural cavity,

commercially available ELISA kits containing monoclonal

antibodies for each cytokine were used according to the

instructions of the manufacturer. The ranges of values

detected by these assays were as follows: IL-1 b,

11.72–750 pg/mL; TNF-a, 5–2.000 pg/mL; and IL-17A,

4–500 pg/mL. The intra-assay coefficients of variation

(CV) were as follows: IL-1b, 3.6 ± 0.5 %; TNF-a,

7.8 ± 0.9 %; and IL-17A, 7.5 ± 1.7 %. The inter-assay

CV were as follows: IL-1b, 9.0 ± 1.7 %; TNF-a,

9.6 ± 2.1 %; and IL-17A, 6.2 ± 0.9 %. Sensitivity values

were as follows: IL-1b, 1.67 pg/mL; TNF-a, 5.0 pg/mL;

and IL-17A, 4.0 pg/mL. The quantification of these cyto-

kines was obtained by interpolation from a standard curve

by colorimetric measurements at 450 nm on an ELISA

plate reader (OrganonTeknika, Roseland, NJ, USA).

Semi-quantification of the mRNA expression levels

of IL-1b, TNF-a, IL-17A and iNOS

Total ribonucleic acid (RNA) was extracted from lung

tissue samples (200 mg) using Brazol� (1,000 mL) plus

chloroform (200 mL) and 75 % isopropyl alcohol (500 lL,

V/V). After 15 min of centrifugation (12,0009g at 4 �C),

the precipitate was washed with 75 % ethanol (1,000 lL,

V/V). The pellets were dissolved in a 0.1 % diethylpyro-

carbonate (DEPC)/water solution (100 lL, V/V). The RNA

concentration was determined using a Picodrop Microliter

UV/Vis spectrophotometer (Picodrop Ltd., Hinxton, Cam-

bridge, UK). The total RNA (1 lg/lL) was mixed with

DNase Grade I (1 lL) to obtain the complementary

deoxyribonucleic acid (cDNA) according to the manufac-

turer’s instructions. The DNase-treated RNA (500 ng) was

added to a solution containing OligodT (12–18) (1 lL) and

reverse transcriptase (1 lL) in accordance with the manu-

facturer’s protocol. All reactions were performed in a

thermocycler (Life Technologies Corporation, Carlsbad,

CA, USA). The primer design for specific genes was based

on the sequences published in Gen-Bank and the poly-

merase chain reaction (PCR) conditions of our protocol

(Table 1). Primers for b-actin were used as the reverse

transcriptase control (internal control) for PCR analysis.

The PCR products were separated by electrophoresis using

an agarose gel (1 %) containing ethidium bromide (0.5 lg/

mL) and then visualised on an ultraviolet transilluminator

(Amersham Biosciences AB, Uppsala, Sweden). The rela-

tive amount of the reverse transcription-polymerase chain

reaction (RT-PCR) products was determined by digital

photography followed by densitometric analysis of the

ethidium bromide-stained agarose gels normalised against

the internal control using Photo-Capt image version 12.4

for Windows� to quantify the intensity.

Measurement of p65 protein phosphorylation

(p-p65-NF-jB)

In this assay, mouse lung tissue was collected (20 mg) to

evaluate the effect of the isolated compounds, SA and LA,

on p65 protein phosphorylation (NF-jB). A commercially

available kit, Insta One Phospho-NF-jB p 65 (Ser536)

ELISA Kit (eBioscience, San Diego, CA, USA), with

monoclonal specific antibodies against phosphorylated

mouse p65 protein was used following the manufacturer’s

protocol. The absorbance of the samples was obtained at

450 nm on an ELISA plate reader (OrganonTeknika,

Roseland, NJ, USA). The total protein content was mea-

sured with a Lowry assay (Lowry et al. 1951) and adjusted

to 60 lg protein per sample in all studied groups to stan-

dardise the p65 protein phosphorylation analysis. The

results are expressed as relative fold change in comparison

with the negative control group, which represents the basal

level of p-65 phosphorylation.

Data analysis

To assess data normality and the homogeneity of variances,

the Shapiro–Wilks test was used. The data are presented as

the mean ± standard error of the mean (SEM) and percent

of five animals per group. Significant differences between

groups were determined by two-way analysis of variance

(ANOVA) followed by the Newman–Keuls post hoc test.

Values of p \ 0.05 were considered significant. All sta-

tistical analyses were performed with GraphPad Prism

software (version 3.0) (San Diego, CA, USA).

Results

Phytochemical analysis

The phytochemical study of the aqueous residual sub-

fraction E from J. sellowii revealed the presence of two

major simple carboxylic acids, LA and SA, representing

57.2 and 14.3 % of this sub-fraction, respectively. These

compounds were identified using NMR spectral data, and

the proton and carbon chemical shift values were in

agreement with the published data (Williams et al. 2002;

Buzas et al. 2003; Nord et al. 2004) (Fig. 2a, b).

Inflammatory parameters analysis

It is important to note that there was no significant differ-

ences between animals treated with vehicle [0.9 % NaCl

plus dimethylsulfoxide (10 %)] in comparison with ani-

mals treated only with sterile saline (0.9 % NaCl) or

animals treated only with phosphate buffer saline (PBS, pH

7.6) upon the studied pro-inflammatory parameters

(p [ 0.05) (results not shown).

Effect of J. sellowii extract and fractions on leukocyte

content and degree of exudation

In comparison to the positive control group the CE sig-

nificantly inhibited, in a dose-dependent manner, the

leukocyte content at doses of 25 mg/kg (% inhibition:

42.8 ± 2.9 %) and 50 mg/kg (% inhibition: 66.8 ± 5.8 %)

(p \ 0.01). This inhibitory effect was associated with a

significant decrease in neutrophils (% inhibition: 25 mg/kg:

40.3 ± 3.4 % and 50 mg/kg: 65.8 ± 6.0 %) (p \ 0.01).

However, the same effect was not observed in relation to

mononuclear cells (p [ 0.05). Additionally, the CE at

doses of 10–50 mg/kg was able to reduce the degree of

exudation (% inhibition: 10 mg/kg: 31.2 ± 3.8 %, 25 mg/

kg: 51.4 ± 3.3 % and 50 mg/kg: 37.8 ± 2.8 %) (p \ 0.01)

(Table 2).

The BuOH fraction showed similar results to the CE,

inhibiting leukocytes (% inhibition: 25 mg/kg: 42.8 ±

5.3 % and 50 mg/kg: 29.8 ± 4.4 %) (p \ 0.01) and neu-

trophils (% inhibition: 25 mg/kg: 40.0 ± 5.9 % and 50 mg/

kg: 28.0 ± 4.4 %) (p \ 0.01) at the same studied doses. At

a dose of 25 mg/kg, this fraction markedly decreased

mononuclear cells (% inhibition: 25 mg/kg: 78.2 ± 4.6 %)

(p \ 0.05). All doses of this fraction (10–50 mg/kg)

Table 1 The primers and conditions used in RT-PCR reactions

Gene Primers Ampliconpb PCR

cycles

Temp. (oC)

of denaturing

Temp. (oC)

of annealing

Temp. (oC)

of extension

Genebank

register

b-actin CCAACCGTGAAAAGATGACC 616 30 95 52 72 BC138614.1

CAGTAATCTCCTTCTGCATCC

IL-1b CAGGCAGGCAGTATCACTCA 350 35 95 53 72 BC11437.1

GGCCACAGGTATTTTGTCG

TNF-a CTGGGACAGTGACCTGGACT 204 36 95 50 72 BC137720.1

CACCTCAGGGAAGAGTCTG

IL-17A TCTCTGATGCTGTTGCTGCT 195 38 95 48 72 BC119309.1

GTGGAACGGTTGAGGTAGT

iNOS GCATCCATGCAAAGAATGTG 282 40 95 51 72 NC000077.5

GCAGCCTCTTGTCTTTGACC

All PCR reactions were performed using a period of 5 min at 95 �C. The cycles were followed by a period of 7 min at 72 �C

M. Nader et al.

reduced the degree of exudation (% inhibition: 10 mg/kg,

58.2 ± 4.0 %, 25 mg/kg: 67.6 ± 3.2 % and 50 mg/kg:

76.5 ± 3.6 %) (p \ 0.01) (Table 2).

The Aq fraction showed a better performance than the

CE or the BuOH fraction in inhibiting leukocytes and the

degree of exudation given that it decreased these studied

Fig. 2 1H NMR spectrum of sub-fraction E (400 MHz, methanol-d4), showing the predominant presence of the lactic (1) and succinic (2) acids

(a) Overloaded 1H NMR spectra of the isolated compounds lactic acid (1) and succinic acid (2) (400 MHz, deuterium oxide) (b)

parameters at lower doses (1–5 mg/kg). At doses of

5–25 mg/kg, this fraction reduced the leukocyte content (%

inhibition: 5 mg/kg: 49.8 ± 4.5 %, 10 mg/kg: 60.7 ±

5.2 % and 25 mg/kg: 47.4 ± 5.0 %) (p \ 0.01) and neu-

trophil content (% inhibition: 5 mg/kg: 47.8 ± 4.6 %,

10 mg/kg: 59.8 ± 5.2 % and 25 mg/kg: 45.9 ± 5.3 %)

(p \ 0.01). At doses of 1–15 mg/kg this fraction also

decreased both mononuclear cells (% inhibition: 1 mg/kg:

59.5 ± 6.9 %, 5 mg/kg: 77.2 ± 5.8 %, 10 mg/kg: 76.8 ±

4.4 % and 25 mg/kg: 70.7 ± 3.6 %) (p \ 0.05) and the

degree of exudation (% inhibition: 1 mg/kg: 58.4 ± 3.9 %,

5 mg/kg: 73.4 ± 3.2 %, 10 mg/kg: 41.4 ± 2.7 % and

25 mg/kg: 70.0 ± 3.1 %) (p \ 0.01) (Table 2).

The Hex, DCM and EtOAc fractions reduced the degree

of exudation (p \ 0.05), but did not decrease the leukocyte

content (p [ 0.05) (data not shown), and for this reason

these fractions were not analysed further.

Based on the results showed above, the Aq fraction was

chosen for further isolation of the active compounds SA

and LA.

The isolated compounds presented similar anti-inflam-

matory action patterns. SA and LA at doses of 1.0 and

2.5 mg/kg decreased the leukocyte content (% inhibition:

1 mg/kg SA: 24.9 ± 6.8 %, 2.5 mg/kg SA: 54.4 ± 2.9 %,

1 mg/kg LA: 31.2 ± 4.3 % and 2.5 mg/kg LA: 66.3 ±

5.3 %) (p \ 0.01) and neutrophils (% inhibition: 1 mg/kg

SA: 25.6 ± 6.3 %, 2.5 mg/kg SA: 53.2 ± 3.3 %, 1 mg/kg

LA: 31.8 ± 4.2 % and 2.5 mg/kg LA: 66.2 ± 5.2 %)

(p \ 0.01). These compounds also decreased mononuclear

cells at a dose of 2.5 mg/kg (% inhibition: SA:

73.9 ± 2.7 % and LA: 74.2 ± 5.6 %) (p \ 0.05). Further,

SA and LA reduced the degree of exudation at all tested

doses (% inhibition: 0.5 mg/kg SA: 15.0 ± 2.6 %, 1 mg/

kg SA: 41.7 ± 5.0 %, and 2.5 mg/kg SA: 42.9 ± 4.8 %,

Table 2 Effect of the crude extract of Jungia sellowii, its derived fractions and isolated compounds on leukocyte content and degree of

exudation in a murine model of pleurisy induced by carrageenan

Groups/

(mg/kg)

Leukocytes (9106)

(% of inhibition)

Neutrophils (9106)

(% of inhibition)

Mononuclears (9106)

(% of inhibition)

Exudation (lg/mL)

(% of inhibition)

Sala 0.93 ± 0.12 0.13 ± 0.03 0.80 ± 0.11 1.16 ± 0.09

Cga 5.70 ± 0.20 5.21 ± 0.25 0.49 ± 0.08 11.18 ± 0.30

CE 10b 5.14 ± 0.22 4.90 ± 0.22 0.24 ± 0.03 7.69 ± 0.43 (31.2 ± 3.8 %)**

CE 25b 3.26 ± 0.16 (42.8 ± 2.9 %)** 3.11 ± 0.18 (40.3 ± 3.4 %)** 0.15 ± 0.03 5.44 ± 0.36 (51.4 ± 3.3 %)**

CE 50b 1.90 ± 0.33 (66.8 ± 5.8 %)** 1.78 ± 0.31 (65.8 ± 6.0 %)** 0.12 ± 0.03 6.96 ± 0.31 (37.8 ± 2.8 %)**

BuOH 10b 5.63 ± 0.30 5.35 ± 0.26 0.28 ± 0.05 4.68 ± 0.45 (58.2 ± 4.0 %)**

BuOH 25b 3.26 ± 0.30 (42.8 ± 5.3 %)** 3.12 ± 0.30 (40.0 ± 5.9 %)** 0.14 ± 0.03 (78.2 ± 4.6 %)* 3.63 ± 0.36 (67.6 ± 3.2 %)**

BuOH 50b 4.00 ± 0.25 (29.8 ± 4.4 %) ** 3.75 ± 0.23 (28.0 ± 4.4 %)** 0.25 ± 0.04 2.63 ± 0.40 (76.5 ± 3.6 %)**

Aq1b 5.18 ± 0.20 4.93 ± 0.17 0.25 ± 0.04 (59.5 ± 6.9 %)* 4.65 ± 0.44 (58.4 ± 3.9 %)**

Aq 5b 2.86 ± 0.26 (49.8 ± 4.5 %)** 2.72 ± 0.24 (47.8 ± 4.6 %)** 0.14 ± 0.04 (77.2 ± 5.8 %)* 2.98 ± 0.35 (73.4 ± 3.2 %)**

Aq 10b 2.24 ± 0.30 (60.7 ± 5.2 %)** 2.10 ± 0.27 (59.8 ± 5.2 %)** 0.14 ± 0.03 (76.8 ± 4.4 %)* 6.56 ± 0.30 (41.4 ± 2.7 %)**

Aq 25b 3.00 ± 0.28 (47.4 ± 5.0 %)** 2.82 ± 0.27 (45.9 ± 5.3 %)** 0.18 ± 0.02 (70.7 ± 3.6 %)* 3.35 ± 0.34 (70.0 ± 3.1 %)**

SA 0.5b 4.94 ± 0.09 4.52 ± 0.08 0.42 ± 0.03 9.50 ± 0.30 (15.0 ± 2.6 %)**

SA 1b 4.28 ± 0.39 (24.9 ± 6.8)** 3.88 ± 0.33 (25.6 ± 6.3)** 0.40 ± 0.07 6.52 ± 0.56 (41.7 ± 5.0 %)**

SA 2.5b 2.60 ± 0.16 (54.4 ± 2.9)** 2.44 ± 0.17 (53.2 ± 3.3)** 0.16 ± 0.02 (73.9 ± 2.7)* 6.39 ± 0.54 (42.9 ± 4.8 %)**

LA 0.5b 5.12 ± 0.14 4.64 ± 0.13 0.48 ± 0.04 8.56 ± 0.32 (23.4 ± 2.9 %)**

LA 1b 3.92 ± 0.24 (31.2 ± 4.3 %)** 3.55 ± 0.22 (31.8 ± 4.2 %)** 0.37 ± 0.03 6.67 ± 0.66 (40.3 ± 5.9 %)**

LA 2.5b 1.92 ± 0.30 (66.3 ± 5.3 %)** 1.76 ± 0.27 (66.2 ± 5.2 %)** 0.16 ± 0.03 (74.2 ± 5.6 %)* 5.30 ± 0.36 (52.6 ± 3.4 %)**

Dex 0.5b 1.59 ± 0.04 (72.0 ± 0.1 %)** 1.26 ± 0.13 (75.9 ± 2.4 %)** 0.34 ± 0.09 5.90 ± 0.11 (47.2 ± 1.0 %)**

Indo 5b 1.85 ± 0.02 (67.5 ± 0.3 %)** 1.54 ± 0.25 (70.4 ± 2.8 %)** 0.31 ± 0.12 6.88 ± 0.32 (38.5 ± 2.9 %)**

Crude extract (CE: 10–50 mg/kg) of Jungia sellowii, its derived fractions: n-butanol fraction (BuOH: 10–50 mg/kg) and aqueous fraction (Aq:

1–25 mg/kg) and isolated compounds: succinic acid (SA: 0.5–2.5 mg/kg) and lactic acid (LA: 0.5–2.5 mg/kg) administered 0.5 h before pleurisy

induction by carrageenan (1 %). Sal = negative control group = animals treated only with sterile saline solution (NaCl 0.9 %), Cg = positive

control group = animals treated only with carrageenan (1 %), Dex = animals pre-treated with dexamethasone (0.5 mg/kg). Indo = animals pre-

treated with indomethacin (5.0 mg/kg)

Each group represents the mean ± SEM of five animals. * p \ 0.05 and ** p \ 0.01a Administered by intrapleural route (i.pl.)b Administered by intraperitoneal route (i.p.)

M. Nader et al.

and 0.5 mg/kg LA: 23.4 ± 2.9 %, 1 mg/kg LA:

40.3 ± 5.9 % and 2.5 mg/kg LA: 52.6 ± 3.4 %)

(p \ 0.01) (Table 2).

The reference anti-inflammatory drugs (Dex: 0.5 mg/kg

and Indo: 5 mg/kg) significantly inhibited these inflam-

matory parameters (p \ 0.01) with the exception of the

mononuclear cell migration (p [ 0.05) (Table 2).

Effect of J. sellowii on MPO and ADA activities

MPO and ADA are important markers of activated leuko-

cytes (Frode and Medeiros 2001). However, the cellular

mechanisms governing the response of these enzymes in the

mouse model of pleurisy induced by Cg have yet to be

elucidated. The effect of J. sellowii upon these enzymes can

assist in the elucidation of the cellular anti-inflammatory

action of this herb. When compared to the positive control

group, the CE (25 mg/kg), BuOH fraction (25 mg/kg), Aq

fraction (5 mg/kg) and the isolated compounds (SA: 1 mg/kg

and LA: 1 mg/kg), drastically reduced the MPO (% inhibi-

tion: CE: 60.1 ± 1.6 %, BuOH: 60.9 ± 1.3 %, Aq:

67.5 ± 1.1 %, SA: 58.8 ± 3.9 % and LA: 65.9 ± 2.8 %)

and ADA activities (% inhibition: CE: 45.2 ± 2.3 %, BuOH:

51.2 ± 8.0 %, Aq: 63.9 ± 5.8 %, SA: 37.5 ± 6.0 % and

LA: 64.4 ± 6.7 %) (p \ 0.01) (Table 3).

The anti-inflammatory drugs Dex (0.5 mg/kg) and Indo

(5 mg/kg) also inhibited MPO and ADA activities

(p \ 0.01) (Table 3).

Effect of J. sellowii on NOx levels and mRNA

expression of iNOS

Nitric oxide (NO) is known to participate in the inflammatory

process, increasing vascular permeability and inflammatory

cell infiltration (Redington 2006). As shown in Fig. 4a, NOx

levels were markedly inhibited by the CE, its derived frac-

tions and isolated compounds (p \ 0.01), with a percentage

inhibition by CE (25 mg/kg) of 40.7 ± 1.1 %,by BuOH

(25 mg/kg) of 62.0 ± 4.0 %, by Aq (5 mg/kg) of

70.4 ± 0.8 %, by SA (1 mg/kg) of 73.8 ± 2.6 % and by LA

(1 mg/kg) of 76.5 ± 1.4 % (Fig. 3a).

Furthermore, at the same conditions, this herb reduced

the mRNA expression levels of iNOS in lung tissues (%

inhibition: 25 mg/kg CE: 49.4 ± 1.6 %, 25 mg/kg BuOH:

68.5 ± 0.7 %, 5 mg/kg Aq: 56.7 ± 0.9 %, 1 mg/kg SA:

49.1 ± 1.1 % and 1 mg/kg LA: 59.1 ± 2.3 %) (p \ 0.01)

(Fig. 3b).

Dex (0.5 mg/kg) and Indo (5 mg/kg) also significantly

decreased both NOx levels and mRNA expression of iNOS

(p \ 0.01) (Fig. 3).

Effect of J. sellowii on of IL-1b, TNF-a and IL-17A

levels and mRNA expression levels of these cytokines

The proinflammatory cytokines IL-1b, TNF-a, and IL-17A

have an important role in leukocyte chemotaxis, and they

have been detected at high concentrations at sites of acute

Table 3 Effect of the crude extract (CE) of Jungia sellowii, its derived fractions and isolated compounds on MPO and ADA activities in a

murine model of pleurisy induced by carrageenan

Groups/doses (mg/kg) MPO (mU/mL) (% of inhibition) ADA (U/L) (% of inhibition)

Sala 78.82 ± 2.50 1.51 ± 0.04

Cga 449.00 ± 22.76 6.22 ± 0.25

CE 25b 179.20 ± 7.23 (60.1 ± 1.6 %)** 3.41 ± 0.15 (45.2 ± 2.3 %)**

BuOH 25b 175.60 ± 5.94 (60.9 ± 1.3 %)** 3.04 ± 0.50 (51.2 ± 8.0 %)**

Aq 5b 146.00 ± 4.94 (67.5 ± 1.1 %)** 2.25 ± 0.36 (63.9 ± 5.8 %)**

SA 1b 184.80 ± 17.69 (58.8 ± 3.9 %)** 3.89 ± 0.37 (37.5 ± 6.0 %)**

LA 1b 153.30 ± 12.81 (65.9 ± 2.8 %)** 2.22 ± 0.42 (64.4 ± 6.7 %)**

Dex 0.5b 115.80 ± 3.15 (74.2 ± 0.7 %)** 2.20 ± 0.36 (64.6 ± 5.8 %)**

Indo 5b 108.50 ± 5.63 (75.8 ± 1.2 %)** 3.00 ± 0.41 (51.8 ± 6.6 %)**

Crude extract (CE: 25 mg/kg) of Jungia sellowii, its derived fractions: n-butanol fraction (BuOH: 25 mg/kg) and aqueous fraction (Aq: 5 mg/kg)

and isolated compounds: succinic acid (SA: 1 mg/kg) and lactic acid (LA: 1 mg/kg), administered 0.5 h before pleurisy induction by carrageenan

(1 %) on myeloperoxidase (MPO) and adenosine-deaminase (ADA) activities. Sal = negative control group = animals treated only with sterile

saline solution (NaCl 0.9 %), Cg = positive control group = animals treated only with carrageenan (1 %), Dex = animals pre-treated with

dexamethasone (0.5 mg/kg). Indo = animals pre-treated with indomethacin (5.0 mg/kg)

Each group represents the mean ± SEM of five animals. ** p \ 0.01a Administered by intrapleural route (i.pl.)b Administered by intraperitoneal route (i.p.)

inflammation (Mazzon and Cuzzocrea 2007; Liu et al.

2011a, b; Guo et al. 2013). In comparison to the positive

control group, J. sellowii decreased the proinflammatory

cytokine levels with a percentage inhibition for each

cytokine as follows: IL-1b: CE (25 mg/kg): 78.3 ± 2.0 %,

BuOH (25 mg/kg): 21.3 ± 1.5 %, Aq (5 mg/kg):

74.2 ± 1.5 %, SA (1 mg/kg): 24.6 ± 1.2 % and LA

(1 mg/kg): 14.9 ± 1.3 % (Fig. 4a) (p \ 0.01); TNF-a: CE

(25 mg/kg): 61.9 ± 3.4 %, BuOH (25 mg/kg):

50.7 ± 2.7 %, Aq (5 mg/kg): 55.1 ± 2.7 %, SA (1 mg/

kg): 82.4 ± 2.3 % and LA (1 mg/kg): 63.3 ± 2.7 %

(Fig. 5a) (p \ 0.01). Additionally, the herb decreased IL-

17A as follows: CE (25 mg/kg): 64.0 ± 6.4 %,BuOH

(25 mg/kg): 61.6 ± 6.6 %, Aq (5 mg/kg): 54.3 ± 2.6 %,

SA (1 mg/kg): 41.93 ± 4.0 % and LA (1 mg/kg):

21.2 ± 5.4 % (Fig. 6a) (p \ 0.01).

Because the studied plant was able to inhibit the protein

levels of proinflammatory cytokines (IL-1b, TNF-a, and

IL-17A), we wondered whether this inhibition could also

have occurred in relation to the inhibition of the mRNA

expression of these cytokines. In these experiments at the

same conditions we observed a significant decrease in the

IL-1b, TNF-a, and IL-17A mRNA levels in lung tissues

with a percentage of inhibition as follows: IL-1b mRNA:

CE 25 mg/kg: 49.1 ± 2.4 %, BuOH 25 mg/kg: 59.7 ±

2.7 %, Aq 5 mg/kg: 41.9 ± 5.6 %, SA 1 mg/kg: 34.3 ±

5.5 % and LA 1 mg/kg: 55.2 ± 1.1 % (Fig. 4b)

(p \ 0.01); TNF-a mRNA: CE 25 mg/kg: 44.1 ± 2.3 %,

BuOH 25 mg/kg: 58.1 ± 2.1 %, Aq 5 mg/kg: 43.7 ±

1.6 %, SA 1 mg/kg: 35.0 ± 1.6 % and LA 1 mg/kg:

50.1 ± 2.1 % (Fig. 5b) (p \ 0.01) and IL-17A mRNA: CE

25 mg/kg: 45.8 ± 2.0 %, BuOH 25 mg/kg: 59.9 ± 1.6 %,

Sal Cg Dex Indo CE BuOH Aq SA LA

**** **

Jungia sellowii Less. (mg/Kg, i.p.)

25 525 1 1

**** **

S / β

Fig. 3 Effects of the crude

extract (CE: 25 mg/kg) isolated

from Jungia sellowii leaves, its

derived fractions the n-butanol

fraction (BuOH: 25 mg/kg) and

the aqueous fraction (Aq: 5 mg/

kg) and the isolated compounds

succinic acid (SA: 1 mg/kg) and

lactic acid (LA: 1 mg/kg)

administered 0.5 h prior to

carrageenan (1 % Cg, i.pl.) in a

murine model of pleurisy on

nitrite/nitrate levels in the fluid

pleural cavity (a) and mRNA

expression levels of inducible

nitric oxide synthase in lung (b).

Sal = negative control

group = animals treated only

with sterile saline solution

(0.9 % NaCl); Cg = positive

control group = animals treated

only with 1 % Cg;

Dex = animals pre-treated with

dexamethasone (0.5 mg/kg).

Indo = animals pre-treated with

indomethacin (5.0 mg/kg). Bars

represent the mean ± SEM of

five animals. ** p \ 0.01

M. Nader et al.

Aq 5 mg/kg: 35.7 ± 1.6 %, SA 1 mg/kg: 32.2 ± 5.9 %

and LA 1 mg/kg: 39.6 ± 4.3 % (Fig. 6b) (p \ 0.01).

Dex (0.5 mg/kg) and Indo (5 mg/kg) inhibited both the

protein and mRNA levels of IL-1b, TNF-a and IL-17A

(p \ 0.01) (Figs. 4, 5, 6).

Effect of the isolated compounds on p65 protein

phosphorylation (p-p65-NF-jB)

The nuclear transcription factor NF-jB plays a pivotal role

in physiological processes and in the response to injury and

inflammation (Hoesel and Schmid 2013). Our analysis

revealed that SA (1 mg/kg) and LA (1 mg/kg) decreased

NF-jB p65 phosphorylation with a percent inhibition of

76.6 ± 7.7 % and 68.9 ± 3.6 %, respectively (p \ 0.01)

(Fig. 7). The same inhibition was observed in animals pre-

treated with Dex (0.5 mg/kg) (p \ 0.01) but not Indo

(5 mg/kg) (p [ 0.05) (Fig. 7).

Discussion

Our results have demonstrated, for the first time, the anti-

inflammatory properties of the hydro-alcoholic extract of

leaves of J. sellowii. Previously, there was only one study

by Casado et al. (2010) demonstrating the anti-inflamma-

tory and anti-oxidant effects of J. paniculata, using in vitro

[NO production in RAW 264.7 macrophages and secretory

phospholipase A2 (sPLA2) inhibition assay] and in vivo

[carrageenan-induced paw oedema in rats and 12-O-tetra-

decanoylphorbol-13-acetato (TPA)-induced ear oedema in

mice] experiments.

** ****

**** **

25 525 1 1

β ( ρ

25 1 1

/ β-a

aqueous fraction (Aq: 5 mg/kg)

and the isolated compounds

interleukin-1b (IL-1b) levels in

the fluid pleural cavity (a) and

mRNA expression levels of IL-

1b in lung (b). Sal = negative

only with sterile saline solution

only with 1 % Cg;

Our research found that J. sellowii markedly inhibited

leukocyte content, as well as the degree of exudation.

Moreover, the Aq fraction had a more potent anti-inflam-

matory capacity than the BuOH (25 mg/kg) fraction or

other fractions (Hex: 25 mg/kg, DCM: 25 mg/kg and

EtOAc: 25 mg/kg), given that lower doses (5 mg/kg) of the

Aq fraction decreased the studied parameters to the same

extent has higher doses of the other fractions.

To analyse leukocyte activation, we chose two enzymes,

MPO, which is related to neutrophil activation, and ADA,

which is associated with mononuclear cell activation

(Frode and Medeiros 2001). In these experiments, we

showed that J. sellowii decreased both MPO and ADA

activities, demonstrating that its leaves not only inhibited

the leukocyte content but also leukocyte activation at the

site of the inflammatory response.

Another important mediator in the inflammatory process

is NO, which regulates vascular tone and influences cyto-

kine synthesis by leukocytes (Tripathi et al. 2007).

Moreover, the induction of iNOS, which promotes the

release of NO, has been implicated in the pathogenesis of

inflammation and also contributes to the exudation process

(Cuzzocrea et al. 2000). Therefore, inhibition of iNOS,

which leads to a decrease in the generation of NO and

prevents the oxidative stress (Conforti and Menichini

2011), is an important target for the treatment of inflam-

mation. Under the investigated conditions, J. sellowii

decreased both NOx levels and the expression of iNOS,

thus demonstrating that this plant possesses antioxidant

activity in addition to its anti-inflammatory properties.

During inflammation, the release of proinflammatory

cytokines such as IL-1 b, TNF-a, and IL-17A determines

the propagation of this process (Kolaczkowska and Kubes

2013). IL-1 b, TNF-a, and IL-17A are the key inflamma-

tory mediators because they can induce the production of

proinflammatory cytokines and chemokines (Chu 2013;

Song and Qian 2013). Therefore, cellular manipulation of

the production of these proinflammatory cytokines is

******

25 525 1 1

( ρg/

** ****

25 525 1 1

/ β-a

the aqueous fraction (Aq: 5 mg/

kg) and the isolated compounds

tumour necrosis factor-a (TNF-

a) levels in the fluid pleural

cavity (a) and mRNA

expression levels of TNF-a in

lung (b). Sal = negative control

only with 1 % Cg;

five animals. **p \ 0.01

M. Nader et al.

important in determining the outcome of the inflammatory

response (Chu 2013; Song and Qian 2013). In this study, it

has been demonstrated for the first time that J. sellowii

significantly affected the protein levels and the gene

expression of IL-1 b, TNF-a, and IL-17A. These results

support the possibility of a post-transcriptional downregu-

lation of these cytokines by this plant.

To assess whether the isolated compounds SA and LA

could be responsible for the anti-inflammatory effect of J.

sellowii, we studied their effect on the same proinflam-

matory parameters. Our results showed that these

compounds reduced the leukocyte content, degree of exu-

dation, proinflammatory enzyme (MPO and ADA)

activities, NOx levels, the production/expression of proin-

flammatory cytokines (IL-1 b, TNF-a, and IL-17A) and the

mRNA expression levels of iNOS. It is important to note

that CE, and its derived fractions (BUOH, Aq) and isolated

compounds (LA and SA) presented the same anti-inflam-

matory effect by inhibiting all these pro-inflammatory

parameters, but Aq fraction, LA and SA demonstrated

greater anti-inflammatory activity than BUOH or CE

because lower dose of them (5 mg/kg for Aq), (1 mg/kg for

LA or SA) inhibited the same inflammatory parameters as

higher doses of BUOH and CE (25 mg/kg).

We also investigated whether these effects were

dependent on the inhibition of a well-known transcriptional

factor involved in inflammation, NF-jB (Hoesel and Sch-

mid 2013). The NF-jB pathway can be activated by

various signalling molecules, such as TNF-a, lipopoly-

saccharides (LPS), and IL-1b (Hoesel and Schmid 2013).

Also NF-jB is responsible for increasing the transcrip-

tional synthesis of TNF-a, IL-1b and iNOS (Diamant and

Dikkstein 2013). So the inhibition of this transcriptional

factor is critical to the downregulation of the inflammatory

** ******

25 525 1 1

aqueous fraction (Aq: 5 mg/kg)

and the isolated compounds

interleukin-17A (IL-17A) levels

in the fluid pleural cavity

(a) and mRNA expression

levels for IL-17A in lung (b).

Sal = negative control

only with 1 % Cg;

response. Our results demonstrated that both compounds

(LA and SA) showed important inhibitory effect against

NF-jB p65 activation specifically through their inhibitory

action on the phosphaorylation of the p65 (Real A) NF-jB

subunit. These findings suggest that the mechanism of the

anti-inflammatory action of J. sellowii may be via the

decreases in the TNF-a, IL-1b and iNOS levels that are at

least partly due to the ability of the major isolated com-

pounds (LA and SA) to inhibit the activation of NF-jB.

Also it is interesting to mention that LA inhibited the

p65 (Real A) NF-jB subunit below the baseline, but did

not decrease the IL-1b protein levels to a large degree. The

possible explanation to these results may be attributed

since although, IL-1b synthesis requires the transcriptional

involvement mainly by NF-kB activation, more recently is

observed that in the cytosol of resident macrophages have a

large amount of inactive IL-1b precursor (dos Santos et al.

2012). When the inflammatory stimulus (danger/stress

signal) was detected by these cells the innate immune

response beginning, and the intracellular cascade start. The

activation of certain nucleotide oligomerization domain

(NOD)-like receptors (NLRs) leads to assembly the in-

flammasome, a high-molecular-weight platform for the

activation of caspase-1 that are required for proteolytic

maturation and release pre-formed proinflammatory cyto-

kine such as IL-1b and also IL-18 from the cytosol

(Dinarello 2009; Kepp et al. 2011; Rubartelli et al. 2011).

Based on these results we can hypothesised that LA is able

to reduce the NF-kB activation, but probably not the in-

flammasome activation, that in the last instance leads

amount of IL-1b, including pre-formed IL-1b and those

that needs maturation.

Also it is important to mention that J. Sellowii its

derived fractions and isolated compounds presented similar

anti-inflammatory action pattern that the reference drugs

dexamethasone and indomethacin showing that the herb

and the reference drugs have at least some common via of

anti-inflammatory action.

The results of our study are in accordance with previous

reports that demonstrated the anti-inflammatory properties

of SA and LA. It has been reported that SA can impair

neutrophils’ phagocytic killing capacity and reduce the

ability of these cells to respond to chemotactic stimuli to

formyl-methionyl-leucyl-phenylalanine and C5a. This

effect occurs in conjunction with an impairment of the

respiratory burst (Rotstein et al. 1985). Other studies have

demonstrated that LA reduced TNF-a and IL-6 mRNA

expression levels by decreasing IjBa phosphorylation and

blocking the dissociation of the IKK complex, which pre-

vents NF-jB activation upon stimulation by LPS (Jiang

et al. 2013; Liu et al. 2011a, b; Xu et al. 2013).

Conclusion

In conclusion, the results demonstrate that J. sellowii has

an important anti-inflammatory effect in the development

of pleurisy induced by Cg that can be attributed, to some

extent, to inhibition of the leucocyte content and decrease

of the degree of exudation. This effect can also be asso-

ciated with the inhibition of the activities of the

proinflammatory enzymes MPO and ADA, the decrease of

NOx levels and the mRNA expression level of iNOS, as

well as the decrease of cytokine (IL-1b, TNF-a and IL-

17A) levels and their mRNA expression levels. Moreover,

both SA and LA may play a major role in the anti-

inflammatory properties of this plant, potentially through

NF-jB inhibition. These results provide the basis for fur-

ther studies to determine the potential of the herb as a

therapeutic agent for inflammatory disorders. Further

studies are required to determine the precise mechanism of

the action involved.

Acknowledgments This study was supported by grants from the

Coordenacao de Aperfeicoamento de Pessoal de Nıvel Superior

(CAPES), Brazil, and the Conselho Nacional de Pesquisa e Desen-

volvimento (CNPq), Brazil.

Conflict of interest The authors declare that they have no conflicts

of interest to disclose.

Sal Cg Dex Indo SA LA

Fig. 7 Effects of the isolated compounds succinic acid (SA: 1 mg/

kg) and lactic acid (LA: 1 mg/kg) from Jungia sellowii administered

0.5 h prior to carrageenan (1 % Cg, i.pl.) in a murine model of

pleurisy on p-65 phosphorylation (p-p65 NF-jB) in lung. Sal = neg-

ative control group = animals treated only with sterile saline solution

(0.9 % NaCl); Cg = positive control group = animals treated only

with 1 % Cg; Dex = animals pre-treated with dexamethasone

(0.5 mg/kg). Indo = animals pre-treated with indomethacin

(5.0 mg/kg). The results were expressed in relative fold change in

comparison to Sal, which represents the basal level of p-65

phosphorylation. Bars represent the mean ± SEM of five animals.

** p \ 0.01

M. Nader et al.

References

Buzas M, Chira N, Deleanu C, Rosca S (2003) Identification and

quantitative measurement by 1H-NMR spectroscopy of several

compounds present in Romanian wines. Rev Chim 54:831–833

Casado R, Landal A, Calvol JJ, Del Terencio MDC, Calvo MI (2010)

Anti-inflammatory and antioxidant activities of Jungia panicu-

lata. Pharm Biol 48:897–905

Chu W (2013) Tumor necrosis factor. Cancer Lett 328:222–225

Conforti F, Menichini F (2011) Phenolic compounds from plants as

nitric oxide production inhibitors. Curr Med Chem

18:1137–1145

Cuzzocrea S, Mazzon E, Calabro G, Dugo L, De Sarro A, Van De

Loo FAJ, Caputi AP (2000) Inducible nitric oxide synthase—

knockout mice exhibit resistance to pleurisy and lung injury

caused by carrageenan. Am J Respir Crit Care Med

162:1859–1866

De-La-Cruz H, Vilcapoma G, Zevallos PA (2007) Ethnobotanical

study of medicinal plants used by the Andean people of Canta,

Lima, Peru. J Ethnopharmacol 111:284–294

Diamant G, Dikkstein R (2013) Transcriptional control by NF-kappa

B: elongation in focus. Biochem Biophys Acta 1829:937–945

Dinarello CA (2009) Immunological and inflammatory functions of

the interleukin-1 family. Annu Rev Immunol 27:519–550

dos Santos G, Kutuzov MA, Ridge KM (2012) The inflammasome in

lung diseases. Am J Physiol Lung Cell Mol Physiol

303(8):L627–L633

Frode TS, Medeiros YS (2001) Myeloperoxidase and adenosine-

deaminase levels in the pleural fluid leakage induced by

carrageenan in the mouse model of pleurisy. Mediat Inflamm

10:223–227

Giusti G, Galanti B (1984) Adenosine deaminase: colorimetric

method. In: Bergmeyer HU (ed) Methods of enzymatic analysis.

Verlang Chemie Press, Weinheim, pp 315–323

Goleniowski ME, Bongiovanni GA, Palacio L, Nunez CO, Cantero JJ

(2006) Medicinal plants from the ‘‘Sierra de Comechigones’’,

Argentina. J Ethnopharmacol 107:324–341

Green IC, Wagner DA, Glowski J, Skipper PL, Wishnok JS,

Tannenbaum SB (1982) Analysis of nitrate, nitrite and [15N]

nitrate in biological fluids. Anal Biochem 126:131–138

Guo J, Gu N, Chen J, Shi T, Zhou Y, Rong Y, Zhou T, Yang W, Gui

X, Chen W (2013) Neutralization of interleukin-1 beta attenuates

silica-induced lung inflammation and fibrosis in C57BL/6 mice.

Arch Toxicol 87:1963–1973

Hammond GB, Fernandes ID, Villegas LF, Vaisberg AJ (1998) A

survey of traditional medicinal plants from the Callejon de

Huaylas, Department of Ancash, Peru. J Ethnopharmacol

61:17–30

Hoesel B, Schmid J (2013) The complexity of NF-jB signaling in

inflammation and cancer. Mol Cancer 12(86):1–15

Jiang J, Xu G, Shi Y, Qiao Y, Hu G, Ren X (2013) Lactic acid inhibits

lipopolysaccharide-induced translocation of NF-jB p65 from

cytoplasm to nucleus and transcription of nuclear factor-jB p65

and cyclooxygenase 2. AAS 44:204–209

Katinas L, Pruski J, Sancho G, Tellerıa MC (2008) The subfamily

Mutisioideae (Asteraceae). Bot Rev 74:469–716

Kepp O, Galluzzi L, Kroemer G (2011) Mitochondrial control of the

NLRP3 inflammasome. Nat Immunol 12:199–200

Kolaczkowska E, Kubes P (2013) Neutrophil recruitment and

function in health and inflammation. Nat Rev Immunol

13:159–175

Liu J, Xue J, Zhu Z, Hu G, Ren X (2011a) Lactic acid inhibits NF-jB

activation by lipopolysaccharide in rat intestinal mucosa micro-

vascular endothelial cells. ASC 10:954–959

Liu Y, Mei J, Gonzales L, Yang G, Dai N, Wang P, Zhang P, Favara

M, Malcom KC, Guttentag S, Worthen GS (2011b) IL-17A and

TNF-a exert synergistic effects on expression of CXCL5 by

alveolar type II cells in vivo and in vitro. J Immunol

186:3197–3205

Lowry OH, Rosebrough NJ, Farr AL, Randall RJ (1951) Protein

measurement with the folin phenol reagent. J Biol Chem

193:265–267

Marchant R, Almeida L, Behling H, Berrrio JC, Bush M, Cleef A,

Duivenvoorden J, Kappelle M, De Oliveira P, De Oliveira-Filho

AT, Lozano-Garcia S, Hooghiemstra H, Ledru M, Ludlow-

Wiechers B, Markgraf V, Mancini V, Paez M, Prieto A, Rangel

O, Salgado-Labouriau ML (2002) Distribution and ecology of

parent taxa of pollen lodged within the Latin American Pollen

Database. Rev Palaeobot Palynol 21:1–75

Mazzon E, Cuzzocrea S (2007) Role of TNF-a in lung tight junction

alteration in mouse model of acute lung inflammation. Respir

Res 8:1–19

National Research Council (1989) Roots and tubers in lost crops of

the Incas: Little known plants of the Andes with promise for

worldwide cultivation. National Academy Press, Washington,

pp 67–73

Nord LI, Vaag P, Duus J (2004) Quantification of organic and amino

acids in beer by 1H NMR spectroscopy. Anal Chem

76:4790–4798

Rao TS, Currie JL, Shaffer AF, Isakson PC (1993) Comparative

evaluation of arachidonic acid (AA)-and tetradecanoylphorbol

acetate (TPA)-induced dermal inflammation. Inflammation

17:723–741

Redington AE (2006) Modulation of nitric oxide pathways: thera-

peutic potential in asthma and chronic obstructive pulmonary

disease. Eur J Pharmacol 533:263–276

Rehecho S, Uriarte-Pueyo I, Calvo J, Vivas LA, Calvo MI (2011)

Ethnopharmacological survey of medicinal plants in Nor-

Yauyos, a part of the Landscape Reserve Nor-Yauyos-Cochas,

Peru. J Ethnopharmacol 133:75–85

Rotstein OD, Pruett TL, Firgel VD, Nelson RD, Simmons RL (1985)

Succinic acid, a metabolic by-product of Bacteroides species,

inhibits polymorfonuclear leukocyte function. Infect Immun

48:402–408

Rubartelli A, Gattorno M, Netea MG, Dinarello CA (2011) Interplay

between redox status and inflammasome activation. Trends

Immunol 32:559–566

Saleh TS, Calixto JB, Medeiros YS (1996) Anti-inflammatory effects

of theophylline, cromolyn and salbutamol in a murine model of

pleurisy. Br J Pharmacol 118:811–819

Song X, Qian Y (2013) IL-17 family cytokines mediated signaling in

the phatogenesis of inflammatory diseases. Cell Signal

25:2335–2347

Tripathi P, Tripathi LK, Singh V (2007) The role of nitric oxide in

inflammatory reactions. FEMS Immunol Med Microbiol

51:443–452

Williams LN, Petterson KA, Roberts JD (2002) The Conformations of

1,4-butanedioic acid as a function of solvent polarity in a series

of alcohols as determined by NMR spectroscopy. J Phys Chem A

106:7491–7493

Xu G, Jiang J, Wang M, Li J, Su J, Ren X (2013) Lactic acid reduced

LPS-induced TNF-a and IL-6 mRNA levels through decreasing

IjBa phosphorylation. JIA 12:1073–1078

Jungia sellowii suppresses the carrageenan-induced inflammatory response in the mouse model of...

Documents

Transcript of Jungia sellowii suppresses the carrageenan-induced inflammatory response in the mouse model of...

Annonaceous acetogenin mimic AA005 suppresses human ...

Preparation and evaluation of chitosan/carrageenan beads for controlled release of sodium diclofenac

Diethylcarbamazine attenuates the development of carrageenan-induced lung injury in mice

Antibacterial Activity of Polyethylenimine/Carrageenan Multilayer against Pathogenic Bacteria

Antioxidant, Anti-Inflammatory, and Immunomodulatory ... - MDPI

Butyricicoccus pullicaecorum in inflammatory bowel disease

Potential of blend of kappa-carrageenan and cellulose derivatives forgreen polymer electrolyte application

Lavender oil suppresses indoleamine 2,3-dioxygenase activity in human PBMC

Crim1 suppresses left ventricular hypertrophy - Spandidos ...

Systemic inflammatory response syndrome

NON-STEROIDAL ANTI-INFLAMMATORY DRUGS (NSAIDs):

The deubiquitinase USP9X suppresses pancreatic ductal adenocarcinoma

Polyphenol-rich pomegranate fruit extract (POMx) suppresses PMACI-induced expression of pro-inflammatory cytokines by inhibiting the activation of MAP Kinases and NF-κB in human KU812

Prurigo Pigmentosa: An under-recognized inflammatory ...

Inhibition of CXCR2 profoundly suppresses inflammation-driven and spontaneous tumorigenesis

Inflammatory myofibroblastic tumors in childhood

TRIM29 suppresses TWIST1 and invasive breast cancer behavior

Advanced Oral Antibacterial/Anti-inflammatory Technology

Cholesterol efflux in megakaryocyte progenitors suppresses platelet production and thrombocytosis

Diminution of eIF4E activity suppresses parkin mutant phenotypes