YEAST VOL. 12: 425438 (1996)

Yeast Protein Translocation Comdex: Isolation of Two Genes SEBl and SEB2 Encoding'Proteins Homologous to the SecGlp subunit JAANA TOIKKANENt, EVELINA GATTIS, KOHJI TAKEIS, MARKKU SALOHEIMO?, VESA M. OLKKONENS, HANS SODERLUNDT, PIETRO DE CAMILLIS AND SIRKKA KERANEN*tf

t VTT, Biotechnology and Food Research, PO Box 1500, FIN-02044 VTT, Finland $Department of Cell Biology and Howard Hughes Medical Institute, Yale University School of Medicine, New Haven, CT 06510, U. S. A. §Department of Biochemistry, National Public Health Institute, Munnerheimintie 166, FIN-00300 Helsinki, Finland

Received 13 July 1995; accepted 12 October 1995

A yeast gene (cDNA clone) was isolated in a screen for suppressors of secretion-defective secl5-1 mutation. This gene encodes a protein homologous to the p subunit of the mammalian Sec61 protein complex functioning in protein translocation into the endoplasmic reticulum (ER). The predicted protein, Seblp, consists of 82 amino acids and contains one potential membrane-spanning region at the C-terminus but no N-terminal signal sequence. Seblp shows 30% identity to the mammalian Sec61P subunit and 34% identity to the Arabidopsis thalianu Sec61P subunit. Overexpression of SEBl from a multicopy plasmid suppressed the temperature sensitivity of sec61-2 and sec61-3 mutants. Immunofluorescence and immunoelectron microscopy indicated that Seblp resides in the ER membranes with the hydrophilic N-terminus exposed to the cytoplasm. The in vitro translated Seblp was post-translationally inserted into microsomal membranes. As the chromosomal disruption of the SEBl gene was not lethal, potential homologous genes were screened by heterologous hybridization. The SEBl homologue thus isolated, SEB2, encodes a protein 53% identical to Seblp. Disruption of the chromosomal SEB2 was not lethal whereas the double disruption of SEBl and SEB2 resulted in a temperature-sensitive phenotype. This study further emphasizes the evolutionary conservation of the ER protein translocation apparatus and provides novel genetic tools for its functional analysk The sequences of SEBl and SEB2 have been deposited in the EMBL database under Accession Numbers 247789 and 250012, respectively. The sequence of the Sebl protein is identical to that of Sbhlp independently identified by Panzner et al. (Cell 81, 561-570. 1995) using a biochemical approach.

KEY WORDS - Saccharomyces cerevisiae; endoplasmic ret~culum; Sec6 1 p; translocation complex; genetic interaction; Seb 1 p/Sbhl p; Seb2p

INTRODUCTION Remarkable progress has been made during the past few years in our understanding of protein translocation into the endoplasmic reticulum (ER; for recent reviews see Larriba, 1993; Dobberstein, 1994; Ng and Walter, 1994; Schekman, 1994). In mammalian cells translocation into the ER occurs mainly cotranslationally, whereas in yeast many proteins are efficiently translocated post- translationally as demonstrated by in vitro assays. The first step in the cotranslational translocation is targeting and attachment of the nascent

*Corresponding author.

polypeptide chain to the ER membrane via inter- action between the signal sequence and the signal recognition particle and its receptor. After this step the secreted protein is translocated into the ER lumen through a multisubunit translocation complex. The main component of this complex is the Sec61 protein, first discovered in the yeast Succhuromyces cerevisiue by genetic means.

The yeast SEC61 and two other genes, SEC62 and SEC63, were identified in a screen for mutants defective in protein translocation into the ER (Deshaies and Schekman, 1987). Null mutation of each of these three genes is lethal and pairwise combinations of specific mutant alleles result in

CCC 0749-503X/96/050425-14 0 1996 by John Wiley & Sons Ltd

426 J . TOIKKANEN ET AL.

synthetic phenotypes indicating genetic interaction in an essential function (Rothblatt et al., 1989). Two further genes, SEC71 and SEC72, were later identified by a similar genetic screen (Green et al., 1992; Kurihara and Silver, 1993; Feldheim and Schekman, 1994). The four proteins, Sec62p, Sec63p, Sec7lp and Sec72p, have been shown to form a multisubunit protein complex which can be crosslinked to the Sec61 complex, suggesting that these two protein complexes may function together in the translocation process (Deshaies et al., 1991). The Sec61 protein (Stirling et al., 1992) was found to share structural features and a low level of sequence homology with the Escherichia coli SecY protein which is part of the bacterial protein translocation complex (Cerretti et al., 1983; Akiyama and Ito, 1987). The mammalian hom- ologue of Sec6lp (Sec6la) was identified by a biochemical approach (Gorlich et al., 1992) and it was found to be part of a protein complex contain- ing two smaller proteins of 14 and 8 kDa (Gorlich and Rapoport, 1993). The Sec6lplSec6lalSecY is an integral membrane protein spanning the bilayer several times. It is the main component of the complex (Deshaies et al., 1991) which makes contact with the nascent polypeptide chain and ribosome during translocation both in yeast (Musch et al., 1992; Sanders et al., 1992) and in mammals (Mothes et al., 1994).

The genes coding for the two smaller subunits of the mammalian Sec61 translocation complex were recently cloned and named SEC61p and SEC6ly (Hartmann et al., 1994). The y subunit gene is homologous to, and can functionally replace the yeast SSSl gene previously isolated as a mu1tico;y suppressor of the sec61-2 temperature-sensitive mutation (Esnault et al., 1993). The y subunit was reported to show homology to E. coli SecEp, another component of the bacterial translocation complex, and to related proteins in other bacteria (Hartmann et al., 1994). The mammalian and y subunits have a single potential membrane-spanning region at the C-terminus, whereas the yeast Ssslp has only a 14 amino acid hydrophobic stretch unable to span the membrane bilayer (Esnault et al., 1993). Based on a detailed analysis of the yeast components involved in the translocation process, Panzner et al. (1995) suggest that the trimeric Sec61 complex participates in both cotranslational and post-translational trans- location. In the former it functions in close con- nection with the ribosome and in the latter

in connection with the other protein complex consisting of Sec62p, Sec63p, Sec7lp and Sec72p.

Here we report the cloning of two genes, SEBI and SEB2, which encode proteins homologous to the p subunit of the Sec61 translocation complex. One of them, SEBl , is shown to display genetic interaction with SEC61 and encodes a protein, Seblp, which we show to be localized in the ER. Double disruption of chromosomal SEBl and SEB2 results in temperature-sensitive phenotype. While this work was in progress, Panzner et al. (1 995) independently reported the identification and characterization of a yeast Sec61 p subunit, Sbhlp. The protein was identified by partial amino acid sequencing of a small protein present in the Sec61 complex. Sbhlp is identical to Seblp.

MATERIALS AND METHODS

Yeast strains and culture conditions The yeast strains are shown in Table 1. The

strains NY179 and BY23 were obtained from Peter Novick, Yale University. The RSY strains, originating from Randy Schekman, University of California, Berkeley, were obtained from Susan Ferro-Novick, Yale University. Yeast cells were grown either in YPD (1% yeast extract, 2% peptone, 2% glucose) or in synthetic complete medium, SC (Sherman et al., 1983). Selective media were SC-Ura and SC-Trp lacking uracil and tryptophan, respectively. Wild-type yeast was grown at 30°C and mutant strains at 25°C. Meiosis and sporulation were induced by growing patches on plates (0.1% Bacto Yeast extract, 1% potassium acetate, 0.05% glucose and 2% Bacto agar).

Plasmids and transformation methods YEpSEBl is the original clone isolated during a

screen for secl5-1 suppressors using the HS33-1 strain (Aalto et al., 1993). The clone was derived from a cDNA library (McKnight and McConaughy, 1983) on a multicopy plasmid in which the gene expression is regulated by the ADHl promoter. YEpSEB2 was isolated from the same cDNA library by heterologous hybridization using an SEBl specific probe. The cDNA of SEBl was transferred as a PCR fragment to E. coli plasmid pBluescript SK - (Stratagene, La Jolla, CA) between EcoRI and Hind111 sites to obtain pBSEBl . Construction of pBSEBl A for disruption of the chromosomal gene in yeast is described below. A hemagglutinin (HA)-tagged form of

YEAST PROTEIN TRANSLOCATION COMPLEX 427

Table 1 . Yeast strains

Strain Genotype Sourcelref.

HS33-1 NY179 BY23 H 1046 H 1048 RSY151 RSY455 RSY524 RSY529

a secl5-1 ade2-1 his4-260 leu2-3,112 trpl (Hindlll) ura3-52 a, leu2-3,112 ura3-52 ala leu2lleu2 ura3lura3 Gal +- lGal +- ala leu2lleu2 ura3lura3 sebl:: URASISEBI Gal + lGal+- a leu2-3,112 ura3-52 sebl:: URA3 a sec63-I leu2-3,112 ura3-52 a sec61-3 leu2-3,112 ura3-52 his4 trpl-1 HOLl-I a sec6I-2 leu2-3,112 ura3-52 his4 ade2 a sec62-I leu2-3,112 ura3-52 his4

Aalto et al. (1993) P. Novick P. Novick This work This work R. Schekman R. Schekman R. Schekman R. Schekman

Seblp was constructed by inserting a 9 amino acids epitope (YPYDVPDYA) of the influenza virus HA by PCR at the N-terminus of the protein. The HA-SEB1 fragment was transferred to the yeast expression vector pVTlOOU (Vernet et al., 1987) to obtain YEpHA-SEB1 in which the expression is driven by a shortened form of the ADHl promoter. pVT102U (Vernet et al., 1987) was used as a vector control. For expression in mammalian cells the HA-SEB1 fragment was cloned into the pRC/RSV expression vector (Invitrogen, Netherlands). For yeast transformation (Gietz et al., 1992; Hill et al., 1991), single-stranded salmon sperm DNA, 50 pg/transformation mix, was used as carrier and 10% DMSO was added before a 15-min heat shock at 42°C. COS-7 cells were transiently transfected by a Ca2+ phosphate procedure (Hanson et al., 1989). COS cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% heat- inactivated fetal calf serum, 100 U/ml penicillin and 100 U/ml streptomycin.

DNA and RNA methods Standard DNA methods were used (Sambrook

et al., 1989). DNA sequencing was done in both directions using the dideoxy chain-termination method (Sanger et al., 1977) with the modified T7 polymerase (USB, Cleveland, Ohio) and with vector or insert sequence-specific oligonucleotide primers. The sequences were analysed with the PC-Gene (Intelligenetics, Switzerland) analysis software, BESTFIT (Smith et al., 1985), BLAST (Altschul et al., 1990) and PILEUP (Feng and Doolitle, 1987) programs of the Genetic Computer Group (Madison, WI). For Southern blotting, 10 pg/lane of yeast chromosomal DNA (Cryer

et al., 1975) was digested with restriction enzymes, separated on 0.8% agarose and transferred to Hybond N membrane (Amersham, UK). The SEBl-specific probe comprising the entire cDNA sequence was labelled with [ R ~ ~ P I ~ A T P (Amersham, UK) using the random primed DNA labeling kit (Boehringer Mannheim, Germany). For cloning of SEB2 a yeast cDNA library (McKnight and McConaughy, 1983) was screened by colony hybridization with a SEBl specific probe under non-stringent conditions (in the pres- ence of 40% formamide at 35°C). For Northern blotting, 1 or 10pg/lane of total yeast RNA (Tollervey and Mattaj, 1987) was treated with glyoxal and electrophoresed on 1% agarose gel, transferred to Hybond N membrane and detected with the same probe as used for the Southern blots. RNA Ladder (BRL, Gaithersburg, MD) was used as a size standard.

Disruption of the chromosomal SEBl and SEB2 Two DNA fragments containing parts of the

SEBl cDNA were generated by PCR using Vent polymerase (New England Biolabs, MA) and 20ng of pBSEBl DNA as a template. The first fragment comprised nucleotides 4-1 30 from the 5’ end of the cDNA and was made using the oligo- nucleotide primers 5’ TGT CAG AGC TCA AAC ACC ACA CTC TAC CTC 3’ (with Sac1 recog- nition site) and 5’ AGA TTG GAT CCT TTC TTT GGA GCG GAT GCC 3’ (with BamHI recognition site). The second fragment comprised nucleotides 35 1-507 from the non-coding region and was made with primers 5’ CGT GAG TCG ACA CGA ACG CGA GAA TTG CCT 3‘ (with SalI recognition site) and 5’ TCC AGG GTA CCT GAA CCA TGA ATT GAA AAA 3’ (with Kpnl

428 J . TOIKKANEN ET AL.

site). The Sad-BamHI fragment was cloned in front of 1.1 kb URA3 insert in plasmid pSFNB274 which is a pBluescript KS+ vector containing URA3 as a Hind111 fragment in the multiple clon- ing site. The SaA-KpnI fragment was then cloned into the multiple cloning site located 3' of URA3 yielding the plasmid pBSEB1A. The URA3- containing disruption cassette was cleaved from the vector sequences with Sac1 and KpnI and used to transform both a haploid (NY179) and a dip- loid (BY23) ura3-52 strain and the Ura+ pheno- type was selected. The SEB2 disruption cassette containing the kanMX4 module (Wach et al., 1994) was made by PCR using 60 nucleotides long primers. The 5' primer contained nucleotides 1 4 0 of the SEB2 cDNA and 20 nucleotides of the template pFA6-kanMX4 specific sequence from the multiple cloning site upstream of the kanMX4 module. The 3' primer contained nucleotides 402441 of the SEB2 cDNA in addition to 20 nucleotides specific to the template sequence downstream of the kanMX4 module. The PCR-made cassette was used to transform both wild-type and SEBl disruptant haploid yeast strain. The transformants were grown in liquid YPD for 3 h and washed with water before plating on YPD containing 200 mg/l of G418 (Geneticin, Gibco, BRL) for selection of G418-resistant phenotype.

Antibodies Rabbit polyclonal antibodies directed against

Seblp were generated using a synthetic peptide corresponding to 18 NH,-terminal residues of the protein, followed by an additional cysteine (MSSPTPPGGQRTLQKRKQC). The peptide was conjugated to keyhole limpet haemocyanine via the COOH-terminal cysteine as described by Johnston et al. (1989). Rabbit polyclonal anti- bodies directed against yeast carboxypeptidase Y (CPY) were obtained from Susan Ferro-Novick (Yale University) and those against yeast Kar2p from Mark Rose (Princeton University). The monoclonal antibody 12CA5 directed against the HA-epitope was from Berkeley Antibodies Co. Inc. (Richmond, CA). Goat anti-rabbit IgG conjugated with CY3 and goat anti-mouse IgG conjugated with DTAF were from Jackson Immunoresearch (West Grove, PA). Goat anti- mouse IgG was from Cappel (Durham, NC). Pro- tein A gold conjugates (diameter 6 nm) were prepared as described (Slot and Geuze, 1985).

Immunojluorescence staining Yeast cells were grown to A,,, 0.5, fixed with

formaldehyde, incubated with zymolyase (ICN Biomedicals, Inc., Costa Mesa, CA) to digest the cell wall, permeabilized with 0.5% SDS and stained as previously described (Brennwald et al., 1994). Transfected COS cells were grown on poly- [Llornithine-coated glass coverslips and fixed with 4% formaldehyde in phosphate buffer containing 4% sucrose. Immunofluorescence was performed as described (Cameron et al., 1991).

Yeast cell fractionation Yeast cells from the early logarithmic growth

phase were collected by centrifugation, converted to spheroplasts in 1.4 M-sorbitol, 50 mM-phosphate buffer pH 7.5 supplemented with 10 mM-NaN,, 40 mM-p-mercaptoethanol and 15 pg/ml of zymolyase as described (Walworth and Novick, 1987) and resuspended in lysis buffer, 10mM- triethanolamine pH 7.2, 0.8 M-sorbitol (Makarow, 1985). Protease inhibitors, antipain 2 pg/ml, apro- tinin 2 pg/ml, chymostatin 2 pg/ml, EDTA 1 mM, leupeptin 2 pg/ml, pepstatin 5 pglml, and PMSF 1 mM, were added and were present throughout the following fractionation procedure carried out in an ice water bath. The centrifugations were done at 4°C. Spheroplasts prepared from 26 A,,, units were lysed in 1 ml of lysis buffer, homogenized by eight strokes in a teflon homogenizer to disrupt aggregates (Walworth et al., 1989) and centrifuged for 3 min, 450g. The supernatant was removed and the pellet was washed with 1 ml of lysis buffer and centrifuged as above. The supernatants were combined (Sl) and centrifuged for lOmin, 10 O O O g in a Sigma K2 centrifuge. The super- natant (S2) was removed and the pellet (P2) was resuspended in lysis buffer. S2 was further centri- fuged for 60 min, 100 000 g in a Beckman table-top ultracentrifuge. The supernatant (S3) was removed and the pellet (P3) was resuspended in lysis buffer. Protein concentrations of the fractions were deter- mined using the BCA protein determination kit (Pierce, Rockford, IL).

Immunoelectron microscopy Yeast cells from early logarithmic growth phase

were converted to spheroplasts as described for yeast cell fractionation. The spheroplasts, resus- pended in the spheroplasting buffer containing the protease inhibitors, were fixed by adding 20 volumes of hypotonic fixative (3% formaldehyde

YEAST PROTEIN TRANSLOCATION COMPLEX

and 0.1% glutaraldehyde in the spheroplast lysis buffer) for 30min at room temperature. The spheroplasts were collected by centrifugation, 3 min at 2200 rpm, resuspended in a small amount of 120 mM-Na-phosphate buffer and embedded in 1% agarose by mixing the sample with the same volume of 2% agarose at 54°C (De Camilli et al., 1983). Agarose sheets (0.17 mm thick) were cut into 3 x 3 mm pieces. The agarose blocks contain- ing the spheroplasts were processed for pre- embedding immunogold labelling as described (Takei et al., 1992). Monoclonal antibody 12CA5, recognizing the HA-epitope, was detected using goat anti-mouse IgG as a bridge, followed by protein A gold conjugates (diameter 6 nm). Post- fixation and plastic embedding were performed as described (De Camilli et al., 1983; Takei et al., 1992).

429

In vitro transcription-translation SEBl was transcribed and translated in vitro

from pBSEBl using the Promega TNT@ T3 coupled reticulocyte lysate system in the presence or absence of the canine pancreatic microsomal membranes (Promega) according to the manu- facturer's instructions. The p-lactamase mRNA supplied with the microsomes was used as a control for the translation of a signal sequence- containing protein. The proteins were labeled with [3H]leucine (Amersham, UK). When studying the post-translational insertion, the translations were performed without microsomes for 60 min at 30°C. Further protein synthesis was inhibited by incu- bation with either RNaseA and DNaseI (both 100 pglml) or with cycloheximide (1 mM) for 20 min prior to 20 min incubation in the presence of the microsomes. The membranes were pelleted through a sucrose cushion (250 mM-sucrose, 50 mM-triethanolamine, pH 7.5) in a Beckman Airfuge (472, 140 000 g, 10 min). The pellets and supernatants were analysed by 15% (p-lactamase) or 17.5% (Seblp) SDS-PAGE and fluorography. The density of the bands was measured with Personal Densitometer SI (Molecular Dynamics, Sunnyvale, CA).

Other methods Isolation of multicopy suppressors and screen-

ing for suppression of the temperature-sensitivity of the see mutants were done as described before (Aalto et al., 1993). Preparation of total yeast cell lysates was done as described before (Keranen,

1986) including the protease inhibitors described above for yeast cell fractionation. For Western blotting the proteins were separated in SDS- PAGE using either the Laemmli (1970) buffer system and 15% or 17.5% gels, or the Schagger and von Jagow (1987) buffer system and 10% gels. The proteins were detected by specific antibodies followed by ['251]protein A, 126 mCi/ml (NEN, Wilmington, DE) or secondary antibody conju- gated to alkaline phosphatase (BioRad, Hercules, CA) .

RESULTS

SEBl and SEB2 encode proteins homologous to See61 p subunit

The SEBl gene was uncovered in a screen for multicopy suppressors of the secl5-1 mutation. Comparison of the predicted Seblp amino acid sequence with the known protein sequences present in databases revealed significant sequence homology with the mammalian and Arabidopsis thuliana p subunit of the Sec61 protein translo- cation complex, hence the name SEBl for s'c61 Beta. Since the disruption of the chromosomal SEBl (described below in detail) was not lethal, heterologous hybridization was used to screen for possible homologues of SEBI. Another clone, SEBZ, was thus isolated from the same cDNA library (McKnight and McConaughy, 1983) as SEBl.

The DNA sequencing revealed an open reading frame of 246 nucleotides and 82 amino acids for SEBl and 264 nucleotides and 88 amino acids for SEBZ (Figure 1). This is in good agreement with the mRNA size determined by Northern analysis using SEBl specific probe by which only one band of 640 bases was detected (data not shown). The deduced molecular weight of Seblp is 8710 daltons and that of Seb2p 9606 daltons. The proteins are 53% identical at the amino acid level and they both contain a hydrophobic stretch of 21 amino acids forming a potential membrane-spanning region at the carboxy terminus. The hydrophobic region is preceded by 54 N-terminal hydrophilic amino acids in Seblp and by 61 amino acids in Seb2p and followed by a tail of seven and six amino acids, respectively. The PI of Seblp predicted from the sequence is 10.99 and that of Seb2p 11.09. Poten- tial sites for post-translational modifications of Seb lp include one N-glycosylation site at position 36. Comparison of the amino acid sequence of the

430 J. TOIKKANEN ET AL.

A GAAAAACACCACACTCTACCTCCTACCATACTCCATAATGTCAAGCCCAACTCCTCCAGG 60

M S S P T P P G

TGGTCAACGTACTTTGAGGZAAGTTCACAAAAAGTTGCGGCATCCGC iao G Q R T L Q K R K Q G S S Q K V A A S A

TCCAAAGAAAAACACGAACAGCAATAATTCGATTTTGAAGATTTATTCTGATGAGGCTAC 180 P K K N T N S N N S I L K I Y S D E A T

GGGACTAAGAGTAGATCCCTTAGTTGTGTTGTTTCTAGCGGTCGGTTTCATCl"lTTCTGl' 240 G L R V D P L V V L P L A V G P I P S V

TGTl'GCATTACATGTTATTTCTAAAGTTWCGGTAAGTTATTTTAAGAATTTTCTTCAGT 300 V A L B V I S K V A G K L F '

A A T G A T T C A G C T T T T A T C C A C C C T A T T T O A C A A A A C A A G A 360

GAATTGCCTTGTTTTGAATAAATTCCTOCCATCCTGCCATCGGATAACGTCCACGGTACTTTTTGATT 420

CAAGTTTCTATAGAAGCACGTATATATCTTTAATACACT?+AATACTTACTTCCACAGAAC 480

B GTTACTAACTGGCCTTAGATATAAGAGGTATGAGAGAGTAGATATATG 60

TGCGTGTGA-GGTAGC~~T~CAGGTGGTATTATCGATCAACAG 120

TATCATAAOAATGGCAGCTTCAGTTCCACCAGGAGGTCAGCGTATCTTGCAGAAGAGAAG 180 Y A A S V P P G G Q R I L Q K R R

ACA~CAATCCATTAAGGAAAAGCAAGCAAAACAAACO 240 Q A Q S I K E K Q A K Q T P T S T R Q A

TGGTTACGGTGOOTCTTCAAGCTCAATTTTGAAGTTATATACGGACGAAGCCAAlQGATT 300 G Y G G S S S S I L K L Y T D E A N G F

C A G A G T C G A C T C C C T T G T C G T A T T A T T O T T C C T A T C T G T C C G T 360 R V D S L V V L F L S V G F I P S V I A

TTTGCATCTATTGACGAAATTTACACACATTATATAATATCAGTAATTTTTTTACATATG 420 L H L L T K F T H I I '

CTAAAGAAAATCGATAATATC

Figure 1. Sequences of the SEBl (A) and SEB2 (B) cDNAs and their encoded proteins. The stop codons are marked with stars. The predicted C-terminal hydrophobic regions of the proteins are underlined.

predicted Sebl and Seb2 proteins to the known sequences in databases (Figure 2) revealed signifi- cant homology to the Sec61P subunit of human and dog (for Seblp 30% and for Seb2p 23% identity) and A. thaliana (34% and 30% identity for Seblp and Seb2p, respectively). The Seblp sequence is identical to that of Sbhlp reported by Panzner et al. (1995) shortly before this manuscript was submitted. All the Sec61P subunits share the domain structure of Seblp and Seb2p, having a hydrophilic N-terminus and a single potential transmembrane region at the C-terminus. As both

Seb proteins are less than 100 amino acids they have not been detected as open reading frames in the yeast genome sequencing project. How- ever, both SEB sequences are found in EMBW GenBank databases and are present in the right arm of chromosome V. SEBl resides between genes ILVl and TRP2 and the sequence is found in the cosmid 9747 (EMBL database, accession number U18839) and SEB2 is between genes MNNl and GPA2 and its sequence is present in the cosmid 9581 (EMBL database accession number U18778).

YEAST PROTEIN TRANSLOCATION COMPLEX 43 1

Sebl Seb2 Atal Sec6lp

Sebl Seb2 Atal Sec6lp

AGXLF THII YFVK TRS

3 4 41 35 50

82 88 82 96

Figure 2. Sequence alignment of related proteins. Identities to Seblp are enclosed within boxes. The sequences of Seblp and Seb2p are from the present report, EMBL database accession numbers 247789 and 250012, respectively. The other sequences were obtained from the GenBank database with the following accession numbers: human Sec61 p, L25085; canine Sec61P, L25052; A. thulium Sec61P, 226753. The human and canine sequences are identical at the amino acid level, thus they are reported only once as Sec610. The predicted C-terminal hydrophobic region is underlined.

Genetic interaction between SEBl and SEC61 genes

As the sequence homologies suggested that SEBl could encode the p subunit of the yeast Sec61 translocation complex, it was of interest to see whether genetic interaction could be detected between SEC61 and SEBl. To this end the sec61-2 and sec61-3 temperature-sensitive mutants (Deshaies and Schekman, 1987; Stirling et al., 1992) were transformed with the multicopy plas- mid, YEpHA-SEB1 . The transformation was done at permissive temperature (25°C) and the growth of the transformants was screened at different temperatures. SEBl rescued the growth of both sec61-2 and sec61-3 at the restrictive temperature. Suppression of sec61-2 was obtained at 36°C (data not shown), whereas suppression of sec61-3 was clearly detected even at 37°C (Figure 3). Over- expression of SEBl did not suppress the temperature-sensitivity of sec62-1 and sec63-1, mutations in two other genes involved in targeting/ translocation of proteins into yeast ER (Deshaies et al., 1991; Sanders et al., 1992). Together with the sequence homology, these results strongly suggest that SEBl functions at the same stage of the secretory pathway as SEC61.

Disruption of chromosomal SEBl and SEB2 The chromosomal SEBl gene was disrupted

both in a diploid and a haploid background by transforming the cells with a DNA fragment carrying SEBl that was disrupted by insertion of the (IRA3 gene. Uraf transformants were

A B C D Figure 3. Rescue of the growth of sec61-3 mutant at the restrictive temperature. The sec61 mutant strains transformed with multicopy plasmid either with or without SEBI were grown at 37°C. (A) pVTlOOU in sec61-3; (B) YEpHA-SEBl in sec61-3; (C) pVTlOOU in sec61-2; (D) YEpHA-SEB1 in sec61-2. Three different transformants of each strain are shown.

obtained equally well in both strains. Southern analysis of the transformants confirmed disruption of the SEBl gene (Figure 4). In the diploid strain one SEBl copy was disrupted and the other remained in wild-type configuration (Figure 4B). The non-lethal phenotype of the haploid dis- ruptant strain was further confirmed by tetrad analysis of the diploid SEBl disruptant. Twenty- five tetrads were dissected and all of them yielded four viable spores. This result could indicate that the function of SEBl is redundant with that of homologous gene(s) and prompted a search for SEBl homologues by heterologous hybridization which resulted in cloning of SEB2. Chromosomal disruption of SEB2 alone was not lethal but disruption of both SEBl and SEB2 in a

432

21.2-

51 5b\= 4.3 -

2.0- 1.9-

1.6- 1.4-

A B 1 2 1 2

0%- 0.83 -

Figure 4. Southern analysis. 10 pg of chromosomal DNA was digested with EcoRl that does not cut within the SEBl gene and analysed in Southern hybridization. The haploid strains (A) analysed were wild-type NY179 (lane 1) and SEBl disruptant H1048 (lane 2). The diploid strains (B) were wild-type BY23 (lane 1) and SEBI disruptant H1046 (lane 2). The double band seen in the disruptant strains is due to an EcoRI site within the Bluescript sequence present in the disruption cassette. The numbers on the left indicate the size in kb of DNA molecules used as size markers.

haploid strain resulted in a temperature-sensitive phenotype at 38°C (data not shown).

Ident@catioiz of the Sebl protein For the detection of the Sebl protein by

immunological methods, polyclonal antibodies were generated in rabbits against a synthetic pep- tide comprising the 18 N-terminal amino acids of Seblp. In Western analysis the endogenous Sebl protein was detected as a band with an apparent size of 9300 daltons (Figure 5, lane l), which is in reasonable agreement with that predicted from the sequence, 8710 daltons. The migration of Seblp remained unchanged when the cells were incubated in the presence of tunicamycin to prevent N-linked glycosylation (data not shown). Under these conditions the unglycosylated form of CPY was readily detected. This shows that the potential

J . TOIKKANEN ET AL.

49.5-

32.5-

27.5-

18.5-

8.0-

1 2 3 Figure 5. Detection of the Sebl protein in Western blots. The yeast cell lysates were analysed in Western blots using the Sebl peptide antibody. The wild-type yeast NY179 (lane 1); SEBl disruptant HI048 (lane 2); NY179 transformed with YEpHA- SEBl (lane 3). Numbers on the left indicate molecular weights of the marker proteins in kDa.

N-glycosylation site present in Seblp was not accessible to glycan addition, consistent with a localization of the N-terminus of the protein on the cytoplasmic side of the ER membrane. An SEBl overexpression strain was constructed by transforming the wild-type yeast with a multicopy plasmid expressing an HA-tagged form of Seblp from the ADHl promoter. The HA-tagged Seblp with nine extra amino acids forming the HA- epitope had an apparent molecular weight of 11 400 (Figure 5 , lane 3). Quantitation by measur- ing the radioactivity present in the bands on the Western filter showed that the level of the HA- tagged Seblp in the overexpression strain was over ten times higher than the level of the endogenous protein. The Sebl protein was absent from the strain in which the SEBl gene was disrupted (Figure 5, lane 2). However, upon longer exposure of the Western blot a weak band migrating at the position of the endogenous Seblp appeared (data not shown). This cross-reacting band most likely represents a protein homologous to Seblp and could well be Seb2p.

Localization of the Sebl protein in the ER demonstrated by immunojluorescence staining

The homology of Seblp to Sec61P and the genetic interaction of SEBl with SEC61 suggest an ER localization of Seblp. To determine whether Seblp indeed localizes in the ER, we performed

YEAST PROTEIN TRANSLOCATION COMPLEX 433

Figure 6. Localization of Sebl protein in the ER of yeast cells. (A) Wild-type yeast (NY 179) overexpressing HA-Seblp stained with Sebl peptide antibody; double labeling with (B) HA antibody and (C) Kar2p antibody. Note the precise colocaliza- tion of Seblp immunoreactivity with Kar2p immunoreactivity. The arrowhead indicates a cell that has lost the YEpHA-SEBI plasmid. Bar indicates 10 pm.

immunofluorescence on wild-type yeast, on yeast cells overexpressing the HA-Seblp and on a hap- loid strain with a disrupted SEBl gene. A typical ER pattern (Preuss et al., 1991) was obtained in the HA-Seblp overexpressing cells, both with the Sebl peptide antibody (Figure 6A) and with the HA-specific antibody (Figure 6B). In double- labeling experiments the HA-specific staining for Seblp (Figure 6B) precisely coincided with stain- ing for Kar2p (Figure 6C), a marker protein of the ER lumen (Rose et al., 1989). The Seblp was barely detectable in wild-type yeast and no staining at all was seen in the strain with the disrupted SEBI gene (data not shown). The subcellular distribution of the Seblp was also studied by differential centrifugations and Western analysis of membrane and soluble fractions prepared from yeast spheroplast lysates. The protein was enriched in the microsomal membranes pelletable at 100 000 g and the overexpression strain showed

Figure 7. Localization of Seblp in the ER of COS cells. COS-7 cells were transfected with the gene encoding HA-Seblp and stained by immunofluorescence. Seblp immunoreactivity shows the typical reticular pattern of the ER in these cells (Takei et al., 1994). Bar indicates 10 pm.

the same distribution of the Sebl protein as the wild-type strain (data not shown), suggesting that Seblp is localized at the ER and that overexpres- sion does not lead to mistargeting of the protein. The Seblp was also expressed in COS-7 cells using the pRC/RSV vector. Also in these cells the Seblp was found to be localized in the ER by immunofluorescence microscopy (Figure 7) as demonstrated by the typical reticular pattern of immunoreactivity (Takei et al., 1994).

Seblp is exposed to the cytoplasmic side of the ER membrane

To analyse the membrane topology of Seblp we performed immunoelectron microscopy of the HA-Seblp overexpression strain. To this aim we used a procedure which we had previously devel- oped for detection of membrane proteins in brain synaptosomes and which involves a lytic fixation followed by immunolabeling of agarose-embedded cell fragments. Yeast spheroplasts were resus- pended in a small volume of the osmotically stabilized spheroplasting buffer and fixed by add- ing a large volume of fixative made in the lysis buffer. Concomitant lysis and fixation allowed preparation of cells which were fixed before they were completely lysed. Fixed cell fragments were then embedded in agarose, labeled by the

434 J . TOIKKANEN ET AL.

Figure 8. Localization of Seblp to the cytoplasmic face of ER membranes by immunoelectron microscopy. Yeast sphero- plasts, prepared from a strain overexpressing the HA-tagged Seblp were fixed hypotonically to allow partial elution of the cytosolic matrix. Organelles are partially disrupted but are still recognizable. Seblp was detected by anti-HA antibody followed by secondary antibody and finally by protein A-conjugated colloidal gold. The labeling is seen exclusively on the cytoplasmic side of the membranes. No labeling is seen in the lumenal side even when the ER membrane is discontinuous (indicated by an arrow) making the lumen accessible to the reagents. ER, vesiculated ER; NE, partially vesiculated nuclear envelope; N, nuclear matrix; PM, plasma membrane. Bar indicates 500 nm.

immunogold procedure and finally plastic embed- ded for ultrathin sectioning (De Camilli et al., 1983; Takei et al., 1992). Anti-HA antibody was used for the primary labeling step. Electron micro- scopic analysis of the preparations revealed the presence of many lysed cells in which the bulk of the cytomatrix had been eluted, thus allowing an optimal accessibility of intracellular membranes. The ER had undergone extensive vacuolation and the nuclear envelope appeared as a series of vacuoles arranged around the swollen nuclear matrix. In these cells, an extensive decoration with immunogold was observed at the cytoplasmic sur- face of a subpopulation of membrane vacuoles including those surrounding the nucleus (Figure 8). The lumenal side of these vacuoles was not decorated with gold even when large disconti- nuities were clearly seen in their membrane, indicating free accessibility of the lumenal side to antibodies and gold particles. Larger membrane fragments forming more open structures or sheets, which were most likely derived from the plasma membrane, were also seen but were not stained. These results, together with those obtained with immunofluorescence staining, indicate that Seb 1 p

Figure 9. Post-translational membrane insertion of Seblp in in vitro transcription-translation assay. The reactions were performed using either (A) SEBI gene or (B) p-lactamase mRNA as the template in the presence or absence of dog pancreatic microsomal membranes and other reagents as indi- cated. Membrane association of the proteins was assayed by pelleting the microsomes through a sucrose cushion. P, pellet; S, supernatant. Signal sequence containing fl-lactamase is indicated by an arrow.

is localized on the yeast ER membrane with its N-terminus exposed to the cytoplasm.

In vitro synthesized Seblp is targeted post-translationally to the microsomal membranes

To obtain more information on the ER mem- brane association of Seblp we performed in vitro transcription-translation assays under different reaction conditions (Figure 9). The microsome association of Seblp was assayed by collecting the microsomal membranes through a sucrose cushion. In the presence of microsomes, about 60% of Seblp associated with the membrane pellet (Figure 9A, lane 3) whereas 90-95% of p-lactamase, used as a control, displayed signal sequence cleavage (Figure 9B, lane 3) and was found in the pellet. If the microsomes were dis- rupted with 1% Triton X-100, the Sebl protein was released almost entirely into the soluble fraction

YEAST PROTEIN TRANSLOCATION COMPLEX

(Figure 9A, lane 6). This indicates that the protein was truly microsome-associated. Post-translational membrane insertion was studied by adding canine microsomes into the in vitro translation mixture after inhibiting further protein synthesis with nucleases or with cycloheximide. Under these conditions the cleaved form of p-lactamase was absent from the pellet (Figure 9B, lanes 7 and 9). In contrast, Seblp was capable of post- translational membrane insertion. More than 30% of the protein was found in the pellet (Figure 9A, lanes 7 and 9). Seblp translated in the absence and in the presence of the membranes had the same apparent molecular weight indicating that the potential N-glycosylation site present in the protein was not used.

435

cases where the genetic interaction reflects surpris- ingly distant functional relationships between the proteins in question (see e.g. Gerst et al., 1992; Esnault et al., 1993). The SEBl gene was isolated as a suppressor of secl5-1, a mutation in a late- acting SEC gene and was subsequently shown to suppress the growth defect of the sec61 mutants. Localization of the Seblp at the ER and the se- quence homology with the Sec61 p subunits suggest that suppression of sec61 mutations is direct and that of secl5-1 an indirect phenomenon. However, a more direct interaction between SECl5 and SEBl has not been excluded. Interestingly, SEBl did not suppress defects in SEC62 and SEC63. This is in accordance with Seblp/Sbhlp being part of the trimeric Sec61 complex (Panzner et al., 1995), which is separate from the complex contain- ing Sec62p and Sec63p (Deshaies et al., 1991).

Seblp has a single potential membrane- spanning region located at the C-terminus. It thus belongs to a specific group of type I1 membrane proteins, termed tail-anchored proteins (Kutay et al., 1993). The membrane topology of Seblp was investigated by an immunoelectron micro- scopic procedure which we have previously devel- oped for brain tissue and which involves labeling of lysed cells (De Camilli et al., 1983; Takei et al., 1992). Immunogold labeling of ultrathin sections is the technique more frequently used for detection of membrane proteins in yeast (see e.g. van Tuinen and Riezman, 1987). While this procedure allows an optimal preservation of cellular structures, the dense packing of cytoplasmic matrix often impairs accessibility of gold labeling to the cytoplasmic surfaces of membranes. In hypotonically lysed spheroplasts the partial elution of cytosolic con- tent made membrane structures clearly visible and enhanced the accessibility of the antibodies and protein A gold labeling of the intracellular epitopes. Extremely heavy labeling of the ER membrane was observed and the Seblp specific staining was exclusively localized on the cyto- plasmic side of the membrane. Even when the ER membrane was clearly discontinuous, gold particles were strictly confined to the cytoplasmic surface.

Several tail-anchored proteins have recently been found to be involved in vesicular traffic including the v- and t-SNARES (Ferro-Novick and Jahn, 1994; Rothman, 1994). As the membrane- spanning region of these proteins is at the C-terminus they must be inserted into the mem- branes post-translationally. This has previously

DISCUSSION The results of the present study strongly suggest that the SEBl gene codes for the p subunit of yeast Sec61 complex. The results are convergent with the independent results of Panzner et al. (1995), who have identified the same protein using a biochemi- cal approach. The encoded protein shows signifi- cant sequence homology to the mammalian and Arabidopsis p subunits (Hartmann et al., 1994). Furthermore, we have detected genetic interaction between SEBl and SEC61 and immunocytochemi- cal data show that the Sebl protein prominently localizes in the yeast ER. The immunofluorescence staining appeared as a shell around the nucleus with extensions to the cytoplasm and under the plasma membrane, the typical fluorescence pattern for the yeast ER (Preuss et al., 1991). Though occasional staining near the plasma membrane was seen, the staining pattern of Seblp is clearly differ- ent from that of the plasma membrane proteins such as Sso2p and Sec9p (Brennwald et al., 1994) and is always identical to the staining for the ER marker Kar2p. The finding that SEBl is not essential in yeast most probably means that the function of Seblp can be performed by more than one protein. Seb2p encoded by the homologous SEB2 gene is a strong candidate for such a func- tional counterpart of Seblp, and the temperature- sensitive phenotype of a haploid strain with disruptions of both SEBl and SEB2 gives further support to this conclusion.

Multicopy suppression is a convenient way to detect genetic interactions in yeast (Rine, 1991). Though this has often allowed identification of physically interacting proteins, there are several

436

been shown for three of the proteins. the Ap(i,.sicr synaptobrevin (Yamasaki et al., 1994), yeast syntaxin Sso2p (Jsntti et al., 1994) and human synaptobrevin (Kutay et (11.. 1995). Here we show that Seblp is inserted into the membrane post-translationally in a n it? ritro system using dog pancreatic microsomes. It has previously been reported that yeast a-factor precursor, prepro a-factor, is efficiently translocated post- translationally into yeast but not into mammalian niicrosonies (Waters and Blobel, 1986; Rothblatt and Meyer, 1986; Hansen et u/.. 1986; Garcia and Walter, 1988). This could be due to the lack of o r too low amounts of Sec proteins other than those forming the Sec61 complex in mammalian micro- somes (Panzner et ul., 1995). Instead, the tail- anchored proteins are rather efficiently inserted into the dog pancreatic microsomes. Therefore it remains to be seen whether the translocation of this specific class of proteins involves components other than those known to be involved in co- and post-translational translocation of the signal sequence-containing proteins.

The Sec61 complex has been suggested to form a protein conducting channel through the lipid bi- layer (Gorlich and Rapoport, 1993; Mothes ef al., 1994). It is likely that this function is performed by the u subunit and that the p and y subunits play accessory roles not yet specified in detail. The genetic interactions shown by us between the a and

subunits as well as the previously described genetic interactions between the u and y subunits (Esnault et al., 1993) now allow new approaches to the functional analysis of the Sec61 protein trans- location complex and will shed new light on the still poorly understood functions of the p and y subunits.

ACKNOWLEDGEMENTS

We thank Peter Novick, Susan Ferro-Novick and Patrick Brennwald for fruitful discussions as well as for yeast strains and plasmids and CPY anti- serum, Randy Schekman for yeast strains. kindly provided to us by Susan Ferro-Novick with his permission, Mark Rose for the Kar2p antiserum and Jussi Jantti for many useful discussions. Laurie Daniel and Riitta Lanipinen are acknowledged for skilful technical assistance. This work was finan- cially supported by a grant from the Academy of Finland to S. K. and by NIH grant (CA 46138) to P. D. C. E. G . is a recipient o f a fellowship from the Associazione Italiana per la Ricerca sul Cancro.

J . TOIKKANEN ET AL.

REFERENCES

Aalto. M. K., Ronne, H. and Keranen, S. (1993). Yeast syntaxins Ssolp and Sso2p belong to a family of related membrane proteins that function in vesicular transport. EMBO J. 12, 40954104.

Akiyania, Y. and Ito, K. (1987). Topology analysis of the SecY protein, an integral membrane protein involved in protein export in Escliericliicr coli. EMBO J. 6, 3465-3470.

Altschul. S. F., Gish, W., Miller. W., Myers, E. W. and Lipman. D. J. (1990). Basic local alignment search tool. J . Mol. Biol. 215, 403410.

Brennwald, P., Kearns, B., Champion, K., Keriinen, S., Bankitis, V. P. and Novick, P. (1994). Sec9 is a SNAPZ5-like component of yeast SNARE complex that may be the effector of Sec4 function in exocytosis. Cell 79, 245-258.

Cameron, P. L., Siidhof. T. C., Jahn, R. and De Camilli, P. (1991). Colocalization of synaptophysin with trans- ferrin receptors: implications for synaptic vesicle biogenesis. J. Cell Biol. 115, 151-164.

Cerretti. D. P.. Dean. D.. Davis. G. R., Bedwell, M. and Nomura, M. (1983). The sp' ribosomal protein operon of E.whericliia coli: sequence and cotranscrip- tion of the ribosomal protein genes and a protein export gene. Nucl. Acids Res. 9, 2599-2615.

Cryer. R. D.. Eccleshall. R. and Marmur, J . (1975). Isolation of yeast DNA. Metli. Cdl Biol. 12, 3944.

De Camilli, P., Harris. S. M., Huttner, W. B. and Greengard, P. (1983). Synapsin I (protein I), a nerve teminal-specific phosphoprotein 11: Its specific associ- ation with synaptic vesicles demonstrated by immuno- cytochemistry in agarose-embedded synaptosonies. J. Cell Biol. 96, 1355-1373.

Deshaies. R. J.. Sanders, S. L., Feldheim. D. A. and Schekman, R. (1991). Assembly of yeast Sec proteins involved in translocation into the endoplasmic reticu- lum into a membrane-bound multisubunit complex. Nlirure 349, 806-808.

Deshaies, R. J . and Schekman, R. (1987). A yeast mutant defective a t an early stage in import of secretory protein precursors into the endoplasmic reticulum. J. Cell Bid. 105, 633-645.

Dobberstein. B. (1994). On the beaten pathway. Nature 367, 599-600.

Esnault, Y., Blondel. R. J., Deshaies. R. J., Schekman, R. and Kepes. F. (1993). The yeast SSSI gene is essential for secretory protein translocation and encodes a conserved protein of the endoplasmic reticulum. EMBO J. 12, 40834093.

Feldheim, D. and Schekman, R. (1994). Sec72p con- tributes to the selective recognition of signal peptides by the secretory polypeptide translocation complex. J. Cell Biol. 126, 935-944.

Feng, D. F. and Doolitle, R. F. (1987). Progressive sequence alignment as a prerequisite to correct phylogenetic trees. J . Mol. E d 25, 351-360.

YEAST PROTEIN TRANSLOCATION COMPLEX 437

Ferro-Novick, S. and Jahn, R. (1994). Vesicle fusion from yeast to man. Nature 370, 191-193.

Garcia, P. D. and Walter, P. (1988). Full-length prepro- alpha-factor can be translocated across the mam- malian microsomal membrane only if translation has not terminated. J. Cell Biol. 106, 1043-1048.

Gerst, F. E., Rodger, L., Riggs, M. and Wigler, M. (1992). SNCI, a yeast homolog of the synaptic vesicle- associated membrane proteinkynaptobrevin gene family: genetic interactions with the RAS and CAP genes. Proc. Natl. Acad. Sci. USA 89, 43384342.

Gietz, D., St. Jean, A,, Woods, R. A. and Schiestl, R. H. (1992). Improved method for high efficiency trans- formation of intact yeast cells. Nucl. Acids Res. 20, 1425.

Green, N., Fang, H. and Walter, P. (1992). Mutants in three novel complementation groups inhibit mem- brane protein insertion into and soluble protein translocation across the endoplasmic reticulum mem- brane of Saccharomyces cerevisiae. J. Cell Biol. 116, 597-604.

Gorlich, D., Hartmann, E., Prehn, S. and Rapoport, T. A. (1992). A protein of the endoplasmic reticulum involved early in polypeptide translocation. Nature 357,47-52.

Gorlich, D. and Rapoport, T. A. (1993). Protein trans- location into proteoliposomes reconstituted from purified components of the endoplasmic reticulum membrane. Cell 75, 615-630.

Hansen, W., Garcia, P. D. and Walter, P. (1986). In vitro protein translocation across the yeast endo- plasmic reticulum: ATP-dependent post-translational translocation of the prepro- a-factor. Cell 45, 397- 406.

Hanson, P. I., Kapiloff, M. S., Lou, L. L., Rosenfeld, M. G. and Schulman, H. (1989). Expression of a multifunctional Ca”/calmodulin-dependent protein kinase and mutational analysis of its autoregulation. Neuron 3, 59-70.

Hartmann, E., Sommer, T., Prehn, S., Gorlich, D., Jentsch, S. and Rapoport, T. A. (1994). Evolutionary conservation of components of the protein translo- cation complex. Nature 367, 654-657.

Hill, J., Donald, K. A. I. G. and Griffiths, D. E. (1991). DMSO-enhanced whole cell yeast transformation. Nucl. Acids Res. 19, 5791.

Jantti, J., Keranen, S., Toikkanen, J., Kuismanen, E., Ehnholm, C., Soderland, H. and Olkkonen, V. M. (1994). Membrane insertion and intracellular trans- port of yeast syntaxin Sso2p in mammalian cells. J. Cell Sci. 107, 3623-3633.

Johnston, P. A,, Cameron, P. A., Stukenbrok, H., Jahn, R. and Sudhof, T. C. (1989). Synaptophysin is tar- geted to similar microvesicles in CHO and PC12 cells. EMBO J. 8, 2863-2872.

Keranen, S. (1986). Synthesis and processing of Semliki forest virus polyprotein in Saccharomyces cerevisiae: a

yeast type glycosylation of El envelope protein. Gene 48. 267-215.

Kurihara, T. and Silver, P. (1993). Suppression of a sec63 mutation identifies a novel component of the yeast endoplasmic reticulum translocation apparatus. Mol. Biol. Cell 4, 919-930.

Kutay, U., Ahnert-Hilger, G., Hartmann, E., Wiedemann, B. and Rapoport, T. A.. (1995). Trans- port route for synaptobrevin via a novel pathway of insertion into the endoplasmic reticulum membrane. EMBO J. 14, 217-223.

Kutay, U., Hartmann, E. and Rapoport, T. A. (1993). A class of membrane proteins with a C-terminal anchor. Trends Cell Biol. 3, 72-75.

Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680-685.

Larriba, G. (1993). Translocation of proteins across the membrane of the endoplasmic reticulum: A place for Saccharomyces cerevisiae. Yeast 9, 441463.

Makarow, M. (1985). Endocytosis in Saccharomyces cerevisiae: internalization of enveloped viruses into spheroplasts. EMBO J. 4, 1855-1860.

McKnight, G. L. and McConaughy, B. L. (1983). Selec- tion of functional cDNAs by complementation in yeast. Proc. Natl. Acad. Sci. USA 80, 44124416.

Mothes, W., Prehn, S. and Rapoport, T. A. (1994). Systematic probing of the environment of a translo- cating secretory protein during translocation through the ER membrane. EMBO J. 13, 3973-3982.

Miisch, A,, Wiedmann, M. and Rapoport, T. A. (1992). Yeast Sec proteins interact with polypeptides travers- ing the endoplasmic reticulum membrane. Cell 69, 343-352.

Ng, D. T. W. and Walter, P. (1994). Protein translo- cation across the endoplasmic reticulum. Curr. Op. Cell Biol. 6, 5 10-5 16.

Panzner, S., Dreler, L., Hartmann, E., Kostka, S. and Rapoport, T. A. (1995). Posttranslational protein transport in yeast reconstituted with purified complex of Sec proteins and Kar2p. Cell 81, 561-570.

Preuss, D., Mulholland, J., Kaiser, C. A., et al. (1991). Structure of the yeast endoplasmic reticulum: localiz- ation of ER proteins using immunofluorescence and immunoelectron microscopy. Yeast 7, 891-91 1.

Rine, J. (1991). Gene overexpression studies of Saccharomyces cerevisiae. Meth. Enzymol. 194, 239-250.

Rose, M. D., Misra, L. M. and Vogel, J. P. (1989). KAR2, a karyogamy gene, is the yeast homolog of the mammalian BiPIGRP78 gene. Cell 57, 121 1-1221.

Rothblatt, J. A., Deshaies, R. J., Sanders, S. L., Daum, G. and Schekman, R. (1989). Multiple genes are required for proper insertion of secretory proteins into the endoplasmic reticulum in yeast. J. Cell Biol. 109,

Rothblatt, J. A. and Meyer, D. I . (1986). Secretion in yeast: reconstitution of the translocation and

2641-2652.

438

glycosylation of a-factor and invertase in a homolo- gous cell-free system. Cell 44, 619-628.

Rothman, J. E. (1994). Mechanisms of intracellular protein transport. Nature 372, 55-63.

Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.

Sanders, S. L., Whitfield, K. M., Vogel, J. P., Rose, M. D. and Sheckman, R. W. (1992). Sec61 and Bip directly facilitate polypeptide translocation into the ER. Cell 69, 353-365.

Sanger, F., Nicklen, S. and Coulson, A. R. (1977). DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acud. Sci. USA 14, 5463-5467.

Schagger, H. and von Jagow, G. (1987). Tricine-sodium dodecyl sulphate polyacrylamide gel electrophoresis for the separation of proteins in the range from 1 to 100 kDa. Anal. Biochem. 166, 368-379.

Schekman, R. (1994). Translocation gets a push. Cell78, 91 1-913.

Sherman, G., Fink, G. and Hicks, J. B. (1983). Methods in Yeast Genetics. A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York.

Slot, J. W. and Geuze, H. J. (1985). A new method of preparing gold probes for multiple-labeling cyto- chemistry. Eur. J. Cell Biol. 38, 87-93.

Smith, T. F., Waterman, M. S. and Burks, C. (1985). The statistical distribution of nucleic acid similarities. Nucl. Acids Res. 13, 645-656.

Stirling, C. J., Rothblatt, J., Hosobuchi, M., Deshaies, R. and Schekman, R. (1992). Protein translocation mutants defective in the insertion of integral mem- brane proteins into the endoplasmic reticulum. Mol. Biol. Cell 3, 129-142.

Takei, K., Mignery, G. A., Mugnaini, E., Siidhof, T. C. and De Camilli, P. (1994). Inositol 1,4,5-triphosphate receptor causes formation of the ER cisternal stacks in transfected fibroblasts and in cerebellar Purkinje cells. Neuron 12, 327-342.

J. TOIKKANEN ET AL.

Takei, K., Stiikenbrok, H., Metcalf, A., Mignery, G. A. Sudhof, T. C., Volpe, P. and De Camilli, P. (1992). Ca2+ stores in Purkinje neurons: endoplasmic reticu- lum subcompartments demonstrated by the hetero- geneous distribution of the InsP3 receptor, Ca2'- ATPase, and calsequestrin. J. Neurosci. 12, 489-505.

Tollervey, D. and Mattaj, I. W. (1987). Fungal small nuclear ribonucleoproteins share properties with plant and vertebrate UsnRNPs. EMBO J. 6, 469476.

van Tuinen, E. and Riezman, H. (1987). Immunolocaliz- ation of glyceraldehyde-3-phosphate dehydrogenase, hexokinase, and carboxypeptidase Y in yeast cells at the ultrastructural level. Histochem. Cytochem. 35, 327-333.

Vernet, T., Dignard, D. and Thomas, D. Y. (1987). A family of yeast expression vectors containing the phage fl intergenic region. Gene 52, 225-233.

Wach, A,, Brachat, A,, Pohlmann, R. and Philippsen, P. (1994). New heterologous modules for classical or PCR-based gene disruptions in Saccharomyces cerevisiae. Yeast 10, 1793-1808.

Walworth, N. C., Goud, B., Ruohola, H. and Novick, P. J. (1989). Fractionation of yeast organelles. Meth. Cell Biol. 31, 335-354.

Walworth, N. C. and Novick, P. J. (1987). Purification and characterization of constitutive secretory vesicles from yeast. J. Cell Biol. 105, 163-174.

Waters, M. and Blobel, G. (1986). Secretory protein translocation in a yeast cell-free system can occur postranslationally and requires ATP hydrolysis. J. Cell Biol. 102, 1543-1550.

Yamasaki, S., Hu, Y., Binz, T., Kalkuhl, A. Kurazono, H., Tamura, T., Jahn, R., Kandel, E. and Niemann, H. (1994). Synaptobrevin/vesicle-associated mem- brane protein (VAMP) of Aplysia californica: struc- ture and proteolysis by tetanus toxin and botulinal neurotoxins type D and F. Proc. Natl. Acad. Sci. USA 91, 46884692.