Tropical Agricultural Research

Tropical Agricultural Research

Volume 30 Number 3

Editor-in-Chief

Dr. U.W.A. Vitharana

Postgraduate Institute of Agriculture

University of Peradeniya

Peradeniya, Sri Lanka

May, 2019

Editor-in-Chief Dr. U.W.A. Vitharana

B.Sc.(Peradeniya, Sri Lanka), M.Sc., Ph.D. (Ghent, Belgium)

Department of Soil Science,

Faculty of Agriculture,

University of Peradeniya,

Peradeniya, Sri Lanka. Editorial Advisory Board Prof. P. Abeygunawardena, Former Professor, Texas A & M University, U.S.A

Prof. B.F.A. Basnayake, University of Peradeniya, Sri Lanka

Prof. W.A.J.M. De Costa, University of Peradeniya, Sri Lanka

Prof. D.M De Costa, University of Peradeniya, Sri Lanka

Dr. H.M.V.G. Herath, University of Peradeniya, Sri Lanka

Prof. A. Hetherington, University of Bristol, United Kingdom

Dr. W. Jenner, Centre for Agriculture and Biosciences International, Switzerland

Prof. D. Kumaragamage, University of Winnipeg Winnipeg, Canada

Dr. B.E.P. Mendis, University of Peradeniya, Sri Lanka

Prof. N. Mukhopadhyay, University of Connecticut, USA

Prof. D. Pavelkova, Tomas Bata University in Zlin, Czech Republic

Prof. R. Pegg, University of Georgia, USA

Dr. B.L. Peiris, University of Peradeniya, Sri Lanka

Dr. N. Sanderatne, Postgraduate Institute of Agriculture, University of Peradeniya

Dr. U.W.A. Vitharana, University of Peradeniya, Sri Lanka

Dr. S. H. Wani, Michigan State University, USA

Prof. W.A.D.P. Wanigasundera, University of Peradeniya, Sri Lanka

Prof. M.P.B. Wijayagunawardhana, University of Peradeniya, Sri Lanka

Editorial Board Prof. D.U. Ahn, Iowa State University, USA

Prof. J.M.R.S. Bandara, University Brunei Darussalam, Brunei

Dr. R.S. Dharmakeerthi, University of Peradeniya, Sri Lanka

Prof. D. Banks, Duke University, USA

Prof. G.M. Hettiarachchi, University of Kansas, USA

Dr. N. S. Hettiarachchy, University of Arkansas, USA

Prof. V. Hurry, Swedish University of Agricultural Sciences, Sweden

Prof. K. Kawamoto, Saitama University, Japan

Prof. S. Kodithuwakku, University of Peradeniya, Sri Lanka

Dr. J. Lam, Memorial University, Canada

Prof. W.M.T. Madhujith, University of Peradeniya, Sri Lanka

Prof. B. Marambe, University of Peradeniya, Sri Lanka

Prof. J. Prohens, Universitat Politecnica de Valencia, Spain

Prof. G.L.L.P. Silva, University of Peradeniya, Sri Lanka

Prof. R.P. de Silva, University of Peradeniya, Sri Lanka

Prof. C. Sivayoganathan, Emeritus Professor, University of Peradeniya, Sri Lanka

Dr. R. Sulaiman, Centre for Research on Innovation and Science Policy (CRISP), India

Prof. R.O. Thattil, Emeritus Professor, University of Peradeniya, Sri Lanka

Prof. J. Weerahewa, University of Peradeniya, Sri Lanka

Prof. S. Wijesundara, National Institute of Fundamental Studies, Sri Lanka

Prof. C. Wilson, Queensland University of Brisbane, Australia

ISSN: 1016 – 1422 Abstracting and Indexing: The Journal is indexed by CAB Abstracts

© Postgraduate Institute of Agriculture

University of Peradeniya Peradeniya, Sri Lanka

EDITORIAL

The journal ‘Tropical Agricultural Research’ publishes the papers accepted upon rigorous

reviewing process. In the past, the journal ‘Tropical Agricultural Research’ carried

scholarly articles submitted to the annual congress. Moving a step further, the editorial

board welcomes submissions throughout the year. Further, submissions can be made

throughout the online submission system available at the official website of the PGIA. Over

the years, the journal has evolved as an international journal which is now abstracted and

indexed in CAB Abstracts. This issue of volume 30 of the journal contains an ensemble of

scholarly articles related to agriculture and allied fields those were presented at the 30th

Annual Congress of the Postgraduate Institute of Agriculture.

I extend my sincere thanks for the guidance and support rendered by the Director/PGIA, the

members of the Editorial Board, reviewers and the authors who submitted their research

work for publication.

Dr. U.W.A. Vitharana

Editor-in-Chief

May, 2019

i

CONTENTS

Research Articles

Antioxidant Potential of Selected Underutilized Fruit Crop Species Grown in Sri Lanka 1

M.A.L.N. Mallawaarachchi, W.M.T. Madhujith and D.K.N.G. Pushpakumara

Millet Phenolics as Natural Antioxidants in Food Model Systems and Human LDL/VLDL

Cholesterol in vitro 13

K.D.D. Kumari, W.M.T. Madhujith and G.A.P. Chandrasekara

Preliminary Evaluation of Probiotic Potential of Yeasts Isolated from Bovine Milk and Curd of Sri

Lanka

27

D.U. Rajawardana, I.G.N. Hewajulige, C.M. Nanayakkara, S.K.M.R.A. Athurupana and T.

Madhujith

Identification of Phosphorus Efficient Rice Cultivars under Low P Nutrition through Hydroponic

based Screening

43

D.S. Kekulandara, P.C.G. Bandaranayake, D.N. Sirisena, W.L.G. Samarasinghe and L.D.B.

Suriyagoda

Dynamics of Nitrifiers in Soils of Intensively Vegetable Cultivated Areas in Sri Lanka 55

K.K.K. Nawarathna, W.S. Dandeniya, R.S. Dharmakeerthi and P. Weerasinghe

Performance of Macrobrachium rosenbergii in Perennial Reservoirs: A Comparative Assessment of

Fisheries in Five Perennial Reservoirs in the Northern Province of Sri Lanka

69

R. Rajeevan, U. Edirisinghe and A.R.S.B. Athauda

Short Communications

Effect of Seaweed Extract (Kappaphycus alvarezii) on the Growth, Yield and Nutrient uptake of

Leafy Vegetable Amaranthus polygamous

81

S. Senthuran, B.L.W.K. Balasooriya, S.J. Arasakesary and N. Gnanavelrajah

Mineral Contents of Sri Lankan Rice Varieties as Affected by Inorganic Fertilization

89

H.M.A.J. Herath, G.A.P. Chandrasekara, U. Pulenthiraj, C.M.N.R. Chandrasekara

and D.G.N.G. Wijesinghe

Determination of Optimum Nitrogen Concentrations in Hydroponics for Tomato Grown in Coir

Medium in Tropical Greenhouse

97

H.R.U.T. Erabadupitiya, W.A.P. Weerakkody and K.A. Nandasena

Impact of Glass Ceiling on Women Career Development in Non-state Banking Sector in Colombo 105

U. K. S. M. Uduwella and M.W.A.P. Jayatilaka

Author Guide 109

Author Index 113

Tropical Agricultural Research Vol. 30 (3): 1 – 12 (2018)

Antioxidant Potential of Selected Underutilized Fruit Crop Species

Grown in Sri Lanka

M.A.L.N. Mallawaarachchi, W.M.T. Madhujith1* and D.K.N.G. Pushpakumara2



Sri Lanka

ABSTRACT: Lyophilized aqueous extracts of four underutilized fruit species namely

Diospyros discolor (Velvet apple), Pouteria campechiana (Lavulu/Canistel), Phylanthus

acidus (Mal-Nelli/Star gooseberry) and Phyllanthus emblica (Nelli/Indian gooseberry) were

investigated for the antioxidant potential (AP) by 2,2-diphenyl-1-picrylhydrazyl (DPPH)

assay, 2,2-azino-bis-3-ethylbenzothiazoline-6-sulphonic acid (ABTS) assay and ferrous

reducing antioxidant power (FRAP) assay. Total phenolic content (TPC) and total monomeric

anthocyanin content (TMAC) were determined by Folin-Ciocalteu’s colorimetric assay and

pH differential method, respectively. Vitamin C (VitC) content of fresh fruit was evaluated

titrimertically and expressed as mg of ascorbic acid in 100 g of fresh weight (FW). The TPC

and TMAC were expressed as mg of gallic acid equivalents (GAE)/100g FW and mg of

cyanodin-3-glucoside (C3G)/100g FW. The measured parameters differed significantly among

four fruit species. The values ranged between 84.42 – 1939.70 mg GAE/100g FW, 10.41 –

55.64 mg C3G/100g FW, 0.067 – 310.63 mg FW/ml, 9 – 81.29%, 238.25 – 2891.57

Fe2+mol/100g FW and 17.12 – 523.14 mg/100g FW for TPC, TMAC, IC50, RSA, FRAP and

VitC, respectively. Phyllanthus emblica possessed highest values in all parameters while

Phyllanthus acidus showed the lowest except in TPC. The lowest TPC was observed in

Diospyros discolor. The extract of Pouteria campechiana also showed considerable amount

of TPC (640 mg C3G/100g FW), RSA (76%) and VitC of 53 mg/ 100g. The results revealed

that these underutilized fruit crops can be used as sources of natural antioxidants and

vitamin C.

Keywords: Antioxidant potential, total anthocyanin content, total phenolic content,

underutilized fruits crop species, Vitamin C

INTRODUCTION

Reactive oxygen species (ROS) are considered as harmful intermediates produced during

oxygen metabolism in biological systems. Excess ROS in the body can lead to cumulative

damage in proteins, lipids, and DNA, resulting in the condition termed as oxidative stress

(Dudonne et al., 2009). Antioxidants can effectively mitigate the oxidative damage in

biological systems by delaying or inhibiting the oxidation process caused by ROS (Shofian et

al., 2011). Numerous epidemiological studies have reported that the regular consumption of

fruits and vegetables is associated with the reduction of chronic diseases which are directly

1 Department of Food science and Technology, Faculty of Agriculture, University of Peradeniya, Sri Lanka 2 Department of Crop science, Faculty of Agriculture, University of Peradeniya, Sri Lanka

* Corresponding author: [email protected]

mailto:[email protected]

Mallawaarachchi et al.

2

linked with the oxidative stress. The increased intake of natural antioxidants, particularly the

antioxidative compounds present in fruits and vegetables contribute to the antioxidant capacity

of plasma and these constituents are reported to mitigate the damage caused by the oxidative

stress (Lie et al., 2005; Oviasogie et al., 2009; Vidhan et al., 2010; Bopitiya and Madhujith,

2012).

In nutritional sciences and medicine, there is much interest on analysis of vitamins such as C,

E and A as they are widely reported to have antioxidant activities via multiple mechanisms

(Rutkowski and Grzegorczyk, 2007). Vitamin C, reduces the risk of arteriosclerosis,

cardiovascular diseases and some forms of cancer (Jacob, 1996; Lee and Kader, 2000).

Vitamin C is also known to have many biological functions in collagen formation, absorption

of inorganic iron, reduction of plasma cholesterol level, inhibition of nitrosoamine formation,

enhancement of the immune system and reaction with singlet oxygen and other free radicals

(Lee and Kader, 2000). Both vitamin A and E are lipid soluble. Vitamin A is important for

normal vision, growth, ageing and reproduction (Adeolu and Enesi, 2013). Vitamin E

considered as a chain breaking antioxidant and reported that regular intakes are correlated with

a reduced risk of cardiovascular diseases (Flome and Traber, 1999) Therefore, these plant

extracts can be used as potential candidates to isolate natural antioxidants.Wide varieties of

fruit crop species are available in Sri Lanka. Besides major fruit crops, there is a large number

of fruit species that remain underutilized. As a result, their nutritive, medicinal and therapeutic

values are little known to date.

The commonly grown two members of the family Euphorbiaceae, namely Phyllanthus emblica

L. (Nelli/Indian gooseberry) and Phyllanthus acidus L. (Rata-Nelli/Star gooseberry) are

cultivated as backyard fruit species in Sri Lanka. The fruits of P. emblica eaten in fresh form

are considered as highly nutritious and therapeutic due to its high amount of Vitamin C,

antioxidant and polyphenol content (Pushpakumara and Heenkenda 2007). It is reported to use

in prevention and management of haemorrhage, anaemia, colic, acute leprosy, fits, insanity,

jaundice, cough, hiccough, indigestion, dyspepsia, asthma and other diseases in traditional

medicine (Jayaweera, 1981). P. acidus fruits may be eaten fresh after sprinkled with salt,

processed into pickle and sweetened dried fruits. In Malaysia, ripe and unripe fruits are cooked

and served as a relish, or made into a thick syrup or sweet preserve (Lim, 2012a). Ramasamy

et al. (2011) reported that leaves of P. acidus perform mild cytotoxicity on human breast cancer

cell line (MCF7), epidermal carcinoma of cervix cell line (CaSki), ovarian cancer cell line

(KO3) and colon cancer cell line (HT29). However, these fruit crops have been neglected in

Sri Lanka and their uses have not been properly exploited (Pushpakumara and Heenkenda

2007).

Pouteria campechiana (Kunth) Baehni. (Sapotaceae), Canistel locally known as Lavulu

mainly grown in home gardens of wet and intermediate zones of Sri Lanka. Due to its compact

crown and glossy leaves, the tree is used for landscaping as well. The fruit is consumed as a

dessert fruit or pickled with salt and pepper. The dehydrated pulp can be used as natural food

colorant especially in baked products. Lanerolle et al. (2008) reported that P. campechiana

fruit pulp is a rich source of pro-vitamin A carotenoids.

Diospyros discolor Willd. a member of family Ebenaceae commonly known as velvet apple,

normally grown in the home gardens of wet and intermediate zones of Sri Lanka as ornamental

and road side shade tree. It has been reported that fruits, leaves and bark of D. discolor is used

in traditional medicine to cure diarrhoea, cough, fever and dysentery. The ripe fruit is peeled

and eaten fresh or used in salad or stew or fried like a vegetable (Lim, 2012b). According to

Lee et al. (2006) the leaves of D. discolor possesses higher antioxidant activity. However to

Antioxidant Potential of Fruit Crop Species

3

the best of our knowledge, there are no previous reports on antioxidant potential of P.

campechiana and D. discolor fruit.

Present study was carried out to evaluate the antioxidant potential, total phenolic, total

anthocyanin and vitamin C contents of four underutilized fruit crop species namely,

Phyllanthus acidus, Phyllanthus emblica, Pouteria campechiana and Diospyros discolor.

METHODOLOGY

Chemicals and regents

The gallic acid, Folin-Ciocalteu’s phenol reagent, sodium carbonate, 2,2-azinobis (3-

ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS), 2,2-Azobis (2-

amidinopropane) dihydrochloride (AAPH), 2,2-diphenyl-1-picrylhydrazyl hydrate (DPPH), 2,

4, 6-tris (2-pyridyl)-1, 3, 5-triazine (TPTZ) and 2,6-dichlorophenolindophenol, were

purchased from Sigma, USA. All other chemicals used were of analytical grade.

Sample preparation

Fully matured fruits of P. acidus (Star gooseberry), P. emblica (Indian gooseberry) and fully

ripe fruits of P. campechiana (Canistel) and D. discolor (Velvet apple) (Figure 1) were

collected from the plants at mid fruiting stage from the home gardens in the Bandarawela

region belonging to the upcountry intermediate zone (IU3), Sri Lanka and transported to the

Regional Agriculture Research and Development Centre, Bandarawela under cold conditions.

The samples were sorted for physical and pest damages, washed with running tap water

followed by distilled water and drained to remove the surface water. Hundred grams of each

fruit was taken after removing seeds and outer skin of P. campechiana and D. discolor. Then

homogenized to prepare the composite sample. Six samples from each fruit were used to

prepare the composite sample. For the evaluation of total phenolic content total monomeric

anthocyanin content and antioxidant potential, 40 g of homogenates of each species were

extracted with 120 ml of distilled water by keeping on reciprocating shaker at 450 rpm for 90

min at room temperature followed by centrifugation at 4,500 rpm for 10 min. The supernatants

were collected separately and the extraction was repeated twice with residues, supernatants

were combined and lyophilized at -50 °C, 24 mbar for 96 h and subsequently stored at 20 °C

until further analysis.

To determine total phenolic content (TPC), ferric reducing antioxidant power (FRAP), total

antioxidant capacity (TAC) and total monomeric anthocyanin content (TMAC), twenty

milligrams of each lyophilized samples were dissolved in 3 ml of methanol, filtered using

whatman number one filter papers, the filtrates were volume up in the 5 ml volumetric flasks

with distilled water to have final concentration of 4 mg/ml. For the DPPH assay, 50 mg of

lyophilized samples were taken followed same procedure then six different concentrations

ranging between 0.5 mg/ml and 10 mg/ml were prepared.

Determination of total phenolic content

The TPC was measured using the method described by Yu et al. (2002) with slight

modifications. Briefly, 100 μl of 2 N Folin-Ciocalteu regent and 1.58 ml of distilled water were

added to 20 μl of each sample, vortexed, incubated at room temperature for 8 minutes,

subsequently 300 μl of 0.7 M sodium carbonate was added, incubated for 30 minutes at room


4

temperature, and absorbance was measured at 765 nm by using a Helios Omega – UV – VIS

spectrophotometer. Different concentrations of gallic acid (0 - 1 mg /ml) were used to construct

the standard curve and the results were expressed as mg gallic acid equivalents in 100 g of fruit

in fresh weight (mg GAE/100 g FW).

Figure 1. Fruits of Selected Species (a - D. discolor fruit, b - P. acidus fruit, c - P. emblica

fruit, and d - P. campechiana fruit)

Determination of antioxidant potential

Ferric reducing antioxidant power assay

The assay was adapted from Benzie and Strain (1996) with minor changes. The FRAPreagent

was freshly prepared by mixing acetate buffer (150 mM, pH 3.6), TPTZ solution (5 mM TPTZ

in 40 mM HCl), FeCl36H2O (10 mM) in a ratio of 10:1:1. The regent was pre-heated at 370C

in a water bath for 10 min. To perform the assay, 1.5 ml of FRAP reagent and 0.05 ml sample

(4 mg/ml) were mixed and vortexed for 30 s, absorbance was measured at 593 nm, using the

FRAP working solution as a blank after a lapse of 4 min. The antioxidant potential of samples

were determined using a linear regression equation (Y= 6.723x, r2= 0.9389) obtained from the

standard curve plotted using FeSO4 7H2O (0 - 5 mM) and results were expressed as M of Fe 2+/100 g fruits in fresh weight (FW).

DPPH radical scavenging assay

The 2, 2-diphenyl-1-picrylhydrazyl hydrate (DPPH) free radical scavenging activity of fruit

crop species was carried out according to the method described by Su et al. (2007) with some

modifications. Six different concentrations ranged between 0.5 mg/ml and 10 mg/ml of each

lyophilized extract (0.2 ml) was mixed with 1.8 ml of 0.1 mM methanolic DPPH radical. The

absorbance was read at 517 nm using Helios Omega – UV – VIS spectrophotometer after

(a) (b)

(c) (d)


5

leaving the mixture for an hour in the dark at room temperature. The procedure was repeated

six times for each concentration. The control was prepared by adding 0.2 ml of methanol into

1.8 ml of DPPH radical. Using following formula, the radical scavenging activity (RSA) was

calculated as percentage of discoloration of DPPH radical.

RSA% = {1- (A sample/A control)} * 100

where; A sample is the absorbance of the sample at 517 nm and A control is the absorbance of the

control at 517 nm.

The results were expressed as IC50 values that denote the concentration of the sample required

(mg of FW/ml) to scavenge 50% of DPPH radicals, was derived from RSA vs Concentration

plot of each sample.

Determination of total antioxidant capacity

The TAC was determined using ABTS radical scavenging capacity assay. The ABTS radical

cation (ABTS•+) was generated by reacting 2,2- azino-bis (2-ethylbenzothiazoline-6-sulfonic

acid) diammonium salt (ABTS, 2.5 mM in PBS at pH 7.4) with 2,2'- azino-bis (2-

methylpropanimidamide) dihydrochloride (AAPH, 2 mM in PBS at pH 7.4) in to 1ː 1 ratio.

The mixture was kept in a water bath at 60 ºC until color developed which possess the

absorbance between 0.3 - 0.5 at 734 nm. To 40 l of each sample, 1.96 ml of stock was added

and absorbance was measured over six minutes at one minute interval at 734 nm (Zhou and

Yu, 2004), the RSA was calculated as percentage inhibition of ABTS+ radical.

Determination of total monomeric anthocyanin content

The pH differential method, previously reported by Lee et al. (2005) was used with slight

modifications to determine the total monomeric anthocyanin content of the freeze dried

extracts. In brief, two separate reaction medium were prepared with 1.80 ml of, potassium

chloride buffer (pH 1) and sodium acetate buffer (pH 4.5) with 0.2 ml of extract (4 mg/ml) for

each. Reaction medium was kept for 15 min at room temperature followed by absorbance was

measured at 520 nm and 700 nm wave lengths using Helios Omega – UV – VIS

spectrophotometer. The TMAC was calculated as follows and expressed as mg of Cyanidin-

3-glucoside in 100 g of Fresh sample.

A x MW x DF x 103

C3G =

Ɛ x 1

A = Absorbance (A 520 –A 700) pH1 - (A 520 –A 700) pH4.5

MW = Molecular weight C3G (449.2g)

DF = Dilution factor

1 = Path length (cm)

Ɛ = Molar extinction co-efficient (26 900)

Determination of the vitamin C content

Determination of vitamin C content was performed on the basis of content of L- Ascorbic acid

(AA), by using the titrimetric method described by Omale and Ugwu (2011). Accurately

weighed (5 g) of fresh sample was macerated with 0.25% Oxalic acid solution, filtered, filtrate


6

was transferred to a 50 ml volumetric flask volume up to the mark with 0.25% oxalic acid and

10 ml of it taken for the titration with standardized 2,6 Dichlorophenolindophenol dye solution.

Statistical analysis

Data, obtained by six replicates were statistically analyzed using SAS 9.1 statistical software.

Analysis of variance and least significant difference tests were conducted to identify mean

differences. Statistical significance was declared at p = 0.05. To evaluate the relationship

between methods used, linear regression and correlation analysis of the values were performed

using MS Office Excel software.

RESULTS AND DISCUSSION

Total phenolic content

Polyphenolic compounds are commonly found in both edible and inedible plants, and reported

to have multiple biological effects, including antioxidant activity (Kähkönen et al., 1999;

Wojdylo et al., 2007). The TPC of selected fruit species was evaluated by Folin-ciocaltures’

colorimetric method, varied widely among selected fruit species ranging from 84.42 mg

GAE/100 FW in D. discolor to 1,939.70 mg GAE/100 g FW in P. emblica (Table 1). All

aqueous extracts tested, contained high TPC compared to commonly consumed fruit species.

The TPC of pineapple, mango, papaya, apple, and berries were 47.9, 56.0, 57.6, 11.9, and 28.7

mg GAE/100g, respectively (Kriengsak et al., 2006; Bopitiya and Madhujith 2012). While

Silva and Sirasa (2018) reported 80% (v/v) methanolic extracts of TPC of P. emblica was

915.7 mg GAE/100 g FW, which was lower than that of our results. The water extracts of P.

emblica prepared by boiling for 5 min, reported to have 295.94 mg GAE/g of dry weight

(Jayathilake et al., 2016). The methanolic extracts of different parts (bark, fruits and leaves) of

D. discolor reported to contain 9.16, 5.95 and 5.65 mg GAE/g of extract, respectively (Das et

al., 2010). Ethanolic extracts of oven dried fruits of P. acidus are reported to have 4.26 mg

GAE/g (Zulaikha et al., 2017). It was found that the yield in total phenolic compounds depends

on the method and the choice of solvent (Goli et al., 2005). The TPC also varies with the

growing season, soil and climatic factors, stage of maturity of the plants (Wang and Zheng,

2001).

Total monomeric anthocyanin content

Anthocyanins considered as one of the major bioactive compounds among six classes of

flavonoids (flavonols, flavanones, isoflavones, flavan-3-ois, flavones and anthocyanins)

(Haminuik et al., 2012). There is increasing interest in the anthocyanin content of food and

neutraceuticals because of possible health benefits (Lee et al., 2005). In this study, pH

differential method was adapted to measure TMAC and calculations were done based on the

cyaniding-3-glucoside (C3G), results were expressed as C3G equivalents in mg/100 g FW.

According to the results presented in Table 1, the highest (55.64 mg C3G/ 100 g FW) TMAC

was observed in P. emblica followed by P. campechiana, D. discolor and P. acidus. To the

best of our knowledge this is the first report of TMAC of these fruit species in Sri Lanka.

Vitamin C content (Vit C)

The vitamin C content was expressed as mg of ascorbic acid (AA) in 100 g of fruits in fresh

weight. The results summarized in Table 1, revealed that P. emblica had the highest AA and


7

P. acidus had the lowest. The value for the AA of P. emblica (523.14 mg AA/100 g FW) was

differed with the observation of Silva and Sirasa (2018). Lee and Kader, 2000 stated that

nutritional composition of a fruit type at harvest can vary widely depending on cultivar,

maturity, climate, soil type, and fertility.

Vitamin C (AA) is an important dietary antioxidant in humans; it acts as highly effective

antioxidant (Padayatty et al., 2003). In view of its antioxidant property, ascorbic acid and its

derivatives are widely used as preservatives in food industry. Ascorbic acid plays an important

role in the maintenance of collagen, which represents about one third of the total body protein.

Table 1. Total Phenolic Content (TPC), Total monomeric anthocyanin content (TMAC)

and Vitamin C content (VitC) of selected fruit species

Data are presented as Mean ±SD (n = 6)

Values with different letters are significantly different at p < 0.5

TPC - mg GAE/100g fruit in fresh weight (FW), TMAC - mg C3G/100g fruit in FW and VitC - mg AA/100g

fruits in FW

Antioxidant potential of fruit extracts

Antioxidant potential (AP) of plant extracts can be evaluated by using ability of scavenging of

free radicals, as they deactivated or stabilized by the antioxidants before they cause oxidative

damage towards cellular structures (Lee et al., 2014). Therefore, AP of lyophilized water

extracts were determined by their ability to scavenge DPPH• and ABTS•+ radicals and reducing

power of Ferric to Ferrous using three different assays of DPPH, ABTS and FRAP

respectively. In DPPH, results were expressed as concentration (mg/ml) of fresh sample

needed for inhibit 50% of radicals (IC50 value) in the reaction medium, which was obtained

from the graphs developed from RSA values of different concentrations of each sample (0.5 –

10 mg/ml) and higher IC50 values denote lower AP. The IC50 b values of four extracts ranged

from 0.067 to 310.63 mg FW/ml. According to the IC50 b values presented in the Table 2, the

highest AP was obtained in P. emblica followed by P. acidus, P. campechiana and D. discolor.

According to the IC50 value of less than 1 mg/ml is categorized as a fruit with extremely high

antioxidant potential (Safaa et al., 2010, Bopitiya and Madhujith, 2012). Therefore, P. Emblica

fruits can be categorized as extremely high antioxidative fruits. In ABTS assay, results are

presented as RSA values, which denote the percentage of inhibiting of ABTS•+ by the

individual sample (4 mg/ml) over six minutes. As described in the Figure 2, among the selected

fruit extracts, the highest total antioxidant capacity being observed in P. emblica (81.29%),

while least was recorded in P. acidus (9%). The extracts of D. discolor and P. campechiana

were also possessed considerably higher RSA values of 71.17% and 76.14%, respectively. But

interestingly within first minute of the reaction, more than 50% of the ABTS cation radical

was inhibit by the fruit extract of P. emblica and D. discolor and completed the reaction within

four minutes. In contrast, P. acidus started to react with ABTS•+ after first minute and showed

very slow reaction rate, finally reached to 9% of RSA within six minutes. Nevertheless, the

Fruit Species TPC TMAC VitC

P. emblica

P. campechina

P. acidus

D. discolor

1,939.70 ± 0.81a

640.01 ± 0.48b

112.89 ± 0.26c

84.42 ± 0.09d

55.64± 13.79 a

29.68± 4.33 b

10.41± 3.59 c

13.14± 3.29 c

523.14± 2.24 a

53.03± 1.04 b

17.12± 0.76 d

39.15± 0.78 c


8

extracts of P. campechiana initially showed slow activity, reached the second highest RSA

value of 76.14% after six minutes.

Table 2. DPPH, ABTS Radical Scavenging Activity and FRAP of Fruit Extracts

Fruit species DPPH Radical Scavenging

Activity

ABTS

RSA%

FRAP Value

IC50 a IC50 b

P. emblica

P. campechina

D. discolor

P. acidus

0.01 ± 0.00d

8.97 ± 0.25a

7.19 ± 0.11b

5.60 ± 0.40c

0.067 ± 0.00c

130.49 ± 3.64b

310.63 ± 4.74a

124.14± 8.84b

81.29 ± 2.42a

76.14 ± 0.16b

71.17 ± 0.42c

9.00 ± 0.48d

2,891.57 ± 4.95a

1,941.54 ±

16.44b

405.35 ± 19.10c

238.25 ± 56.05d Data are presented as Mean ±SD (n = 6)

Values with different letters are significantly different at p < 0.5

RSA – lyophilized sample of 4 mg/ml (over six minutes), FRAP - M of Fe2+/100 g of fruit in fresh weight, IC 50 a -

mg of lyophilized sample/ml, IC 50 b – mg of fruit in fresh weight/ml

The FRAP assay was carried out to investigate the ability of selected fruit extracts to reduce

ferric ion (Fe3+) to ferrous ion (Fe2+). It quantifies the reducing power of extract which is an

integral attribute of such compounds (Bopitiya and Madhujith, 2012). The highest and lowest

reducing powers were observed in P. emblica and P. acidus, respectively. The extracts of P.

campechiana also showed higher reducing property with 1,941.54 Fe2+M/100 g FW (Table

2). In this study both P. emblica and P. campechiana fruit extracts showed higher reducing

power than the commonly consumed fruits such as mango and banana as observed by Silva

and Sirasa (2018).

Figure 2. ABTS+ radical scavenging activity of fruit crop species

Use of a single method to determine antioxidant capacity is insufficient, thus adoption of

different assays and model systems provide a better insight into the actual activity of the

extracts (Bopitiya and Madhujith, 2012). The results summarized in the Table 2, illustrates

antioxidant potential of selected fruit extracts are significant at p=0.05 except in IC50 in FW

basis. It may be due to different extraction yield of individual fruit species. Based on the

results, P. emblica exhibited the highest TPC, TMAC, VitC and AP.

-20

0

20

40

60

80

100

0 2 4 6 8

P. emblica

P. campechiana

D. discolor

P. acidus

Time (Minutes)

Rad

ical

Sca

ven

gin

g A

ctiv

ity

%


9

Correlation analysis

The Table 3 illustrates the correlation between tested parameters with R2 values. The DPPH,

FRAP, ABTS, TMAC and VitC showed strong positive correlation with TPC. The least

correlation, but positive (R2 = 0.0009) was observed between DPPH and ABTS assays, while

other four methods performed were possessed more than 0.5 R2 values. This poor correlation

may be due to different attributes of phenolic compounds. Also the reaction time of the ABTS

assay is only six minutes much shorter than that of DPPH (Surveswaran et al., 2007).

Table 3. Correlation between TPC, DPPH, ABTS, FRAP, TMAC and VitC

CONCLUSIONS

The results revealed that water extracts of the fruit crops tested have potential antioxidant

activity and vitamin C content. The extract of P. emlica exhibited significantly higher

antioxidant potential, vitamin C, TPC and TMAC than other fruit crops. This study highlighted

significance of selected underutilized fruit species as cheap sources of natural antioxidants and

Vitamin C. Further studies to identify individual phenolic compounds and also in vivo studies

to understand their mechanism of action are therefore suggested.

ACKNOLEDGEMENT

The authors acknowledge Postgraduate Institute of Agriculture, University of Peradeniya for

their financial support through Research Facilitation Fund (RFF).

REFERENCES

Adeolu, A.T. and Enesi, D.O. (2013). Assessment of proximate, mineral, vitamin and

phytochemical composition of plantain (Musa paradisiaca) bract – an agricultural waste. Int.

J. Plant Sci. 4(7), 192-197.

Benzie, I.F.F. and Strain, J.J. (1996). Ferric reducing ability of plasma (FRAP) as a measure

of “antioxidant power”: the FRAP assay. Anal. Bio-chem. 239(1), 70–76.

Bopitiya, D. and Madhujith, T. (2012). Antioxidant potential of pomegranate (Punica

granatum L.) cultivars grown in Sri Lanka. Trop. Agric. Res. 24(1), 71–81.

R2 TPC DPPH FRAP ABTS TMAC

TPC

DPPH

FRAP

ABTS

TMAC

VitC

-

0.6509

0.8803

0.9500

0.9784

0.9384

-

-

0.5591

0.0009

0.5889

0.5989

-

-

-

0.4691

0.9533

0.6781

-

-

-

-

0.4120

0.1811

-

-

-

-

-

0.8533


10

Das, S.C., Hamid, K., Bulbul, I.J., Sultana S. and Islam, S. (2010). In Vitro Antioxidant

Activity of Different Parts of the Plant Diospyros discolor. Res. J. of Agric. and Biol. Sci. 6(4),

472-475.

Dudonne S., Vitrac, X., Coutiere, P., Woillez, M. and Merillon, J.M. (2009). Comparative

study of antioxidant properties and total phenolic content of 30 plant extracts of Industrial

interest using DPPH, ABTS, FRAP, SOD and ORAC assays. J. Agric. Food Chem. 57(5),

1768-1774.

Flohe, R.B and Traber M.G. (1999). Vitamin Eː function and metabolism. The FASEB J. 13,

1145-1155.

Goli, A.H, Barzegar, M. and Sahari, M.A. (2005). Antioxidant activity and total phenolic

compounds of pistachio (Pistachia vera) hull extracts. Food Chem. 92, 521–525.

Haminiuk, C.W.I., Maciel, G.M., Plata-Oviedo, M.S.V. and Peralta, R.M. (2012). Invited

review Phenolic compounds in fruits – an overview. Int. J. Food Sci. and Tech. 47(10), 2023-

2044.

Jacob, A.R. (1996). Chapter 01ː Introduction. pp. 1-16. In Harris, J.R. (Ed.) Subcellular

Biochemistry, Ascorbic Acid: Biochemistry and Biomedical Cell Biology, vol. 25. Plenum,

New York, NY, USA.

Jayathilake, C., Rizliya, V. and Liyanage, R. (2016). Antioxidant and free radical scavenging

capacity of extensively used medicinal plants in Sri Lanka. Procedia Food Sci. 6, 123-126.

Jayaweera, D.M.A. (1981). Medicinal plants (Indigenous and exotic) used in Ceylon. Part II.

The National Science Foundation, Sri Lanka. pp. 228-229.

Kahkonen, M. P., Hopia, A. I., Vuorela, H. J., Rauha, J.-P., Pihlaja, K., Kujala, T. S. (1999).

Antioxidant activity of plant extracts containing phenolic compounds. J. Agri. and Food Chem.

47, 3954–3962.

Kriengsak, T., Unaroj, B., Kevin, C., Luis, C. and David, H.B. (2006). Comparison of ABTS,

DPPH, FRAP, and ORAC assays for estimating antioxidant activity from guava fruit extracts.

J. Food Com. and Analysis. 19, 669-675.

Lanerolle, M.S.De, Priyadharshani, A.M.B., sumithraarachchi, D.B. and Jansz E.R. (2008).

The carotenoids of Pouteria campechiana (Sinhalaː ratalawalu). J. of the National. Science

Foundation, Sri Lanka. 36(1), 95-98.

Lee, S.K. and Kader, A.A. (2000). Preharvest and postharvest factors influencing vitamin C

content of horticultural crops. Postharvest Bio. and Tech. 20, 20-220.

Lee, J., Robert, W.D. and Ronald, E.W. (2005). Determination of total monomeric anthocyanin

pigment content of fruit juices, beverages, natural colorants, and wines by the pH differential

method: collaborative study. J. AOAC Int. 88(5), 1269-1278.


11

Lee, M.H., Jiang, C.B., Juan, S.H., Lin, R.D. and Hou, W.C. (2006). Antioxidant and heme

oxygenase-1 (HO-1)-induced effects of selected Taiwanese plants. Fitoterapia. 77(2), 109–

115.

Lee, S., Mediani, A., Nur Ashikin, A., Azliana, A. and Abas, F. (2014). Antioxidant and α-

glucosidase inhibitory activities of the leaf and stem of selected traditional medicinal plants.

Int. Food Res. J. 21(1), 165-172.

Lie-Fen, S., Jieh-Hen, T., Je-Hsin, C., Chih-Yang, C. and Chiu-Ping, L. (2005). Antioxidant

properties of extracts from medicinal plants popularly used in Taiwan. Int. J. Applied Sci. and

Eng. 3(3), 195 - 202.

Lim, T.K. (2012a). Phyllanthaceaeː Phyllanthus acidus in Edible Medicinal and non-medicinal

plants, Vol 4, Fruits, Springer Science+Business Media. London, pp. 252- 257.

Lim, T.K. (2012b). Ebinaceaeː Diospyros blancoi in Edible Medicinal and non-medicinal

plants, Vol 2, Fruits, Springer Science+Business Media. London, UK. pp. 421-424.

Omale J. and Ugwu C. E. (2011). Comparative studies on the protein and mineral composition

of some selected Nigerian vegetables. African J. Food Sci. 5(1), 22–25.

Oviasogie, P.O., Okoro, D. and Ndiokwere, C.L. (2009). Determination of total phenolic

amounts of some edible fruits and vegetables. African J. Biotech. 8(12), 2819 -2820.

Padayatty, S., Katz, A., Wang,Y., Eck, P., Lee, J., Chen, S., Corpe, C., Dutta, A., Dutta, S. and

Levine, M. (2003). Vitamin C as an antioxidant: evaluation of its role in disease prevention. J.

Am. Clin. Nutr. 22(1), 18-35.

Pushpakumara, D.K.N.G. and Heenkenda, H.M.S. (2007). Chapter 06: Nelli (Amla)

(Phyllanthus embilica L.). pp. 180-221. In Pushpakumara, D.K.N.G., Gunasena, H.P.M.,

Singh, V.P. (Ed.) Underutilized Fruit Trees in Sri Lanka Volume 1. World Agro-forestry

Centre, South Asia Regional office, New Delhi, India; National Multipurpose Tree Species

Research Network of Sri Lanka; Sri Lanka Council for Agricultural Research Policy, Asian

Centre for Underutilized Crops, Sri Lanka.

Ramasamy, S., Wahab, N.A., Abidin, N.Z. and Manickam, S. (2011). Cytotoxicity evaluation

of five Malaysian Phyllanthaceae species on various human cancer cell lines. J. Med. Plant

Res. 5(11), 2267-2273 .

Safaa, Y. Q., Abo-khatwa, A.N. and Lahwa, M.A.B. (2010). Screening of antioxidant activity

and phenolic content of selected food items cited in the Holly Quran. Europ. J. Biol. Sci. 2(1),

40-51.

Shofian, N.M., Hamid, A.A., Osman, A., Saari, N., Anwar, F., Dek, M. S. P. and Hairuddin,

M.R. (2011). Effect of freeze-drying on the antioxidant compounds and antioxidant activity

of selected tropical fruits. Int. J. Mol. Sci. 12, 4678-4692.

Silva, K.D.R.R. and Sirasa M.S.F. (2018). Antioxidant properties of selected fruit cultivars

grown in Sri Lanka. Food Chem. 238, 203-208.


12

Su, L., Yin, J.J., Charles, D., Zhou, K., Moore, J. and Yu, L. (2007). Total Phenolic contents,

chelating capacities and radical-scavenging properties of black peppercorn, nutmeg,

hrosewhip, cinnamon and oregano leaf. J. Food Chem. 100(3), 990-997.

Surveswaran, S., Cai, Y.Z., Cork, H. and Sun, M. (2007). Evaluation of natural phenolic

antioxidant from 133 Indian medicinal plants. Food Chem. 102, 938-953.

Vidhan, J., DerMarderosian, A. and John, R.P. (2010). Anthocyanins and polyphenol oxidase

from dried arils of pomegranate (Punica granatum L.). J. Food Chem. 118(1), 11-16.

Wang, S.Y and Zheng, W. (2001). Effect of plant growth temperature on antioxidant capacity

in strawberry, J. Agric. Food Chem. 49, 4977–4982.

Wojdyło, A., Oszmianski, J. and Czemerys R. (2007). Antioxidant activity and phenolic

compounds in 32 selected herbs. Food Chem. 105, 940-949.

Yu, L., Perret, J. and Davy, B., Wilson, J. and Melby, C.L. (2002). Antioxidant properties of

cereal products. J. Food Sci. 67(7), 2600-2603.

Zhou, K. and Yu, L. (2004). Antioxidant properties of bean extracts from Trego wheat grown

at different locations. J. Agri. Food Chem. 52(5), 1112-1117.

Zulaikha, A.G.S., Mediani, A., Khoo, L.W., Lee, S.Y., Leong, S.W. and Abas, F. (2017).

Effect of different drying methods and solvent ratios on biological activities of Phyllanthus

acidus extracts. Int. Food Res. J. 24(1), 114-120.


Millet Phenolics as Natural Antioxidants in Food Model Systems and

Human LDL/VLDL Cholesterol in vitro

K.D.D. Kumari, W.M.T. Madhujith1 and G.A.P. Chandrasekara2*



Sri Lanka

ABSTRACT: Dehulled grain flour of finger millet (Eleusine coracana), proso millet (Panicum

miliaceum) and foxtail millet (Setaria italica) and phenolic extracts of millet hulls were

evaluated for ability to inhibit lipid oxidation in several food model systems, namely cooked

comminuted pork and fish, roasted peanut butter and gingelly oil. Food samples were kept for

14 days with added millet hull extracts and dehulled grain flours. The percentage inhibition of

production of thiobarbituric acid reactive substances (TBARS) during storage was determined.

Inhibitory activities of phenolic extracts of finger millet dehulled grain and finger millet foods,

namely, Rotti, Pittu, Halapa, Thalapa and porridge, against human very low-density

lipoprotein (VLDL) and low-density lipoprotein (LDL) oxidation were determined by

measuring the production level of conjugated dienes (CD) in vitro. Finger millet had higher

phenolic content and antioxidant activities compared to the respective proso and foxtail millet

samples. Finger millet hull extracts exhibited the highest inhibition of lipid peroxidation in

food model systems. The maximum percentage inhibition of TBARS in pork, fish, and peanut

with added finger millet hull extracts were observed at days 3, 7, 5, and 14, respectively. The

percentage inihibition of TBARS in cooked pork and fish with added millet hull extracts

ranged from 4.4 to 12.8% and 63 to 77%, respectively at the end of the second week. Millet

grains and desolventized millet phenolic extracts can act as natural sources of antioxidants at

different degrees in pork, fish, peanut and gingelly oil to prevent lipid oxidation during storage.

Keywords: Lipid oxidation inhibition, millet, natural antioxidants, meat, gingelly oil, roasted

peanut butter

INTRODUCTION

Lipid oxidation products formed in foods lead to the development of off-flavours and affect

nutritional and sensory qualities. Further, they act as atherogenic agents in addition to their

mutagenic and carcinogenic properties (Shahidi et al., 2012). Polyunsaturated fatty acids

(PUFA) in foods are susceptible to oxidation during processing and storage (Shahidi et al.,

2012). A number of factors affects the rate of lipid oxidation in foods. Special measures are

taken during processing and storage to prevent food lipid oxidation and addition of

antioxidants is a common practice among others. Butylated hydroxyanisole (BHA), butylated

hydroxytoluene (BHT) and tert-butyl hydroquinone (TBHQ) are most widely used synthetic

antioxidants in food industry (Shahidi and Zhong, 2005). There are several controversies in

1 Department of Food science and Technology, Faculty of Agriculture, University of Peradeniya, Sri Lanka 2 Department of Applied Nutrition, Wayamba University of Sri Lanka, Makandura, Gonawila, Sri Lanka


Kumari et al.

14

the use of synthetic antioxidants as health concerns have been raised on their addition in foods

(Shahidi and Zhong, 2005). Food additives are subjected to the most stringent toxicological

testing procedures, and only a few synthetic antioxidants have been used in foods so far. There

is a growing interest of using natural antioxidants in foods. The natural antioxidants include

phenolic compounds, tocopherols, and flavonoids (Artajo et al., 2006). Oxidized Low-density

lipoproteins (LDLs) have been detected in atherosclerotic vessels and they appear to play a

major role in the disease process (Esterbauer et al., 1992; Steinberg, 1992). Naturally occurring

antioxidants in the diet may play a role in inhibiting the oxidative modification of LDL and

hence they might act as anti-atherosclerotic agents (Shahidi et al., 2012)

Millets are recognized as potential future crops due to their nutrient contents similar to other

major cereals and rich non-nutrient profiles, especially phenolic compounds (Shahidi and

Chandrasekara, 2014; Kumari et al., 2017(. Previous work on millets have proven that phenolic

compounds present in millets are bioaccessible and may act as antioxidants within the human

body to protect against oxidative stress (Chandrasekara and Shahidi, 2012a). The aim of the

present work was to evaluate the ability of millet phenolic compounds to prevent the oxidation

of lipids present in food model systems namely, pork, fish, peanut, and gingelly oil and to

determine the ability of millet phenolics to prevent the oxidation of human LDL cholesterol in

vitro.

METHODOLOGY

Samples of finger millet (Elusine coracana) variety “Oshada”, local variety of proso millet

(Panicum miliacium) and foxtail millet (Setaria italica) grown in Sri Lanka were used in this

study. All grain materials were obtained from the Department of Agriculture, Sri Lanka. Folin-

Ciocalteu’s reagent was purchased from Research Lab Fine Chem Industries, Mumbai, India.

Vanillin, 2,2-diphenyl-1-picrylhydrazyl (DPPH), 2,2 azinobis (3-ethylbenzothiazoline-6-

sulfonate diammonium salt) (ABTS), 2,2-azobis (2-methylpropionamidine) dihydrocholride

(AAPH), ferrous chloride, sodium chloride, butylated hydroxyanisole (BHA), ferulic acid,

trolox, catechin, and ethanol were purchased from Sigma-Aldrich, St Louis, USA. Sodium

carbonate, ferric chloride, were purchased from Thomas Baker (Chemicals) Limited, Bombay,

India. Aluminium chloride, trichloroacetic acid (TCA), and potassium phosphate dibasic were

purchased from Techno Pharm Chem, India. Sodium hydroxide, and potassium phosphate

monobasic were purchased from Loba Chem Pvt Ltd, India. 3-(2-pyridyl)-5,6-diphenyl-1,2,4-

triazine-4,4-disulfonic acid sodium salt (Ferrozine) were purchased from SERVA

Electrophoresis GmbH, Heildberg, Germany. Ethylene diamine tetra acetic acid tri sodium salt

(Na3EDTA) was purchased from Needham Market Sufflock, England. 2, 2, 4-

trimethylpentane and 1,1,3,3-tetramethoxypropane were purchased from Sigma-Aldrich, St

Louis, USA.

Sample preparation

Millet whole grains were dehulled and hulls were separated from grains. Finger millet grains

were dehulled using a rice polishing machine (Rice husker and polisher PM 500, Satake

Engineering Co Ltd, Japan). Foxtail millets and proso millets were dehulled using rice milling

machine (Rice machine, Satake Engineering Co Ltd, Japan). Dehulled grains, and hulls were

separately used for the extraction of phenolics. Samples were ground using an electric grinder

and sieved (0.038 seive opening; As 200 test seiver, Retsch, Germany(. Samples were defatted

using hexane (1:5 w/v, 2 min, two times) at ambient temperature. Defatted samples packed in

Millet Phenolics as Natural Antioxidants

15

polythene pouches were stored at -80 ºC until used within a week for extraction of phenolic

compounds.

Extraction of soluble phenolic compounds

Soluble phenolic compounds were extracted from dehulled grains and hulls of millets. Defatted

meal (5 g) was mixed with 100 mL of 80% (v/v) aqueous ethanol in a capped conical flask and

placed in a shaking water bath at 50°C, stirring at 175 rpm speed for 40 minutes. The extraction

procedure was repeated two more times. Combined supernatants were evaporated in rotary

evaporator at 40ºC at 125 rpm. Concentrated samples were freeze dried at -55ºC, and 12 x 10-

3 mbar. Lyophilized crude phenolic extracts were stored at -80ºC until used for further analysis.

During all stages, extracts were protected from light by covering with aluminum foil.

Determination of oxidative stability in comminuted pork model

The samples were prepared to determine the oxidative stability of dehulled millet flour and

soluble phenolic extracts of millet hull according to Chandrasekara and Shahidi (2012b). In

brief, ground pork (80g) was mixed with 20 g deionized water in a glass jar and mixed with

testing materials, namely dehulled millet flour (2%), hull phenolic extracts (0.2%), ferulic acid

(0.02%) or BHA (0.02%) followed by thoroughly mixing with a glass rod. A control without

added compounds was maintained under same experimental conditions. Capped glass jars

were cooked in a water bath at 80 ± 2 ºC for 40 minutes while stirring with a glass rod at every

5 minutes. Samples were cooled to room temperature and were transferred to polythene bags.

Bags were stored in a refrigerator at 4 ºC and samples were drawn on days 0, 3, 5, 7 and 14 for

the analysis of thiobarbituric acid reactive substances (TBARS). The experiment of each test

material was carried out in three replications.

Determination of oxidative stability in fish model

The oxidative stability of dehulled millet grains and soluble phenolic extracts in the inhibition

of TBARS production in cooked Tuna fish (ground boneless flesh) was determined as

previously explained (Wijeratne et al., 2006). The experimental procedure was similar to the

pork model explained in the previous section.

Determination of oxidative stability in peanut model

The effect of dehulled millet grain and soluble phenolic extracts in the inhibition of TBARS

production in roasted ground peanut was determined according to Wijeratne et al. (2006).

Dehulled millet flour (2%), phenolic extracts of hulls (0.2%), ferulic acid (0.02%) and BHA

(0.02%) were added to 100 g of ground peanut and thoroughly mixed with a glass rod in a

glass jar. A separate control sample without extracts was also prepared. Samples were mixed

thoroughly and transferred into polythene bags. Samples were stored in room temperature for

14 days. Samples were drawn on days 0, 3, 5, 7 and 14 for analysis of TBARS.

Determination of oxidative stability in gingelly oil

The efficacy of soluble millet extracts to inhibit the oxidation of gingelly oil was measured

according to the method explained by Chandrasekara and Shahidi, (2011b). Hull phenolic

extracts (1%), ferulic acid (1%) and BHA (1%) were added separately into 100 mL glass jars,

and then 2 g of gingelly oil sample was added following vortexing thoroughly for 2 minutes.

Each treatment was prepared in triplicate and jars were kept in the oven at 60ºC. Samples for

Kumari et al.

16

the analysis of TBARS were drawn on 0, 6, 12, 24, 36 and 48 hours and were analyzed for the

inhibition percentage of TBARS and the production of conjugated dienes (CD). Control

samples of oil without test materials were maintained under identical experimental conditions.

Inhibition percentage of TBARS

The inhibition percentage of TBARS was determined according to the method explained by

Chandrasekara and Shahidi, (2012b). In this, 2 g from each fish, meat, or peanut sample was

weighed in a 50 mL centrifuge tube. Then 5 mL of 10% (w/v) solution of trichloroacetic acid

(TCA) were added and vortexed at high speed for 2 minutes. Thiobarbituric acid (TBA)

solution (0.02 M, 5 mL) was added to each centrifuge tube and vortexed for 30 seconds. The

samples were subsequently centrifuged at 3000 g for 10 minutes and the supernatants were

filtered through a Whatman No.3 paper. Filtrates were heated in a boiling water bath for 45

minutes and cooled to room temperature on an ice bath. The absorbance of the pink coloured

chromogen was measured at 532 nm (UV-VIS Spectrophotometer, Labomed Inc, USA).

Standard curve was prepared using 1,1,3,3-tetramethoxypropane as a precursor of the

malondialdehyde (MDA). The percentage inhibition of TBARS formation was calculated as

follows. Inhibition percentage = {(TBARS control TBARS sample) / TBARS control} x 100, where

TBARS control = TBARS formed in the control and TBARS sample = TBARS formed in the

sample. TBARS values of oil samples were determined according to the standard AOCS

method. In brief the oil (50 – 100 mg) was weighed into a 25 mL volumetric flask and made

up to volume with 1-butanol. Then 5 mL of this solution was transferred into a screw capped

test tube with added 5 mL of freshly prepared 2-TBA reagent (500 mg of TBA in 250 mL 1-

butanol). Contents were thoroughly mixed and heated in a water bath at 95ºC for 2 hours.

Samples were cooled in an ice bath and the absorbance values were measured at 532 nm.

Standard curve was prepared using 1,1,3,3-tetramethoxypropane as a precursor of the

malondialdehyde (MDA). The percentage inhibition of TBARS formation was calculated as

follows. Inhibition percentage = {(TBARS control TBARS sample) / TBARS control} x 100, where

TBARS control = TBARS formed in the control and TBARS sample = TBARS formed in the

sample.

Determination of conjugated diene (CD) in gingelly oil sample

The CD contents of oil samples were determined according to the method explained by Shahidi

and Zhong (2005). In this a sample of gingelly oil (0.02-0.03 g) was weighed into a 25 mL

volumetric flask, and made up to the mark with 2,2,4-trimethylpentane. The solution was

thoroughly mixed and the absorbance was measured at 234 nm. Pure 2, 2, 4- trimethylpentane

was used as a reference. CD values were calculated using the following equation;

CD=Absorbance of solution at 234 nm / C*L, where C= concentration of oil in g per 100 mL,

L=length of the cuvette (cm(.

Inhibition of copper-mediated human LDL and VLDL oxidation

Inhibitory activities of phenolic extracts of finger millet dehulled grain and finger millet foods

(Rotti, Pittu, Halapa, Thalapa and Porridge) against human VLDL and LDL oxidation were

determined by measuring conjugated dienes (CD) produced in the system using the method

described by Chandrasekara and Shahidi, (2012b). LDL and VLDLs from human serum were

isolated using HDL precipitating reagents. Pellets (LDL/VLDL precipitate) were obtained by

decanting the supernatant (HDL) and suspended in phosphate buffer to obtain diluted

cholesterol solution of 0.1mg/mL protein concentration in PBS (pH 7.4, 0.15M NaCl). Protein

concentrations of lipoproteins were determined using the biuret reagent test. The diluted


17

solution (0.8 mL) was mixed with 100 μL of soluble extract of foods (0.5 mg / mL in PBS) in

an eppendorf tube. Oxidation of LDL was initiated by adding 0.1 mL of 100 μM CuSO4

solution in distilled water. The mixture was incubated at 37ºC for 24 hours. The initial

absorbance (t=0) was read at 234 nm immediately after mixing and CD hydroperoxides formed

were measured at 0, 3, 6, 12 and 24-hour intervals. The concentration of CD formed was

calculated using the molar extinction coefficient of 29500M-1cm-1.


All experiments were carried out in triplicates and data were reported as mean ± standard

deviation. The differences of mean values among samples were determined by one-way

analysis of variance (ANOVA) followed by Tukeys Honestly Significant Difference (HSD)

multiple rank tests at p = 0.05, significance level. All statistical analysis was performed by

SPSS version 16 (SPSS Inc., Chicago, IL).


The ability of the lipid containing foods to act against oxidation is expressed as oxidative

stability of foods. TBARS values measure the level of lipid oxidation. Table 1 and 2 show the

effect of the millet extracts, ferulic acid and BHA on the inhibition of TBARS on pork and fish

models. In communited pork model BHA showed the highest inhibition of TBARS in the range

of 80 to 94 % from day 0 to end of the second week, compared to ferulic acid and millet

extracts. The inhibition percentage of TBARS in pork model with added millet extracts ranged

from 1 to 40% from day 0 and end of second week. In addition, the ability of TBARS

production inhibition decreased with time in pork model with added millet flour or extracts.

This could be due to the reduction of antioxidant power in millet extracts with the storage time.

The inhibition percentage of TBARS in the fish model with added BHA and millet

flour/extracts were 62 and 83% and 3 and 57%, respectively on day 0 and end of second week.

Generally, the highest inhibition percentage was observed on day 0 and day 14 in pork and

fish models respectively, with added millet flour/extract. Millet grain hull extracts showed high

TBARS production inhibition which ranged from 56 to 63% in fish model at the end of second

week . Further, the greater effect of the millet hull extract on inhibiting the production of

TBARS could be due to the high phenolic content and the antioxidant activities in addition to

the presence of other compounds such as, vitamin C, E, with antioxidant activities in hull

extracts compared to those of dehulled grain. Previous studies also reported the ability of plant

extracts to prevent the oxidation of lipids in meat (Rhee et al., 1996; Karwowska and

Dolatowski, 2007). The phenolics present in natural plant extracts have strong H+ donating

activity. In the present study also the phenolic extracts of millet showed high antioxidant

activity against lipid oxidation of the meat and fish samples. These results are in agreement

with several other studies that reported natural antioxidants from plant sources could prevent

the lipid oxidation of meat and meat products (Yu et al., 2002).

Table 3 shows the the effect of the millet flour/extracts, ferulic acid and BHA on production

inhibition of TBARS on roasted peanut model. BHA showed the highest inhibition percentage

of TBARS at the day 0 compared to ferulic acid and millet flour/extracts. Peanut sample with

added proso millet dehulled grain flour showed the highest ability to prevent the production of

TBARS at the end of second, third and fourth weeks. Tea catechins, as a polyphenolic

flavonoid to prevent the lipid oxidation in green tea has been demonstrated in a variety of food

systems (McCarthy, 2001; Nissen, 2004; Mitsumoto, 2005). Moreover, the use of millet

Kumari et al.

18

phenolic extracts shows antioxidant effects similar or better than those of BHA. Polyphenolic

extracts are excellent electron and proton donors, and their intermediate radicals are quite

stable due to electronic delocalization phenomenon as well as the lack of position attackable

by oxygen (Rhee et al., 2001). Therefore, millets can be used in peanut butter preparations to

improve the quality of the product.

Table 4 shows the effect of the millet flour/extracts, ferulic acid and BHA on production

inhibition of TBARS on gingelly oil model. Among those phenolic extracts of millet showed

higher ability to prevent the production of TBARS reflecting their higher antioxidant activity

for protection of gingelly oil against oxidation compared to ferulic acid and BHA.The highest

TBARS inhibition was showed at 72 hours by phenolic extracts of finger millet hull. Compared

to BHA, phenolic extracts of millet dehulled grains and hulls showed increased duration of

oxidative stability in oil samples. Table 5 shows the production of CD in gingelly oil model

system. Compared with the control millet hull extract added oil samples showed significantly

low CD levels at 36, 48 and 72 hours. During the 0 to 24 hours of time period there were not

any significant difference in the production of CD in oil samples with added millet hull

extracts.

Results of TBARS and CD in gingelly oil model showed that phenolic extracts of millets have

the ability to delay the oxidation of gingelly oil during storage. Previous studies showed that

natural antioxidants from plant sources have an effect to increase the oxidative stability in oil

samples (Kamali et al., 2011). Further, they showed that addition of cinnamon extracts

increased the oxidative stability of sunflower oil (Kamali et al., 2011). The antioxidant

potential of plant extracts is a result of not only the presence of the active phenolic compounds

but also of other components present in the system. Figure 1 shows the ability of phenolic

extracts of finger millet dehulled grain and finger millet foods (Rotti, Pittu, Halapa, Thalapa

and Porridge) to prevent the oxidation of human VLDL and LDL in vitro. Pittu had the highest

ability to prevent the production of conjugated dienes in oxidation of human VLDL and LDLs

in vitro while Thalapa shows the lowest ability.

The phenolic compounds which are present in finger millet foods should have the ability to

chelate cupric ions and scavenge the formed peroxyl radicals to prevent the oxidation of VLDL

and LDL cholesterol in vitro (Decker et al., 2001). According to Chandrasekara and Shahidi

(2011b) soluble phenolic extracts of pearl millet hulls and dehulled grain at a low concentration

(0.125 mg/mL) showed 1.6 and 3.9 times higher inhibition, respectively, of LDL oxidation

than that at high concentration (0.5 mg/mL). Authors explained that there is a possibility that

phenolic compounds at high concentrations may complex with protein moieties of the LDL

cholesterol molecules, which makes them unavailable to inhibit oxidation of cholesterol.

Previous studies have shown that phenolic compounds can inhibit protein oxidation by binding

of the proteins to form complexes with protein molecules (Siebert et al., 1996; Riedl and

Hagerman, 2001). Therefore, the low ability of finger millet foods with high phenolic content

to inhibit the oxidation of LDL and VLDL cholesterol in vitro might be due to the interactions

of proteins and phenolic compounds at high concentrations of phenolics.


Table 1. Inhibition percentage of thiobarbeturic acid reactive substances (TBARS) at different time periods in the pork model system


Day 0 Day 3 Day 5 Day

7

Day 14

BHA 80.09 ± 0.11a1 93.66 ± 0.38a2 86.94 ± 0.69a3 88.98 ± 1.01a3 79.47 ± 0.39a1

Ferulic acid 14.39 ± 0.05b1 23.94 ± 0.03b2 19.65 ± 2.20b3 27.34 ± 2.06b4 3.67± 1.25b5

Finger millet dehulled grain flour 4.60 ± 0.61c1 18.34 ± 0.07c2 19.20 ± 1.30b2 16.76 ± 3.28c3 8.18 ± 0.63b4

Foxtail millet dehulled grain flour 10.89 ± 0.05d1 9.45 ± 0.21d1 21.07 ± 2.13b2 24.72 ± 2.43b3 12.85 ± 0.82c4

Proso millet dehulled grain flour 30.53 ± 1.78e1 10.41 ± 0.10e2 0.64 ± 0.04c3 13.40 ± 1.30c4 8.49 ± 0.04d5

Finger millet hull extract 38.06 ± 0.10e1 25.25 ± 0.83b2 18.20 ± 0.07b3 20.24 ± 1.81b4 5.09 ± 0.82e5

Foxtail millet hull extract 4.20 ± 0.45c1 18.18 ± 0.03c2 7.94 ± 0.22d3 23.58 ± 3.25b4 6.62 ± 1.02e5

Proso millet hull extract 39.71 ± 0.79e1 10.93 ± 0.83e2 15.63 ± 1.63e3 13.19 ± 0.22d4 4.51 ± 0.70e5

Superscripts with the same letters in each column and same numbers in each row are not significantly different

Table 2. Inhibition percentage of thiobarbeturic acid reactive substances (TBARS) at different time periods in fish model system



Day 0 Day 3 Day 5 Day 7 Day 14

BHA 81.73 ± 2.99a1 83.33 ± 1.39a1 80.63 ± 1.26a1 77.87 ± 2.54a2 61.88 ± 1.86a2

Ferulic acid 18.27 ± 2.09b1 18.13 ± 0.62b1 5.66 ± 0.19b2 20.55 ± 0.35b3 4.65 ± 0.10b4

Finger millet dehulled grain flour 22.36 ± 1.25c1 3.37 ± 0.68c2 18.93 ± 0.88c3 3.82 ± 1.62c2 5.08 ± 0.18 c4

Foxtail millet dehulled grain flour 38.03 ± 0.58d1 5.21 ± 0.16d2 16.92 ± 1.07d3 7.16 ± 1.20d4 2.61 ± 0.34d5

Proso millet dehulled grain flour 34.46 ± 1.68e1 3.91 ± 0.16c2 18.49 ± 1.24c3 8.78 ± 5.08e4 6.10 ± 0.19e5

Finger millet hull extract 33.38 ± 6.22e1 9.12 ± 0.16e2 17.48 ± 1.53e3 30.70 ± 5.06f4 56.10 ± 0.04f5

Foxtail millet hull extract 46.35 ± 5.23f1 16.83 ± 4.55f2 17.61 ± 3.60e3 21.61 ± 2.22g4 63.13 ± 0.14g5

Proso millet hull extract 49.72 ± 5.07g1 8.85 ± 3.08g2 21.51 ± 1.00f3 30.57 ± 1.73f4 56.10 ± 0.19f5

Kumari et al.

20

Table 3. Inhibition percentage of thiobarbeturic acid reactive substances (TBARS) at different time periods in peanut model system


Table 4. Inhibition percentage of thiobarbeturic acid reactive substances (TBARS) at different time periods in gingelly oil model system


Inhibition percentage of thiobarbeturic acid reactive substances (TBARS)

Day 0 Day 7 Day 14 Day 21 Day 28

BHA 63.71 ± 0.09a1 23.81 ±3.23a2 43.86 ±1.25a3 24.83 ±4.04a2 25.75 ±3.21a2

Ferulic acid 59.72 ±0.46b1 23.05 ±0.14a2 37.14 ±2.13b2 22.43 ±0.06b2 25.87 ±0.22b2

Finger millet dehulled grain flour 57.61 ±0.58c1 24.37 ±0.13b2 45.45 ±3.62c3 29.67 ±5.87c3 34.13 ±0.35c4

Foxtail millet dehulled grain flour 51.75 ±4.21d1 22.08 ±0.13c2 37.28 ±1.35d3 32.98 ±0.22d3 32.52 ±0.17d3

Proso millet dehulled grain flour 49.13 ±1.46e1 27.96 ±0.07d2 45.85 ±1.31e3 33.16 ±0.43e4 37.91 ±1.09e3

Finger millet hull extract 51.89 ±0.05d1 32.67 ±0.09e2 28.15 ±0.10f3 13.00 ±0.10f4 19.97 ±0.11f5

Foxtail millet hull extract 55.15 ±0.99f1 31.49 ±1.77f2 27.55 ±0.13g3 6.87 ±1.02g4 7.47 ±0.27g5

Proso millet hull extract 33.54 ±2.65g1 28.26 ±0.20g2 28.19 ±0.15h2 9.72 ±1.11h3 2.52 ±1.09h4


0 hours 6 hours 12 hours 24 hours 36 hours 72 hours

BHA 12.88 ± 3.30a1 4.90 ±0.90a2 5.00 ±1.89a2 6.26 ±1.15a3 9.90 ±2.03a4 18.71 ±1.90a5

Ferulic acid 21.46 ±3.40b1 1.96 ±0.90b2 20.71 ±1.89b1 3.68 ±1.94b3 9.20 ±0.77b4 53.00 ±2.31b5

Finger millet hull extract 28.03 ±2.00c1 13.33 ±0.68c2 32.38 ±2.89c3 23.57 ±1.39c4 41.84 ±1.17c5 61.87 ±1.25c6

Foxtail millet hull extract 20.20 ±1.10d1 10.59 ±1.18d2 19.29 ±0.71b1 32.04 ±2.53d3 8.68 ±0.80e4 56.12 ±1.90d5

Proso millet hull extract 11.62 ±1.20e1 14.12 ±2.04e2 37.86 ±0.71d3 29.47 ±2.61e4 43.23 ±2.03f5 54.68 ±0.72e6


21

Table 5. Production of conjugated dienes (CD) in gingerlly oil model system


Time (hr)

0 06 12 24 36 48 72

Control 9.3 ±1.0a1 11.2 ±2.1a2 12.3 ±0.5a2 12.7 ±0.5a2 13.5 ±1.1a3 11.7 ±0.2a2 14.0 ±1.4a3

BHA 8.2 ±1.2a1 11.9 ±1.2a2 12.2 ±0.7a3 13.7 ±0.4b2 11.9 ±0.9b3 11.3 ±0.3a2 12.5 ±1.3b3

Ferulic acid 9.1 ±1.0a1 11.7 ±1.1a2 11.7 ±0.7a2 11.9 ±1.2a2 13.6 ±0.7a3 12.4 ±0.4a4 13.9 ±1.0b3

Finger millet hull extract 8.3 ±0.8a1 10.9 ±0.9a2 11.5 ±1.2a3 12.8 ±1.1a1 13.8 ±0.1a4 9.6 ±0.5b5 9.8 ±0.5c5

Foxtail millet hull extract 8.1 ±0.2a1 10.2 ±0.8a2 11.7 ±1.1a1 12.7 ±0.9a3 11.80 ±0.5b1 9.4 ±0.4b2 12.4 ±0.8b3

Proso millet hull extract 8.5 ±1.3a1 11.9 ±0.4a2 12.4 ±1.6a2 11.8 ±1.3a2 12.1 ±0.4b2 11.4 ±1.2a2 12.9 ±0.2b2


Figure 1. The production of CD in human LDL and VLDLs samples in vitro with added

synthetic antioxidants and phenolic extracts of finger millet foods

Previous studies showed that plant phenolic compounds have potential to prevent the oxidation

of LDL cholesterols in vitro. Phenolic compounds found in wine are potent antioxidants in

inhibiting LDL oxidation in vitro (Teissedre et al., 1996; Meyer et al., 1997). According to

Heinonen et al. (1998) phenolic extracts of berries, namely black berries, red raspberries, sweet

cherries, blueberries, and strawberries demonstrated inhibition of human LDL oxidation.

Therefore, further in vivo research is warranted to reveal the effect of millet foods consumption

to prevent and control or reduce the burden of cardio vascular disease among humans. The

oxidized LDL can increase the risk of initiating vascular lesions in blood vessels leading to

atheroma formation.


23

CONCLUSIONS

Millet grains and millet phenolic extracts act as natural sources of antioxidants in comminuted

pork and fish, peanut butter and gingelly oil to prevent lipid oxidation during storage. Millet

hull phenolics are potential sources of natural antioxidants which can be utilized in food

industry replacing synthetic antioxidants. Further, it is worthwhile to explore the possibility of

using millet hull phenolics as potential raw materials for the production of nutraceuticals to

attenuate LDL cholesterol oxidation.

ACKNOLEDGEMENT

This research was supported by the National Research Council of Sri Lanka (NRC 12-096).

REFERENCES

Adeolu, A.T. and Enesi, D.O. (2013). Assessment of proximate, mineral, vitamin and

phytochemical composition of plantain (Musa paradisiaca) bract – an agricultural waste. Int.

j. Plant Sci. 4(7), 192-197.

Benzie, I.F.F. and Strain, J.J. (1996). Ferric reducing ability of plasma (FRAP) as a measure

of “antioxidant power”: the FRAP assay. Anal. Bio-chem. 239(1), 70–76.

Bopitiya, D. and Madhujith, T. (2012). Antioxidant Potential of Pomegranate (Punica

granatum L.) Cultivars Grown in Sri Lanka. Trop. Agric. Res. 24(1), 71–81.

Das, S.C., Hamid, K., Bulbul, I.J., Sultana S. and Islam, S. (2010). In Vitro Antioxidant

Activity of Different Parts of the Plant Diospyros discolor. Res. J. of Agric. and Biol. Sci. 6(4),

472-475.

Dudonne S., Vitrac, X., Coutiere, P., Woillez, M. and Merillon, J.M. (2009). Comparative

study of antioxidant properties and total phenolic content of 30 plant extracts of Industrial

interest using DPPH, ABTS, FRAP, SOD and ORAC assays. J. Agric. Food Chem. 57(5),

1768-1774.

Flohe, R.B and Traber M.G. (1999). Vitamin Eː function and metabolism. The FASEB J. 13,

1145-1155.

Goli, A.H, Barzegar, M. and Sahari, M.A. (2005). Antioxidant activity and total phenolic

compounds of pistachio (Pistachia vera) hull extracts. Food Chem. 92, 521–525.

Haminiuk, C.W.I., Maciel, G.M., Plata-Oviedo, M.S.V. and Peralta, R.M. (2012). Invited

review Phenolic compounds in fruits – an overview. Int. J. Food Sci. and Tech. 47(10), 2023-

2044.

Jacob, A.R. (1996). Chapter 01ː Introduction. pp. 1-16. In Harris, J.R. (Ed.) Subcellular

Biochemistry, Ascorbic Acid: Biochemistry and Biomedical Cell Biology, vol. 25. Plenum,

New York, NY, USA.

Kumari et al.

24

Jayathilake, C., Rizliya, V. and Liyanage, R. (2016). Antioxidant and free radical scavenging

capacity of extensively used medicinal plants in Sri Lanka. Procedia Food Sci. 6, 123-126.

Jayaweera, D.M.A. (1981). Medicinal plants (Indigenous and exotic) used in Ceylon. Part II.

The National Science Foundation, Sri Lanka. pp. 228-229.

Kahkonen, M. P., Hopia, A. I., Vuorela, H. J., Rauha, J.-P., Pihlaja, K., Kujala, T. S. (1999).

Antioxidant activity of plant extracts containing phenolic compounds. J. Agri. and Food Chem.

47, 3954–3962.

Kriengsak, T., Unaroj, B., Kevin, C., Luis, C. and David, H.B. (2006). Comparison of ABTS,

DPPH, FRAP, and ORAC assays for estimating antioxidant activity from guava fruit extracts.

J. Food Com. and Analysis. 19, 669-675.

Lanerolle, M.S.De, Priyadharshani, A.M.B., sumithraarachchi, D.B. and Jansz E.R. (2008).

The carotenoids of Pouteria campechiana (Sinhalaː ratalawalu). J. of the National. Science

Foundation, Sri Lanka. 36(1), 95-98.

Lee, S.K. and Kader, A.A. (2000). Preharvest and postharvest factors influencing vitamin C

content of horticultural crops. Postharvest Bio. and Tech. 20, 20-220.

Lee, J., Robert, W.D. and Ronald, E.W. (2005). Determination of total monomeric anthocyanin

pigment content of fruit juices, beverages, natural colorants, and wines by the pH differential

method: collaborative study. J. AOAC Int. 88(5), 1269-1278.

Lee, M.H., Jiang, C.B., Juan, S.H., Lin, R.D. and Hou, W.C. (2006). Antioxidant and heme

oxygenase-1 (HO-1)-induced effects of selected Taiwanese plants. Fitoterapia. 77(2), 109–

115.

Lee, S., Mediani, A., Nur Ashikin, A., Azliana, A. and Abas, F. (2014). Antioxidant and α-

glucosidase inhibitory activities of the leaf and stem of selected traditional medicinal plants.

Int. Food Res. J. 21(1), 165-172.

Lie-Fen, S., Jieh-Hen, T., Je-Hsin, C., Chih-Yang, C. and Chiu-Ping, L. (2005). Antioxidant

properties of extracts from medicinal plants popularly used in Taiwan. Int. J. Applied Sci. and

Eng. 3(3), 195 - 202.

Lim, T.K. (2012a). Phyllanthaceaeː Phylanthus acidus in Edible Medicinal and non-medicinal

plants, Vol 4, Fruits, Springer Science+Business Media. London, pp. 252- 257.

Lim, T.K. (2012b). Ebinaceaeː Diospyros blancoi in Edible Medicinal and non-medicinal

plants, Vol 2, Fruits, Springer Science+Business Media. London, UK. pp. 421-424.

Omale J. and Ugwu C. E. (2011). Comparative studies on the protein and mineral composition

of some selected Nigerian vegetables. African J. Food Sci. 5(1), 22–25.

Oviasogie, P.O., Okoro, D. and Ndiokwere, C.L. (2009). Determination of total phenolic

amounts of some edible fruits and vegetables. African J. Biotech. 8(12), 2819 -2820.


25

Padayatty, S., Katz, A., Wang,Y., Eck, P., Lee, J., Chen, S., Corpe, C., Dutta, A., Dutta, S. and

Levine, M. (2003). Vitamin C as an antioxidant: evaluation of its role in disease prevention. J.

Am. Clin. Nutr. 22(1), 18-35.

Pushpakumara, D.K.N.G. and Heenkenda, H.M.S. (2007). Chapter 06: Nelli (Amla)

(Phyllanthus embilica L.). pp. 180-221. In Pushpakumara, D.K.N.G., Gunasena, H.P.M.,

Singh, V.P. (Ed.) Underutilized Fruit Trees in Sri Lanka Volume 1. World Agro-forestry

Centre, South Asia Regional office, New Delhi, India; National Multipurpose Tree Species

Research Network of Sri Lanka; Sri Lanka Council for Agricultural Research Policy, Asian

Centre for Underutilized Crops, Sri Lanka.

Ramasamy, S., Wahab, N.A., Abidin, N.Z. and Manickam, S. (2011). Cytotoxicity evaluation

of five Malaysian Phyllanthaceae species on various human cancer cell lines. J. Med. Plant

Res. 5(11), 2267-2273 .

Safaa, Y. Q., Abo-khatwa, A.N. and Lahwa, M.A.B. (2010). Screening of antioxidant activity

and phenolic content of selected food items cited in the Holly Quran. Europ. J. Biol. Sci. 2(1),

40-51.

Shofian, N.M., Hamid, A.A., Osman, A., Saari, N., Anwar, F., Dek, M. S. P. and Hairuddin,

M.R. (2011). Effect of freeze-drying on the antioxidant compounds and antioxidant activity of

selected tropical fruits. Int. J. Mol. Sci. 12, 4678-4692.

Silva, K.D.R.R. and Sirasa M.S.F. (2018). Antioxidant properties of selected fruit cultivars

grown in Sri Lanka. Food Chem. 238, 203-208.

Su, L., Yin, J.J., Charles, D., Zhou, K., Moore, J. and Yu, L. (2007). Total Phenolic contents,

chelating capacities and radical-scavenging properties of black peppercorn, nutmeg,

hrosewhip, cinnamon and oregano leaf. J. Food Chem. 100(3), 990-997.

Surveswaran, S., Cai, Y.Z., Cork, H. and Sun, M. (2007). Evaluation of natural phenolic

antioxidant from 133 Indian medicinal plants. Food Chem. 102, 938-953.

Vidhan, J., DerMarderosian, A. and John, R.P. (2010). Anthocyanins and polyphenol oxidase

from dried arils of pomegranate (Punica granatum L.). J. Food Chem. 118(1), 11-16.

Wang, S.Y and Zheng, W. (2001). Effect of plant growth temperature on antioxidant capacity

in strawberry, J. Agric. Food Chem. 49, 4977–4982.

Wojdyło, A., Oszmianski, J. and Czemerys R. (2007). Antioxidant activity and phenolic

compounds in 32 selected herbs. Food Chem. 105, 940-949.

Yu, L., Perret, J. and Davy, B., Wilson, J. and Melby, C.L. (2002). Antioxidant properties of

cereal products. J. Food Sci. 67(7), 2600-2603.

Zhou, K. and Yu, L. (2004). Antioxidant properties of bean extracts from Trego wheat grown

at different locations. J. Agri. Food Chem. 52(5), 1112-1117.

Kumari et al.

26

Zulaikha, A.G.S., Mediani, A., Khoo, L.W., Lee, S.Y., Leong, S.W. and Abas, F. (2017).

Effect of different drying methods and solvent ratios on biological activities of Phyllanthus

acidus extracts. Int. Food Res. J. 24(1), 114-120.

Tropical Agricultural Research Vol. 30 (3): 27– 41 (2018)

Preliminary Evaluation of Probiotic Potential of Yeasts Isolated from

Bovine Milk and Curd of Sri Lanka

D.U. Rajawardana*, I.G.N. Hewajulige1, C.M. Nanayakkara2, S.K.M.R.A. Athurupana3 and

W.M.T. Madhujith3

Department of Plant Sciences, Faculty of Science

University of Colombo

Sri Lanka

ABSTRACT: There has been mounting interest in the health benefits associated with live

microorganisms commonly known as probiotics. Many probiotic bacterial species have been

identified. However, the potential of yeasts as a source of probiotics has not been well

explored. The present study was carried out to screen and identify potential probiotic yeasts

from selected dairy sources available in Sri Lanka. Yeasts from raw bovine milk and curd

were isolated, purified, selected and phenotypically characterized by performing

morphological, physiological and biochemical tests. Isolates were assessed for their ability to

survive under simulated gastro-intestinal conditions to explore their probiotic potential.

Approximately, 190 colonies similar to yeast were isolated and 45 isolates of the division

Ascomycota were selected and coded for convenience (SLDY_001-SLDY_045). Most

promising probiotic isolates (20) were genotypically identified to be species of Pichia (55%),

Candida (30%), and Kluyveromyces (15%) of the family: Saccharomycetaceae. Considering

a threshold of >95% similarity to the type strain, eight different yeast species were identified.

Isolates (SLDY_005, SLDY_006 and SLDY_039) of Kluyveromyces marxianus species

showed the highest probiotic potential from the pool. The strain confirmation and in-vitro/in-

vivo safety assessment of these isolates will further verify their suitability as probiotic starter

cultures to be used in local food and pharmaceutical industries.

Keywords: Curd, gastro-intestinal conditions, Kluyveromyces, probiotic yeast

INTRODUCTION

Yeasts constitute a large and heterogeneous group of microorganisms included in the

kingdom of Fungi. In addition to their role in the food processing industry, yeasts play

various roles in livestock feeding, veterinary practices, medical, biomedical and

pharmaceutical industries (Jakobsena and Narvhu, 1996). In recent years, yeasts are gaining

increased attention from the food industry as probiotics. FAO/WHO (2002) defines

probiotics as living microorganisms, which upon ingestion in adequate amounts confer health

benefits to the host. Accordingly, any nonpathogenic microorganism capable of surviving in

the gastro-intestinal tract (GIT) of the host and provide additional health benefits could be

considered as a candidate for probiotic use. While bacterial probiotics are common and

1 Food Technology Section, Industrial Technology Institute, Colombo, Sri Lanka 2 Department of Plant Sciences, Faculty of Science, University of Colombo, Sri Lanka 3 Department of Food Science and Technology, Faculty of Agriculture, University of Peradeniya, Sri Lanka


Rajawardana et al.

28

mostly studied, yeast probiotics are yet to be explored. When compared with well-known

bacterial probiotics, yeasts offer different advantages and are genetically more stable than

bacteria. They have more diverse enzymatic profiles and more versatile effects on the

immune system, natural resistance against antibiotics and can use for patients undergoing

prolonged antibiotic treatments. They also appear to be better suited for nutritional

enrichment and delivery of bioactive molecules (Nayak, 2011). Yeasts also have a long

history of safe human consumption in traditional fermented foods (Jakobsena and Narvhu,

1996). This includes buffalo curd fermented with indigenous starter cultures. Curd contains

numerous undefined species of lactic acid bacteria and yeasts, which act synergistically to

develop desirable taste, texture, flavor, aroma and extending the shelf life. As reported by

previous researches (Maccaferri et al., 2012), Saccharomyces cerevisiae var.boulardii and

kluyveromyces marxianus B0399® are live yeasts used extensively as probiotics and often

marketed as dietary supplements.Therefore, yeasts are promising candidates for the

development of novel probiotics and probiotic products.

Common yeast genera with probiotic properties include Saccharomyces, Pichia,

Metschnikowia, Yarrowia, Candida, Debaryomyces, Isaatchenkia and Kluyveromyces

(Nayak, 2011). Predominant genera of yeasts found in bovine milk and fermented dairy

products also include Saccharomyces, Pichia, Candida, Isaatchenkia, Debaryomyces,

Kluyveromyces and Rhodotorula. Therefore, dairy sources could be considered as a unique

environment for the selection of novel yeast strains. Despite the occurrence of yeasts in raw

bovine milk and many dairy related products and also in human gastrointestinal tract, studies,

which examine their probiotic features, are limited. In this backdrop, the present study was

carried out with the objective of isolation, subsequent characterization and exploration of

probiotic diversity of yeasts present in raw bovine milk and curd manufactured by home

based producers using indigenous starters.

METHODOLOGY

Sample collection, media and chemicals

Samples (cattle milk and curd, 30 samples each) were collected during October to December

2015 representing three different climatic zones of Sri Lanka as per the statistical methods

and procedures in Sri Lanka standard for milk and milk product sampling (SLSI: 1404:2010).

Samples collected to sterilized disposable polypropylene tubes (50 ml) were cooled

immediately and transported on ice to the laboratory to be stored at -20 °C for analysis, for

no longer than 3-4 hours. All microbiological media were obtained from Oxoid, UK,

chemicals from Sigma, St. Louis, USA and genomic DNA purification Kit (Wizard®),

Promega, USA.

Isolation and morphological characterization of yeast

Samples were serially diluted using 0.85% NaCl and microbial counts were taken by pour

and spread plate techniques. Yeast peptone dextrose agar (YPDA), Malt extract-yeast

extract-peptone-glucose agar (MYPG) and Potato dextrose agar (PDA) were used for the

enumeration of yeasts with 0.1 g/L chloramphenicol and incubated aerobically for 5 days at

25 °C. Colonies with distinct morphological differences were selected and purified by

repeated streaking on PDA. Isolates were preserved in YPDA slants at 4 °C and 40%

glycerol stocks at -20 °C.Colony morphologies (form, size, elevation, margin, texture and

Probiotic Potential of Yeasts Isolated from Bovine Milk and Curd

29

colony color) were visually examined and then cells were microscopically observed after wet

mounting and Methylene blue staining (Barnett et al., 2000).

Biochemical characterization of isolates

Catalase and Urease test: Catalase producing yeasts were identified by slide

method.Commercially available Christensen's urea agar base (Merck) was used to identify

urease producing yeasts (Christensen, 1946).

Sugar fermentation test: The fermentation basal medium was prepared using 0.45% (w/v)

yeast extract; 0.75% (w/v) peptone and 2% (w/v) of sugars (glucose, sucrose and lactose

independently) in distilled water. Fermentation test was carried out as described by Nahvi

and Moeini (2004). Conversion of the medium from green to yellow was taken as the

positive reaction.

Growth on 50% glucose: The growth ability of yeasts at high concentration of sugars was

tested on media having 50% (w/v) glucose, 1% (w/v) yeast extract, 3% agar and

chlorampenicol 0.01 % (w/v).

Liquid assimilation of carbon and nitrogen compounds: Assimilation of carbon compounds

was determined using bacto yeast nitrogen base medium without amino acids (Sigma,

Y0626), for sucrose, D-maltose, raffinose, L-rhamnose, glycerol and D-mannitol. Nitrogen

assimilation was checked using yeast carbon base medium (Sigma, Y3627) for potassium

nitrate, L-cysteine and L-lysine (Gadaga et al., 2000).

Survival of yeasts in physiological and simulated chemical conditions existing in the

GIT

Probiotic potential of the isolates was determined by investigating their tolerance to

temperature, pH, bile and simulated gastric enzymes following the methods explained by

Walker and Gilliland, 1993 and Aswathy et al. (2008). Fresh yeast (18 hours old) cultures

were prepared and adjusted to 0.6 OD at 600 nm (UV-Visible spectrophotometer) to

determine the temperature tolerance. Cultures were transferred to 96-well microtiter

microplate and incubated aerobically at 10 °C, 37 °C and 45 °C over 5 hours. After every

hour of incubation, samples were periodically drawn out to determine the cell concentration

by measuring OD at 600 nm. Tolerance to different pH levels was studied by incubating the

isolates in YPD broth medium adjusted to pH 1.5, 3.0 and 9 following the method described

above. To test the bile tolerance YPD broth medium was prepared by adding 0.3, 0.5 and 3%

of bile (oxgall, Sigma-Aldrich, B-8631). The best bile tolerant isolates were further studied

for their tolerance to simulated gastric enzymes by preparing YPD broth medium containing

pepsin (3 g/L, Sigma P-7000) and pancreatin (1 g/L, Sigma P-1750) separately, each with 2

different pH levels (pH 2 and 8).

Genotypic identification of the selected isolates

Isolates grown in YPD broth medium at 25 °C for 12 hours were centrifuged, and pallet was

washed twice in phosphate-buffered saline (PBS) pH (7.2). Genomic DNA was extracted and

purified using the Wizard® Genomic DAN Purification Kit, following the manufacturer’s

instructions. Selected regions of 18S rRNA gene were PCR amplified with universal primers

(ITS1 – TCCGTAGGTGAACCTGCGG, ITS4 – TCCTCCGCTTATTGATATGC) and

amplified products were subjected to DNA sequencing at Macrogen-South Korea. Resulted

Rajawardana et al.

30

sequences were analysed using online Basic Local Alignment Search Tool (BLAST) and

similarity to the type strain was conformed comparing with the National Center for

Biotechnology Information (NCBI) data base.

Statistical Analysis

Enumerations were done in triplicate, experiments were performed in duplicate and

experimental data were expressed as mean ± standard deviation (SD).


Enumeration and preliminary selection of Yeasts

Differentiation of yeasts and molds

From the three different yeast isolation medias used maximum number of yeasts were

enumerated on YPDA. Hence, it was selected as the most suitable growth medium for the

isolation of yeast throughout the study. Previous researchers also have reported YPDA as a

better enumeration media for the isolation of yeast (Oda and Ouchi, 2000). From the 60

samples analyzed, 190 isolates that resembled yeasts were selected while removing the

molds based on their colony morphologies. Subsequently, eighty isolates which were closely

resembling yeast and having distinct morphological differences were selected and purified by

repeated streaking.

Catalase and Urease tests

The selected isolates were catalase positive. Yeasts are either aerobes or facultative aerobes;

hence production of catalase enzyme is an important criterion for preliminary selection.

Predominant genera of yeasts with probiotic affinities found in dairy sources belonging to the

division Ascomycota and the production of extracellular urease has been generally

considered as a universal character of Basidiomycetous yeasts shared by very few

Ascomycetous yeasts (Rij,1984). Rutherford (2014) suggests that urease positive

microorganisms have preserved roles in promoting bacterial and fungal infections.

Furthermore, enzymatic hydrolysis of urea (milk contains approximately 0.2-0.4 g/L) leads

to a slower reduction of pH during fermentation process (Spinnler and Corrieu, 1989) thus

could consider as undesirable for industrial fermentations. Considering above factors 45

distinct urease negative isolates were selected and coded for convenience (SLDY_001-

SLDY_045) for further characterization.

Colony and cell morphology

The yeast colonies generally looked similar with fewer variations. Most of the cells appeared

oval to elongate in shape, arranged singly, in pairs or in chains/ bunches. Reproduction was

by budding or by psedohypha. Isolates with closely similar morphologies were grouped into

five categories (Table 1). When compared with the colony and cell morphologies and mode

of asexual reproduction (Li et al., 2015), isolates in Group 1 resembles either Saccharomyces

sp. or Pichia sp., Group 2, Kluyveromycessp. Group 3 and 4 Candida sp. and Group 5 to

Rhodotorulasp. Our categorizations are also similar with the previously reported data of

Gadaga et al. (2000) and Kurtzman et al. (2011).

https://en.wikipedia.org/wiki/Ascomycota


31

Table 1. Macroscopic and microscopic features of yeasts isolated from dairy sources

Group Macroscopic and microscopic

features

Isolate number

1 Circular or slightly undulate shape

colonies of large/medium size,

butyrous texture, milky white color,

rough surface, flat with entire

margins.Ovoid to elongate cells

arranged singly or in pairs reproduction

by budding

SLDY_001, SLDY_002, SLDY_004,






SLDY_035, SLDY_036

2 Circular shape colonies, medium size,

puffy, moist-dull surface, smooth

butyrous texture, grayish-white, raised,

spreading, with entire

margins.Ovoid/ellipsoidal cells

arranged singly, in pairs or small

clusters or chains. Reproduction by

budding


SLDY_039

3 Circular shape large colonies, soft,

smooth and spongy, butyrous texture,

off-white/white color, raised with

entire margins. Spherical/

ovoid/cylindrical cells arranged singly

or in pairs. Reproduction by

psedohypha





SLDY_044, SLDY_045

4 Circular shape small/medium colonies,

cream colored, glistening surface,

smooth and spongy, raised colonies

with entire margins.Globose to oval

cells arranged singly or in chains.

Reproduction by budding

SLDY_012, SLDY_013, SLDY_016

5 Circular shape small/medium colonies,

pigmented (pink color), glistening

surface, smooth, raised colonies with

entire margins. Globose to ovoid cells

arranged singly or in chains.

Reproduction by budding

SLDY_031, SLDY_037, SLDY_038

Rajawardana et al.

32

Biochemical characterization of isolates

Isolates, namely SLDY_009, SLDY_010, SLDY_024, SLDY_031, SLDY_033, SLDY_034,

SLDY_037, SLDY_038 and SLDY_041 either lost their viability or got contaminated while

sub-culturing. These isolates were discontinued from further characterizations (Table 2).

Sugar fermentation

Yeasts gain carbon typically from hexose sugars, such as glucose and fructose or

disaccharides such as sucrose and maltose while some species can also metabolize pentose

sugars such as xylose, alcohols and organic acids (Ebabhi et al., 2013). However, as

mentioned by Gana et al. (2014) and Li et al. (2015), all strains of Pseudozyma and some

strains of Debaryomyces sp. are unable to ferment D-glucose whereas Saccharomyces,

Pichia, Kluyveromyces, Candida as well as Rhodotorula species easily ferment D-glucose.

All tested isolates in the pool were able to ferment D-glucose and their morphologies also

tally with the above mentioned D-glucose fermentative types indicating their suitability to

consider as isolates belonging to those species. Nearly two third (70%) of the isolates were

able to ferment lactose whereas 30% could not. Literature reveals that S. cerevisiae and

some Debaryomyces species are unable to grow and ferment lactose when it is provided as

the sole carbon source as it doesn’t possess lactose metabolizing system. Lactase or β-D-

galactosidase enzyme is present in lactose fermenting yeasts such as Kluyveromyces lactis,

Kluyveromyces fragilis, and Candida pseudotropicalis (Nahvi and Moeini, 2004). Hence,

lactose fermentative yeasts in the pool should also contain above mentioned species which has

a potential to grow in milk and whey, therefore could be promising candidates for bio

processing industries.

Growth on 50% glucose

Except, SLDY_026, SLDY_027 and SLDY_029 other isolates grown well on media

supplemented with 50% glucose thus, majority of the isolates could be considered as suitable

candidates for the production of highly concentrated food products. Gana et al. (2014),

reported that the Pseudozyma and Cryptococcus species are unable to grow under high

osmotic pressure conditions. Based on the colony characteristics and biochemical test results,

the pool of yeast isolates belong to Kluyveromyces, Pseudozyma, Cryptococcus, Candida,

Rhodotorula, Saccaromyces and Debaryomyces species.

Liquid Assimilation of Carbon and Nitrogen Compounds

Rij (1984) preferred assimilation tests than the fermentation tests for testing enzyme systems.

All tested isolates were able to assimilate D-Sucrose, Raffinose, D-Mannitol, Glycerol, and

L-Rhamnose. Majority of the pool (80%) was able to assimilate D-maltose indicating the

presence of the enzyme maltase. The whole pool of isolates was able to assimilate glycerol

indicating the presence of glycerol kinase gene (Obasi et al., 2014). All tested isolates were

also able to assimilate L-cysteine and L-lysine. Gadaga et al. (2000) reported that S.

cerevisiae could ferment sucrose, raffinose, glucose and galactose but, unable to utilize

lysine. Assimilation of L-lysine indicated the absence of S. cerevisiae isolates. This was

further confirmed by the genotypic identifications. According to Rij (1984), the inability to

utilize nitrate nitrogen is considered to be a valuable tool for characterization of yeast. Some

species of Saccharomyces, Kluyveromyces, Pichia and Debaryomycesare unable to utilize

nitrates, while the all species of other genera (e.g Hansenula) utilize nitrate. There are some

genera in which both nitrate positive and negative species occur (e.g. Candida and


33

Trichosporon). Isolates, SLDY_005, SLDY_006, SLDY_015, SLDY_016, SLDY_039,

SLDY_044 were unable to assimilate potassium nitrate, therefore could consider as

belonging to Saccharomyces, Kluyveromyces, Pichia or Debaryomyces species. However,

when these results were compared with the genotypic identifications this was true to all other

genera except Pichia isolates which exhibited assimilation of potassium nitrate.

Probiotic potential of the selected isolates

Species and strain specificity are very important factors (Fijan et al., 2014) when deciding

probiotic properties and safety for consumption. Hence, known probiotic species should be

considered first for selection. Kluyveromyces species isolated from dairy sources have shown

considerable potential in commercial probiotic applications. Further, Pichia and Candida

strains are also being studied to a certain extent. Results obtained for the selected isolates of

the present study are presented in Table 3. Isolates that grown under all simulated GI

conditions were selected as potential probiotics for genotypic identifications. One fourth

(25%) of yeasts from the initial pool of isolates (80) possessed satisfactory level of probiotic

affinities.

Figure 1. Survival of K. marxianus isolates in the presence of acid (a) pH 1.5, (b) pH 9.0

(c) bile 0.3% and (d) 3.0%

Rajawardana et al.

34

Acid and alkaline tolerance

Survival under a wide range of pH conditions is an important characteristic of a probiotic

yeast to survive in human digestive tract. The selected yeasts were found to grow and survive

up to 5 hours under pH range of 1.5 to 9.0. This confirmed that the isolates can survive in the

extreme acidity and alkalinity existing in the stomach and intestines. In agreement with

Hamed and Elattar (2013) the viability of many types of yeast decreased at pH 1.5 and

growth increased at pH 9 and sustained over 5 hours. They exhibited a very low but,

consistent growth compared to initial cell count [unable to grow above one log unit (log10

CFU /ml)] within 5 hour period. However, at pH 9.0 isolates grew well and initial cell count

of 106 reached to 107 after 5 hours of incubation (log10 CFU /ml). Results obtained for the K.

marxianus isolates (SLDL_005, SLDL_006 and SLDL_039) identified from the pool is

shown in Figure.1 a and b.

Effects of bile salt on viability

According to FAO/WHO, it is mandatory to assess bile tolerance for in-vitro selection of

probiotic strains (Vinderola et al., 2008). Isolates survived and exhibited gradual increase in

cell densities during 5 hour incubation period at 0.3% and 3% of bile. As shown in Figure1. c

and d, growth of the yeast (SLDL_005, SLDL_006 and SLDL_039) was not heavily affected

by the addition of bile salts as compared to reduced pH. Although, the isolates grew

gradually in both bile concentrations, growth was higher at 0.3%. Other researchers have also

reported similar results (Sourabh et al,. 2011) in previous studies.

Effects of gastric and pancreatic juice on viability

Another critical factor that affects the viability of microorganisms during digestion is gastric

and pancreatic juices. The obtained results for the above discussed strains are presented in

Figure 2. a, b, c and d. At pH 8 isolates showed gradual growth and survival in gastric and

pancreatic juices. At pH 2 isolates exhibited a slow growth compared to pH 8 and reached

stationary phase earlier (within 3-4 hours).These findings correlate well with the earlier

findings of Chelliah et al. (2016) and Díaz-Vergara et al. (2017).

Genotypic identification of most promising probiotic yeast isolates

Above results revealed that the most promising probiotic yeasts of dairy origin were of

Pichia, Candida and Kluyveromyces genera. Considering a threshold of >95% similarity to

the type strain, 8 different yeast species were identified and listed in table 4. P. kudriavzevii,

K. marxianus and C. tropicalis were the highest 3 probiotic species in frequency of

occurrence as shown in Figure 3. These results well tally with the findings of many

researchers previously investigated about the yeast taxonomy in raw milk and dairy products

(Fleet, 1990; Wouters, et al., 2002). All identified species of our pool of isolates are there in

the Bourdichon’s list of beneficial yeasts. Based on species specificity, isolates SLDY_005,

SLDY_006 and SLDY_039 which were identified as K. marxianus (15% from the pool)

could be considered as the best candidates for further investigations. Maccaferri et al. (2012)

reported about the probiotic K. marxianus B0399 (food grade) which has favorably

modulated immune response in caco-2 cells, peripheral blood mononuclear cells and

exhibited favorable effects on health-promoting bacteria of the

genus Bifidobacterium (Bif164). Romanin et al. (2016) reports about anti-inflammatory and

anti-oxidative properties of probiotic K. marxianus CIDCA 8154.

https://www.sciencedirect.com/science/article/pii/S0958694601001510#!


Table 2. Biochemical Characteristics of yeast isolates

Isolate

Fermentation of

sugars

50

% g

luco

se

Carbon assimilation

Nitrogen assimilation test

Glu

co

se

Su

cro

se

La

cto

se

La

cto

se

Su

cro

se

Ra

ffin

ose

Ma

nn

ito

l

Gly

cero

l

Ma

lto

se

Rh

am

no

se

Cy

stein

e

P.n

itra

te

Ly

sin

e

1. SLDY_001 + + + + + + + + + + + + +

2. SLDY_002 + + + + + + + + + + + + +

3. SLDY_003 + + - + + + + + + + + + +

4. SLDY_004 + + + + + + + + + + + + +

5. SLDY_005 + + + + + + + + + + + - +

6. SLDY_006 + + + + + + + + + + + - +

7. SLDY_007 + + + + + + + + + + + + +

8. SLDY_008 + + + + + + + + + + + + +

9. SLDY_011 + + + + + + + + + + + + +

10. SLDY_012 + - - + + + + + + + + + +

11 .SLDY_013 + + - + + + + + + + + + +

12. SLDY_014 + + + + + + + + + + + + +

13. SLDY_015 + + - + + + + + + + + - +

14. SLDY_016 + + + + + + + + - + + - +

15. SLDY_017 + - + + + + + + + + + + +

16. SLDY_018 + + + + + + + + + + + + +

17. SLDY_019 + + - + + + + + + + + + +

18. SLDY_020 + + + + + + + + + + + + +

19. SLDY_021 + + + + + + + + + + + + +

20. SLDY_022 + + + + + + + + + + + + +

21. SLDY_023 + - - + + + + + + + + + +

22. SLDY_025 + - - + + + + + + + + + +

23. SLDY_026 + - - - + + + + + + + + +

24. SLDY_027 + - - - + + + + + + + + +

25. SLDY_028 + - - + + + + + - + + + +

26. SLDY_029 + - - - + + + + + + + + +

27. SLDY_030 + + + + + + + + - + + + +

28. SLDY_032 + + + + + + + + + + + + +

29. SLDY_035 + + + + + + + + + + + + +

30. SLDY_036 + + + + + + + + + + + + +

31. SLDY_039 + + + + + + + + + + + - +

32. SLDY_040 + + + + + + + + + + + + +

33. SLDY_042 + + + + + + + + + + + + +

34. SLDY_043 + + + + + + + + + + + + +

35. SLDY_044 + + + + + + + + + + + - +

36. SLDY_045 + + + + + + + + - + + + +


Table 3. Survival of selected yeast isolates in the presence of simulated GIT conditions

ND: Not Done

Isolate Temperature pH Bile Gastric enzymes

10 °

C

37 °

C

45 °

C

1.5

3

9

0.3

0%

0.5

0%

3.0

0%

Pep

sin (

3g/L

)

Pan

crea

tin

(3g/L

)

pH 2 pH 8 pH 2 pH 8

1. SLDY_001 √

√ √ √ √ √ √ √ √ √ √ √ √

2. SLDY_002 √

√ √ √ √ √ √ √ √ √ √ √ √

3. SLDY_003 √

√ √ √ √ √ × × × ND ND ND ND

4. SLDY_004 √

√ √ √ √ √ √ √ √ √ √ √ √

5. SLDY_005 √

√ √ √ √ √ √ √ √ √ √ √ √

6. SLDY_006 √

√ √ √ √ √ √ √ √ √ √ √ √

7. SLDY_007 √

√ √ √ √ √ √ √ √ √ √ √ √

8. SLDY_008 √

√ √ √ √ √ √ √ √ √ √ √ √

9. SLDY_011 √

√ √ × √ √ ND ND ND ND ND ND ND

10. SLDY_012 √


11 .SLDY_013 √


12. SLDY_014 √

√ √ √ √ √ √ √ √ √ √ √ √

13. SLDY_015 √


14. SLDY_016 √

√ √ √ √ √ √ √ √ √ √ √ √

15. SLDY_017 √

√ √ √ √ √ √ √ √ √ √ √ √

16. SLDY_018 √

√ √ √ √ √ √ √ √ √ √ √ √

17. SLDY_019 ×

√ √ √ × × ND ND ND ND ND ND ND

18. SLDY_020 √

√ √ √ √ √ √ √ × ND ND ND ND

19. SLDY_021 √ × × √ √ √ × × × ND ND ND ND

20. SLDY_022 √

√ √ √ √ √ √ √ √ √ √ √ √

21. SLDY_023 ×

√ √ × × √ ND ND ND ND ND ND ND

22. SLDY_025 ×

√ × × √ √ ND ND ND ND ND ND ND

23. SLDY_026 ×


24. SLDY_027 √

√ × √ √ √ × × × ND ND ND ND

25. SLDY_028 ×

√ × × √ √ ND ND ND ND ND ND ND

26. SLDY_029 √


27. SLDY_030 √

√ √ √ √ √ √ √ √ √ √ √ √

28. SLDY_032 √

× × × √ √ ND ND ND ND ND ND ND

29. SLDY_035 √

√ √ √ √ √ √ √ √ √ √ √ √

30. SLDY_036 √

√ √ √ √ √ √ √ √ √ √ √ √

31. SLDY_039 √

√ √ √ √ √ √ √ √ √ √ √ √

32. SLDY_040 ×

√ √ √ √ √ √ √ × ND ND ND ND

33. SLDY_042 √

√ √ √ √ √ √ √ √ √ √ √ √

34. SLDY_043 √

√ √ √ √ √ √ √ √ √ √ √ √

35. SLDY_044 √

√ √ √ √ √ √ √ √ √ √ √ √

36. SLDY_045 √

√ √ √ √ √ √ √ √ √ √ √ √


37

Figure 2. Survival of K. marxianus isolates in the presence of pancreatin (a) pH 2, (b)

pH 8.0, (c) pepsin pH 2 and (d) pH 8.0

Pichia is the predominant probiotic genera identified from the pool (55%) which also had

exhibited probiotic potential and safety in previous studies. Greppi et al. (2017) has tested

and confirmed the probiotic potential of P.kudriavzevii strains and their ability to enhance

folate content of traditional cereal-based African fermented food. Chelliah et al. (2016) has

evaluated and confirmed the antimicrobial activity and probiotic properties of P.kudriavzevii

isolated from frozen idli batter and Ogunremi et al. (2015) has developed a cereal-based

functional food using cereal-mix substrate fermented with probiotic strain – P.kudriavzevii

OG32.Therefore, Pichia isolates could consider as the second priority for further

investigations.

Figure 3. Abundance of potentially probiotic yeast species isolated from dairy sources

of Sri Lanka

Rajawardana et al.

38

Table 4. Potentially probiotic yeast species isolated from dairy sources of Sri Lanka

with % similarity to type strain

CONCLUSIONS

This investigation provides a theoretical basis for probiotic yeast diversity of Sri Lankan

dairies. This might be an attractive solution to the steadily increasing demands of food

manufacturers looking for probiotics with viability under extreme conditions. Identified

isolates could be useful for probiotic strain selection, manufacturing dairy products for

lactose intolerant people, production of fermented foods with high concentrations of sugar,

single cell proteins (SCP) and bio ethanol production from whey, and production of

functional ingredients for food and pharmaceutical industries. P.kudriavzevii and K.

marxianus (65% from the total) were the best probiotics identified therefore, worth to study

further to establish as commercial probiotics. Moreover, remaining species of the pool (P.

AQGWD 7, C.pararugosa, C. tropicalis, C. metapsilosis, C. rugosa, C. orthopsilosis) also

could consider as promising candidates for local bio processing industries.

Code Identity Similarity to type strain

SLDY_001 Curd Pichia kudriavzevii isolate C12 100%

SLDY_002 Curd Pichia kudriavzevii strain IFM 64555 100%


SLDY_005 Curd Kluyveromyces marxianus CBS 5673 100%

SLDY_006 Curd Kluyveromyces marxianus CBS 5673 100%

SLDY_007 Curd Pichia kudriavzevii IFM 56882 100%

SLDY_008 Curd Pichia sp. AQGWD 7 99%

SLDY_014 Curd Candida tropicalis SBKS 3 100%

SLDY_016 Curd Candida parapsilosis isolate S22811 100%



SLDY_022 Curd Pichia kudriavzevii isolate H-237 96%

SLDY_030 Curd Pichia kudriavzevii strain B187B 100%

SLDY_035 Raw cows’ milk Pichia kudriavzevii strain YB-25 100%

SLDY_036 Raw cows’ milk Pichia kudriavzevii strain B187B 100%

SLDY_039 Raw cows’ milk Kluyveromyces marxianus strain CBS 1555 100%

SLDY_042 Raw cows’ milk Candida rugosa strain CBS 613 100%

SLDY_043 Raw cows’ milk Candida tropicalis LEM123 99%

SLDY_044 Raw cows’ milk Candida pararugosa strain M172B 100%

SLDY_045 Raw cows’ milk Candida orthopsilosis strain IFM55182 100%


39

ACKNOLEDGEMENT

The authors wish to acknowledge the financial support provided by the Industrial

Technology Institute, Colombo, Sri Lanka (TG 15/117) and National Science Foundation

Grant (RG/2016/AG/02).

REFERENCES

Aswathy, R.G., Ismail, B., John, R.P. and Nampoothiri, K.M. (2008). Evaluation of the

probiotic characteristics of newly isolated lactic acid bacteria. Applied Biochemistry and

Biotechnol.151, 244-255.

Barnett, Y.A., Payne, R.W. and Yarrow, D. (2000). Yeasts: characteristics and

identification, Cambridge Uni. Press, U.K, pp. 25-35.

Bourdichon, F., Casaregola, S., Farrokh, C., Frisvad, J.C., Gerds, M.L., Prajapati, J.P., Seto,

Y., Schure, E.T., Boven, A.V., Vankerckhoven, V., Zgoda, A., Tuijtelaars S. and Hansen,

E.B. (2012). Food fermentations: Microorganisms with technological beneficial use. Int. J. of

Food Microbiol. 154, 87-97.

Chelliah, R.P., Ramakrishnan, S.R., Prabhu, P.R. and Antony, U. (2016). Evaluation of

antimicrobial activity and probiotic properties of wild-strain Pichia kudriavzevii isolated

from frozen idli batter. Yeast special Issue; 33: 385-401.

Christensen, W. B. (1946). Urea decomposition as a means of differentiating Proteus and

paracolon cultures from each other and from Salmonella and Shigella types. J. of Bacteriol.

52, 461-466.

Díaz-Vergara, L., Pereyra, C.M., Montenegro, M., Pena, G.A., Aminahuel, C.A. and

Cavaglieri, L.R. (2017). Encapsulated whey–native yeast Kluyveromyces marxianus as a feed

additive for animal production. Food Additives and Contaminants. 34, 750-759.

Ebabhi, A.M., Adekunle, A.A., Okunowo, W.O. and Osuntoki, A.A. (2013). Isolation and

characterization of yeast strains from local food crops. J. of Yeast and Fungal Research. 4(4),

38-43.

FAO/WHO (2002). Guidelines for the evaluation of probiotics in food. Food and Agriculture

Organization of the United Nations and World Health Organization working group report,

London Ontario, Canada.

Fijan, S. (2014). Microorganisms with claimed probiotic properties: An overview of recent

literature. Int. J. Environ. Res. Public Health. 11, 4745-4767.

Fleet, G.H. (1990). Yeasts in dairy products- A review. J. Appl. Bacteriol. 68, 199–211.

Gadaga, T.H., Mutukumira, A.N. and Narvhus J.A. (2000). Enumeration and identification

of yeasts isolated from Zimbabwean traditional fermented milk. Int. Dairy J. 10, 459-466.

Rajawardana et al.

40

Gana, N.H.T., Mendoza, B.C. and Monsalud, R.G. (2014). Isolation, screening and

characterization of yeasts with amyloytic, lipolytic, and proteolytic activities from the

surface of Philippine bananas (musa spp.), Philippine J.of Sci.143 (1), 81-87.

Greppi, A., Saubade, F., Botta, C., Humblot, C., Guyot, J.P. and Cocolin, L. (2017). Potential

probiotic Pichia kudriavzevii strains and their ability to enhance folate content of traditional

cereal-based African fermented food. Food Microbiol. 62, 169-177.

Hamed, E. and Elattar, A. (2013). Identification and some probiotic potential of lactic acid

bacteria isolated from Egyptian camels milk. Life Sci. J. 10(1), 1952-1961.

Jakobsena, M. and Narvhu, J. (1996). Yeasts and their possible beneficial and negative

effects on the quality of dairy products. Dairy J.6, 755-768.

Kurtzman, C.P., Fell, J.W. and Boekhout, T. (2011). The Yeasts: A Taxonomic Study, 5th

Edn., Elsevier Science, Burlington, U.K.

Li, Y., Liu, T. and He, G. (2015). Isolation and Identification of Yeasts from Tibet Kefir.

Ad. J. of Food Sci. and Technol. 7(3): 199-203.

Maccaferri, S., Klinder, A., Brigidi, P., Cavina, P. and Costabile, A. (2012). Potential

Probiotic Kluyveromyces marxianus B0399 modulates the immune response in caco-2 cells

and peripheral blood mononuclear cells and impacts the human gut microbiota in an in-vitro

colonic model system. Appl. Environ. Microbiol, 78 (4) 956-964.

Nahvi, I. and Moeini, H. (2004). Isolation and identification of yeast strains with high β-

galactosidase activity from dairy products. Biotechnol. 3: 35-40.

Nayak S.K. (2011). Probiotics, Microbiology Monographs. 21, 29-55.

Obasi, B.C., Whong, C.M.Z., Ado, S.A. and Abdullah, I.O. (2014), Isolation and

Identification of yeast associated with fermented orange juice. Int. J. of Engineering and

Sci.3, 9, 64-69.

Oda, Y. and Ouchi, K. (2000). Saccharomyces, Encyclopedia of food microbiology. Richard

K., Robinson C.A., Batt P. and Patel D. (Ed.) Academic press, Londan, U.K. 3, 1907-1927.

Ogunremi, O.R., Agrawal, R. and Sanni, A.I. (2015). Development of cereal-based

functional food using cereal-mix substrate fermented with probiotic strain – Pichia

kudriavzevii OG32. Food Sci. and Nutrition, Wiley Periodicals, Inc. pp.486-489.

Rij, N.J.W.K. (1984). The yeasts. Elsevier Science Publishers B.V., Amsterdam. pp.75-95.

Romanin, D.E., Llopis, S., Genovés, S., Martorell, P., Ramón, V.D., Garrote, G.L. and

Rumbo, M. (2016). Probiotic yeast Kluyveromyces marxianus CIDCA 8154 shows anti-

inflammatory and anti-oxidative stress properties in in-vivo models. Beneficial Microbes. 83-

93.

Rutherford, J.C. (2014). The emerging role of urease as a general microbial virulence factor.

PLOS Pathogens | www.plospathogens.org.


41

Sourabh, A., Kanwar, S.S. and Sharma, O.P. (2011). Screening of indigenous yeast isolates

obtained from traditional fermented foods of Western Himalayas for probiotic attributes. J. of

Yeast and Fungal Research. 2(8), 117 - 126.

Spinnler, H.E. and Corrieu, G. (1989). Automatic method to quantify starter activity based

on pH measurement. J. of Dairy Research. 56, 755-764.

Vinderola, G., Capellini, B., Villarreal, F., Suárez, V., Quiberoni, A. and Reinheimer, J. (

2008). Usefulness of a set of simple in-vitro tests for the screening and identification of

probiotic candidate strains for dairy use. LWT - Food Sci. and Technology, 41, 1678-1688.

Walker, D. K. and Gilliland, S. E. (1993). Relationships among bile tolerance, bile salt de-

conjugation and assimilation of cholesterol by Lactobacillus acidophilus. J. of Dairy Sci., 76-

95.

Wouters, J.T.M., Eman H.E., Jeroen, A. and Smit H.G. (2002). Microbes from raw milk for

fermented dairy products, Int. Dairy J, 12, 91-109.

Tropical Agricultural Research Vol. 30 (3): (2018)

42


Identification of Phosphorus Efficient Rice Cultivars under

Low P Nutrition through Hydroponic based Screening

D.S. Kekulandara1*, P.C.G. Bandaranayake2, D.N. Sirisena1, W.L.G. Samarasinghe3 and

L.D.B. Suriyagoda4



Sri Lanka

ABSTRACT: Phosphorus (P) is one of the major nutrients required by plants. A higher portion

of P in lowland rice soils is found in unavailable forms due to fixation. Therefore, continuous

application of P fertilizer to rice (Oryza sativa L.) is needed to obtain a satisfactory yield.

Identification and subsequent cultivation of high yielding rice varieties which can withstand

low level of P is a better alternative to the continuous P application. The objective of this study

was to categorize Sri Lankan rice varieties according to their response to P deficient conditions.

Forty eight rice varieties including three old improved varieties and 45 new improved varieties

were evaluated at deprived (10 µM P) and sufficient (50 µM P) P levels in a nutrient solution

culture. Multiple plant traits; number of tillers, root and shoot dry weights and P content in

shoot tissues were assessed at 52 days after planting. Rice variety Bg 94-1 gained higher

biomass and P uptake (i.e. shoot P content- mg/plant). Simultaneously, At402 had lower

biomass gain and shoot P content. Rice varieties were grouped into two distinct clusters based

on their responses to P deficiency such as biomass gain, P uptake and number of tillers per

plant. This study showed that At 405, Bg 94-1, At 307, Bg 304, Bg 300 and At 354 are

promising rice varieties with higher response to low level of P supply.

Keywords: Deficiency, germplasm evaluation, phosphorus, screening, tolerance

INTRODUCTION

Rice is the most important food crop in Asia, and the food security mainly depends on the

production of rice. As such rice cultivation plays a big role in Asia generating income directly

and indirectly (Dawe, 2000). Increase in the rate of rice production shows a diminishing trend

with urbanization, climate change and soil problems. Therefore, the increase in rice production

should be obtained through increasing productivity of rice per unit area cultivated (Redfern et

al., 2012). One solution for increasing production efficiency (i.e. productivity) in rice is

through the development of higher-yielding and nutrient efficient varieties (Kush, 1995).

Sixteen essential elements are required for proper growth of rice; mainly nitrogen (N),

phosphorus (P) and potassium (K) are supplied in rice fields as inorganic fertilizers in greater

quantities (De Datta, 1981). Unavailability of adequate amount of P in soil, retarded plant

1 Rice Research & Development Institute, Batalagoda, Ibbagamuwa, Sri Lanka 2 Agricultural Biotechnology Centre, Faculty of Agriculture, University of Peradeniya, Sri Lanka 3 Plant Genetic Resource Centre, Peradeniya, Sri Lanka

4 Department of Crop Science, Faculty of Agriculture, University of Peradeniya, Sri Lanka


Kekulandara et al.

44

growth and development resulting significant yield losses (Dobermann and Fairhurst, 2000).

Phosphorus requirement and acquisition are higher during the early growth stages (Vinod

and Heuer, 2012).

Applied P is quickly converted to unavailable forms adhering to soil particles and can lead to

deficiency in available P in soil. Also P deficiency in soil can occur due to the low P content

of the parental material, low pH and soil with high P-fixing characteristics (Rose and Wissuwa,

2012). Phosphorus deficiency is one of the major limiting factors for crop production in highly

weathered soils (Sanchez and Salinas, 1981). Some soil properties, such as soil pH, clay, Fe

and Al contents are closely related to the P sorption capacity of the soils. Due to high P fixation

capacity, a greater amount of external P should be applied to reach higher productivity (Yost

et al., 1979). Excessive application of P fertilizers can cause P contamination of freshwater

bodies. This triggers the eutrophication in freshwater systems (Tirado and Allsopp, 2012).

Therefore, it is important to use a balance fertilizer for sustainable rice farming. Application

of high amounts of P fertilizers for two seasons per year has increased the accumulation of P

in Sri Lankan soils (Sirisena and Suriyagoda, 2018). Therefore, the most economical and

environmental friendly alternative is to introduce rice varieties which perform well under low

P conditions.

Rice varieties differ significantly in their P requirement under P deficient condition. To

identify P efficient varieties shoot and root dry weight can be used as a criterion for screening

(Fageria.1998). Kottearachchi et al. (2013) has reported that there is a significant difference in

root length and shoot dry weight between rice varieties grown under low P hydroponic system

although there was no such difference in high P supplied condition. Meanwhile, Aluvihare et

al. (2015) has identified Bg94-1, Bg403 and At362 as P deficiency tolerant varieties. The aim

of this work was to identify the variation in P deficiency tolerance in Sri Lankan rice varieties

under controlled P levels in hydroponic nutrient medium, and thereby identify the best

performing varieties having deficiency tolerance at vegetative stage.

METHODOLOGY

The experiment was conducted in a glasshouse at the Agricultural Biotechnology Center,

University of Peradeniya, Sri Lanka. Minimum and maximum temperatures inside the

glasshouse during this period were 26˚C and 38˚C, respectively. Forty eight locally bred rice

varieties, forty-five new improved and three old improved rice varieties under different

maturity age groups were screened in Yoshida nutrient solution with low (10 µM) and high

(50 µM) P concentrations (Table 1).

Establishment and maintenance of plants

Seeds were imbibed in water for 24 h and germinated. Seedlings were transferred in to plastic

buckets filled with full strength Yoshida nutrient solution (Yoshida, 1976) supplemented with

50 µM of P (optimal) or 10 µM P (deprived) concentrations (Kekulandara et al., 2016). Sodium

dihydrogen phosphate monohydrate (NaH2PO4.H2O) was used as the P source. Six seedlings

per bucket were maintained with equal spacing. The pH of the solution was maintained at 5.6

- 5.8 and it was replaced once a week. The experimental design was Complete Randomized

Design with 3 replicates.

https://www.ncbi.nlm.nih.gov/pubmed/?term=Vinod%20KK%5BAuthor%5D&cauthor=true&cauthor_uid=23115710

https://www.ncbi.nlm.nih.gov/pubmed/?term=Heuer%20S%5BAuthor%5D&cauthor=true&cauthor_uid=23115710

Phosphorus Efficient Rice Cultivars under Low P Nutrition

45

Table 1. Rice varieties used for the study

Variety Duration

(months)

Recommendation Pedigree

New Improved Varieties

Bg 250 2 1/2 Drought/flood escaping Farmer field selection

Bg300 3 General cultivation Bg 367-7//IR 841/Bg 276-5

Bg304 3 General cultivation Co 10/IR 50//84-1587/Bg 731-2

Bg305 3 General cultivation Bg 1203/Bg 1492

Bg310 3 Saline prone areas Bg 300/Pokkali

Bw272-6B 3 Low country wet zone BW 259-3/BW 242-5-5

At303 3 General cultivation At 66-2/Bg 276-5

At306 3 General cultivation OB 2273/At 05

At307 3 General cultivation Bg 2225-1/Bg 96-3298

At 308 3 General cultivation Bg 2225-1/Bg 2426-2

Bg366 3 1/2 General cultivation Bg300/94-2236//Bg300/Bg304

Bg352 3 1/2 General cultivation Bg 380/Bg 367-4

Bg369 3 1/2 Saline prone areas Bg 94-1/Nonabokra

Bg360 3 1/2 General cultivation 84-3346/IR36//Senerang

Bg357 3 1/2 Island wide cultivation Bg797/Bg300//85-1580/

Senerang M-17

Bg358 3 1/2 General cultivation Bg 12-1/Bg1492

Bg94-1 3 1/2 General cultivation IR 262/Ld66

Bw361 3 1/2 General cultivation IR 36/Bw 267-3-11M

Bg359 3 1/2 Wet zone 88-5089/Bg 379-2

Bw364 3 1/2 Wet zone IR 36/Bw 267-3-11M

Bw363 3 1/2 General cultivation IR 36/BW 267-311M

Bw351 3 1/2 Low country wet zone Bg 90-2/Bg 401-1

Bw 367 3 1/2 General cultivation Bg 358/Bw 361

At353 3 1/2 Saline prone area Bg 94-1(R)/Bg400-1//Bg 94-1

At354 3 1/2 Saline prone area Bg 94-1/Pokkali

At 362 3 1/2 General cultivation At 85-2/Bg 380

Ld368 3 1/2 Wet Zone Ld 4-9-11/Ld 99-17-4

Ld365 3 1/2 Wet zone Selection of Ld 355

Bg380 4 Dry &Intermediate zone Bg 90-2*4/Ob 677

Bg403 4 General cultivation 83-1026/Bg 379-2

Bg406 4 Northern region Bg 73-797/Ptb 33/Ob 678

Bg450 4 1/2 General cultivation Bg 12-1 *2 /IR 42

Bg454 4 1/2 General cultivation MR 1523/87-519

Bg455 4 1/2 Submergence areas Ob2547/CR9413//IR46/Ob 2552

Bg379-2 4 1/2 Low country wet zone IR 2071-586/Bg 400-1

Bg 400-1 4 General cultivation Ob 678//IR 20/H-4

Bg11-11 4 1/2 General cultivation Engkatek/ #2H-8

Bw400 4 Saline and acid soils Bw 259-3/Bw 242-5-5

Bw451 4 1/2 Low country wet zone Bg 400-1/Bg 11-11

Bw452 4 1/2 General cultivation Hondarawala 502/C 104

Bw453 4 1/2 Low country wet zone IR 2071-586/Bg 400-1

At401 4 Costal Saline area Bg 94-1/Pokkali

At402 4 Southern province IR4432-52-6-4/Bg90-2//76-

3990/Ob 678

Kekulandara et al.

46

Table 1. cont..

At405 4 Dry and Intermediate

zones

At 402/Basmathi 442

Ld408 4 General cultivation At 01/Ld 98-152

Old Improved Varieties

H4 4 1/2 General cultivation Murungakayan 302/Mas

H7 3 1/2 General cultivation Pachchapefumal/Mas//H-5

H10 3 General cultivation Pachchaperumal/Mas/H-5

Plant trait measurements

Physiological traits of varieties were assessed by evaluating multiple plant attributes closely

related to P deficiency. Three plants were harvested as replicates from each pot at 52 days after

planting. Number of tillers, roots and shoot dry weight, and shoot P content were taken at the

time of harvesting.

Phosphorus analyses

Shoots and roots were air dried for two days and oven dried for 48 hours at 60°C. Weight of

shoots and roots were measured and 5 g of each sample was ground and made into ash at

200 °C for 2 h followed by 450 °C for 2 h. The ash was dissolved in 6% HNO3 and P

concentrations were measured by colorimetric assay using the molybdovanadophosphate

method using a spectrophotometer (Kitson and Melon, 1944). Shoot P content (SPC) was

calculated by multiplying shoot P concentration with shoot dry weight.

Data analysis

Measured and calculated data were analyzed using GLM procedure in SAS to determine the

main effects of variety, P concentration and interactions among them. Means were compared

using least significant differences at P = 0·05. All the variables of P deprived condition were

subjected to hierarchical cluster analysis using MINITAB statistical software to observe the

grouping of varieties.


The effects of P concentration in the medium, variety and their interaction on shoot dry weight,

root dry weight and total dry weight were significant (P<0.05). At 50 µM P level shoot and

root dry weight among varieties were similar whereas at 10 µM P level, dry weights were

significantly different among varieties. Therefore, shoot, root and total dry weights were

compared separately at 10 µM P level for all the varieties tested. Bg 94-1 showed the highest

biomass gain in all three aspects. Similarly P content was compared among all the varieties

studied. Bg 94-1 showed a higher amount of shoot P content proving its ability to perform in

low P availability. Simultaneously, At402 has the lowest biomass gain in shoot, root and total

dry weights. Low shoot P content recorded in At 402 confirms the poor performance in P

uptake and utilization efficiency(Figure 2).


47

Figure 1. Variation of mean (a) shoot dry weight, (b) root dry weight (c) total dry weight

and (d) shoot P content among the varieties grown at low P condition (10 µM)

Grouping of varieties

0.00

0.50

1.00

1.50

2.00

At4

02

Bg3

10

At3

62

Bg3

58

Bg3

60

At3

06

Bg3

79-2

Bg4

55

Ld40

8

Bw

451

Ld36

8

H7

Bg2

50

Bg4

03

Bg3

52

At3

53

Bg4

50

Bw

367

H10

Bg3

57

Bw

272

-6B

Bw

351

Bg3

59

Bg1

1-11

Bw

453

Bg3

69

At3

08 H4

Bg4

06

At3

03

Bg3

05

Bg3

80

Bw

364

Bg4

54

Ld36

5

Bg4

00-1

Bg3

66

At3

54

Bw

363

At4

01

Bw

361

Bw

400

Bw

452

Bg3

04

At3

07

Bg3

00

At4

05

Bg9

4-1

Sho

ot

dry

wei

ght

(g/p

lan

t)

0

0.2

0.4

0.6

0.8

1

1.2

1.4

At4

02

Bg3

69

Bg3

10

At3

62

Bg3

58

Bg3

60

At3

06

Bg3

79-2

Bg4

55

Ld40

8

Bw

451

Ld36

8

H7

Bg2

50

Bg4

03

Bg3

52

At3

53

Bg4

50

Bw

367

H10

Bg3

57

Bw

272

-6B

Bg3

66

Bw

351

Bg3

59

Bg1

1-11

Bw

453

At3

08 H4

Bg4

06

At3

03

Bg3

05

Bg3

80

Bw

364

Bg4

54

Ld36

5

Bg4

00-1

At3

54

Bw

363

At4

01

Bw

361

Bw

400

Bw

452

Bg3

04

At3

07

Bg3

00

At4

05

Bg9

4-1Ro

ot

dry

wei

ght

(g/p

lan

t)

0.00

1.00

2.00

3.00

4.00

At4

02

Bg3

10

At3

62

Bg3

58

Bg3

60

At3

06

Bg3

79-2

Bg4

55

Ld40

8

Bw

451

Ld36

8

H7

Bg2

50

Bg4

03

Bg3

52

At3

53

Bg4

50

Bw

367

H10

Bg3

57

Bw

272

-6B

Bw

351

Bg3

59

Bg1

1-11

Bw

453

Bg3

69

At3

08 H4

Bg4

06

At3

03

Bg3

05

Bg3

80

Bw

364

Bg4

54

Ld36

5

Bg4

00-1

Bg3

66

At3

54

Bw

363

At4

01

Bw

361

Bw

400

Bw

452

Bg3

04

At3

07

Bg3

00

At4

05

Bg9

4-1

Tota

l D

ry w

eigh

t (g

/pla

nt)

0

300

600

900

1200

1500

1800

At4

02

Bg3

10

At3

62

Bg3

58

Bg3

60

At3

06

Bg3

79-2

Bg4

55

Ld40

8

Bw

451

Ld36

8

H7

Bg2

50

Bg4

03

Bg3

52

At3

53

Bg4

50

Bw

367

H10

Bg3

57

Bw

272

-6B

Bw

351

Bg3

59

Bg1

1-11

Bw

453

Bg3

69

At3

08 H4

Bg4

06

At3

03

Bg3

05

Bg3

80

Bw

364

Bg4

54

Ld36

5

Bg4

00-1

Bg3

66

At3

54

Bw

363

At4

01

Bw

361

Bw

400

Bw

452

Bg3

04

At3

07

Bg3

00

At4

05

Bg9

4-1

Sho

ot

P c

on

ten

t (µ

g/p

lan

t)

(a)

(b)

(c)

(d)

Kekulandara et al.

48

Crop varieties can be classified in to two different groups according to their responses to

nutrient supply such as efficient or inefficient in nutrient deficient condition and responder or

non- responder in nutrient sufficient condition (Ortiz-Monasterio et al., 2001). The

dendrogram drawn using shoot and root dry weights, shoot P concentrations and contents and

number of tillers under low P condition at 52 days after planting showed two distinct clusters.

The varieties At405, Bg94-1, At307, Bg304, Bg300 and At354 clustered in to Cluster 2 while

all other 44 varieties clustered in to Cluster 1 at similarity level at 33% (Figure 2). Varieties

belonging to each cluster are shown in Table 2 and the means of each parameter are shown in

Table 3. Means of all the P efficiency related parameters of Cluster 2 are greater than those of

Cluster 1 revealing that the varieties in Cluster 2 are tolerant to P deficiency. Bg94-1, Bg304,

At405 and At354 varieties have previously been identified as early tillering varieties at low P

available condition confirming their efficiency for P uptake and use (Kekulandara et al, 2016).

Although varieties At354 and Bg300 included in phosphorus deficiency tolerant category in

this study, they were grouped under susceptible group by Aluvihare et al. (2016). Similarly,

At362 was identified as P deficiency tolerant variety by Aluvihare et al. (2016) while an

opposite response was observed in the present experiment. Bg 94-1 has been identified as a

tolerant variety in both the studies. Each cluster consists of short, medium and long age rice

varieties. It indicates that clustering has been made irrespective of the maturity age of the

variety proving that there is no effect of the age of the variety on P deficiency tolerance.

Figure 2. Dendrogram constructed by using shoot and root dry weights, number of tillers

and shoot P concentration and contents at 10 µM P supply

At4

05Bg

94-1

At3

07Bg

304

Bg30

0A

t354

Bw45

2Bg

250

Bg35

8H

10H7

Bw27

2-6B

Bg31

0Ld

365

Bg38

0Bw

364

Bg40

0-1

Bg30

5A

t308

At3

53Bg

379-

2A

t362

Bw40

0Bw

361

At4

01Bg

366

At3

03H4

Bg36

9Bg

454

Bg40

6Bw

363

Bg11

-11

Bw45

3Bg

357

Bg35

2Bg

403

Ld36

8Bg

455

Bw45

1Ld

408

At3

06Bg

359

Bw35

1Bw

367

Bg45

0Bg

360

At4

02

0.00

33.33

66.67

100.00

Similarity


49

Table 2. Varieties in different clusters

Cluster 1 Cluster2

At 303 At308 At306 Bg403 At354

Bw400 At353 Bg455 Bw451 Bg94-1

At401 Bg400-1 Bw351 Bg359 Bg300

Bw364 Ld365 Bg352 H10 At405

Bg380 Bg454 Ld408 Bg250 A307

Bg360 Bw361 Bg450 Bg358 Bg304

Bg406 At362 Bg310 Bg369

H4 Bg379-2 H7 Bg366

Bw363 Bg272-6B At402

Bw452 Bg11-11 Bw367

Bw453 Bg305 Bg357

Ld368

Table 3. Mean values of variables in each cluster

Cluster 1 Cluster 2

Shoot dry weight (g/plant) 0.97 ± 0.08 1.45± 0.16

Root dry weight (g/plant) 0.63 ± 0.05 0.87± 0.09

Total dry weight (g/plant) 1.60 ± 0.10 2.32 ± 0.16

Shoot P concentration (µg/g) 825.7 ± 78.9 918.8±113.3

Shoot P content (µg/plant) 801.8 ± 103.5 1313.3 ± 248.2

Number of tillers per plant 1.71 ± 0.20 2.44 ± 0.33

Regression analysis

Scatter plot drawn for total dry weight of varieties against their time taken for matutity under

low P conditions is shown in Figure 3. It descriminates Bg300, Bg94-1, At405 and Bw452

producing greater biomass from the age groups of 3 month, 3½ month, 4 month and 4½ month

age groups respectively at low P supplied environment. Scatter plot drawn against maturity

age and the mean P content in shoots is shown in Figure 4. Varieties Bg300, At354, At 405

and Bg380 were the superior in 3 month, 3½ month, 4 month and 4½ month age groups,

rspectively.

Kekulandara et al.

50

Figure 3. Distribution of varieties based on total dry weight gained at low P availability

according to their maturity age classes

Figure 4. Distribution of varieties based on shoot P content at low P availability against

their maturity age classes


51

Comparison of varietal performance under high and low P availability

The scatter plot drawn for biomass gained at low P and high P availability illustrates that

varieties Bg94-1, At405, Bg300, Bg304 and At307 performed well in both at low and high P

availability, whereas H7, H4, Bg455, At306, At402 and Bg11/11 performed poorly in both

conditions (Figure 6). However, some varieties such as Bg250, Bg358, Bg310 and Bg369 have

gained comparatively higher dry weight in high P availability compared to P deprived

condition. Most of the short age varieties have shown higher dry weight at 52 days after

planting at high P supply. It is clear that dry weight of all the varieties has reduced by more

than half at low P condition compared to high P supply confirming the importance of P in plant

growth and the occurrence of P deficiency at 10 µM P supply (Figure 5).

Figure 5. Varietal performances on dry weight gained at low P vs high P availability at

52 days after planting.

Efficient genotypes possess high P uptake efficiency, whereas responders show high utilization

efficiency. As nutrient uptake and utilization processes are interdependent from each other, it

is difficult to distinguish a responder from an efficient cultivar. Therefore, efficient screening

method is important to select cultivars for low-nutrient tolerance (Agrama, 2006). Deficiency

symptoms of plants can be studied well using hydroponics, where the presence or absence of

nutrient components can be controlled precisely. Studies under controlled conditions in a

hydroponic solution generally involve giving precise P deficiency stress on seedlings over in

the field which may show a considerable level of spatial and temporal variation in P content

in the medium. In addition, it makes easier to observe deficiency symptoms that occur in the

roots, which is difficult to observe in soil-grown plants (Salisbury and Ross, 1992). Thus,

hydroponic based screening system gives more reliable data than nutrient experiments

conducted in soil although it is not the real practice adopted in rice cultivation.

Kekulandara et al.

52

CONCLUSIONS

There is a significant variation in genotypes for P deficiency tolerance in rice. The P deficiency

tolerance ability in varieties did not show any correlation with their maturity age classes.

Bg300, Bg304 and At307 in 3 month age group, Bg94-1, At354 in 3½ month age group and

At405 in 4 month age group performed well in both P uptake and dry matter production. Bg94-

1 performed extraordinarily in biomass gain and P accumulation. Simultaneously, At402

showed poor performance in biomass gain in both shoots and roots. Low amount of shoot P

content recorded in At402 confirms its poor P uptake and utilization efficiency under P

deprived conditions.

ACKNOLEDGEMENT

This work was supported by a grant from the National Science Foundation, Sri Lanka

(NSF/AG/2014/01|). We thank the Director, Rice Research and Development Institute for

providing seed materials for this research. We are very much grateful to all the staff members

of Agricultural Biotechnology Center (AgBC) for providing facilities and fullest support for

conducting research at AgBC and Mr. Gemunu Wijesuriya at the Department of Crop Science,

University of Peradeniya for technical assistance.

REFERENCES

Agrama, H. A. (2006). Application of molecular markers in breeding for nitrogen use

efficiency. Journal of Crop Improvement. 15, 175–211.

Aluwihare, Y.C., Ishan, M. , Chamikara, M.D.M., Weebedde, C. K, Sirisena, D. N.,

Samarasinghe, W. L. G., Sooriyapathirana, S. D. S. S.(2016). Characterization and selection

of phosphorus deficiency tolerant rice genotypes in Sri Lanka. Rice Science. 23, 184-195.

Dawe, D. (2000). The potential role of biological nitrogen fixation in meeting future demand

for rice and fertilizer. In: Ladha JK, Reddy PM, editors. The quest for nitrogen fixation in

rice. Philippines: International Rice Research Institute. 1–9.

De Datta,S.K. (1981) Principles and practice of rice production. Singapore: John Wiley and

Sons. 348–419.

Dobermann, A., Fairhurst, T. (2000). Rice: nutrient disorders & nutrient management. Potash

& Phosphate Institute, Potash & Phosphate Institute of Canada and International Rice Research

Institute Singapore and Los Baños.

Fageria, N. K, Wright, R. J., Baligar, R.C., (1998). Cultivar evaluation for phosphorus use

efficiency. Plant and Soil 111, 105-109.

Kekulandara, D.S., Suriyagoda, L.D.B., Bandaranayake, P.C.G., Sirisena, D.N. and

Samarasinghe, W.L.G. (2016). Temporal tillering behavior of Sri Lankan elite rice varieties in

response to phosphorus availability. Tropical Agricultural Research.28 (2), 133 – 143.


53

Khush, G. S. (1995) Modern varieties - their real contribution to food supply and

equity.Geojournal. 35 (3), 275 - 284.

Kitson, R.E., Melon, M.G. (1944). Colorimetric determination of phosphorus as

molybdovanadophosphoric acid. IndEngChem Anal Ed 16:379.

Kottearachchi, N.S. and Wijesekara, U.A.D.S.L. (2013). Implementation of Pup 1 gene based

markers for screening of donor varieties for phosphorus deficiency tolerance in rice. Indian

Journal of Plant Sciences.2 (4), 76-83.

Ortiz-Monasterio, J.I., Manske, G.G.B., van Ginkel, M. (2001). Nitrogen and phosphorus use

efficiency. In: Reynolds MP, Ortiz-Monasterio JI, McNab A, eds. Application of physiology

in wheat breeding. Mexico: CIMMYT, 200–207.

Redfern, S.K., Azzu, N., Binamira, J.S. (2012). Rice in Southeast Asia: facing risks and

vulnerabilities to respond to climate change. Building resilience for adaptation to climate

change in the agriculture sector. 23, 295–314.

Rose, T.J., Wissuwa, M. (2012) Rethinking internal phosphorus utilization efficiency: a new

approach is needed to improve PUE in grain crops. Adv. Agron. 116,183–215

Salisbury, F. B. and Ross,C.W. (1992). Plant Physiology, 4th ed. Wadsworth Publishing Co.,

Belmont, CA.

Sanchez, P. A. and Salinas, J. G. (1981) Low input technology for managing oxisols and

ultisols in tropical America. Adv. Agron. 34, 279-398.

Sirisena, D. N. and Suriyagoda, L.D.B. (2018). Towards sustainable phosphorus management

in Sri Lankan rice and vegetable-based cropping systems. Agriculture and Natural Resources.

52, 9-15.

Tirado, R. & Allsopp, M.(2012). Phosphorus in agriculture: Problems and solutions.

Vinod , K.K. and Heuer, S. (2012). Approaches towards nitrogen- and phosphorus-efficient

rice. AoB Plants, pls028. [PubMed].

Yoshida, S, Forno, D.A.,Cock, J.H., Gmez, K.A. (1976). Laboratory manual for physiological

studies of rice, IRRI.

Yost, R. S., Kamprath, E. J., Lobato, E. and Naderman, G. C. (1979). Phosphorus response of

corn on an oxisol as influenced by rates and placement. Soil Sci. Soc. Am. J. 43, 338-343.

https://www.ncbi.nlm.nih.gov/pubmed/?term=Vinod%20KK%5BAuthor%5D&cauthor=true&cauthor_uid=23115710

https://www.ncbi.nlm.nih.gov/pubmed/?term=Heuer%20S%5BAuthor%5D&cauthor=true&cauthor_uid=23115710

https://www.ncbi.nlm.nih.gov/pubmed/23115710


54


Dynamics of Nitrifiers in Soils of Intensively Vegetable Cultivated Areas

in Sri Lanka

K.K.K. Nawarathna1, W.S. Dandeniya2*, R.S. Dharmakeerthi2 and P. Weerasinghe1



Sri Lanka

ABSTRACT: Nitrification tend to reduce the agronomic fertilizer use efficiency in cropping

systems because nitrate, the end product of nitrification, has high potential to loss from soil

environment due to denitrification and leaching. The population characteristics of ammonia

oxidizing and nitrite oxidizing microorganisms carrying out nitrification in soils may affect

the effectiveness of approaches taken to suppress nitrification. A study was conducted to assess

the activity and abundance of nitrifiers in soils of intensively vegetable grown regions in Sri

Lanka. Soil samples were collected from 72 locations across Nuwara Eliya, Marassana,

Kalpitiya and Gannoruwa representing vegetable cultivated fields managed conventionally

(n=45) and organically (n=9), and uncultivated areas (n=18). Basic soil characteristics were

determined using standard procedures. Potential nitrification rate (PNR) and the abundance of

ammonia oxidizers and nitrite oxidizers were estimated. Chemical characteristics of soils

varied widely with pH, EC and organic C% ranging from 3.8 to 8.5, 0.04 to 0.94 dS/m and

0.9% to 4.5%, respectively. The PNR of the studied soils ranged from 0.18 to 15.80 NO3--

N/kg/h. The abundance of ammonia oxidizers and nitrite oxidizers ranged from 1.96 to 5.97

log10CFU g-1 and 1.36 to 5.63 log10CFU g-1, respectively. The potential activity of nitrifiers

did not correlate with the abundance of ammonia oxidizers or nitrite oxidizers. Thus, the

functional and compositional diversities of nitrifying communities may be different across the

soils. PNR values for studied soils are higher compared to reported values in literature. Hence,

appropriate measures need to be taken to suppress nitrification as high nitrification rates could

lead to reduce fertilizer use efficiency and increase risk of groundwater contamination with

nitrate.

Keywords: Fertilizer use efficiency, potential nitrification rate, soil nitrifiers, vegetable

cultivation

INTRODUCTION

Nearly 11 % of the N-fertilizers (urea and ammonium sulphate) imported to Sri Lanka is being

consumed by vegetable sector, only second to tea sector (27 %) from among the systems that

dominates cultivation under unsaturated soil moisture conditions (personal communication

with National Fertilizer Secretariat, 2017). Nitrification, conversion of NH4+ to NO3

-, is a

biological transformation occurring predominantly under unsaturated soil moisture conditions

since it is mediated by aerobic microorganisms. Thus, fertilize-N is converted to NO3--N in

soils at different rates depending upon the dynamics of soil nitrifiers. Krishnapillai (1979)

1 Horticultural Crops Research and Development Institute, Gannoruwa, Peradeniya, Sri Lanka 2 Department of Soil Science, Faculty of Agriculture, University of Peradeniya, Sri Lanka


Nawarathna et al.

56

reported that about 35 - 50% of the ammonium and urea fertilizer applied to soils in tea

plantations in Sri Lanka were nitrified within 3 to 4 weeks after application and the produced

NO3- rapidly leached from soil under high rainfall condition. In Sri Lanka, Nuwara Eliya,

Kalpitiya and Marassana are some of the intensively vegetable grown regions that experience

heavy application of nitrogen fertilizers. According to Jayasingha et al. (2011) NO3--N in 50

% of the studied groundwater samples collected from Kalpitiya exceeded WHO standards for

drinking water (10 mg L-1) both in dry season and rainy season with values ranging from 0.20–

212.4 mg L-1. A number of studies suggest association of NO3--N in groundwater with

fertilizer-N usage for vegetable cropping in the region threatening human health (Henegama

et al., 2013; Kuruppuarachchi, 2010; Jayasingha et al., 2011; Liyanage et al., 2000). However,

little or no information is available on the diversity and dynamics of nitrifiers inhabiting soils

of Sri Lanka.

Biological nitrification was first explained by Winogradsky during 1889-1890 describing the

role of nitrifying bacteria. Two chemoautotrophic groups of bacteria broadly known as

ammonia oxidizers (e.g. Nitrosomonas spp., Nitrosospira spp., Nitrsococcus spp., etc.) and

nitrite oxidizers (Nitrobacter spp., Nitrospira spp., Nitrococcus spp., etc.) are known to oxidize

ammonia into nitrite and subsequently nitrite into nitrate (Schmidt, 1982). However, presence

of ammonia oxidizing archaea (AOA) in soil have been detected and several studies suggest

that AOA may play an important role in nitrification under low ammonium concentrations

and/or under suboptimal conditions defined for ammonia oxidizing bacteria (AOB), such as

acidic pH, high EC, and low temperature (Leininger et al., 2006; Bernhard et al., 2010;

Hofferle et al., 2010; Posser and Nicol, 2012; Hu and He, 2014). Further complete oxidation

of ammonia to nitrate by a single organism via a process known as complete ammonia

oxidation or comammox has been detected in some members of Nitrospira genus although the

responsible microorganisms have not been isolated (Kessel et al., 2015). Organisms exhibiting

comammox are considered to be having slow growth rates. Beeckman et al. (2018) also

emphasized about ammonia oxidizing Achaea and comammaox bacteria who play a critical

role in nitrification. Decaying organic matter, biologically fixed NH4+ and added fertilizers

provide NH4+-N, the substrate for nitrification (Sylivia et al., 2005). Ammonia oxidizing

bacteria seems to govern nitrification under NH4+-N rich soil conditions such as in soils that

received fertilizer-N, polluted with sewage sludge, or experienced leakages from septic tanks

(Leininger et al., 2006; Höfferle, et al., 2010).

Both NO3- and NH4

+ are considered as plant available forms of N though NO3- is a mobile ion

subjected to leaching and loss from soil through denitrification. Hence, nitrification rate

determines how quick the N is becoming unavailable for crop uptake when provides NH4+

through fertilizers in agriculture field. Potential nitrification rate (PNR) is a measure used to

identify rapidity of nitrification with the provision of ample amount of NH4+ which converts

NH4+ into NO3

- in the presence of nitrifying communities for a particular soil. Enumeration of

ammonia oxidizers and nitrite oxidizers coupled with most probable number (MPN) technique

is commonly used to estimate the abundance of these two groups (Prosser and Nicol, 2012;

Hesselsoe et al., 2001). Both PNR and MPN techniques do not discriminate between archaeal

and bacterial counterparts (Prosser and Nicol, 2012) but found to be more representative of

bacterial nitrifiers under NH4+-N rich soil conditions (Hofferle et al., 2010). Although these

techniques provide a fairly good understanding about soil nitrifiers the anomalies common for

culture based techniques should be considered when interpret results.

Intensive vegetable cultivation is practiced in several agro ecological regions in Sri Lanka in

varying intensity and types of input management with different crop rotations leading to high

diversity in vegetable grown systems. Therefore, we hypothesized that the abundance and the

Dynamics of Nitrifiers in Vegetable Grown Soils

57

activity of nitrifiers in soils will be different across different vegetable grown systems. This

study was conducted to estimate the activity of nitrifiers and their abundance in soils from

selected intensively vegetable cultivated regions using PNR and MPN techniques to generate

preliminary information on dynamics of nitrifiers in these systems. The information will be

useful in future research and planning activities to enhance N-fertilizer use efficiency and

minimize NO3- leaching to groundwater. Further this study attempted to enumerate and isolate

nitrifying bacteria for future research.

METHODOLOGY

Vegetable production under different input management systems in different agro-ecological

regions were selected in order to introduce high diversity of systems to the study. Accordingly,

four locations having contrasting climatic conditions and soil types, and also representing

popular regions for vegetable production in the country, were selected. Introducing variability

in input management, uncultivated lands under natural vegetation, vegetable cultivated fields

managed conventionally using synthetic agrochemicals, and those managed with organic

farming methods were included in the sampling scheme whenever possible. Details of the

locations used for soil sampling is given in Figure 1 and Table 1.

Figure 1. Map of Sri Lanka depicting sampling locations in three districts

Nawarathna et al.

58

Table 1. Details of the sampling locations and the number of samples collected from each

location

Location1

Nuwara Eliya Marassana Kalpitiya Gannoruwa

Agro

ecological

region

IU2 IM3c DL3 WM2b

Taxonomic

class/classes

of soil/s2

Red yellow

podsolic soils

(Typic

Paleudults)

Red yellow

podsollic soils

(Typic

Paleudults)

Sandy regosols

(Typic

Quatzepsamments)

Reddish

Brown

latasolic

(Typic

Troporthents)

Sampling

localities

Bambarakele

Seethaeliya,

Mahagastota

Katumana,

Nuwara Eliiya

Marassana Nawakkadu,

Norochcholei,

Kalpitiya,

Narakkalliya

HORDI

research fields

Number:

Conventional

farm (CF)3

Organic farm

(OF)

Natural

vegetation

6

6

5

18

-

6

18

2

5

3

1

2

Types of

crops in

cultivated

fields at the

time of

sampling

CF: Carrot,

beet, leeks

OF: Carrot

cabbage

broccoli

CF:

Tomato,

capsicum

Luffa,

cucumber,

bitter guard

CF: beet, onion,

Chilies, pumpkin,

batana, capsicum

potato, pumpkin,

Manioc, gherkin

OF: Nivithi, beet

root, long bean,

okra, capsicum

CF: brinjal,

tomato

OF: cabbage

Sampling was performed for 4 months, from October, 2016 to March in 2017. Selected

vegetable cultivated fields were having a crop at maturity stage at the time of sampling. From

each field eight random soil samples were collected at 0-15 cm depth to make a composite

sample representative of the field. Altogether 72 soil samples were collected for the study. Soil

samples were immediately transferred to the laboratory at HORDI, Peradeniya, Sri Lanka. A

subsample of the field moist soil was sieved through 4 mm sieve and refrigerated for

subsequent microbial analyses. The remaining portion of each soil sample was air dried, sieved

through 2 mm mesh sieve and stored for chemical and physical characterization.

Physico-chemical Analyses

Soil pH and electrical conductivity (EC) were measured in soil: water suspensions of 1:1 and

1:5, respectively. Soil organic carbon was analyzed using Walkley and Black method (Baruah

and Barthakur, 1997) and active carbon content was analyzed according to permanganate


59

oxidiazable carbon (POXC) method described by Weil et al. (2003). Soil texture was

determined by pipette method as explained in Dharmakeertihi et al. (2007).

Microbiological analyses

Soils were analyzed for total culturable bacteria, fungi, ammonia oxidizing bacteria and nitrite

oxidizing bacteria using culture based techniques. Total culturable bacteria and fungi were

enumerated on 3% triptic soy agar (TSA) and Rose Bengal agar, respectively, using serial

dilutions in spread plate technique. Plates were incubated at 28±1 °C and bacterial colony

counts were taken 2 days after inoculation and fungal colonies were counted 6 days after

inoculation. Most probable number (MPN) method as described by Schmidt and Belser (1994)

was used to estimate the abundance of ammonia oxidizers and nitrite oxidizers. Cultures were

incubated in triplicates for 21 days before making observations. Potential Nitrification Rate

(PNR) of soils was assessed following shaken slurry method (Heart et al., 1995). Optimum

time points to collect subsamples for the determination of potential nitrification rates were

identified after conducting a preliminary study. Accordingly subsamples of the slurry was

drawn at 4 h and 20 h after initiating incubation at room temperature (26±2 °C) and nitrate was

measured calorimetrically (Cataldo et al.,1975). Ammonia oxidizers were cultured in NH4+

containing P buffer medium used in MPN method and plated on to TSA to obtain single

colonies. Selected colonies were purified and screened for their ability to oxidize NH4+.

Isolates of ammonia oxidizers were cultured in NH4+ containing P buffer medium and stored

in refrigerator for future analyses.


All the statistical analyses were performed using SPSS 16 statistical package. Data collected

were used in preliminary descriptive analysis and Pearson correlation analysis for the

measured parameters was performed at p<0.05. Principal component analysis (PCA) was

performed to identify the variables among the measured parameters contributing mostly for

the differences among soils. In here, correlation PCA was performed and the suitability of the

data set for the structure detection was confirmed by performing Kaiser-Meyer-Olkin (KMO)

Test and Bartlett's test of sphericity. Results indicated that sampling was adequate for factor

analysis (KMO test value = 0.62) and there is adequate relationship between variables for

structure detection (significance level at <0.001). Parallel analysis was performed to confirm

the number of components to be retained from PCA and accordingly first three principal

components (PC) were selected and single scores for each component for soil sample was

calculated considering the variables contributing mostly to each PC to present data graphically.


Soil samples collected from the four regions belonging to different climatic regions and having

different soil types as indicated in Table 1 were diverse in terms of measured soil

characteristics (Table 2). The pH of the studied soils ranged from very strongly acidic (3.8) to

moderately alkaline (8.5). High variability in pH was observed even within the same

management system in a region (e.g.CF in Nuwara Eliya) possibly due to multitude of factors

including differences in topography and intensity of input management. Majority of the soil

samples from Nuwara Eliya region were acidic while 92% of soils found in Kalpitiya were

alkaline but none of the studied soils were saline (Table 2). Organic C percentages were high

in 56% of the soil samples from Nuwara Eliya. In contrast, 60% of soils from Kalpitiya had

Nawarathna et al.

60

Table 2. Basic statistics of chemical properties of soil collected from Nuwara Eliya,

Gannoruwa, Marassana and Kalpitiya

Location GC GO# GU KC KO KU MC MU NC NO NU

Number

of

samples

3 1 2 18 2 5 18 6 6 6 5

pH

Mean 6.6 6.7 6.3 7.6 7.8 7.7 6.6 6.9 5.6 6.5 4.9

St. Dev. 0.5 - 0.1 0.5 0.1 1.0 0.6 0.4 1.1 0.2 1.1

Minimum 6.2 - 6.3 6.4 7.7 6.0 5.2 6.1 4.5 6.3 3.8

Maximum 7.2 - 6.4 8.5 7.9 8.3 7.2 7.2 7.3 6.8 6.5

EC (dS/m)

Mean 0.19 0.06 0.08 0.12 0.13 0.25 0.25 0.18 0.37 0.2 0.12

St. Dev . 0.02 - 0.004 0.04 0.03 0.14 0.22 0.03 0.2 0.12 0.02

Minimum 0.17 - 0.08 0.06 0.10 0.09 0.04 0.10 0.12 0.13 0.09

Maximum 0.06 - 0.23 0.15 0.15 0.43 0.94 0.18 0.58 0.44 0.14

Organic Carbon (%)

Mean 1.9 1.2 4.0 0.7 0.9 1.5 1.5 1.5 2.7 3.2 3.1

St. Dev. 0.5 - 0.5 0.8 0.1 1.3 1.1 1.1 0.6 0.8 0.5

Minimum 1.6 - 3.6 0.3 0.9 0.4 1.0 0.5 1.6 2.3 2.3

Maximum 2.4 - 4.3 3.8 1.0 3.4 3.2 3.0 3.4 4.5 3.7

Active carbon (mg/kg)

Mean 248 261 207 257 395 457 307 419 290 371 563

St. Dev . 233 - 46 153 49 263 111 126 155 213 138

Minimum 34 - 174 2 360 135 120 284 103 136 419

Maximum 496 - 240 306 429 815 453 630 553 708 749 Nuwara Eliya, Gannoruwa, Marassana and Kalpitiya are denoted by N, G, M and K, respectively as first letter in data

labels representing uncultivated lands and fields cultivated with vegetables using conventional and organic practices (as denoted by U, C and O, respectively as second letter in data labels).# There was only one field sampled from

Gannoruwa representing organic vegetable production. Therefore, standard deviation, minimum and maximum are

not calculated

very low organic C content. In the present study, there was no clear effect of implementing

organic management practices on soil organic C contents. This may be partly due to the less

number of samples representing organically cultivated fields compared to conventionally

managed fields. Active carbon quantifies labile carbon in soil (Culman et al., 2013). The

amount of labile carbon influences the availability of readily utilizable carbon to

microorganisms and hence, their activity (Hurisso et al., 2016). It is considered as a sensitive

indicator of soil quality (Culman et al., 2013). The active carbon contents varied widely in

analyzed soil samples (Table 2) and the values are within the range reported previously, which

is from 24 to 1469 mg kg−1 (Culman et al., 2013; Hurisso et al., 2016). Soil texture was highly

variable among the tested samples with sand contents ranging from 6 to 97%. In overall, the

most prominent textural classes of the studied soils were Sandy clay loam (34%) and Sandy

loam (30%). The highest diversity in soil texture was found in samples collected from

Marassana with Sandy clay loam, Sandy loam, Loam, Loamy sand and Sandy clay as the

textural classes. Soil samples collected from Gannoruwa had Sandy clay loam texture. The

texture of soil samples collected from Nuwara Eliya were mostly loamy type and belonged to


61

textural classes of Sandy clay loam, Sandy loam, Silt loam, Loam and Clay loam. On the other

hand, the soils collected from Kalpitiya region were mostly sandy type and belonged to textural

classes of sandy clay loam, sandy loam, loamy sand and sand.

The potential activity of nitrifiers ranged from 0.1 to 16.0 NO3- -N mg/kg of dry soil/ h (Figure

2a). Mostly conventionally managed fields showed higher PNR rate compared to other

cropping histories in respective regions. This may be due to the higher ammonium levels

applied by farmers. When analyzing total ammonia oxidizing bacteria and nitrite oxidizing

bacteria referred to as nitrifying bacteria, above results cannot be explained subjected to

population size of them (Figure 2b and 2c). The efficiency of nitrifying communities under

optimum conditions when expressed as potential nitrification rate per unit of ammonia

oxidizers, who are conducting the rate limiting first step of nitrification, varied from 1 to

57,341 pg NO3- -N/ ammonia oxidizer cell/ h suggesting differences in species composition in

these communities

Table 3. The abundance of total culturable bacteria and fungi in the soil collected from

Nuwara Eliya, Gannoruwa, Marassana and Kalpitiya

Location NO NC NU GO GC GU MC MU KO KC KU

Bacteria (log10 CFU g -)

Mean 8.1 7.9 7.8 - 7.7 8.35 8.2 8.1 8.8 8.6 8.9

St. Dev. 0.3 0.2 0.2 - 0.2 0.01 0.2 0.2 0.1 0.2 0.5

Minimum 7.69 7.7 7.6 - 7.6 8.34 7.5 7.8 8.7 8.1 8.6

Maximum 8.5 8.2 8.1 - 7.9 8.36 8.5 8.4 8.9 9.0 9.9

Fungi (log10 CFU g -)

Mean 4.1 3.7 3.6 - 3.2 3.3 3.3 4.9 4.5 4.5 4.4

St. Dev. 0.8 0.5 0.2 - 0.2 0.0 0.3 0.10 0.1 0.4 0.1

Minimum 3.3 3.1 3.4 - 3.0 3.3 2.7 4.8 4.4 3.6 4.2

Maximum 5.2 4.4 3.9 - 3.0 3.3 3.9 5.1 4.5 4.9 4.5 Nuwara Eliya, Gannoruwa, Marassana and Kalpitiya are as denoted by N, G, M and K, respectively as first letter in data

labels representing uncultivated lands and fields cultivated with vegetables using conventional and organic practices (as

denoted by U, C and O, respectively as second letter in data labels)

Loamy type textures usually facilitate good air and water balance while soils with sandy type

textures are highly aerated and have less water retention. When water retention in soil is poor

it affects substrate diffusion to microbial cells and cause adverse physiological effects due to

cell dehydration; thus, affecting nitrification (Stark and Firesotne 1995). Further, oxidation of

organic matter is high in well aerated soils than poorly aerated soils when moisture level is not

limiting microbial activity and therefore, organic matter retention is less in sandy type texture

compared to loamy or clayey type soil textures. Significant negative correlations between sand

content of soils and the organic carbon and active carbon contents were seen in the present

study (Table 4). Soil pH correlated with a number of parameters measured (Table 4).

Therefore, the nitrifying communities of the studied soils may have evolved under unique sets

of environmental constraints as facilitated by interacting effects of soil properties like texture,

pH and organic carbon contents with agro-climatic conditions (O’Sullivan et al., 2013).

Nawarathna et al.

62

Population size of nitrite oxidizers were higher compared to ammonia oxidizers (Figure 2b.and

2c.). Sergei Winogradsky first isolated and showed in 1890 the organisms responsible for two

steps of nitrification. 1st step is carried out by mainly Nitrosomonas, Nitrosospira,

Nitrosolobus, and Nitrosococcus. Second step is carried out by mainly Nitrobactor, followed

by Nitrospira and Nitrosococcus (Sullivan et al., 2012). However, recent studies indicated

that some members of genera Nitrospira could perform complete oxidation of NH4+ to NO3

-

via comammox (Kessel et al., 2015).

Figure 2. The activity and abundance of nitrifiers as indicated by (a) potential nitrification rate (mg of nitrate

N/kg of dry soil /h) (b) abundance of ammonia oxidizers and (c) abundance of nitrite oxidizers of the

soils collected from Nuwara Eliya, Gannoruwa, Marassana and Kalpitiya (as denoted by N, G, M

and K, respectively as first letter in data labels) representing uncultivated lands and fields cultivated

with vegetables using conventional and organic practices (as denoted by U, C and O, respectively as

second letter in data labels)

Nitrospira could be found in high abundance in soil but their activity is very slow compared

to Nitrosomonas like species (van Kessel et al., 2015). Further, AOB like Nitrosomonas spp.

1 3 5 7

KU1

KU2

KU3

KU4

KU5

KC1

KC2

KC3

KC4

KC5

KC6

KC7

KC8

KC9

KC10

KC11

KC12

KC13

KC14

KC15

KC16

KC17

KC18

KO1

KO2

MU1

MU2

MU3

MU4

MU5

MU6

MC1

MC2

MC3

MC4

MC5

MC6

MC7

MC8

MC9

MC10

MC11

MC12

MC13

MC14

MC15

MC16

MC17

MC18

GU1

GU2

GC1

GC2

GC3

GO1

NU1

NU2

NU3

NU4

NU5

NC1

NC2

NC3

NC4

NC5

NC6

NO1

NO2

NO3

NO4

NO5

NO6

Theabundanceofnitriteoxidizers(log10 Cells/gdrysoil)

(c) OrganicConventionalUncultivated

1 3 5 7

KU1

KU2

KU3

KU4

KU5

KC1

KC2

KC3

KC4

KC5

KC6

KC7

KC8

KC9

KC10

KC11

KC12

KC13

KC14

KC15

KC16

KC17

KC18

KO1

KO2

MU1

MU2

MU3

MU4

MU5

MU6

MC1

MC2

MC3

MC4

MC5

MC6

MC7

MC8

MC9

MC10

MC11

MC12

MC13

MC14

MC15

MC16

MC17

MC18

GU1

GU2

GC1

GC2

GC3

GO1

NU1

NU2

NU3

NU4

NU5

NC1

NC2

NC3

NC4

NC5

NC6

NO1

NO2

NO3

NO4

NO5

NO6

Theabundanceofammoniaoxidizers(log10 Cells/gdrysoil)

(b)

0 4 8 12 16

KU1

KU2

KU3

KU4

KU5

KC1

KC2

KC3

KC4

KC5

KC6

KC7

KC8

KC9

KC10

KC11

KC12

KC13

KC14

KC15

KC16

KC17

KC18

KO1

KO2

MU1

MU2

MU3

MU4

MU5

MU6

MC1

MC2

MC3

MC4

MC5

MC6

MC7

MC8

MC9

MC10

MC11

MC12

MC13

MC14

MC15

MC16

MC17

MC18

GU1

GU2

GC1

GC2

GC3

GO1

NU1

NU2

NU3

NU4

NU5

NC1

NC2

NC3

NC4

NC5

NC6

NO1

NO2

NO3

NO4

NO5

NO6

PotentialNitrificationRate(mgN/kgsoil/h)

(a)


63

frequently found in agricultural soils are metabolically classified as obligate

chemolithoautotrophs that utilize NH4+ as an energy source and CO2 as the C source. Increase

in activity of this organism in the presence of organic substrates has been reported (Hommes

et al., 2003). Therefore, the activity of the same group of organism could be different with

respect to soil environmental characters such as composition and availability of labile carbon.

Techniques used in the present study to analyze PNR and the abundance of nitrite oxidizers

and ammonia oxidizers do not discriminate between bacterial and archaeal counterparts

(Prosser and Nicol, 2012). However significant differences in terms of the contribution of these

two groups of organisms for nitrification have been suggested based on molecular based

approaches in a number of studies (Leininger et al., 2006; Bernhard et al., 2010; Hofferle et

al., 2010; Posser and Nicol 2012; Hu and He, 2014). Bacterial nitrifiers are reported to

dominate nitrification under slightly acidic to neutral pH soil conditions and also under

environments receiving high NH4+ inputs (Fan et al., 2011; Tylor et al., 2011; Verhamme et

al., 2011). According to Tylor et al. (2011) fertilizer-N application and manure addition

increased AOB abundance in soils compared to unfertilized soils while AOA abundance

remained unchanged. However, the community composition of both AOB and AOA groups

changed with fertilizer treatments. They further reported that change in community

composition of AOB with crop growth stage was more prominent than that of AOA. Therefore,

there should be high variability in the dominance of AOB and AOA in the studied soils that

represent uncultivated and cultivated systems, which are different with respect to input

management and vegetation.

Higher number of archaeal nitrifiers have been reported under extreme soil conditions for

microbial growth such as high or low pH, salinity, etc. (Bernhard et al., 2010; Hofferle et al.,

2010; Posser and Nicol 2012; Hu and He, 2014). Change in abundance of these two groups

depending on temperature and soil moisture regimes and altitude has also been reported

(O’Sullivan et al., 2013; Tylor et al., 2011; Zhang et al., 2009). The altitude of the sampling

sites used in the present study varied from 8 m (e.g. Kalpitiya) to above 1860 m (e.g. Nuwara

Eliya) from mean sea level and along with the elevation gradient the climatic conditions the

soils are experiencing changes as indicated by the different agro-ecological regions the

locations belong to (Table 1). Further high diversity in soil texture is suggestive of high

variability in temperature and moisture conductivity among many other processes affecting

microbial growth. Therefore, it can be expected that even though two soils have relatively

similar abundance of ammonia oxidizers the activity can be very different because composition

of community affects the potential activity. This is evident in the present study since the

abundance of ammonia oxidizers in soils collected from Kalpitiya and Marassana are less

variable compared to the variability exist in the potential activity of nitrifiers from the same

soils (Figure 1a and 1b). Potential nitrification rate is often reported to show correlation with

AOB abundance than AOA (Bernhard et al., 2010). Lack of correlation between PNR and

AOA and AOB abundance was observed by O’Sullivan et al. (2013). In the present study,

significant correlation was observed between PNR and EC but there was no correlation

between PNR and the abundance of either ammonia oxidizer or nitrite oxidizer groups (Table

4). There may be differences in terms of the contribution of AOA and AOB for the nitrification

in soils used in present study.

Although there is high variability in the estimated characters of the nitrifying populations these

characters were not strong at defining the variability of the studied soils as indicated by PCA

(Table 5 and 6). The variability among the studied soils was captured by PC1, PC2 and PC3

at 30, 16 and 14%, respectively. Structure of data along PC1 is mostly due to soil pH and

Nawarathna et al.

64

organic C and abundance of bacteria and fungi. Potential nitrification rate and EC scored high

in PC2. O’Sullivan et al. (2013) reported that PNR was more sensitive to the soil fertility status

than the population sizes of AOA and AOB. In the present study PNR contributed for the

variability of studied soils than ammonia oxidizer or nitrite oxidizer abundance as depicted by

PCA.

Despite the differences in soil characteristics and agro-climatic conditions, the studied

vegetable production systems have one character in common, which is intensive production

with high input use (organic and/or synthetic fertilizers). Therefore, the soils receive high dose

of nitrogenous fertilizers in each cropping cycle. The intensity of cultivation considering the

number of crops per year vary as NuwaraEliya>Kalpitiya>Marassana=Gannoruwa. These

regions are environmentally sensitive areas as Nuwara Eliya, Gannoruwa and Marassana are

in tributaries of major rivers (mainly river Mahaweli) and Kalpitiya is located on a perched

water table. Therefore, contamination of groundwater and surface water bodies with nitrate

causing on-site and off-site effects is highly probable in these regions.

Table 4. Correlations between measured variables

pH EC OC AC PNR TB TF AO NO

EC -0.137

NS

OC -0.490 0.126

*** NS

AC -0.175 -0.039 0.183

NS NS NS

PNR -0.225 0.547 0.193 0.109

* *** NS NS

TB 0.500 -0.060 -0.339 0.034 -0.237

*** NS ** NS *

TF 0.296 -0.214 -0.297 0.044 -0.389 0.361

* * * NS ** **

AO 0.200 -0.075 -0.175 0.163 -0.084 0.282 0.329

NS NS NS NS NS * **

NO 0.157 -0.263 -0.096 0.203 -0.116 -0.021 0.021 0.146

NS * NS NS NS NS NS NS

sand% 0.49 0.001 -0.51 -0.496 0.014 0.004 0.18 -0.11 -0.16

*** NS *** *** NS NS NS NS NS OC-organic carbon, AC-active carbon, PNR-potential nitrification rate, TB-total bacteria, TF-total fungi, AO-ammonia oxidizers, NO-nitrite oxidizers

NS - Not significant:

Significance at probability levels: p<0.05,*: p<0.01,**: p<0.001,***

Table 5. Total Variance explained by the first three principal components (PCs)

Component Initial Eigenvalues

Total % of Variance Cumulative %

1 2.758 30.645 30.645

2 1.435 15.940 46.585

3 1.290 14.331 60.916


65

Table 6. Scores of each variable in Rotated Component Matrix

There are enough evidences to indicate nitrate pollution in surface and ground water due to

fertilizer usage in vegetable production is already an issue (Henegama et al., 2013;

Kuruppuarachchi, 2010; Jayasingha et al., 2011; Liyanage et al., 2000). Therefore, information

on potential activity of nitrifiers and the diversity of nitrifying communities are important to

design suitable techniques to manage N fertilizers and minimize N losses to the environment.

From among the parameters estimated in relation to nitrifiers, PNR was the only parameter

that contributed to the structured variability among soils (Table 5 and 6). Based on the PNR

values observed in the present study about 48% of soils had PNR values from 3 to 10 mg of

N/kg soil/h and 7% of soils had values greater than 10 mg of N/kg soil/h. Olsson and

Falkengren-Grerup (1999) reported PNR in soils from Oak forests in Southern Sweden ranging

from 0 to 24 nmol NO3- /g/h which is equivalent to 0 to 0.34 mg of N/kg/ h. They further

reported that PNR positively correlated with pH. Tylor et al. (2011) reported PNR rates as

high as 2.4 µmol N/g/day (equivalent to 1.46 mg of N/kg soil/h) when soil is incubated with 1

mM NH4+ supplement. Based on a study conducted on an Alfisol soil in Northeast China, Fan

et al. (2011) indicated that PNR tend to be suppressed by long term mineral fertilizer

application but enhanced by application of manures such as horse manure. The reported PNR

rates by Fan et al. (2011) ranged from 0.5 to 2.6 mg NO3-/kg soil/h (equivalent to 0.11 to 0.59

mg of N/kg soil/h). Therefore, PNR in most of the soils in this study are higher than those

reported in literature (Figure 2a). Considering the high PNR values observed in the present

study in agricultural soils there is a high potential of losing N once nitrogenous fertilizer are

added to cultivated fields, contaminating groundwater and surface water with NO3-, and

increasing emissions of N2O, a greenhouse gas with 296 times more global warming potential

than CO2 (Dalal et al., 2003). The N2O is emitted during nitrification to some extent and largely

through denitrification of NO3- produced from nitrification (Dalal et al., 2003). Hence timely

actions are needed to be taken to moderate nitrification rate as vegetable grown regions receive

high quantities of nitrogen fertilizers. Nine ammonia oxidizer isolates were made from the

studied soils to facilitate future research activities on developing suitable techniques to

suppress nitrification in vegetable cropping systems.

In the present study, the abundance of bacteria, fungi, ammonia oxidizers and nitrite oxidizers

are presented in per gram of soil basis, which is a standard expression used. However,

differences in patterns can be expected if the same has been presented in per unit soil volume

because the soil texture and organic matter content vary widely across soils and structural

properties, especially bulk density, also vary across fields (Mehlich, 1972). Since soil bulk

density measurements were not made the comparison in per volume basis cannot be performed.

Variable Component

1 2 3

Bacteria abundance 0.797 0.013 0.126

pH 0.751 -0.119 -0.109

Organic C -0.683 0.106 0.202

Fungi abundance 0.668 -0.243 0.120

EC -0.042 0.877 -0.072

Potential nitrification rate -0.280 0.796 0.101

Active C -0.176 0.062 0.829

Ammonia oxidizer abundance 0.483 0.043 0.566

Nitrite oxidizer abundance -0.005 -0.423 0.497

Nawarathna et al.

66

It is suggested that in future research of this nature it will be important to consider expressing

results in per volume of soil.

CONCLUSIONS

The soil characteristics, potential activity and abundance of nitrifiers’ populations varied

widely across the studied soils. The results indicate very high diversity in nitrifying

communities inhabiting intensively vegetable cultivated soils. PNR contributed more to

structuring the variability of soils than abundance of ammonia oxidizers and nitrite oxidizers,

thus, it is a better indicator of dynamics of nitrifiers than population size of the group. It is

revealed that potential nitrification rates of 55% of soils from the studied vegetable grown

regions were higher than the values reported in literature. Hence, moderation of nitrification

rate should be crucial, especially in vegetable grown soils, to improve agronomic fertilizer use

efficiency and reduce groundwater contamination with nitrate and emissions of N2O as these

fields receive high amounts of nitrogen fertilizers with each cropping cycle. The variability in

soils with respect to functional diversity of nitrifying communities may have to be considered

when developing mechanisms for the moderation of nitrification.

REFERENCES

Baruah, T.C and Barthakur. H.P. (1997). a text book of soil analysis. Vikas publishing house

Pvt. Ltd. New Delhi.

Beeckman, F., Motte, H. and Beeckman, T. (2018). Nitrification in agricultural soils: impact,

actors and mitigation, Current Opinion in Biotechnology. 50, 166-173.

Cataldo, D.A., Haroon, M. Schrader,L,E., and Youngs, V.L. (1975), Rapid colorimetric

determination of nitrate in plat tissue by nitration of salicylic acid. Communications in Soil

Science and Plant Analysis, 6(1), 71-80.

Culman, S. W., Snapp, S. S., Green, J. M., and Gentry, L. E. (2013). Short- and long-term

labile soil carbon and nitrogen dynamics reflect management and predict corn agronomic

performance. Agronomy Journal, 105:493–502. doi:10.2134/agronj2012.0382.

Dalal, R.C., Wang, W. Robertson, G.P. and Parton, W.J. (2003). Nitrous oxide emission from

Australian agricultural lands and mitigation options: a review. Soil Research, 41(2), 165-195.

Dharmakeerthi, R.S., Indraratne,S.P. and Kumaragamage, D. (2007), Manual of Soil Sampling

and Analysis, Special Publications, Soil Science Society of Sri Lanka.

Fan, F., Yang, Q., Li, Z., Wei, D., Cui, X.A. and Liang, Y. (2011). Impacts of organic and

inorganic fertilizers on nitrification in a cold climate soil are linked to the bacterial ammonia

oxidizer community. Microbial ecology, 62(4), 982-990.

Hart, S.C., Stark, J.M., Davidson, E.A. and Firestone, M.K. (1994). Nitrogen mineralization,

immobilization and nitrification. pp. 985-1018.In: Weaver, R.W., Angle, J.S., and Bottomley,

P.S. (Eds.) Methods of Soil Analysis, Part 2. Microbiological and Biochemical Properties. Soil

Science Society of America. Madison, WI, USA.


67

Henegama, H.P., Dayawansa, N.D.K. and De Silva, S. (2013). An Assessment of Social and

Environmental Implications of Agricultural Water Pollution in Nuwara Eliya. Tropical

Agricultural Research, 24(4), 304-316.

Hesselsøe, M., Brandt, K. K. and Sørensen, J. (2001). Quantification of ammonia oxidizing

bacteria in soil using microcolony technique combined with fluorescence in situ hybridization

(MCFU–FISH). FEMS microbiology ecology, 38(2-3), 87-95.

Höfferle, Š., Nicol, G. W., Pal, L., Hacin, J., Prosser, J. I. and Mandić-Mulec, I. (2010).

Ammonium supply rate influences archaeal and bacterial ammonia oxidizers in a wetland soil

vertical profile. FEMS microbiology ecology, 74(2), 302-315.

Hommes, N.G., Sayavedra-Soto, L.A. and Arp, D.J. (2003). Chemolithoorganotrophic growth

of Nitrosomonas europaea on fructose. Journal of bacteriology, 185(23), 6809-6814.

Hu, H.W. and He, J.Z. (2014). Ammonia oxidizing Achaea play a predominant role in acid

soil nitrification. Advances in Agronomy. 125, 261-302.

Hurisso, T. T., S. W. Culman, W. R. Horwath, J. Wade, D. Cass, J. W. Beniston, T. M.

Bowles, A. S. Grandy, A. J. Franzluebbers, M. E. Schipanski, et al. (2016). Comparison of

permanganate-oxidizable carbon and mineralizable carbon for assessment of organic matter

stabilization and mineralization. Soil Science Society of America Journal, 80:1352–64.

doi:10.2136/sssaj2016.04.0106.

van Kessel, M.A., Speth, D.R., Albertsen, M., Nielsen, P.H., den Camp, H.J.O., Kartal, B.,

Jetten, M.S. and Lücker, S. (2015). Complete nitrification by a single

microorganism. Nature, 528(7583), 555-559.

Krishnapillai, S. (1979). Inhibition of nitirification by waste tea (tea fluff). Plant and Soil, 51,

563-569.

Kuruppuarachchi, D.S.P. (2010). A review on the leaching of nitrate from agricultural soil and

pollution of ground water in Sri Lanka. Journal of Soil Science Society Sri Lanka, 22.

Leininger, S., Urich, T., Schloter, M., Schwark, L., Qi, J., Nicol, G.W., Prosser, J.I.,

Schuster, S.C. and Schleper, C. (2006). Archaea predominate among ammonia-oxidizing

prokaryotes in soils. Nature, 442 (7104), 806-809.

Liyanage C. E., Thabrew, M. I. and Kuruppuarachchi D.S.P. (2000). Nitrate pollution in

ground water of Kalpitiya: An evaluation of the content of nitrate in the water and food items

cultivated in the area. Journal of National Science Foundation of Sri Lanka. 28(2), 101-112.

Mapa, R.B., Somasiri, S. and Dassanayake, A.R. (2010). Soils of the Dry zone of Sri Lanka,

Soil Science Society of Sri Lanka.

Mapa, R.B., Somasiri S. and Nagarajah, S. (1999). Soils of the wet zone of Sri Lanka, Soil

Science Society of Sri Lanka.

Mehlich, A. (1972). Uniformity of expressing soil test results a case for calculating results on

a volume basis. Communications in Soil Science and Plant Analysis, 3(5), pp.417-424.

Nawarathna et al.

68

Nicol, G.W. and Prosser, J.I. (2011). Strategies to determine diversity, growth, and activity of

ammonia-oxidizing archaea in soil. In Methods in enzymology (Vol. 496, pp. 3-34). Academic

Press.

O’Sullivan, C.A., Wakelin, S.A., Fillery, I.R. and Roper, M.M. (2013). Factors affecting

ammonia-oxidising microorganisms and potential nitrification rates in southern Australian

agricultural soils. Soil Research, 51(3), 240-252.

Olsson, M.O. and Falkengren-Grerup, U. (2000). Potential nitrification as an indicator of

preferential uptake of ammonium or nitrate by plants in an oak woodland

understorey. Annals of Botany, 85(3), 299-305.

Prosser, J. I. and Nicol, G. W. (2012). Archaeal and bacterial ammonia-oxidisers in soil: the

quest for niche specialization and differentiation. Trends in microbiology, 20(11), 523-531.

Schmidt, E.L. (1982). Nitrification in Soil, In F.J. Stevenson (ed.), Nitrogen in Agricultural

Soils, Agronomy Monograph No. 22, Madison WI, ASA-CSSA-SSSA, 253–288.

Schmidt, E.L. and Belser, L.W. 1994. Autotrophic nitrifying bacteria. In Methods of Soil

Analysis, Part 2 Microbiological and Biochemical Properties. Eds. R.W. Weaver, J.S. Angle

and P.S. Bottomley. Pp 59-79. Soil Science Society of America, Inc. Madison, WI, USA.

Sylvia, D.M., Fuhrmann, J.J., Hartel, P.G. and Zuberer, D.A. eds. (2005). Principles and

applications of soil microbiology (No. QR111 S674 2005). Upper Saddle River, NJ: Pearson

Prentice Hall.

Stark, J.M. and Firestone, M.K. (1995). Mechanisms for soil moisture effects on activity of

nitrifying bacteria. Applied and environmental microbiology, 61(1), 218-221.

Sullivan, B.W., Selmants, P.C. and Hart, S.C. (2012). New evidence that high potential

nitrification rates occur in soils during dry seasons: Are microbial communities metabolically

active during dry seasons? Soil biology and biochemistry, 53, 28-31.

Taylor, A.E., Zeglin, L.H., Wanzek, T.A., Myrold, D.D. and Bottomley, P.J. (2012). Dynamics

of ammonia-oxidizing archaea and bacteria populations and contributions to soil nitrification

potentials. The ISME journal, 6(11), 2024-2032.

Verhamme, D.T., Prosser, J.I. and Nicol, G.W. (2011). Ammonia concentration determines

differential growth of ammonia-oxidizing archaea and bacteria in soil microcosms. The ISME

journal, 5(6), 1067-1071.


Performance of Macrobrachium rosenbergii in Perennial Reservoirs: A

Comparative Assessment of Fisheries in Five Perennial Reservoirs in the

Northern Province of Sri Lanka

R. Rajeevan*, U. Edirisinghe1 and A.R.S.B. Athauda1



Sri Lanka

ABSTRACT: The giant freshwater prawn (Macrobrachium rosenbergii), was first introduced

to the reservoirs in the Northern Province of Sri Lanka. Studies on the performances of

introduced species in reservoirs are essential for development of fisheries and management.

The objective of the present study was to evaluate and compare the performance of M.

rosenbergii production in five selected perennial reservoirs. Primary data relating to the

fisheries of the reservoirs and relevant socio-economic data were gathered through field data

collection and questionnaire survey conducted in 2016 and 2017. Unit production of M.

rosenbergii in 2017 in the Vavunikulam, Muthayankattu, Puthumurippu, Kalmadu and

Muhathankulam reservoirs was 5.3 kg/ha, 3.2 kg/ha, 13.6 kg/ha, 21.8 kg/ha, 12.9 kg/ha,

respectively with a farm-gate values of 6.84, 4.39, 2.1, 1.59, and 2.85 million Sri Lankan

rupees, respectively. Relative abundance, economic (total farm-gate price) contribution and

recapture rate of M. rosenbergii in the catch, ranged between 2.3%-20%, 13.5%-72.3% and

1.44%-6.49%, respectively across the reservoirs. Even though the recapture rate was low,

catching of M. rosenbergii improved the livelihood of fishers while increasing their interest in

fisheries. Size of the reservoir, stocking density, fishing intensity and gear specification,

rainfall, wind and socio-economic factors significantly influenced the catch of M. rosenbergii

in the selected reservoirs. The results showed that the introduction of M. rosenbergii as culture-

based fisheries in the selected five reservoirs has achieved considerable success, particularly

in terms of economic benefits.

Keywords: Macrobrachium rosenbergii, perennial reservoirs, culture-based fisheries, PL

stocking, performance

INTRODUCTION

Sri Lanka has many reservoirs of varying nature and scale including seasonal and perennial

reservoirs of large, medium and small sizes. While the primary purposes of these reservoirs

are irrigation and generation of hydroelectricity, they contribute for fisheries production too,

similar to reservoirs in other parts of Asia (Amarasinghe et al., 2001). Making use of reservoirs

for fisheries production in Asia in the past few decades have contributed to increase both

production of food protein and income of rural dwellers (De Silva, 1996; Amarasinghe et al.,

2001). There are few factors influencing the yield from reservoirs, such as reservoir

morphometry, hydro-climatic factors, species composition, fishing effort, gear specification,

1 Department of Animal Science, Faculty of Agriculture, University of Peradeniya, Sri Lanka


Rajeevan et al.

70

stocking of post-larvae, socioeconomic factors and behavior of fish and prawn species (Craig

et al., 1985; De Silva, 1996; Gray et al., 2005). Reservoir fisheries show unique characteristics

compared to other types of fisheries, where majority of reservoir fisheries are artisanal and

highly seasonal integrating well with the ecology of fishery resources (Welcomme, 2001). In

Sri Lanka, fishing methods mainly depend on multi-mesh gillnets which are highly selective

targeting mainly exotic tilapia species (De Silva, 1988). Due to the seasonal variations in the

size of the stocks of these target species, reservoir fishers are compelled to use different mesh

compositions of gillnets during different seasons (Pet et al., 1999).

Introducing and stocking of desirable fish species to reservoirs is commonly practiced

worldwide to improve production though the stocking is not the sole mechanism for

improvement of fishery (Quirõs and Boveri, 1999). FAO (1999) indicated that fish stocking in

Asia and Oceania is practiced for increasing yields, production of food and generation of

income. Stocking can be categorized according to the purpose, which include stocking for

pollution mitigation, for enhancement, for restoration and for creation of new fisheries. For the

purpose of creating new fisheries, a new fish stock is introduced to a river, lake or reservoir,

where the particular fish did not exist earlier due to natural habitat related barriers or

evolutionary reasons. Establishment of new fish species is also done for reasons including, to

increase diversity of species, to fulfill an existing niche gap and to increase fish yield (Cowx,

1999). Success of stocking can be measured by increase in yield, comparison between stocked

and non-stocked waters and increase of income to fishers/stakeholders. Success of a stocking

program may get impacted by factors such as stocking density and ecological carrying capacity

of the receiving environment, age and size of fish at stocking, condition and health of stocked

seed, genetic factors, suitability of habitat, feeds, competitors and predators, timing of stocking

and release methods (Li, 1999; Brown and Day, 2002). The influence of those factor could

differ among species, habitats as well as in time and space (Brown and Day, 2002).

The giant freshwater prawn, Macrobrachium rosenbergii is one of the most economically

important prawn species in the world (New, 2017). Freshwater prawn farming has become a

crucial and growing contributor to global aquaculture both in terms of quantity and value

(FAO, 2017). Capture fisheries in inland waters, culture based fisheries and shrimp farming

are part of inland fisheries in Sri Lanka (Amarasinghe, 2014). With the emerging interest in

aquaculture in Sri Lanka, M. rosenbergii has become a notable species due to its rich taste,

high price and cultivable quantities that make it a suitable candidate for extensive and intensive

culture both in fresh and brackish waters. M. rosenbergii culture in Sri Lanka is limited mainly

due to lack of freshwater prawn seeds which amounted only 60.9 million in 2017 (NAQDA,

2018). Therefore, improved breeding technique and increase in the production of seeds are

essential for increasing freshwater prawn production. As a strategy to improve and expand the

freshwater prawn production, NAQDA has launched free stocking program of M. rosenbergii

in selected perennial and seasonal reservoirs. However, fisheries development was not given

due attention in the Northern Province until recently. In this study, M. rosenbergii was

introduced for the first time in all five selected reservoirs in the Northern Province. Studies

focusing on the performances of introduced species in reservoirs are essential for planning of

reservoir fisheries development and management. Thus, the objective of the present study was

to evaluate and compare performances of introduced M. rosenbergii production in the five

selected perennial reservoirs.

Performance of Macrobrachium rosenbergii in Perennial Reservoirs

71

METHODOLOGY

The study was conducted in five perennial reservoirs (Figure 1) in the Northern Province of

Sri Lanka, viz., Vavunikulam (R1), Muthayankattu (R2), Puthumurippu (R3), Kalmadu (R4)

and Muhathankulam (R5) with areas at full supply level of 1275 ha, 1255 ha, 151 ha, 74 ha

and 211 ha, respectively. Among the five reservoirs, Vavunikulam and Muthayankattu were

categorized as large reservoirs and Puthumurippu, Kalmadu and Muhathankulam were

categorized as small reservoirs for comparison purposes. Fishers are registered under

respective fisheries societies for getting permits for fisheries. The number of registered fishers

of Vavunikulam, Muthayankattu, Puthumurippu, Kalmadu and Muhathankulam are 84, 90, 21,

21, and 65 respectively. The five reservoirs were stocked with exotic tilapia, carp species and

native M. rosenbergii. Performance evaluation and comparison of reservoirs were done based

on M. rosenbergii production along with total fish production and other factors such as socio-

economic, hydro-climatic and anthropogenic factors.

Figure 1. Locations of the selected reservoirs

Field data of the fived reservoirs was gathered on a biweekly basis in the years 2016 and 2017.

The type of data included catch of M. rosenbergii (number and weight of both males and

females), total fish production (number of individuals and weight), number of active fishers

and canoes, type of gear, number of M. rosenbergii post larvae (PL)stocked, stocking time and

their cost and farm-gate price of M. rosenbergii and other fish species. In addition, socio-

economic and other factors affecting the catch of M. rosenbergii was gathered by a

questionnaire survey of 190 fishers and also by observations. Furthermore, recapture rate,

return on investment and contribution of M. rosenbergii to reservoir fisheries on both weight

and economic value basis were calculated for each reservoir. Relationship between the

different parameters, such as yield (kg ha-1 day-1), catch per unit effort (CPUE:

Rajeevan et al.

72

kg/fisherman/day), fishing effort (fishermen km-2), stocking density (PL/ ha) and area at full

supply level (FSL: ha) were determined by regression analyses and Pearson correlations using

Minitab 17 statistical software and MS Excel (MS Office 2016).


Assessment of artisanal fisheries of five perennial reservoirs

A total of 94144 individuals were quantified in the catch between 2016 and 2017, which

comprised of 27 fish species and 2 freshwater prawn species. The larger reservoirs of

Vavunikulam (65.4%) and Muthayankattu (55.8%) were dominated with exotic species, while

Kalmadu (64.34%) and Muhathankulam reservoirs (67%) were dominated with non-stocked

native species and the Puthumurippu reservoir had almost equal amounts of stocked and non-

stocked species (Table 1). However, in all the reservoirs Nile Tilapia (O. niloticus) had the

highest abundance among all the species in the catch. After the introduction and continuous

stocking of M. rosenbergii, the relative abundance of Tilapia, Carp and most of the native

species decreased, while M. rosenbergii increased in catch.

Table 1. Relative abundance of fish and prawn species at selected reservoirs

Species Vavunikulam Muthayankattu Puthumurippu Kalmadu Muhathankulam

2016 2017 2016 2017 2016 2017 2016 2017 2016 2017

Tilapia 64.03 63.68 53.17 52.12 30.1 22.78 19.21 17.15 24.03 21.77

Carp 1.74 1.27 3.23 3.17 13.16 11.25 11.05 11.23 7.7 7.51 Native 32.94 32.47 42.7 42.05 56.74 44.3 66.8 61.88 67.34 66.63

FWP 1.28 2.59 0.91 2.64 - 21.67 2.95 9.74 0.92 4.1

FWP: Machrobrachium rosenbergii

The relationship between Yield (kg ha-1 day-1) and fishing effort was similar across all the

selected five reservoirs (Figure 2).

Figure 2. Relationship between yield and fishing effort of five reservoirs

R1:Vavunikulam, R2:Muthayankattu, R3:Puthumurippu, R4:Kalmadu,

R5:Muhathankulam and All: pooled data for the five reservoirs.

Fishing effort (Fishermen km-2) (R4) Fishing effort (Fishermen km-2) (R5) Fishing effort (Fishermen km-2) (All)

Fishing effort (Fishermen km-2) (R1) Fishing effort (Fishermen km-2) (R2) Fishing effort (Fishermen km-2) (R3)

Yie

ld (

kg/h

a/day)

Yie

ld (

kg/h

a/day)

Yie

ld (

kg/h

a/day)

Yie

ld (

kg/h

a/day)

Yie

ld (

kg/h

a/day)

Yie

ld (

kg/h

a/day)

120

100

80

60

40

20

0

80

70

60

50

40

20

0

30

10

10

8

6

4

2

0

6

5

4

3

2

1

0

14

12

8

6

2

0

4

10

16

40

140

120

80

60

20

0

100

140

160

0.5 1.0 2.5 1.5 2.0 3.0 3.5 4.0 0

0 5 10 25 15 20 30 35 0

0.1 0.2 0.5 0.3 0.4 0.6 0.7 0.8 0.9 0 1 2 5 3 4 6

0.2 0.4 1.0 0.6 0.8 1.2 1.4 1.6 0 1.8 0.5 1 2.5 1.5 2


73

Yield tended to increase linearly with increasing fishing effort. Figure 2 suggests that the

selected reservoirs are subjected to sub-optimal fishing pressure and perhaps represent the

ascending limb of a possible Schaefar-type curve. However, this does not mean that the fishing

effort can be increased indefinitely but indicates that the relationship is valid for ranges in the

yield and effort indicated.

This study revealed that the catch per unit effort (CPUE) for a day increased with the increase

in number of fishermen per unit area in Vavunikulam, Muthayankattu, Muhathankulam

reservoir and decreased with the increase in number of fishermen per unit effort in

Puthumurippu and Kalmadu reservoir (Figure 3). However, when the CPUE per day and unit

fishing effort of the five reservoirs were considered as a whole, CPUE decreased linearly,

though M. rosenbergii catch increased linearly. This indicates that even though in all the

reservoirs fishermen had targeted more on M. rosenbergii, it is still under exploited except for

Vavunikulam and Muhathankulam reservoirs.

Figure 3. Variation of CPUE with the total catch (A) and M. rosenbergii (B) according to

the fishing effort. R1-Vavunikulam, R2-Muthayankattu, R3-Puthumurippu,

R4-Kalmadu, R5-Muhathankulam and All-pooled data for the five reservoirs

M. rosenbergii production in selected perennial reservoirs

Table 2 shows the statistics of production of M. rosenbergii in the five reservoirs. Unit

productions of M. rosenbergii in Vavunikulam, Muthayankattu, Puthumurippu, Kalmadu and

Muhathankulam were 5.3 kg/ha, 3.2 kg/ha, 13.6 kg/ha, 21.8 kg/ha, 12.9 kg/ha, respectively,

representing farm-gate values of 6.84, 4.39, 2.1, 1.59, and 2.85 million Sri Lankan rupees,

respectively. Total weight basis contribution of M. rosenbergii in 2017 was highest in

Puthumurippu (20%) and lowest in Vavunikulam (2.8%) and Muthayankattu (2.3%)

FE (Fishermen/km2) R1 (A) FE (Fishermen/km2) R1 (B) FE (Fishermen/km2) R2 (A) FE (Fishermen/km2) R2 (B)

FE (Fishermen/km2) R3 (A) FE (Fishermen/km2) R3 (B) FE (Fishermen/km2) R4 (A) FE (Fishermen/km2) R4 (B)

FE (Fishermen/km2) R5 (A) FE (Fishermen/km2) R5 (B) FE (Fishermen/km2) All (A) FE (Fishermen/km2) All (B)

CP

UE

(kg/f

ish

erm

en/d

ay)

CP

UE

(k

g/f

ish

erm

en/d

ay)

CP

UE

(kg/f

ish

erm

en/d

ay)

CP

UE

(kg/f

ish

erm

en/d

ay)

CP

UE

(kg/f

ish

erm

en/d

ay)

CP

UE

(kg/f

ish

erm

en/d

ay)

CP

UE

(kg/f

ish

erm

en/d

ay)

CP

UE

(kg/f

ish

erm

en/d

ay)

CP

UE

(kg/f

ish

erm

en/d

ay)

CP

UE

(kg/f

ish

erm

en/d

ay)

CP

UE

(kg/f

ish

erm

en/d

ay)

CP

UE

(kg/f

ish

erm

en/d

ay)

25

20

15

10

5

0

1

0.8

0.6

0.4

0.2

12

10

8

6

4

2

0

20

18

16

14

0.5

0.4

0.3

0.2

0.1

0

14 16

10

8

6

4

2

0

1.0

0.8

0.6

0.4

0.2

0

1.8

1.6

1.4

1.2

10

8

6

4

2

0

12

1.0

0.8

0.6

0.4

0.2

0

1.8

1.6

1.4

1.2

0 1 2 5 3 4 0 1 2 5 3 4

0 2 4 10 6 8 12

0 1 2 5 3 4 6 0 1 2 5 3 4 6 0 5 10 25 15 20 30 0 5 10 25 15 20 30

0 0.5 1 2.5 1.5 2 3 3.5

4

0 0.5 1 2.5 1.5 2 3 3.5 4

7

14 16 0 2 4 10 6 8 12 0 5 10 25 15 20 30 0 5 10 25 15 20 30

1.0

0.8

0.6

0.4

0.2

0

1.8

1.6

1.4

1.2

1.0

0.8

0.6

0.4

0.2

0

25

20

15

10

5

0

8

6

4

2

0

Rajeevan et al.

74

reservoirs, whereas Kalmadu and Muhathankulam recorded a contributions of 9.1% and 8.4%,

respectively. The economic contribution of M. rosenbergii harvest to the total economic value

of fish production in Vavunikulam, Muthayankattu, Puthumurippu, Kalmadu and

Muhathankulam reservoirs was 15.1%, 13.5%, 72.3%, 57.2% and 59.5%, respectively.

Table 2. Summary of M. rosenbergii (FWP) production, stocking density (SD), recapture

rate, return on investment (ROI) and economic contribution in five reservoirs†

Parameter R1 R2 R3 R4 R5

Male FWP (kg/ha) 3.28 2.5 9.99 12.28 8.94

Female FWP (kg/ha) 2.04 0.7 3.65 9.56 3.99

Total FWP (kg/ha) 5.32 3.20 13.64 21.84 12.93

Range (Min-Max) (g) 155-

680

170-

700

115-

635

70-560 65-520

Income (million Rs.) 6.84 4.39 2.1 1.59 2.85

SD (PLs/ ha) 1058.8 597.6 662.3 2702.7 3507.1

Cost (million Rs.) 2.7 1.5 0.2 0.4 1.48

ROI (%) 253.3 292.7 1050 397.5 192.6

Recapture rate 1.73 1.44 6.49 3.74 1.61

Weight % 2.77 2.3 20 9.12 8.43

Economic value % 15.06 13.47 72.28 57.22 59.52 †R1-Vavunikulam, R2-Muthayankattu, R3-Puthumurippu, R4-Kalmadu, R5-Muhathankulam

Market price of a M. rosenbergii PL was Rs. 2 including the transportation cost. The highest

return on investment (ROI) of 1050% was recorded in Puthumurippu with a 6.49% recapture

rate per year. ROI of Kalmadu was 397.5% with a 3.74% recapture rate and the Vavunikulam

and Muthayankattu major reservoirs had almost similar ROI values of 253.3% and 292.7%

with recapture rates of 1.73% and 1.44%, respectively. The lowest ROI of 192.6% was

recorded in Muhathankulam with a recapture rate of 1.61% probably owing to the

characteristic of the catch mostly represent small sized M. rosenbergii, which draws relatively

lower market price. Despite the recorded low recapture rate, due to the comparatively high

market price M. rosenbergii production was beneficial for both the investors and the fishers.

As a result, fishers had become more interested in fisheries without moving away from

fisheries activities to find secondary livelihoods, which was the case before the introduction of

M. rosenbergii to those reservoirs. After the introduction of M. rosenbergii a steady daily

income has been ensured for fishers. The lowest individual weights of M. rosenbergii

recorded in Kalmadu (70 g) and Muhathankulam (65 g) while the highest weights were

recorded in large reservoirs; i.e. Vavunikulam (680 g) and Muthayankattu (700 g).

Pearson correlation coefficient revealed that there was a strong negative (r= -0.9) correlation

between area at full supply level (ha) and yield of freshwater prawn (kg/ha/yr). The regression

relationship of yield (kg/ha/yr) and area at FSL (ha) was Yield = 14.222e-0.001(FSL) (R2 = 0.8).

Thus, the unit yield is higher in small reservoirs than large reservoirs. On the other hand, with

the exclusion of Puthumurippu reservoir, there was a strong positive (r= 0.969) correlation

between stocking density (SD: PLs/ha) and yield (kg/ha). Considering all five reservoirs

together, the relationship of yield (kg/ha) with stocking density (PLs/ha) was Yield = 0.1036

(SD)0.6245 with a (R2 = 0.4). Gear specifications and fishing intensity, reservoir morphology,

catchability and the presence of stumps could be the possible reasons for the low R2 value.

Age and experience of the fisher, catch from the previous day, degree of poverty and livelihood

diversification were the important socio-economic factors that affected the catch of M.


75

rosenbergii. As revealed in the present study, M. rosenbergii was mostly targeted by young

fishers below 40 years of age. Older fishers considered that catching of M. rosenbergii as a

new fishery which is risky as they have no experience. In addition, the amount of catch from

the previous day was the deciding factor for most of the fishers (87%) in choosing the location

for fishing on the following day. If they got a large catch on the previous day, some fishers

choose the same location for fishing on the next day too. Instead, some others go to little

faraway places to catch fish on the next day. Also, the fishers that are poor tend to choose catch

tilapia and carps over M. rosenbergii because M. rosenbergii is required to be caught at the

bottom of the reservoir, which has a risk of catching no fish at all. Therefore, to ensure that

they get some income for their survival, poor fishers choose to fish for tilapia and carps. Also,

fishers who have diversified their livelihoods and mostly who are income secured, choose to

take the risk and invest in the catching of M. rosenbergii. On contrary, poor fishers in

Puthumurippu focused on catching M. rosenbergii because culture based fishery was relatively

new to Puthumurippu compared to the other reservoirs and hence, fisheries production

including Tilapia was comparatively low. Therefore, they focused more on M. rosenbergii due

to its high value.

Hydro-climatic factors that contributed fluctuations in fish catches were low rainfall, strong

winds and high temperature. As evident from the meteorological data and responses of fishers,

rainfall has been significantly low in the reservoir areas in the past five years resulting in low

water levels as considerable amount of water is diverted for irrigation purposes. Fishermen get

benefitted from low water levels of reservoirs in a short run. However, in the long run low

water levels lead to low species diversity in reservoirs due to the combined effects of low water

levels, increased temperature and high fishing intensity. Thus, the reasons for the observation

of fish deaths observed in 2016 in Muthayankattu, Kalmadu and Muhathankulam reservoirs

could be due to the effects of low water level, high temperature, increase in fish biomass and

vegetation, low feed availability and oxygen depletion. Strong winds limit the access to all

areas of the reservoir for fishing and hence, fishers mostly choose areas that are close to the

landing site. Therefore, fishing pressure on those nearby areas was higher than the other areas

of the reservoir. Further, fishermen refrain from applying gear close to areas where there are

tree trumps and vegetation, which is the potential area for M. rosenbergii, in order to avoid

damaging the gear. This practice also has resulted in lower fish production in large reservoirs

during the months with strong winds. Production in the Puthumurippu reservoir was not

significantly affected by strong winds as it was a small reservoir and applying gear was easy.

Gilling, wedging, snagging and entangling are the four methods used for catching fish using a

gillnet (Fonseca et al., 2005). M. rosenbergii is mostly caught in gillnet by entangling mostly

by their claw, rostrum spines and all parts of the body resulted by struggling to escape. Further,

presence of body projections such as, teeth or spines, facilitate significant proportion of prawns

being entangled in gillnets (Sparre and Venema, 1998). Mesh size, hanging ratio, twine

thickness and the colour of twine are the characteristics of gillnets that affect the selectivity

and catch size (Fonseca et al., 2005; Holst et al., 2002; Tweddle and Bodington, 1988). The

significant contribution of M. rosenbergii to the harvest in the selected reservoirs is also partly

due to the change in fishing gear technique. In those reservoirs, gillnets are generally set in

the evening and taken out on the next day morning. Therefore, during the night time deep and

turbid water contribute to low visibility of the net. Red, green or blue colour dyes are applied

in gillnets depending on the reservoirs. Different hanging ratios change the shape of the mesh

and slackness of the net. Since M. rosenbergii has a higher market value than other fish species,

fishers have strategically modified their gear by adding more sinkers with a few floats to reach

the bottom and to reduce stretch due to speedy backward movement of M. rosenbergii when

they touch or sense of strange objects. Usage of modified gillnets in small reservoirs is higher

Rajeevan et al.

76

than large reservoirs. Since Catla, Rohu and tilapia inhabit the surface and column of the

reservoir (Edirisinghe, 2007), the likelihood of catching them is low after the introduction of

M. rosenbergii. Thus, fin-fish had become a bi-catch particularly in the small reservoirs.

The observation of Puthumurippu perennial reservoir was comparable to the observation of a

study conducted in Pak Mun Dam, which is a major reservoir of 4909 ha in Thailand

(Sripatrprasite and Lin, 2003). The average weight of the male M. rosenbergii in Puthumurippu

was 389.0 ± 5.9 g while in the Pak Mun Dam reservoir average weight of the M. rosenbergii

harvested during the one-year study period was 236.5 ± 102.1g. In terms of M. rosenbergii

production, stocking of 2 million M. rosenbergii PL resulted in a production of 3 kg/ha/yr in

the Pak Mun Dam reservoir (Sripatrprasite and Lin, 2003). When the stocking was increased

to 40 million PLs, the production reached up to11.5 kg/ha/yr (Jutagate and Kwangkhang,

2015). In the present study, Vavunikulam and Muthayankattu reservoirs had a yield of 2.66

kg/ha/yr and 1.6 kg/ha/yr respectively, while Puthumurippu and Kalmadu reservoirs had

higher yields of 13.64 kg/ha/yr and 14.56 kg/ha/yr followed by Muhathankulam with a yield

of 7.76 kg/ha/yr.

Asoka et al. (2015) reported that in Sri Lankan reservoirs, the highest and the lowest mean

annual yield of freshwater prawn were from minor perennial and major perennial reservoirs,

with a yields of 41.3 kg/ha and 3.4 kg/ha stocking densities of 2062 PL/ha and 222 PL/ha

representing yield contributions of 3% and 1.6%, respectively. Despite the difference in yield

both major and minor perennial reservoirs contributed significantly to the income of the

fishers. The recapture rate of stocked fish is generally high with an average of over 10%, and

could be as high as 50% in communal ponds and swamps, whereas the recapture rate of the M.

rosenbergii is generally poor and less than 5 % (Jutagate and Rattanachai, 2010). The highest

recapture rate of about 10 % for M. rosenbergii was recorded in a natural lake, Beung Borapet

in Thailand, which had been stocked in 1995 with 3 million PLs (Jutagate and Kwangkhang,

2015). Similarly, in the present study Puthumurippu recorded a recapture rate of 6.49%. The

recapture rate in large reservoirs is comparatively lower than small reservoirs. Pak Mun Dam

major reservoir showed a lower recapture of 1% (Sripatrprasite and Lin, 2003). Similarly, in

the present study large reservoirs of Vavunikulam (1.73%) and Muthayankattu (1.44%)

showed a slightly higher recapture rate.

The economic benefit from M. rosenbergii was higher than any other stocked fish species in

the reservoirs. Sripatrprasite and Lin (2003) reported that catches of prawn contributed 53.8%

to the total fish catch by weight and 97% to the economic value of the landings in the Pak Mun

Dam Reservoir. A five-year monitoring program undertaken by Chumnongsittsthum (1987)

revealed that the profit of stocked M. rosenbergii in Ubolratana reservoir was 382 %. Jutagate

and Kwangkhang (2015) reported a 722% profit only with a recapture rate of 1.8 % of M.

rosenbergii in Bangphra reservoir. The high economic return reflects the high market demand

of M. rosenbergii and there is a large difference between the cost of production of seed and

market price of the adult freshwater prawns. In the present study, the cost of a M. rosenbergii

PL was Rs. 2.00, which was equivalent to the price of a fingerling of major carps or GIFT

tilapia. The farm-gate prices of the stocked carps and tilapia ranged between Rs. 120-200 /kg,

whereas the market price of M. rosenbergii ranged from Rs. 700-1200 /kg. Stocked M.

rosenbergii, therefore, benefits traders at various levels in the market chain and provides

employment opportunities and income for all related sectors (Jutagate and Kwangkhang,

2015). Similar experiences of introducing M. rosenbergii has also been recorded in Kerala,

India where it contributed to development of fisheries in reservoirs (Laxmappa and Krishna,

2015). Thus, stocking programs of M. rosenbergii could successfully contribute to the

improvement of fisheries in the five selected reservoirs.


77

CONCLUSIONS

The introduction of M. rosenbergii as culture-based fisheries in the selected five reservoirs has

achieved considerable success, especially in terms of economic benefits. Even though the

recapture rate was low, catching of M. rosenbergii improved the livelihood of fishers while

increasing their interest in fisheries. Size of the reservoir, stocking density, fishing intensity

and gear specification, rainfall, wind and socio-economic factors significantly influenced the

catch of M. rosenbergii in the selected reservoirs. Further investigations on yield, growth rate,

and factors affecting the growth of M. rosenbergii in reservoirs in Northern Province over time

need to be carried out to improve culture based fisheries to utilize the reservoirs in a sustainable

manner and to improve livelihoods of fisher families. Findings of the present study would be

useful to aqua-culturists and fisheries managers for the establishment of culture-based fisheries

in reservoirs using M. rosenbergii under extensive culture.

ACKNOLEDGEMENT

The authors would like to thank the fishermen who cooperated in conducting this study, the

staffs of NAQDA Regional Office, Northern Province and Divron Bioventures (Pvt.) Ltd.,

who shared data and lent logistic support.

REFERENCES

Amarasinghe, U., Duncan, A., Moreau, J., Schiemer, F., Simon, D. and Vijverberg, J. (2001).

Promotion of sustainable capture fisheries and aquaculture in Asian reservoirs and lakes.

Hydrobiologia. 458, 181-190.

Amarasinghe, U. (2014). Fisheries resources in alleviation of hunger and malnutrition in Sri

Lanka - accomplishment and challenges. Sri Lanka Journal of Aquatic Science. 18,1–15.

Asoka, J.M., Chandraratne, P.N. and Amarasinghe, U.S. (2015). Production performance of

Macrobrachium rosenbergii in culture based fisheries in perennial reservoirs. Proceedings of

the Twenty-first Scientific Sessions of the Sri Lanka Association for Fisheries and Aquatic

Resources. Auditorium of National Aquatic Resources Research and Development Agency,

Colombo 15, Sri Lanka.

Brown, C. and Day, R.L. (2002). The future of stock enhancements: lessons for hatchery

practice from conservation biology. Fish and Fisheries, 3(2),79–94.

Chumnongsittsthum, B., (1987). Stocking of giant freshwater prawn, Macrobrachium

rosenbergii in Ubolratana Reservoir during 1981-1986. Proceedings of the seminar on

fisheries 1987 of the Department of Fisheries, Department of Fisheries, Bangkok, pp. 279 –

285.

Cowx, I.G. (1999). An appraisal of stocking strategies in the light of developing country

constraints. Fisheries Management and Ecology, 6,21-34.

Craig, J.F., Sharma, A. and Smiley, K. (1985). The variability in catches from multi-mesh

gillnets fished in three Canadian lakes. Journal of Fish Biology 28,671-688.

Rajeevan et al.

78

De Silva, S.S. (1988). Reservoirs of Sri Lanka and their fisheries. FAO Fisheries Technical

Paper 298, 128.

De Silva, S.S. (1996). The Asian inland fishery with special reference to reservoir fisheries: A

reappraisal. Pp. 321– 332. In: Schiemer F., Boland K.T. (eds.) Perspectives in tropical

limnology. SPB Academic Publishing, Amsterdam, the Netherlands.

Edirisinghe, U. (2007). Freshwater Capture Fisheries and Aquaculture of Sri Lanka. Anura

Press, Kurunegala, Sri Lanka.

FAO. (1999). Review of the state of world fishery resources: Inland fisheries. FAO Fish. Circ.

No. 942. Rome, FAO. 54 pp.

FAO. (2017). FAO Aquaculture Newsletter. No. 56 (April). Rome.

Fonseca, P., Martins, R., Campos, A. and Sobral, P. (2005). Gill-net selectivity off the

Portuguese western coast. Fisheries Research 73 (3),323–339.

Gray, C.A., Broadhurst, M.K. Johnson, D.D. and Young, D.J. (2005). Influences of hanging

ratio, fishing height, twine diameter and material of bottom-set gillnets on catches of dusky

flathead Platycephalus fuscus and non-target species in New South Wales, Australia. Fisheries

Science 71,1217–1228.

Jutagate, T. and Kwangkhang, W. (2015). Culture-based fishery of giant freshwater prawn:

Experiences from Thailand. In: Sena S. De Silva, B.A. Ingram and S. Wilkinson (eds.),

Perspectives on culture-based fisheries developments in Asia, pp. 91-97. Network of

Aquaculture Centers in Asia-Pacific, Bangkok, Thailand.

Jutagate, T., and Rattanachai, A. (2010). Inland fisheries resource enhancement and

conservation in Thailand. RAP Publication 2010/22, pp. 133–150. Regional Office for Asia

and the Pacific, FAO, Bangkok.

Holst, R., Wileman, D., and Madsen, N. (2002). The effects of twine thickness on the size

selectivity and fishing power of Baltic cod gill nets. Fisheries Research 56 (3), 303-312.

Laxmappa, B. and Krishna, S.M. (2015). Polyculture of the freshwater prawn Macrobrachium

malcolmsonii (H.M. Edwards) in Koilsagar reservoir of Mahabubnagar district (TS), India.

International J. Fish. & Aqua. Stud. 2(4), 147-152.

Li, J. (1999). An appraisal of factors constraining the success of fish stock enhancement

programmes. Fisheries Management & Ecology, 6(2), 161–169.

NAQDA, (2018). NAQDA website, Retrieved 14th of April 2018.

(http://www.naqda.gov.lk/statistics)

New, M.B. (2017). Update on global farmed freshwater prawn production statistics. In: Giant

prawn conference 2017; Thailand. (March), 1–12.

Pet, J.S., van Densen, W.L.T., and Vijverberg, J. (1999). Management options for the

exploitation of introduced tilapia and small indigenous cyprinids in Sri Lankan reservoirs. In:

Fish and fisheries of lakes and reservoirs in Southeast Asia and Africa (ed. W.L.T. van Densen

and M.J. Morris), pp. 159-185. Westbury Publishing, Otley.


79

Quirós, R. and Boveri, M.B. (1999). Fish effects on reservoir tropical relationships. Pp. 529

546. In: Tundisi, J. G. and M. Straškraba. (Eds.). Theoretical reservoir ecology and its

applications. São Carlos, International Institute of Ecology.

Sparre, P., and Venema, S.C. (1998). Introduction to tropical fish stock assessment. Part 1.

Manual. FAO Fisheries Technical Paper No. 306.1: Rev. 2. FAO, Rome.

Sripatrprasite, P. and Lin, C. (2003). Stocking and recapture of freshwater prawn

(Macrobrachium rosenbergii De Man) in a run-of-river type dam (Pak Mun Dam) in Thailand.

Asian Fish. Sci. 16, 167-174

Tweddle, D., and Bodington, P. (1988). A comparison of the effectiveness of black and white

gillnets in Lake Malawi, Africa. Fisheries Research 6 (3), 257–269.

Welcomme, R.L. (2001). Inland fisheries: Ecology and management. FAO Rome and Fishing

News Books, Blackwell Science, Oxford, UK.


80

Tropical Agricultural Research Vol. 30 (3): 81–88 (2018)

Short Communication

Effect of Seaweed Extract (Kappaphycus alvarezii) on the Growth, Yield

and Nutrient uptake of Leafy Vegetable Amaranthus polygamous

S. Senthuran*, B.L.W.K. Balasooriya1, S.J. Arasakesary 23and N. Gnanavelrajah3



Sri Lanka

ABSTRACT: A greenhouse study was conducted during the dry (March to April) season of

2018 at the District Agriculture Training Center (DATC), Thirunelvely, Jaffna, Sri Lanka to

study the effect of seaweed (Kappaphycus alvarezii) extracts (SWE) as foliar spray at the rates

of 5.0% and 10.0% (v/v) on growth and yield of common leafy vegetable crop Amaranthus

polygamous. The study was conducted as a three factor factorial with two levels of fertilizers

(100% and 50% recommended chemical fertilizer dose (CF)) and two sources of irrigation

water with different salinity levels collected from Thirunelvely (high salinity water, EC = 1

500 µS/cm) and Moolai (very high salinity water, EC = 12200 µS/cm). At the harvesting stage,

highest plant height was observed with 100% chemical fertilizer and Thirunelvely water.

However comparable plant growth was found with 50% chemical fertilizers when

supplemented with 10% (v/v) SWE. In addition, number of leaves per plant, fresh weight of

leaves, stem and whole plant (28.6 g) as well were highest in T2 (100% CF + Thirunelvely

water). Replacement of 50% of fertilizer with SWE and Thirunelvely water yielded

significantly comparable fresh plant weight (22.8 g), while addition of Moolai water resulted

in poor yield (20.1 g) even with addition of 10% SWE. Leaf N, P, K and Na content further

confirmed the effect of SWE on plant at harvesting stage. There was no significant difference

in the percentage of N in leaves between chemical fertilizer alone and foliar application of

SWE combined with 50% CF. In all treatments, which has received Moolai water contained

significantly the highest Na concentration in Amaranthus leaves. The study indicates that

foliar application of 10% (v/v) seaweed extract combined with 50% of recommended chemical

fertilizer dose and irrigation with Thirunelvely water (at 1 500µS/cm) could be an effective

alternative for sustainable cultivation of Amaranthus polygamous.

Keywords: Amaranthus polygamous, salinity, seaweed extract, Kappaphycus alvarezii

INTRODUCTION

The agricultural sector will continue to play a vital role in developing and implementing

strategies targeted towards a planned socio-economic development in Sri Lanka. Salinity is

the one of the major problems faced by agricultural areas, which decreases the crop production

drastically. In Sri Lanka, 22 300 ha (about 3% of the Island) of salt affected lands are found in

dry zone (Subasinghe, 2004). Due to rapidly growing population, there is a considerable

1 Department of Biotechnology, Faculty of Agriculture and Plantation Management, Wayamba University of Sri

Lanka 2 Regional Agricultural Research & Development Centre, Kilinochchi, Sri Lanka 3 Department of Agricultural Chemistry, Faculty of Agriculture, University of Jaffna, Sri Lanka


Senthuran et al.

82

pressure on limited good quality water resources. So it needs to consider the use of poor quality

water in crop irrigation for more efficient and sustainable agricultural production systems to

feed these growing populations. On the other hand, agriculture sector in the country is

threatened due to excessive use of synthetic agro-chemicals. For example, WHO-UN report in

December 2013 identified that Sri Lanka as the highest per hectare user of pesticides and the

eighth highest user of chemical fertilizers in the world. Therefore, it is very important to focus

on approaches for using naturally available renewable resources of plant nutrients

as alternatives to chemical fertilizers. Research attempts have been largely made to increase

soil fertility and crop productivity via organic farming (Roy chowdhury et al., 2013). Seaweed

extracts is known as a bio stimulant and organic fertilizer, which contain plant growth

promoters/regulators, hormones, macronutrients and micronutrients which promote faster seed

germination and a higher yield (Sasikala et al., 2016). Kappaphycus alvarezii is edible red

seaweed which is one of the largest tropical algae with relatively higher growth rate.

On this background, a pot experiment was conducted to study the effect of K.

alvarezii seaweed extract applied as a foliar spray at 5% and 10% concentration combined

with 100% and 50% recommended chemical fertilizer dose (CF) on growth of Amaranthus

polygamous which is a widely grown leafy vegetable crop.

METHODOLOGY

Preparation of Sea Weed Extract (SWE)

The seaweed extract used in this study was obtained from marine red alga Kappaphycus

alvarezii. The marine alga K. alvarezii was collected from coastal area of Jaffna (9° 77' 60.41"

N latitude, 79° 91' 22.35" E longitude), Sri Lanka during March 2018. The fresh K. alvarezii

alga were brought to the laboratory and washed thoroughly in tap water for 3 or 4 times. Then

the fresh K. alvarezii were homogenized by grinding using an electrical grinder, filtered

(Eswaran et al., 2005) and stored at 4˚С for further use. The filtrate (100% concentration) was

used as the stock solution for preparation of 5.0 % and 10.0% (volume/volume; v/v) SWE by

mixing appropriate volumes of distilled water.

Greenhouse experiment

The greenhouse pot experiment was conducted at the DATC, Thirunelvely, Jaffna, Sri Lanka

(9° 69' 61.76" N latitude, 80° 03' 20.54" E longitude). The soil of the site is characterized as

Calcic red latosols and some important soil characteristics are given in Table 1. The pot

experiment was designed with 10 treatments arranged in a completely

randomized design (CRD). The treatments are given in Table 2 and details about inorganic

fertilizer application are given in Table 3. Each treatment was replicated 3 times. Pots (cross

sectional area of 452.16 cm2 and heights of 20 cm) were filled with soil with 1.5 g/cm3 bulk

density and basal fertilizer was added according to the fertilizer treatments. Six seeds of A.

polygamous were planted per pot at 3–5 cm distance. During the growing period, 10 ml of

each SWE (5% and 10%) was applied as foliar sprays at three times, first at 7 days (seedling

stage), second at 14 days and third at 24 days after sowing.

For irrigation, two types of water sources were selected from Thirunelvely and Moolai areas

in Jaffna. Based on salinity hazard to crop (Wilcox, 1955), Moolai water (12 200 µS/cm) was

belonged to the hazard class unsuitable water (> 2,250 μS/cm), while Thirunelvely water (1

Effect of Seaweed Extract on Amaranthus polygamous

83

500µS/cm) belonged to doubtful water (750-2,250 μS/cm). As control, distilled water was used

and the irrigation was carried at 3 days intervals.

Table 1. Soil characteristics at the study site, Thirunelvely, Jaffna, Sri Lanka

Soil characteristic Average value

pH (1:5/ soil: water) 7.24±0.06

EC (μS/cm) 98.50±6.76

Available N (mg/100g) 6.30±0.48

Available P (kg/ha) 74.40±7.01

Available K (kg/ha) 376.80±28.45

Organic matter (%) 0.48±0.0007

Table 2. Treatment panel used in the greenhouse study

Treatment

T1 100%CF + D water

T2 100%CF + T water

T3 100%CF + M water

T4 50%CF + 5% SWE +D water

T5 50% CF + 10% SWE + D water

T6 50% CF + 5% SWE + T water

T7 50% CF + 10% SWE + T water

T8 50% CF + 5% SWE + M water

T9 50% CF + 10% SWE + M water

T10 Only soil + D water (CF-Chemical Fertilizer as Department of Agriculture Recommendation, SWE-Sea Weed Extract, T – Thirunelvely, M - Moolai, D – Distilled)

A. polygamous from each pot were harvested once it reached marketable size at 30 days after

sowing (DAS). Measurements and analysis namely, plant height, total number of leaves per

plant, diameter of main stem, root length, fresh weight of leaves, stem and roots, dry weight

of leaves, stem and roots, nitrogen percentage in leaves (total N was determined by semi-micro

Kjeldahl method), Phosphorous percentage in leaves (by vanado-molybdate yellow spectro-

photometric method at the wave length of 450 nm : Jackson, 1973), Potassium percentage in

leaves (by flame photometer : Jackson, 1973) and Sodium percentage in leaves (by flame

photometer : Jackson, 1973) were performed.

Table 3. Fertilizer recommendation for Amaranthus by Department of Agriculture

Fertilizer type Basal 1st top dressing (14 DAE)

Urea [CO(NH2)2] 85 kg/ha 85 kg /ha

Triple superphosphate

[Ca(H2PO4)2•H2O]

130 kg/ha -

Muriate of Potash [KCl] 100 kg/ha -

(DOA=Department of Agriculture, Sri Lanka, DAE=Days after emergence)

Senthuran et al.

84


Data were analyzed by SAS (9.1) package and the mean separation were done by Duncan

multiple range test at p=0.05.


Effect of SWE and quality of irrigation water on plant growth

Plant height in each treatment increased from 18 DAP to harvesting at 30 DAP (Table 4). At

the harvesting stage, plant height was the highest in T2 followed by T1, however it was not

significantly different from T7 and T5. Therefore 10% SWE and 50% CF with Thirunelvely

water have given comparable results with 100% CF with respect to plant height. It can be due

to the presence of growth promoting hormones and nutrients in seaweed extract (Sasikala et

al., 2016). However, irrigation with Moolai water has resulted significantly lower plant height

with 100% CF or with addition of SWE. This can be due the high salinity (12200µS/cm) of

Moolai water. Salinity decreases the cell division, elongation and meristemic activity (Ruf, et

al., 1963). In the case of unsuitable water application (Moolai at 12 200 µS/cm), spraying 10%

of SWE enhanced the plant height as compared to 100% of CF. It’s obvious that addition of

foliar application (10%) of SWE reduced the salt stress on Amaranthus crop and increased the

growth of the plant under very high saline water application.

Effect on yield parameters

Yield parameters at harvesting are given in the Table 5. Maximum values for fresh weight of

leaves, fresh weight of stem and fresh weight of whole plant were recorded in T2 (100 %CF +

Thirunelvely water). In addition, highest dry weights of leaves, roots and whole plant were

observed in T2. Replacement of 50% fertilizer with SWE with Thirunelvely water (T7-50%

CF + 10% SWE + Thirunelvely water) has yielded second highest fresh plant weight, while

addition of Moolai water resulted poor yield irrespective of addition of SWE. El-Yazied et al.

(2012) also reported that fresh and dry weights of leaf and Stem per plant of Snap bean were

significantly increased by foliar application of seaweed extract at higher rate (750 ppm).

Nutrient uptake

Figures 1a to 1d illustrate the effects of K. alvarezii seaweed SWE with or without CF and

irrigated using Thirunelvely water and Moolai water compared with control. Nitrogen is the

key element required for crop growth in combination with Phosphorus and Potassium. K.

alvarezii seaweed extract contain high in macro (N: 0.45-0.70%, P: 0.007-0.010%, K: 1.60-

2.10%) and micro elements for plant growth (Zodape, et al., 2009). It was found that there was

no significant difference in the percentage of N in leaves among 100% CF alone and foliar

application of SWE combined with 50%CF treatment, due to the availability of nitrogen in K.

alvarezii seaweed extract. In the case of P% and K% in leaves, foliar application of SWE

(10%) combined with 50% CF treatments resulted higher values, compared to that in 100%

CF alone under all both types of irrigation water and control with distilled water. The reason

may be that K. alvarezii extract which was applied 3 times contains readily available forms of

P and K. Alam et al. (2013) also confirmed that seaweed extract provides a readily available

source of nutrients and organic compounds. Pramanick et al. (2013) reported that foliar sprays

of 7.5% Kappaphycus SWE with 50% recommended dose of basal CF gave the higher P and


85

K in grains of green gram compared with that of 100% of recommended dose of CF alone. K.

alvarezii extract is rich in potassium and found to affect on the regulation of stomata pore size

and protein synthesis (Karthikeyan and Shanmugam, 2016).

Table 4. Effect of K. alvarezii SWE on the plant heights of A. polygamous on 18th to 30th

day after sowing (DAS)

18th DAS

(cm)

21th DAS

(cm)

24th DAS

(cm)

27th DAS

(cm)

30th DAS

(cm)

T1

19.0±1.32 ab

29.0±5.07 ab

34.3±3.75 a

39.0 ±3.61ab

44.3 ±2.08ab

T2 21.0±1.00 a 30.0±2.59 a 35.0±2.64 a 41.3±4.72a 46.3 ±3.40a

T3 11.0±0.50e 14.7±1.60 cd 18.7±0.76 c 22.7±0.57c 27.7 ±0.76d

T4 17.7±0.76 bc 24.5±2.50 b 28.2±3.01b 33.7±1.52 b 37.3±2.51c

T5 19.3±1.60 ab 26.2±1.89 ab 31.7±2.46 ab 36.2 ±3.25 ab 42.3 ±4.61abc

T6 18.7±1.89 ab 26.5±2.59ab 30.2±2.02ab 35.0±4.58 b 38.7±6.33 bc

T7 19.7±2.02 ab 26.8±3.78 ab 33.7±5.13 a 38.2 ±4.31ab 44.2±3.68 ab

T8 12.0±2.78 e 12.8±0.57 d 18.5±3.61 c 21.7±3.51 c 24.3±3.05 d

T9 12.7±1.25 de 17.8±0.76 c 21.2±2.08 c 24.8±1.61 c 29.0±1.73 d

T10 15.0±1.50 cd 18.3±1.44 c 21.0 ±1.73c 23.3 ±2.52c 24.7±2.08 d

Values are means of triplicates with ± SD. Different letters in a single column show statistically significant differences

at P <0.05.

Table.5. Effect of K. alvarezii SWE on the yield contributing characters of

A.polygamous on 30th day after sowing

Fresh

weight of

leaves

(g)/plant

Fresh weight

of stem(g)

/ plant

Fresh

weight of

root(g)

/ plant

Fresh weight

of plant (g)

Dry weight

of plant(g)

T1

9.3±3.46ab

12.1 ±1.69bcd

1.94±0.30bc

23.3±4.97abc

3.25±0.66ab

T2 10.7±1.89a 15.4 ±0.88a 2.59±0.19a 28.6 ±1.23 a 4.07±0.28a

T3 8.8±1.18abc 7.5±1.34ef 1.65±0.31c 17.9 ±2.57 cde 2.14 ±0.47cd

T4 6.4±0.91bc 9.1±1.38ed 1.72±0.41bc 17.3 ±2.16 de 3.04 ±0.39abc

T5 8.7±1.68abc 11.9 ±2.35bcd 2.27±0.18ab 22.9 ±3.73 abcd 3.84±0.61a

T6 8.3±1.87abc 12.7 ±1.61abc 1.78±0.39bc 22.8±3.57abcd 3.92±0.73a

T7 9.1±0.47ab 13.3 ±2.30ab 2.03±0.29bc 24.5 ±2.20 ab 3.90 ±0.69a

T8 5.6 ±1.14dc 5.5±1.04gf 1.62±0.45c 12.7±1.50ef 1.98±0.49cd

T9 8.6±2.42abc 9.6 ±2.64cde 1.84±0.23bc 20.1 ±5.02 bcd 2.73 ±0.85bc

Values are means of triplicates with ± SD. Different letters in a single column show statistically significant differences

at P <0.05.

Senthuran et al.

86

Figure1. Effects of K. alvarezii seaweed extracts (SWE) on (a) nitrogen (N), (b) phosphorous (P),

(c) potassium (K) and (d) sodium (Na) percentage in leaves of A. polygamous plants

growing under different treatments. The columns marked with same lowercase letters do

not differ significantly (p>0. 05). Error bars represent standard error (n=3).

In all treatments which have received Moolai water (T3, T8 and T9), significantly highest

sodium content in leaves was observed. Observed sodium content in leaves was mostly

opposite to the percentage of potassium in leaves. Na+ has adverse effects on K+ nutrition

results a competition between uptake of Na+ and K+ by plant roots. In agreement, De Lacerda

et al. (2003) reported that salt stress leads to accumulation of Na+ and reduction of K+ content

in leaves. SWE applied with 50% CF treatments showed higher Na percentage than that of

(a)

(b)

(c)

(d)


87

100% CF alone, which can be due to the higher sodium levels in marine algae. Marine alga of

K. alvarezii extract reported to contain sodium at the rate of 0.45- 0.7 % (Eswaran et al, 2005).

CONCLUSIONS

At the harvesting stage, highest plant height was observed with 100% Chemical fertilizer and

Thirunelvely water. However comparable plant growth was found with 50% CF when

supplemented with 10% (v/v) sea weed extract. In addition, number of leaves per plant, fresh

weight of leaves, stem and whole plant (28.6 g) as well were highest in T2 (100%CF +

Thirunelvely water). Replacement of 50% of fertilizer with 10% SWE and Thirunelvely water

yielded significantly comparable fresh plant weight (24.5 g) with T2 treatment (28.6). Leaf N,

P, K and Na content in leaves further confirmed the effect of SWE on plant growth. There was

no significant difference in the percentage of N in leaves between chemical fertilizer alone and

foliar application of SWE combined with 50% CF. In the case of P and Kin leaves, foliar

application of SWE (10%) combined with 50% CF treatments resulted higher values compared

to that in chemical fertilizer alone. In contrast, all treatments which have received unsuitable

MOOLAI water indicated significantly highest sodium content in Amaranthus. It is evident

that foliar application of 10% (v/v) seaweed extract combined with reduced recommended

chemical fertilizer doses (50%) with comparatively less saline water could be an effective

alternative for sustainable cultivation of Amaranthus polygamous.

REFERENCES

Alam, M. Z., Braun, G., Norrie, J. and Hodges, D. M. (2013). Effect of Ascophyllum extract

application on plant growth, fruit yield and soil microbial communities of strawberry. Can. J.

Plant Sci., 93(1), 23-36.

De Lacerda, C. F., Cambraia, J., Oliva, M. A., Ruiz, H. A. and Prisco, J. T. (2003). Solute

accumulation and distribution during shoot and leaf development in two sorghum genotypes

under salt stress. Environ. Exp. Bot., 49(2), 107-120.

El-Yazied, A., El-Gizawy, A. M., Ragab, M. I. and Hamed, E. S. (2012). Effect of seaweed

extract and compost treatments on growth, yield and quality of snap bean. J. Am. Sci., 8(6), 1-

20.

Eswaran, K., Ghosh, P. K., Siddhanta, A. K., Patolia, J. S., Periasamy, C., Mehta, A. S., Mody,

K. H., Ramavat, B. K., Prasad, K., Rajyaguru, M. R., Reddy, S. K. C. R., Pandya, J. B. and

Tewari, A. (2005). Integrated method for production of carrageenan and liquid seaweed

fertilizer from fresh seaweeds, U S Pat 6893479, 2005.

Jackson, M.L. (1973). Soil Chemical Analysis. Prentice Hall of India Pvt. Ltd. New Delhi.

Karthikeyan, K. and Shanmugam, M. (2016). Bio-stimulant of seaweed source as an organic

alimentative to Bellary onion: Bulb yield and Pyruvic acid levels. Am. J. Agri. Res., 1(2), 1-9

Pramanick, B., Brahmachari, K. and Ghosh, A. (2013). Effect of seaweed saps on growth and

yield improvement of green gram. Afr. J. Agric. Res., 8(13), 1180-1186.

Senthuran et al.

88

Ruf, R. H., Eckert, R. E. and Gifford, R. O. (1963). Osmotic adjustment of cell sap to increases

in root medium osmotic stress. Soil Sci., 96(5), 326-330.

Sasikala, M., Indumathi, E., Radhika, S. and Sasireka, R. (2016). Effect of Seaweed Extract

(Sargassumtenerrimum) on Seed Germination and growth of Tomato Plant. Int. J. Chemtech.

Res., 9(9), 285-293.

Zodape, S.T. (2001). Seaweeds as a biofertilizer. J. Sci. Ind. Res., 60(8), 378-382.


Short Communication

Mineral Contents of Sri Lankan Rice Varieties as Affected by Inorganic

Fertilization

H.M.A.J. Herath, G.A.P. Chandrasekara1*, U. Pulenthiraj1, C.M.N.R. Chandrasekara23

and D.G.N.G. Wijesinghe3



Sri Lanka

ABSTRACT: Application of inorganic fertilizers may incorporate minerals into rice grains.

Distribution of minerals in rice grains vary in bran and kernel. The aim of the present study

was to compare mineral contents (MCs) of bran and kernels of selected newly improved rice

varieties in Sri Lanka with and without fertilizers. Twenty rice varieties were tested. Rice bran

and rice kernels were analyzed for Ca, Mg, Mn and Zn using Atomic Absorption

Spectrophotometer. Calcium contents of brans and kernels ranged from 952 to 1605 mg/kg

and 613 to 1107 mg/kg dry matter in fertilized varieties, respectively. High MCs were observed

in fertilizer applied varieties. Higher MCs were found in the bran of rice grains. The MCs of

rice grains were significantly different among the varieties and affected by fertilizer

application and processing. Applications of inorganic fertilizers strengthened the MCs of rice

kernels and bran.

Keywords: Bran, fertilizer, kernel, mineral contents, rice

INTRODUCTION

Cereals are the edible grains of Gramineae family. There are a variety of cereals including

rice, wheat, rye, oats, barley, maize, millet and sorghum. Rice is the staple food for more than

half of the worlds’ population being the second most leading cereal next to wheat

worldwide(Anjum et al., 2007). Rice grain provides 75-80% of starch, 12% water, 7% of

protein, fats, B vitamins mainly thiamine, riboflavin and niacin and minerals such as calcium,

magnesium, phosphorus, manganese, copper, and iron (Oko et al., 2012). The prominent

cultivating species of rice in Sri Lanka is Oryza sativa.

Minerals are essential nutrients for human growth and development. They play a vital role in

the effective functioning of the human systems. Ca and Mg are known as major minerals which

require >100mg/day for the body functions and Zn and Mn are known as trace minerals which

require <100mg/day. One of the major reasons for the loss of essential micronutrients from

rice is the high polishing rate (Abbas et al., 2011).

1 Department of Applied Nutrition, Wayamba University of Sri Lanka, Sri Lanka 2 Department of Agriculture, Sri Lanka School of Agriculture, Kundasale, Sri Lanka 3 Department of Food Science and Technology, Faculty of Agriculture, University of Peradeniya, Sri Lanka


Herath et al.

90

Department of Agriculture has introduced newly developed rice varieties having higher yield

potential, pest and disease resistance, response to fertilizers and better grain quality. The

growing environment has a great influence on the composition of the rice grain. (Abbas et al.,

2011). Urea, Triple Super Phosphate and Muriate of potash are the three key chemical

fertilizers used in Sri Lanka (Ekanayake, 2009). These chemical fertilizers commonly consist

of three major components, namely as nitrogen, phosphorus and potassium. The aim of the

current study was to determine the impact of the application of fertilizers on the mineral

contents of bran and kernel fractions of newly improved rice varieties in Sri Lanka.

METHODOLOGY

Sample preparation

Random sampling method was used to obtain the rice grain samples from rice fields in the

Rice Research and Development Institute in Bathalagoda, Rice Research Station. Twenty

inorganic fertilized (Urea, Mureate of Pottash and Triple super Phosphate in 225 : 60 : 55

kg/ha, respectively) and non-fertilized Sri Lankan rice varieties, At 353, At 362, At 303, H4,

Bw 276 - 6B, Ld 368, Bg 450, Bg 400 - 1, Bg 360, Bg 94 - 1, Bg 379 - 2, Bg 300, Bg 305, Bg

357, Bw 367, Bw 451, Ld 371, At 306, At 309 and At 405were obtained. Three representative

samples from each variety were obtained. Rice samples were dehusked using a rice milling

machine (Rice machine, Satake Engineering Co Ltd, Japan). The whole grains were polished

(up to 90%) with a rice miller (Rice husker and polisher PM 500, Satake Engineering Co Ltd,

Japan). Milling and polishing processes were performed at the Institute of Postharvest

Technology of Sri Lanka, Anuradhapura. Rice grains and bran were separately collected.

Polished raw rice grains were finely ground using a grinder (Phillips HR 2011, Koninklijke

Phillips Electronics N.V., China). The ground samples were passed through a sieve with the

mesh size of 1 mm. Rice grains and counterpart bran samples were oven dried at 105ºC for

constant weight to remove moisture. All the samples were stored in freezer (DW-86L626

Haier, U.K.) at -80ºC until further analysis.

Determination of mineral contents

A 0.5 g sample was measured into microwave digestion vessel using a top loading balance

(AdventurerTM OHAUS, U.S.A.) followed by addition of 2 ml of concentrated HCl (35%) and

2 ml of concentrated HNO3(69%).The mixture was allowed for predigesting and digested for

one hour using microwave digestion system (MARS 6 One touch technology CEM

Corporation, North Carolina). The digested samples were filtered and volume up to 50 ml

using deionized water. Mineral contents were determined using atomic absorption

spectrophotometry. A series of standards for selected minerals were prepared from the

standard stock solutions (1000 mg/l) of corresponding minerals as 1 mg/l, 2 mg/land 3 mg/l.

The mineral contents of the standards and the samples were measured using atomic absorption

spectrophotometer (iCETM 3000 series Thermo Scientific, USA). The mineral contents were

calculated on drymatter basis. All the samples were analyzed in triplicates.


The differences of mean values among kernels and brans of fertilized and non fertilized

treatments were determined using multivariate analysis of variance (MANOVA) followed by

Tukey’s Honestly Significant Differences (HSD) multiple rank test at p ≤ 0.05 significance

level. SPSS version (16.0) was used for the statistical analysis.

Inorganic Fertilization and Mineral Contents of Sri Lankan Rice Varieties

91


Tables 1 to 3 present Ca, Mg, Zn and Mn contents of rice varieties constituted of red and white

pericarps. In general, higher Ca, Mg, Zn and Mn contents were observed in bran than the kernel

for all rice varieties with red pericarp (Table 1). Further, it was noted that Ca, Mg, Zn and Mn

contents of fertilized brans and kernels were higher than those of corresponding non-fertilized

rice samples.

Ca content of rice varieties

The bran fraction of fertilizer added rice showed a range of Ca contents varying from 1368 to

1911 mg/kg (Table 1). The fertilized kernel fractions had Ca contents varying from 613 to

1107 mg/kg of rice varieties with red pericarp. The variety BG 305 reported the highest content

of Ca for fertilized bran and kernels whereas BW 451 and AT 309 had the highest contents of

Ca of non- fertilized bran and kernels, respectively.

Mg content of rice varieties

The Mg contents of fertilized and non- fertilized rice kernels varied 224-655 and 237- 452

mg/kg, respectively. Non-fertilized kernels of AT 362, AT 303 and H4 red rice varieties

showed higher Mg content than those of fertilized counterparts. The range of Mg contents of

rice bran and kernel with white pericarp ranged from 1230 to 1068 and from 487 to 212 mg/kg

of the bran and kernel, respectively.

Zn content of rice varieties

Fertilized and non-fertilized brans of rice with red pericarp had a Zn content ranged from 121-

192 and 123-163 mg/kg, respectively. In general, fertilized and non-fertilized kernels of rice

with red pericarp showed a Zn content ranged from 15 to 26 mg/kg. The Zn contents of kernels

were 6-10 times lesser than that of bran of rice with red pericarp. The Zn and Mn contents of

the rice varieties were comparatively lower than the Ca and Mg contents (Table 3). Among

non-fertilized rice brans AT 309 had the highest (210.5 mg/kg) and BG 360 had the lowest

(106.7 mg/kg) zinc contents. The rice varieties except AT 309, AT 306, BG 300 and BG 379-

2, explicated significantly higher Zn contents in fertilized brans compared to those of non-

fertilized (P<0.05).

Mn content of rice varieties

Among rice varieties with red pericarp LD 368 reported the highest content of Mn of fertilized

and non-fertilized rice bran whereas BW 276-6B had the highest content of Mn of kernels

(Table 1). The Mn contents of the rice varieties with white pericarp were comparatively lower

than those of Ca and Mg. Among fertilized bran, Mn contents varied from 214 to 131 mg/kg.

Among non-fertilized rice brans BG 450 had the highest Mn content (Table 3).

Herath et al.

92

Table 1. Mean calcium, magnesium, zinc and manganese contents of rice varieties with

red pericarp (mg/kg)

Calcium

Fertilized Non-fertilized

Bran Kernel Bran Kernel

AT 353 1368.4 ± 29.3a1 682.5 ± 6.6b* 904.9 ± 15.5c2 545.6 ± 8.2d#

AT 362 1428.6 ± 8.2a1 696.4 ± 7.7b* 903.8 ± 4.5c2 520.7 ± 7.4d#

AT 303 1604.9 ± 17.1a1 613.4 ± 12.5b* 749.5 ± 12.2c2 690.9 ± 17.1c#

H4 1571.6 ± 31.5a1 616.4 ± 4.6b* 689.1 ± 13.7c2 589.6 ± 8.2c#

BW 276-6B 1486.3 ± 14.5a1 1107.2 ± 11.7b* 671.7 ± 2.2c2 561.7 ± 6.8c#

LD 368 1911.1 ± 2.7a1 730.1 ± 4.4b* 836.2 ± 18.0c2 560.0 ± 6.2d#

Magnesium

AT 353 1208.5 ± 6.8a1 279.2 ± 0.4b* 1157.5 ± 6.3c2 242.2 ± 1.2d#

AT 362 1206.5 ± 0.6a1 224.4 ± 2.6b* 1175.3 ± 6.5c2 271.9 ± 1.8d#

AT 303 1203.8 ± 12.5a1 240.8 ± 2.1b* 1112.9 ± 6.2c2 287.6 ± 1.0d#

H4 1181.6 ± 6.0a1 223.8 ± 0.6b* 1117.4 ± 11.4c2 237.0 ± 1.6d#

BW 276-6B 1176.9 ± 13.0a1 655.0 ± 6.7b* 1094.2 ± 10.5c2 452.3 ± 2.8d#

LD 368 1204.5 ± 6.6a1 410.1 ± 1.4b* 1162.2 ± 11.5c2 344.5 ± 2.2d#

Zinc

AT 353 127.5 ± 1.2a1 17.5 ± 0.4b* 153.5 ± 0.7c* 16.1 ± 0.1d#

AT 362 192.2 ± 1.6a1 21.5 ± 0.2b* 152.0 ± 1.8c* 18.5 ± 0.3d#

AT 303 121.1 ± 1.9a1 15.1 ± 0.4b* 163.1 ± 1.3c* 24.6 ± 0.2d#

H4 188.1 ± 1.4a1 24.8 ± 0.2b* 128.7 ± 1.0c* 22.9 ± 0.3d#

BW 276-6B 144.3 ± 0.8a1 23.5 ± 0.2b* 122.8 ± 1.0c* 26.4 ± 0.2d#

LD 368 154.7 ± 0.6a1 18.4 ± 0.1b* 130.3 ± 0.7c* 22.4 ± 0.4d#

Manganese

AT 353 122.0 ± 1.6a1 20.6 ± 0.8b* 99.5 ± 2.2a1 16.8 ± 0.4c#

AT 362 157.5 ± 1.5a1 22.1 ± 1.2b* 120.6 ± 1.3c2 18.7 ± 0.8d#

AT 303 126.1 ± 0.7a1 20.0 ± 0.8b* 106.3 ± 2.3a1 19.8 ± 1.7c#

H4 125.9 ± 0.6a1 21.7 ± 1.2b* 106.6 ± 1.5a1 21.5 ± 1.4c#

BW 276-6B 203.2 ± 2.5a1 29.2 ± 0.6b* 121.8 ± 1.0c2 24.3 ± 0.9d#

LD 368 273.1 ± 2.8a1 25.1 ± 1.0b* 176.5 ± 1.7c2 26.6 ± 1.0d# Means in the same row followed by different digits (fertilized bran: fertilized kernel) /letters (fertilized bran: fertilized

krenel)/symbols (fertilized kernel:non fertilized kernel) are significantly different at 95% confidence level(p>0.05)


93

Nutritional significance of minerals

Ca is an important mineral for the synthesis of skeletal functions. Mg is a significant facilitator

for many of the biochemical functions. Mn and Zn which are identified as trace minerals are

important for many of the physiological functions.

Table 2. Mean calcium,and magnesium, contents of rice varieties with white pericarp

(mg/kg)

Means in the same row followed by different digits(fertilized bran: fertilized kernel) /letters(fertilized bran: fertilized

krenel)/symbols(fertilized kernel:non fertilized kernel) are significantly different at 95% confidence level. (p>0.05)

Calcium

Fertilized Non- fertilized


BG 450 1296.0 ± 29.6a1 772.5 ± 10.0b* 675.3 ± 14.1c2 620.4 ± 2.5c#

BG400-1 1325.6 ± 32.9a1 670.5 ± 17.5b* 552.4 ± 5.3c2 167.8 ± 50.1d#

BG 360 1467.8 ± 4.9a1 693.7 ± 13.2b* 593.8 ± 8.0c2 760.5 ± 0.7d#

BG 94-1 1380.7 ± 17.0a1 684.4 ± 5.1b* 492.2 ± 7.9c2 522.9 ± 10.6d#

BG 379-2 1442.8 ± 5.5a1 734.3 ± 5.5b* 1251.5 ± 11.2c2 659.5 ± 14.7d#

BG 300 1456.2 ± 24.6a1 687.0 ± 0.4b* 1345.1 ± 2.0c2 629.2 ± 6.4d#

BG 305 1510.8 ± 6.2a1 829.2 ± 3.4b* 1281.1 ± 88.2c2 501.9 ± 0.9d#

BG 357 1437.6 ± 12.2a1 693.1 ± 8.5b* 1291.6 ± 17.8c2 655.2 ± 10.4d#

BW 367 1476.0 ± 6.7a1 671.0 ± 13.9b* 1309.7 ± 4.1c2 618.4 ± 16.3d#

BW 451 1162.1 ± 14.8a1 643.0 ± 7.1b* 1445.3 ± 9.7c2 603.9 ± 6.5d#

LD 371 1345.5 ± 10.6a1 709.8 ± 10.3b* 1202.0 ± 8.5c2 682.1 ± 8.4d#

AT 306 1254.2 ± 30.3a1 537.0 ± 6.3b* 1441.3 ± 26.3c2 761.4 ± 6.3d#

AT 309 1151.6 ± 31.3a1 631.1 ± 5.7b* 1418.4 ± 16.5c2 892.0 ± 9.6d#

AT 405 952.5 ± 20.6a1 616.4 ± 5.8b* 1319.9 ± 20.9c2 806.9 ± 8.8d#

Magnesium

BG 450 1174.3 ± 13.3a1 373.1 ± 3.8b* 1158.2 ± 1.9c2 384.8 ± 2.5d#

BG400-1 1173.1 ± 7.4a1 227.8 ± 1.9b* 1117.7 ± 11.3c2 227.4 ± 1.3d#

BG 360 1152.0 ± 6.8a1 285.0 ± 2.4b* 1128.5 ± 12.8c2 366.7 ± 1.5d#

BG 94-1 1178.0 ± 0.6a1 193.3 ± 2.4b* 1144.0 ± 6.2c2 211.7 ± 0.4d#

BG 379-2 1144.6 ± 6.5a1 276.5 ± 3.5b* 1172.3 ± 1.7c2 241.7 ± 3.5d#

BG 300 1124.3 ± 11.1a1 250.0 ± 0.9b* 1129.6 ± 11.6a2 338.2 ± 1.9b#

BG 305 1166.2 ± 6.9a1 272.3 ± 3.0b* 1118.4 ± 12.0c2 217.9 ± 0.4d#

BG 357 1152.2 ± 0.5a1 230.3 ± 1.9b* 1146.6 ± 0.7a2 269.2 ± 1.1b#

BW 367 1127.1 ± 0.9a1 313.8 ± 1.8b* 1136.9 ± 11.8a2 296.5 ± 0.7b#

BW 451 1184.2 ± 11.4a1 487.3 ± 3.7b* 1095.1 ± 13.1c2 254.5 ± 0.2d#

LD 371 1184.1 ± 6.3a1 353.6 ± 2.2b* 1068.2 ± 6.5c2 257.2 ± 2.2d#

AT 306 1205.7 ± 13.8a1 286.7 ± 1.5b* 1142.7 ± 7.2c2 285.0 ± 2.6d#

AT 309 1229.6 ± 8.6a1 453.0 ± 3.9b* 1192.6 ± 0.7c2 349.2 ± 1.8d#

AT 405 1132.6 ± 13.2a1 262.6 ± 1.4b* 1147.4 ± 11.4a2 348.4 ± 2.0d#

Herath et al.

94

The per capita availability of rice is 100Kg/year. Accordingly the contribution of fertilization

to the Ca, Mg, Zn content (168.5-304mg), (61.6-124mg), (4.12-7.15mg), respectively is below

the RDA value of the above minerals. The reported Mn content (505-7.4mg) is higher than the

RDA values.

Effect of processing on the mineral content of rice varieties

Sarwar et al., (2009) reported a similar trend in the variations of Ca and Mg of husk and whole

grain fractions of Pakistani rice variety with application of different levels of organic and

inorganic fertilizers compared to control (Non-fertilized). They further reported that fertilized

husk and grains showed higher Ca and Mg contents than that of control.

Table 3. Mean zinc and manganese contents of rice varieties with white pericarp

(mg/kg)

Zinc

Fertilized Non-fertilized


BG 450 154.0 ± 2.6a1 18.0 ± 0.5b* 127.6 ± 0.6c2 23.7 ± 0.4d#

20.4 ± 0.3d#

26.4 ±0.3d3#

19.2 ± 0.5d#

BG400-1 146.4 ± 0.8a1 21.5 ± 0.4b* 140.7 ± 0.9c2

BG 360 168.0 ± 0.8a1 17.8 ± 0.3b* 106.7 ± 0.2c2

BG 94-1 159.9 ± 1.1a1 17.0 ± 0.4b* 153.5 ± 0.7c2

BG 379-2 139.7 ± 1.3a1 18.8 ± 0.0b* 156.4 ± 0.9c2 17.7 ± 0.0d#

BG 300 139.8 ± 2.0a1 23.0 ± 0.3b* 197.5 ± 0.8c2 23.0 ± 0.5d#

BG 305 149.7 ± 0.7a1 22.3 ± 0.4b* 143.6 ± 0.7c2 22.7 ± 0.4d#

18.3 ± 0.2d# BG 357 155.0 ± 1.7a1 17.9 ± 0.4b* 114.9 ± 0.6c2

BW 367 158.6 ± 2.2a1 16.9 ± 0.3b* 134.8 ± 2.0c2 20.0 ± 0.1d#

BW 451 171.3 ± 1.4a1 23.7 ± 0.2b* 126.9 ± 1.1c2 19.3 ± 0.3d#

LD 371 132.3 ± 1.7a1 23.1 ± 0.2b* 116.6 ± 1.4c2 25.5 ± 0.2d#

31.6 ± 0.4d#

32.9 ± 0.3d#

25.4 ± 0.1d#

AT 306 167.3 ± 1.4a1 25.3 ± 0.5b* 190.7 ± 2.3c2

AT 309 146.5 ± 0.7a1 21.9 ± 0.1b* 210.5 ± 2.4c2

AT 405 166.1 ± 1.9a1 25.2 ± 0.5b* 126.0 ± 2.2c2

Manganese

BG 450 184.3 ± 3.2a1 25.3 ± 0.5b* 175.4 ± 1.7a1 24.3 ± 0.4c#

21.6 ± 1.6d#

23.0 ± 0.5d#

19.9 ± 1.3d#

BG400-1 142.0 ± 1.5a1 20.5 ± 0.7b* 94.8 ± 0.5c2

BG 360 214.3 ± 3.3a1 25.3 ± 1.5b* 98.2 ± 1.7c2

BG 94-1 150.6 ± 2.4a1 21.3 ± 0.5b* 109.8 ± 0.6c2

BG 379-2 188.1 ± 1.1a1 34.5 ± 0.4b* 85.8 ± 0.6c2 25.7 ± 0.6d#

BG 300 151.4 ± 1.5a1 24.0 ± 1.1b* 126.5 ± 1.3c2 20.8 ± 0.6d#

BG 305 130.6 ± 0.8a1 23.6 ± 1.0b* 119.5 ± 1.2a1 18.7 ± 0.8d#

22.5 ± 1.3d# BG 357 131.9 ± 0.6a1 20.8 ± 0.6b* 102.5 ± 1.0c1

BW 367 151.3 ± 0.9a1 20.7 ± 1.1b* 158.5 ± 1.4a2 23.9 ± 0.7d#

BW 451 182.0 ± 1.0a1 25.9 ± 1.8b* 128.7 ± 0.6c2 20.9 ± 0.3d#

LD 371 164.1 ± 0.2a1 25.9 ± 0.4b* 142.5 ± 1.4a1 24.8 ± 0.2d#

19.4 ± 1.1d#

20.3 ± 0.5d#

23.3 ± 0.2d#

AT 306 193.7 ± 1.8a1 22.8 ± 0.2b* 130.5 ± 1.5c2

AT 309 169.6 ± 1.9a1 23.6 ± 0.2b* 142.3 ± 1.4c2

AT 405 210.7 ± 0.3a1 27.4 ± 0.4b* 141.2 ± 1.9c2 Means in the same row followed by different digits(fertilized bran: fertilized kernel) /letters(fertilized bran: fertilized

krenel)/symbols(fertilized kernel:non fertilized kernel) are significantly different at 95% confidence level. (p>0.05)


95

The Ca and Mg contents of control husk (Non fertilized) were 2007mg/kg and 401mg/kg,

respectively, whereas inorganically fertilized husk was reported 3477mg/kg and 530mg/kg of

Ca and Mg, respectively. Ca and Mg contents in control rice grains were 778mg/kg and

255mg/kg, respectively, and inorganically fertilized rice grains showed 1041mg/kg and

355mg/kg of Ca and Mg, respectively. This supported the findings of the present study that

the application of inorganic fertilizers strengthened the mineral content of rice grains and husk.

Recently, Verma and Srivastav (2017) showed that the mineral contents of polished

counterparts of some aromatic and non-aromatic rice varieties grown in India. Their results

showed that Ca, Mg and Zn contents of rice ranged 63-99 mg/kg, 83-182 mg/kg and 9-17

mg/kg, respectively. The lower levels of Ca and Mg obtained in their study compared to the

present study could be due to the variations in geographical locations, soil properties like pH,

cation exchange capacity and leaching level of minerals, fertilization rate and techniques and

the plant properties to absorb certain minerals (Leigh and Wyn Jones, 1984).The degree of

milling which removes the most of the micronutrients severely affects the mineral

composition. Processing operations of rice, namely dehulling, milling, and polishing affect the

mineral contents. The mineral content variations among 100% rough rice, 82% brown rice and

72% milling rice. The Ca contents reported were 300, 100 and 100 mg/kg for 100% rough rice,

82% brown rice and 72% milling rice, respectively (Abbas et al., 2011). In addition, Wang

and coworkers (2011) demonstrated the variations of mineral content between bran and kernel

fractions of three Indica rice cultivars. The ranges of Ca, Zn, Mn contents of bran were 682-

1331, 38 -56 and 160-232 mg/kg, respectively. Further the ranges of 52-76, 19-29 and 10-28

mg/kg of Ca, Zn and Mn, respectively were reported for kernel fractions. The trend of

variations revealed in the present work tallied with the previous study by Wang et al., (2011).

Mineral contents of the used rice varieties were significantly affected by variety, fertilization

and processing (P<0.05). In addition, the interactive effects of variety and fertilization, variety

and polishing, fertilization and processing and variety, fertilization and processing also showed

a significant effect on the mineral composition of selected rice varieties (P<0.05). There are

limited studies on the mineral content of newly improved Sri Lankan rice varieties. Further

research are warranted to validate the results obtained in this study.

CONCLUSIONS

The application of inorganic fertilizers strengthen the mineral contents (Ca, Mg, Mn, and Zn)

of rice kernels and brans of selected Sri Lankan newly improved rice varieties.

ACKNOWLEDGEMENT

This research was supported by the Wayamba University Research Grant Scheme

(SRHDC/RP/04/15-20) through a research grant to AC. Dr Gamika Prathapasinghe was

acknowledged by authors for the support extended for the mineral analysis.

Herath et al.

96

REFERENCES

Abbas, A., Murtaza, S., Faiza, A. K. and Naheed, S. R., S. (2011). Effect of processing on

nutritional value of rice (Oryza Sativa). World Med Sci, 6(2), 68-73.

Anjum, F.M., Pasha, I., Bugti, M.A. and Butt, M.S. (2007). Mineral sciences composition of

different rice varieties snd their milling fractions. Pakistan J Agric, 44(2), 332–336.

Diyabalanage, S., Navarathna, T., Abeysundara, H.T.K., Rajapakse, S. and Chandrajith, R.

(2016). Trace elements in native and improved paddy rice from different climatic regions of

Sri Lanka: implications for public health. Springer Plus, 5, 1864.

Ekanayake, H. (2009). The impact of fertilizer subsidy on paddy cultivation in Sri Lanka. Staff

studies 3, Pp 74–96.

Oko, A.O., Ubi, B.E., Efisue, A.A. and Dambaba, N. (2012). Comparative analysis of the

chemical nutrient composition of selected local and newly introduced rice varieties grown in

Ebonyi State of Nigeria. Inter J Agric Forestry, 2(2), 16–23.

Leigh R.A., and Wyn Jones, R.G. (1984). Hypothesis relating critical potassium

concentrations for growth to the distribution and functions of this ion in the plant cell. New

Phytologist 97, 1-13.

Sarwar, G., Schmeisky, H., Hussain, N., Muhammad, S., Tahir, A., and Saleem, U. (2009).

Variations in nutrient concentrations of wheat and paddy as affected by different levels of

compost and chemical fertilizer in normal soil. Pakistan J Bot 41(5), 2403-2410.

Verma, D.K. and Srivastav, P.P. (2017). Proximate composition, mineral content and fatty

acids analyses of aromatic and non-aromatic Indian rice [Online]. Rice Science, 24(1), 21–31.

Wang, K. M., Wu, J. G., Li, G., Zhang, D. P., Yang, Z. W., and Shi, C. H.(2011).Distribution

of phytic acid and mineral elements in three indica rice (Oryza sativa L.) cultivars. J Cereal

Sci, 54(1), 116–121.


Short Communication

Determination of Optimum Nitrogen Concentrations in Hydroponics for

Tomato Grown in Coir Medium in Tropical Greenhouse

H.R.U.T. Erabadupitiya*, W.A.P. Weerakkody1 and K.A. Nandasena23



Sri Lanka

ABSTRACT: Protected culture is a production technology for growing high-value

horticultural crops. Fertigation in soilless culture is a major determinant of the quality and

quantity of the greenhouse crop yields. Nitrogen is the widely used plant nutrient in fertigation

and also the major potential environmental contaminant. Mismanagement of nitrogen in

different growth stages has been reported in literature. Therefore, increasing of nitrogen use

efficiency is vitally important for ensuring economic and environmental sustainability of

protected culture. This study was conducted to determine optimum rates of nitrogen

application for tomato addressing the plant nutrient status and total marketable yield. Tomato

plants were fertigated with a progressive array of ten N treatments covering vegetative and

reproductive stages. Plant analysis, growth parameters and total harvest were measured to

find out the optimum nitrogen requirement. The treatment, supplied with N rates of 50, 60, 90

and 140 mg/plant/day at vegetative, early, middle and late reproductive stages, respectively

showed the highest plant response. Thus it was selected as the most appropriate fertigation

schedule for tomato grown soilless culture which comparatively increases tomato yield while

reducing the cost of fertilizer and environmental hazards associated with excessive use of N

fertilizer.

Keywords: Optimum nitrogen, fertigation, coir medium, tomato, green house

INTRODUCTION

Protected culture; growing perishable crops in environment controlled greenhouses, is a move

on technology of global horticulture for last many decades. Since its introduction to Sri Lanka

in 1997 protected agriculture techniques are being practiced for cultivation of high-value

vegetables. Crops grown commercially, particularly those grown hydroponically, are provided

with high levels of inorganic nutrients. Fertigation in soilless culture is a major determinant of

the quality and quantity of the greenhouse crop yields (Wijesekara, 2013).

Nitrogen (N) is the most important and widely used plant nutrient and also the major potential

environmental contaminant. In greenhouse tomatoes, excess N supplies have been found to be

contributive to poor fruit set, reduced soluble sugars, off-flavor and fruit taste. Several studies

have pointed out that N wastage from soilless cultures is in the range of 1 ton of N ha-1 year-1

in the absence of drainage recycling (Van Noordwijk, 1990). Albert’s fertilizer mixture is the

most commonly used fertilizer mixture and coir dust medium is the main crop growing

1 Department of Crop Science, Faculty of Agriculture, University of Peradeniya, Sri Lanka 2 Department of Soil Science, Faculty of Agriculture, University of Peradeniya, Sri Lanka


Erabadupitiya et al.

98

medium of greenhouse farmers in Sri Lanka which contains all the essential nutrients

(Wijesekara, 2013).

In Sri Lanka, hydroponics growers mainly use Albert’s mixture without specific

recommendation and also without considering crop growth stages. Tomato plants absorb

nutrients at different rates at different stages of growth. This is especially true for nitrogen and

potassium (Ministry of Agriculture, Canada, 2010). Plant tissue analysis is a useful diagnostic

tool for developing nutrient management programs that predict when crops need additional

nutrients while avoiding negative impacts on the environment (Silveira et al., 2007). Therefore

the aim of this work was to find out the optimum level of nitrogen application at different

growth stages of tomato grown in soilless culture, in order to maintain optimum yields.

METHODOLOGY

The experiment was conducted in a semi-intensive greenhouse (100 m2) at the Meewathura

Experimental Station in the Department of Crop Science of the Faculty of Agriculture,

University of Peradeniya (agro-ecological zone, WM2) during 2017. The experiment was laid

out as a RCB design. Plantlets of tomato (Solanum lycopersicum) variety, Larisa F1 hybrid

were transplanted in18 L standard grow bags filled with sterilized coir medium when the plants

had five to six true leaves. Grow bags were placed on plastic trays to collect the leachate

separately. Plant density was maintained as 3plants/m2. The medium was fertilized with a

progressive array of a soluble fertilizer with ten fertigation treatments, keeping three replicates

and a plot size of 10 plants. Crop management practices were done according to the standard

practices for the tomato crop (Wijesekara, 2013).

Application of nitrogen treatments

In each treatment, except nitrogen, other essential nutrients were provided equally according

to the widely accepted proportion and dosages using Albert’s solution (Saparamadu et.al.,

2011); whereas the nitrogen level varied in the treatments according to each growth stages as

shown in Table1. Fertigation was done stating from 500 ml to 1200 ml of solution per day as

plant growth was progressed. The volume of irrigation water applied was decided based on the

evapo-transpiration rate at different growth stages (Mawalagedera, 2011). Nutrient solutions

of each treatment were applied manually on daily basis and the drainage collection (excess

nutrient solution) to the plates kept under the pots were circulated to each pot. The pH and EC

could be maintained at around 5.8 - 6.5 and 2-3 dS/m respectively.

Data collection and analysis

Data were collected at four different growth stages (Table 1) and vegetative growth was

examined with growth parameters of plant height, 3rd leaf length, total leaf area and total dry

matter per plants in each treatment. At the early reproductive stage plant height, total leaf area

per plant, number of clusters and flowers per plants and total plant dry weight were measured.

In the middle reproductive and late reproductive stages, mature ripened fruits were harvested

weekly for determining the marketable yield and total yield. Most information used to interpret

tissue analysis is based on the most-recently-matured whole leaf. For tomatoes, this leaf is

usually the fifth or sixth leaf from the top (Hochmuth, 1988). Thus the 5th leaf of plants were

sampled at four different growth stages (Table 1) and analysed for total N, P, K, Ca and Mg.

Total nitrogen was determined using standard Kjeldahl procedure. P in plant tissue was

determined using visible light spectrophotometer (880 nm) while Ca and Mg were determined

Optimum Nitrogen Concentrations in Hydroponics for Tomato

99

using flame photometer and atomic absorption spectrophotometer respectively (Van Ranst

et.al., 1999). The parametric data processing and statistical analysis were carried out through

ANOVA procedure and mean separation by Duncan’s multiple range Test (DMRT) at the 0.05

probability level using Statistical Analysis System (SAS).

Table1. N levels applied at different growth stages of tomato in each treatment

Treatments (T) Vegetative

stage

Reproductive stages

(N amount - mg/plant/day)

Early

(5-8WAP)

Middle

(9-12WAP)

Late

(13-18 WAP)

1 10 20 50 90

2 20 30 60 100

3 25 40 70 110

4 30 45 75 120

5 40 50 80 130

6 50 60 90 140

7 60 70 100 150

8 70 80 110 160

9 75 90 120 170

10 80 100 130 180 WAP –Week after transplanting


Vegetative Stage

The treatment effect on the plant growth during the vegetative stage was analysed with respect

to several plant growth parameters/indices, as illustrated in Table 2. The means of plant height,

total leaf area and total dry matter were not significantly different among nitrogen treatments

at p≤0.05. The 3rd leaf length was also not significant. Previous studies on greenhouse tomato

has reported a stem thickness of 1cm at the 15 cm below the tip as the standard stem thickness

for a properly nourished tomato plant (Ministry of Agriculture-Canada, 2010) but the stem

diameter of this experiment did not show significant treatment effect while the treatment

means fall within the desirable plant vigour level as specified above. However, treatment 5

showed the highest diameter and treatment 2 showed the lowest (Table 2). Nutrient status of

the 5th leaf of tomato plant were analysed at the end of the vegetative stage and nitrogen

percentage of the 5th leaf was not significantly different among N treatments at (p≤ 0.05) and

it was 4-5%, within adequate range for tomato (4-5.5%) (Hochmuth et al., 2006). Plant tissue

P, Ca and Mg content also did not show a significant treatment effect and they were in

satisfactory levels. K percentage was also not significantly different among treatments and the

range was below the required level (3.5-5%) (Hochmuth et al., 2006) (Table 3). According to

the above results, the least level of N supply, treatment 1 was also found to be satisfying the

N requirement during this vegetative-stage (1-4 WAP) which was normal practices of farmers.

Application of high dosage of fertilizer further increases the cost of production.


100

Table 2. Average values of each growth parameters in vegetative stage (1-4WAP)

Trt. Plant

height

(cm)

3rd leaf

length (cm)

Stem

diameter(cm)

Leaf Area

(cm2/plant)

Plant

DM (g)

1 112.3a 23.1ab 2.94cd 1250a 79.1a

2 116.1a 23.4ab 2.57d 1260a 78.2a

3 114.0a 26.7a 2.82cd 1151a 80.0a

4 113.3a 23.8ab 2.87cd 1210a 78.9a

5 124.1a 24.3ab 3.52a 1128a 81.2a

6 114.6a 23.5ab 3.47abc 1114a 83.1a

7 114.5a 25.0ab 3.31abc 1156a 81.3a

8 120.3a 24.7ab 3.57ab 1154a 81.8a

9 116.3a 26.5a 3.44abc 1165a 82.1a

10 126.6a 24.5ab 3.41abc 1210a 81.9a Trt. – Treatments, The treatment means denoted by the same letters within each column are not significantly different

(DMRT/P<0.05)

Early Reproductive Stage (5-8 WAP)

Table 4 illustrates that mean plant height was significantly higher in the treatment 5, 8, 9 and

10 followed by treatment 2, 4, 6 and 7. Number of clusters and flowers per plants did not show

a significant treatment differences while leaf area increases in response to increasing N (from

treatment 1-10) and thus the highest total leaf area was resulted by the treatment 5-9. Similarly

total dry matter in tomato plants significantly increased as N supply increased up to treatment

5 and then showed a slight decrease in response to further increase in N (Table 3).

Table 3. Main nutrient % of the 5th leaf of tomato at vegetative & early reproductive

stages

Trt.

Vegetative stag (1-4WAP) Early reproductive (5-8 WAP)

N P K Ca Mg N P K Ca Mg

1 5.26a 0.81a 2.19bc 1.50bc 0.08a 2.09c 0.48a 1.76ab 0.26ab 0.15a

2 5.20a 0.78a 2.19c 1.43bc 0.08a 2.04c 0.47a 1.69b 0.25ab 0.12ab

3 5.33a 0.83a 2.07c 1.34c 0.08a 2.51c 0.43a 1.92a 0.25ab 0.11ab

4 5.29a 0.77a 2.21bc 1.55abc 0.09a 3.37b 0.42a 1.88ab 0.23b 0.10ab

5 5.24a 0.80a 2.24bc 1.65ab 0.08a 3.41b 0.42a 1.79ab 0.22b 0.10ab

6 5.25a 0.77a 2.55a 1.79a 0.09a 3.58ab 0.57a 1.78ab 0.32a 0.10ab

7 5.29a 0.76a 2.52a 1.66ab 0.09a 4.02ab 0.57a 1.84ab 0.27ab 0.07bc

8 5.30a 0.75a 2.42ab 1.52abc 0.08a 3.72ab 0.56a 1.77ab 0.32a 0.07bc

9 5.37a 0.81a 2.16c 1.53abc 0.08a 3.98ab 0.53a 1.68b 0.32a 0.06c

10 5.33a 0.77a 2.41bc 1.65ab 0.09a 4.18a 0.44a 1.85ab 0.23b 0.05c Trt. – Treatments, The treatment means denoted by the same letters within each column are not significantly different

(DMRT/P<0.05)


101

Table 4. Average values of each vegetative growth parameters of tomato in early

reproductive stage (5-8WAP)

Trt. Plant

height(cm)

No. of

flowers

No. of

clusters

LA

(m2/plant)

Plant

DM(g)

1 89.3abc 5.43ab 3.60b 0.31d 83.9c

2 93.0ab 5.63ab 4.17ab 0.33d 75.6c

3 90.0abc 4.77b 3.63ab 0 .37cd 87.8c

4 93.5ab 10.33ab 3.60b 0.38cd 126.2b

5 97.7a 11.2a 3.63ab 0.50abc 164.7a

6 95.4ab 9.4ab 3.87ab 0.50abc 159.6a

7 92.0ab 8.4ab 4.00ab 0.51abc 134.1b

8 100.1a 7.5ab 4.53a 0.51abc 134.7b

9 102.4a 8.2ab 4.43ab 0.52ab 117.3b

10 104.8a 10.8a 3.77ab 0.54a 112.1b Trt. – Treatments, The treatment means denoted by the same letters within each column are not significantly different

(DMRT/P<0.05)

As shown in Table 3, leaf N level gradually increased in response to increase in N fertilizer,

leading to apparently highest leaf N content at treatment 10 (4.2%). When consider the rate of

increase, increasing N fertilizer up to treatment 4 was much higher, when the N fertilizer

increased with the treatments and in treatment 10 showed the significantly highest N

percentage. Meanwhile leaf P, K and Ca percentages were not influenced by the N treatments

meanwhile the leaf magnesium percentage showed a gradual decrease from treatment 1 to 10

and significantly lower percentage of Mg was present in treatment 8-10 than other treatments

(Table 3). Based on these evidences, N level in the nutrient solution applied for treatment 5 or

6 could be selected as the optimum N level in early reproductive stage because proper nutrient

absorption may lead to have highest dry mater content, and also plant leaf N, P, Ca and Mg

was within the adequate range according to the Hochmuth, et al., (2006).

Middle (8-12WAP) and late (13-18WAP) reproductive stages

Harvesting was continued to the end of the late reproductive stage in order to determine the

marketable yield. The marketable yield of treatments 5, 6 and 7 significantly higher than the

other treatment (Figure 1). Marketable yield was almost similar to the total yield in all the

treatments, indicating the quality of harvest. In Middle reproductive stage the mean nitrogen

percentage of leaf tissue in treatment 6-10 was significantly higher than the lower N fertilizer

dosages treatments. Percentage P, K and Ca levels in 5th leaf did not show treatment

differences. There was an unusual drop in leaf K percentage in treatment 5 but treatment 6

onwards it came to the normal range (Table 5). Leaf K contents were not adequate in the

middle reproductive stage, according to the Hochmuth et al. (2006). Leaf K content of

treatments was inversely related with fruit formation (yield) data, indicating K partitioning

into fruit sink. In late reproductive stage, mean leaf N, K and P percentages were statistically

insignificant within treatments despite some apparent ups and downs found for some of the

plant nutrients at some levels of N fertilizer supply (Table5). In middle and late reproductive

stages, treatment 6 could be selected as the optimum N level in the fertigation solution because

treatments 6 and 7 showed the highest yield while there was no significant difference in yield

between treatments 6 and 7. With regard to previous studies (Hochmuth etal.,2006; Ministry

of Agriculture-Canada, 2010), plant leaf N, P and Mg contents were within the adequate range

while K and Ca percentages were at sub-optimum in all the treatments.


102

In this study the highest N fertilizer applied treatments (treatments 8 to 10) showed a relatively

lower yield as reported by several authors found negative effects of high N levels in soil and

in nutrient solution on tomato shoot dry weight (SDW) and yield (Cezar, et al., 2002). The low

rate of N fertilization not only produced health-safe and environment-friendly tomato yield but

also reduces the cost of fertilization. Hence further research is needed to examine whether the

reduced rate of other nutrients use can also sustain the tomato yield and maintain the eco-

system sustainably.

Table 5. Main nutrient % of the 5th leaf of tomato at Middle and late reproductive stages

Trt. Middle reproductive (9-13WAP) Late reproductive (14-18WAP)

N P K Ca Mg N P K Ca Mg

1 2.64c 0.53a 1.88a 1.51c 0.56a 3.96a 0.63a 2.98ab 2.62a 0.62a

2 2.96c 0.58a 1.85a 1.65abc 0.50a 3.80a 0.69a 3.08a 2.88a 0.46a

3 3.63b 0.75a 1.63ab 1.81abc 0.46ab 3.73a 0.76a 2.98b 2.70a 0.43a

4 3.88a

b 0.47a 1.57ab

2.07ab

0.48a 4.35a 0.80a 2.98ab 2.83a

0.38ab

5 4.06a

b 0.55a 1.37b

2.16a

0.46ab 3.80a 0.88a 2.88ab 2.87a

0.40ab

6 4.21a 0.68a 1.66ab 1.83abc 0.47ab 4.10a 0.80a 2.97ab 1.95b 0.39ab

7 4.26a 0.59a 1.62ab 1.66abc 0.46ab 4.19a 0.90a 2.80ab 2.42ab 0.30ab

8 4.16a 0.56a 1.47ab 1.46c 0.36ab 4.28a 0.94a 2.75ab 2.35ab 0.27ab

9 4.36a 0.67a 1.63ab 1.51c 0.28bc 4.05a 0.82a 2.72ab 2.48a 0.23bc

10 4.29a 0.64a 1.66ab 1.62bc 0.26c 4.11a 0.81a 2.98ab 2.47a 0.21c Trt. – Treatments, The treatment means denoted by the same letters within each column are not significantly different (DMRT/P<0.05)

Figure1. Total tomato yield per plant, variation among the treatments

CONCLUSIONS

The optimum N levels needed for each growth stage of hydroponics tomato, grown in coir dust

medium under greenhouse conditions in the mid country wet zone (MW2) in Sri Lanka could

be identified. For the vegetative stage, N levels applied in the treatments 1 to 10 were in

satisfactory levels while for the preceding growth stages the treatment levels 5-6 were

0

1

2

3

4

5

T1 T2 T3 T4 T5 T6 T7 T8 T9 T10

To

tal

yie

ld/p

lan

t (K

g)

Treatments


103

adequate. Based on the total and marketable yields, N level used in treatment 6 could be

identified as the optimum for all growth stages of tomato plant, which were 50, 60, 90 and 140

mg/plant/day in vegetative, early, middle and late reproductive stages, respectively.

Restricting into these optimum N levels definitely reduces possible yield losses, cost of

fertilizer and environmental hazards associated with excessive N fertilizer use in hydroponics

tomato cultivation.

REFERENCES

Cezar,P., Fontes,R and Ronchi, C.P.(2002)Critical values of nitrogen indices in tomato plants

grown in soil and nutrient solution determined by different statistical procedures[online].

[Accessed on 10.01.2017] available at

http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-204X2002001000010

Hochmuth, G. J, Maynard, D., Vavrina, C., Hanlon, E. and Simonne, E. (2006). Plant tissue

analysis and interpretation for vegetable crops in Florida: Handbook on Nutrient Management

of Vegetable and Row Crop, University of Florida IFAS Extension.

Mawalagedera, S.M.R. and Premaratne, K.P. (2011). Circulation culture of tomato for efficient

nutrient uptake and high yield in tropical green houses, Tropical Agriculture research 23 (3):

204-217.

Ministry of Agriculture.(2010). Growing greenhouse vegetable in Ontario. Publ.No.836.

Ministry of Agriculture , Canada.

Saparamadu, M.D.J.S., Weerakkody, W.A.P., Wijesekara, R.D., Gunawardhna, H.D. (2011).

Development of a low cost hydroponic system and a formulation for the tropics. Journal of

Applied Horticulture, 13p.

Silveira, M.L.,Vendramini, J.M.,Sollenberger, L.E.,Mackowiak, C.L. andNewman, Y.C.

(2007).Tissue Analysis as a Nutrient Management Tool forBahiagrass Pastures1, University

of Florida, IFAS.

Van Noordwijk, M. (1990). Synchronisation of supply and demand is necessary to increase

efficiency of nutrient use in soilless horticulture. In: van Beusichem ML, ed. Plant nutrition-

physiology and applications. The Netherlands: Kluwer Academic, Publishers, 525-531.

Van Ranst, E., Verloo, M., Demryer, A. and Pauwels, J.M. (1999). Manual for the soil

chemistry and fertility laboratory. University of Ghent, Belgium.

Wijesekara, R.S.(2013). “ArakshithaGruhathulaBogaWagawa”, Department of Agric.pub. Sri

Lanka.


104


Short Communication

Impact of Glass Ceiling on Women Career Development in Non-state

Banking Sector in Colombo

U. K. S. M. Uduwella* and M.W.A.P. Jayatilaka1*

National Institute of Business Management

Sri Lanka

ABSTRACT: Despite banking industry having more female employees than males, women are

still underrepresented in management and senior management levels. This study focused on

the effect of glass ceiling factors (GCFs) on women’s career development in non-state banking

industry in the Colombo district. Five glass ceiling factors, namely individual, childcare and

spouse care, elder care and housework, organizational and cultural factors were considered.

The study was guided by three objectives, namely to identify the current level of women’s

career development, assess the existing level of GCFs and identify the effect of GCFs on career

development of female executives. All female executives employed in the Head Offices of four

non-state, licensed commercial banks in Colombo, Sri Lanka were selected for the study. This

study revealed significant positive and negative effects of individual factors and organizational

factors, respectively on career development of women. Other three factors, namely child care

and spouse care, elder care and housework and cultural factors did not show significant

relationship on women career development. This study recommends developing self-efficacy

by encouraging management to use social modelling, verbal encouragement and constructive

feedback. Furthermore, conducting developmental performance appraisals, instead of

traditional performance appraisals to increase their personal growth initiatives is suggested.

Keywords: Cultural and Organizational Factors, Glass Ceiling, Women’s Career

Development

INTRODUCTION

The most significant feature of the global labour market in the last half of the twentieth century,

is increasing participation of women. During the last two decades in the global labour market

there has been an increase in the proportion of women at lower and middle-level management

positions, resulting from the activities of the women’s movement, policies of the political

system, and corporate equal opportunity initiatives. However, according to Meyerson and

Fletcher (2000) women at the highest levels of business are still rare. They comprise only 10%

of senior managers in Fortune 500 companies; less than 4% of the uppermost ranks of CEO,

President, Executive Vice President, and Chief Operation Officer (COO); and less than 3% of

top corporate earners. The average share of senior management jobs held by women is 21%

globally (Strank and Dyrchs, 2012). There is strong evidence of the under-representation of

women in leadership positions in many countries all over the world. Population of women

executives in BRIC (Brazil, Russia, India and China) states is 26% and in south East Asia’s

economies, it’s 32 % (Strank and Dyrchs, 2012). Grant Thornton (2012) showed that women

1 Department of Biotechnology, Faculty of Agriculture and Plantation Management, Wayamba University of Sri

Lanka


Uduwella et al.

106

occupy only about 13 % of senior management jobs in Germany and 17% in U.S.A. and in

Japan, only 5% of top executives are females. Thus, the gender gap in management is

noticeable. This compelling situation is explained in literature as “Glass Ceiling” (GC). Simply

the term “Glass Ceiling” refers to invisible or artificial barriers that prevent women from

advancing past a certain level (Reich, 1997).

Female employees in the non-state banking sector in Sri Lanka have been declining during the

past few years (Gunawardena, 2010). Annual reports of nine large Commercial Banks

(according to Fitch ratings) revealed that 22% of Board of Directors are female. In the

corporate level management, 21%of managers are female. In Senior Management level the

female representation is only a mere 25%. The basic purpose of this study is to identify the

effect of Glass Ceiling on women career development in Banking Industry in Colombo

District.

METHODOLOGY

A Cross Sectional research design was used in this study. The population of this research

comprised of the licensed commercial banks in Sri Lanka those recorded as “The large banks”

according to Fitch rating. The sample of the study covers the executive level women

employees who are currently employed in head offices of Colombo district. Head offices were

selected as a range of executive job titles can be easily accessed. The sample size comprised

of 231 female employees (Table 1).

Table 1. Population of executive level women employees who are currently employed in

head offices of Colombo District and Sample

Name of the Bank Population Sample

Sampath Bank PLC 212 79

Hatton National Bank (HNB) 200 77

DFCC Bank 136 45

NDB 80 30

Total 628 231

Independent and dependent variables

This study mainly focuses on the impact of Glass Ceiling (GC) factors on women career

development (WCD). Glass Ceiling and women career development can be considered as the

independent and dependent variables, respectively. In early research studies, different factors

under glass ceiling have identified. Based on those findings, individual factors (IF)

(Okurame,2014), family factors (FF) (Cutler and Jackson, 2002), organizational factors (OF)

(Cooper, 2001) and cultural factors (CF) (Bombuwela et al., 2013) were considered as the

factors under glass ceiling in this study. Career development is the life long process of fostering

and cultivating the shape of the individual’s working life so as to make best use of inherent

talent, skills, knowledge and interests for that person’s and employer’s benefit and also to

match it as closely as possible to other aspects of the person’s life. According to Fried et al.,

(1996) equal career opportunities (including equal treatment in recruitment and selection

process, timely promotions), pay equity and networking are the main considerations in the

women career development. Therefore, based on the literature survey, three main

considerations of Fried’s study were selected to measure the women career development. The

secondary data were available in different sources such as textbooks, journals, articles,

Glass Ceiling on Women Career Development

107

research papers, reviews in the internet and newspapers. A self-administered questionnaire

was developed as the survey instrument. After formulation of the preliminary questionnaire,

for the purpose of testing the reliability, accuracy and validity of those questions it was

subjected to a pilot survey.


Correlation and regression analysis were performed to assess the GC factors on the career

development of women.


Mean values of women career development were between 2.3 to 3.7. This indicated that the

women career development is at a moderate level. Mean values of individual factors were

between 3.7 and 5.0. This reflected that the existing level of individual factors such as self-

efficacy beliefs and personal growth initiatives are at a higher level. Mean values of child and

spouse care, elder care and housework indicated that these factors at higher level. Mean value

of organizational factors and cultural factors were at moderate level. Individual factors showed

significantly positive effect on women career development. Thus, self-efficacy beliefs and

personal growth initiatives favor the women career development. Factors namely, child care

and spouse care, elder care and housework had no significant effect on women career

development. Moreover, organizational factors have significant negative effect on women

career development. According to the results of multiple regression analysis, 49.5% variation

in women career development’ can be explained by two independent variables namely

individual factors and organizational factors.

This study revealed that the top level managers of selected Commercial Banks have put some

effort in using friendly human resource policies. Self-efficacy reflects an individual’s

judgment of individual capability to do well in a range of situations or tasks. Mastery

experiences are the most effective way to boost self-efficacy because people are more likely

to believe they can do something well if it is similar to what they have done well

(Bandura,1994). Therefore this study recommends developing self-efficacy by encouraging

management to use mentoring for women executives (Social Modeling). Mentoring is most

often defined as a professional relationship in which an experienced superior (the mentor)

assists women executives (the mentee) in developing specific skills and knowledge that will

enhance their professional and personal growth. An increase of self-efficacy through verbal

encouragement of management/superiors helps. Constructive feedback is important in

maintaining a sense of efficacy as it may help overcome self-doubt.

CONCLUSIONS

This study revealed a moderate level of women career development. Further glass ceiling

factors namely, individual factors, family factors, organizational factors and cultural factors

lie within the range of low level. Individual factors have a significance positive effect on

Women Career Development. Organizational factors have a significantly negative effect on

Women Career Development. This indicates that there are negative effects of Management

Policies and practices, Senior Management Beliefs and Organizational Structure on Women

Career Development. In order to reduce the negative effect of glass ceiling on women career

development, this study recommends developing self-efficacy by encouraging management to

use mentoring for women executives. Mentoring will support female executives to reduce self-

Uduwella et al.

108

limiting beliefs and lack of self-confidence, which can result in them going forward for

promotions.

REFERENCES

Bandura, A., (1977). Self-efficacy: Toward a unifying theory of behavioral change.

Psychological Review, 84, 191-215.

Bandura, A., (1994). Self-efficacy. In V.S. Ramachaundran (Ed.), Encyclopedia of human

Behaviour , 4, 71-81.

Bombuwela, P.M., and De Alwis, A. C., (2013). Effects of Glass Ceiling on Women Career

Development in Private Sector Organizations – Case of Sri Lanka, Journal of Competitiveness,

5(2), 3-19.

Cooper, J., (2001). Women middle managers’ perception of the glass ceiling, Women in

Management Review, 16(1), 30–41.

Fried, L.P., Francomano, C.A., MacDonald, M., Wagner, E.M., Stckes, E.J., Carbone, K.M.,

Bias, W.B., Newman, M.M. and Stobo, J.D.,(1996). Career development for women in

academic medicine, JAMA, 276(11), 898-905.

Gunawardena, K. (2009). Women participation in senior management positions in licensed

commercial banks in Sri Lanka. Banking in Association. [online] Available at:

https://www.researchgate.net/publication/271523276 [Accessed 18 Oct. 2017].

International Business Report, (2012). Grant Thornton International.

Meyerson, D., and Fletcher, J., (2000). A modest manifesto for shattering the glass ceiling,

Harvard Business Review, 78(1), 127–140.

Okurame, D., (2014). Individual Factors Influencing Career Growth Prospects in Contexts of

Radical Organizational Changes. International Business Research, [online] 7(10). Available

at: http://dx.doi.org/10.5539/ibr.v7n10p74 [Accessed 14 Aug. 2017].

Reich, (1997). The GC, Workplace/women’s place: an anthology, Federal GC Commission,

In Dunn D. (ed.), Los Angeles, CA: Roxbury Publishing, 226 -233.

Strank, R., and Dyrchs, S., (2012). Shattering the Glass Ceiling : An Analytical Approach to

Advancing Women in to Leadership Roles, [online]. Available at :

http://www.bcg.perspectives.com [Accessed 18 Oct. 2017].

http://www.bcg.perspectives.com/

Author Guide: Tropical Agricultural Research

109

GUIDELINES FOR PREPARATION OF MANUSCRIPTS

I. GENERAL INSTRUCTIONS

01) Research presented in the manuscript could be in any field of agriculture or allied

discipline leading to a postgraduate degree. Research data should either be from an

ongoing study or a study that has been completed within last 2 years.

02) The research work should not have been published or submitted for publication

elsewhere.

03) The postgraduate student should be identified as the first author.

04) A corresponding author who will be responsible for all communications with the

Congress Office should be stated clearly.

05) Submission of manuscripts: Manuscripts can be submitted through

[email protected].

06) Certificate of authenticity: Declaration form should be duly filled, signed by all

authors and uploaded to the online submission system.

07) Information of corresponding author: Please fill online form.

08) Submissions that involve human or animal trials should provide evidence of

approval obtained by an ethics review committee.

II. SPECIFIC INSTRUCTIONS TO AUTHORS

01) Documents to be submitted

Manuscript

Duly filled and signed 'Certificate of Authenticity' form.

Duly filled ‘Information of Corresponding Author’ form.

02) Format for typesetting

Paper size: A4 (210 × 297 mm) typed single sided only.

Margins: Top, bottom and right margins of 25 mm and a left margin of 30

mm.

Line spacing: 1.5 (18 points) throughout the text.

Length: Length of the manuscript including text, tables, figures and

references should not exceed 15 typed pages.(07 pages for poster).

Page and line numbering: All pages should be sequentially numbered

using Arabic numbers. All lines should also be numbered sequentially

starting from the top to the bottom of each page.

Font: Arial font, size 12.

Language/spelling: UK English only.

Software: Authors may use either MS Word® 2010 onwards format.


110

03) Title:

Title and running title (less than 30 characters). They should be in bold

faced letters.

Name/s and affiliation/s of author/s.

E-mail address, mailing address and contact numbers of the corresponding

author.

NOTE: Identify the corresponding author by placing an asterisk after the

name.

04) Abstract

Should be limited to a maximum of 250 words

Up to a maximum of five (05) keywords should be identified, arranged in

the alphabetical order and included immediately after the abstract.

Abstract should be typed in italics. Scientific names in the abstract should

be underlined.

No references, tables or figures should be included in the abstract.

05) Body

Introduction: Justification of the research work, objectives and

hypotheses should be included in the introduction.

Methodology: All materials, chemicals, clinical subjects and samples

used should be identified. Analytical, survey and statistical methods

should be explained concisely. Common analytical methods need not be

elaborated.

Results and Discussion: Can be combined.

Conclusions: Should be concise.

Headings: All headings should be in bold capital and centered.

E.g. INTRODUCTION

Subheadings: All subheadings should be in bold and in title case.

E.g. Preparation of Land

Non-English terms: All non-English terms should be italicized.

E.g. et al., viz, etc, in vivo, in vacuo, sous vide, Yala, Maha.

All scientific names should be italicized. Both genus and species names

should be mentioned at the first appearance and only the species name can

be mentioned with abbreviated genus name subsequently.

E.g. Clostridium botulinum and subsequently C. botulinum.

References: Refer to the authors and year of publication within the text as

follows. (Sharma, 1997); (David and Silva, 2009) and in case of three or

more authors (Gordon et al., 2009). When two or more references are to

be cited together, they should be given in the chronological order. E.g.

(Sharma, 1997; David and Silva, 2009). All publications cited in the text

should be presented in the list of references in alphabetical order following

the style mentioned below.


111

Journal Articles

Slavin, J., Jacobs, D. and Marquart, L. (1997). Whole grain consumption and

chronic diseases: Protective mechanism. Nutr. Cancer. 27, 14-21.

Books

Shahidi, F. and Naczk, M. (2004). Phenolics in Food and Nutraceuticals.

CRC Press, Boca Raton, FL, pp.446-448.

Edited books

Jeyarani, S. Karuppuchamy, P. and Sathiah, N. (2008). Interaction between

the egg larval parasitoid, Chelonus blackburni and Nucleopolyhedrovirus in

Helicoverpa armigera. pp. 126-130. In: Ignachimuthu and Jeyaraj. S. (Ed.)

Recent Trends in Pest Management. Elie Publishing (Pvt.) Ltd., New Delhi,

India.

Websites

Sharma, V.P. (2009). Cyber extension: Connecting farmers' in India - Some

experience [on line]. [Accessed on 12.08.2009]. Available at

http://www.gisdevelopment.net/proceedings/mapasia/2003/papers/i4d003.ht

m

Digital Object Identifier (DOI):

doi:10.1016/jphysletb.2003.10.071

06) Tables and Figures

Should be included in the exact place within the text.

Should fit into a size of 138 × 208 mm to facilitate reproduction in B5

size.

Tables should be numbered sequentially using Arabic numerals. The titles

should be self-explanatory and placed above the tables.

Tables should not contain any vertical lines.

Figures should be numbered sequentially using Arabic numerals. Captions

should be self-explanatory and placed below the figures.

Illustrations, Line drawings and Photographs (Plates), if any, should be

clear, properly numbered and captioned and ready for reproduction. They

should be of high resolution such as a minimum of 300 dpi and saved in

.tif or .bmp formats.

All lettering, graph lines and points on graphs should be sufficiently large

and bold faced to permit reproduction for inclusion in the Proceedings and

Journal.

Lines of maps, artworks and illustrations should be of appropriate

thickness. Please note that the thin lines do not reproduce well.

Please note that the illustrations, line drawings and photographs should be

placed in the appropriate location of the electronic file and numbered in

sequence with other figures.


112

Adjustments to the illustrations can be made to improve clarity. E.g. to

enhance brightness, contrast, or color balance. However, manipulations

that may obscure, move, remove or introduce should not be performed.

07) Acknowledgements

Only the essential individuals and/or organizations/institutes should be

included.

08) Units

SI units should be used.

A single space should be left between the numerical value and the unit.

E.g. 24 mL, 45 L, 45 g/L, 2 mg/kg.

Degree symbol for temperature should be used separated from the

numerical values by a single space as for example, 20 ºC, 37 ºF.

09) Acronyms and Abbreviations:

All acronyms should be written in full at the first time of appearance.

Abbreviations can be used subsequently.

The full stop should not be included in abbreviations, e.g. rpm (not r.p.m.),

ppb (not p.p.b.), '%' and '/' should be used in preference to 'per cent' and

'per', respectively (e.g. 45%, 2 m/s). Where abbreviations are likely to

cause ambiguity or may not be readily understood by readers, the units

should be mentioned in full.

10) On being informed of the acceptance, the manuscripts should be revised as per the

reviewers’ suggestions and re-submitted using online system. The accepted

manuscripts should be presented orally or as a poster at the Congress and they will

be published in the Journal 'Tropical Agricultural Research', vol. 30, 2815 (ISSN:

1016-1422).

11) Please note that the manuscripts that do not confirm to the above guidelines

will not be accepted.


113

Author Index

Author Page

Arasakesary S.J. 81

Athauda A.R.S.B. 69

Athurupana S.K.M.R.A. 27

Balasooriya B.L.W.K. 81

Bandaranayake P.C.G. 43

Chandrasekara C.M.N.R. 89

Chandrasekara G.A.P. 13,89

Dandeniya W.S. 55

Dharmakeerthi R.S. 55

Edirisinghe U. 69

Erabadupitiya H.R.U.T. 97

Gnanavelrajah N. 81

Herath H.M.A.J. 89

Hewajulige I.G.N. 27

Jayatilaka M.W.A.P. 105

Kekulandara D.S. 43

Kumari K.D.D. 13

Madhujith W.M.T. 1,13,27

Mallawaarachchi M.A.L.N. 1

Nanayakkara C.M. 27

Nandasena K.A. 97

Nawarathna K.K.K. 55

Pulenthiraj U. 89

Pushpakumara D.K.N.G. 1

Rajawardana D.U. 27

Rajeevan R. 69

Samarasinghe W.L.G. 43

Senthuran S. 81

Sirisena D.N. 43

Suriyagoda L.D.B. 43

Uduwella U. K. S. M. 105

Weerakkody W.A.P. 97

Weerasinghe P. 55

Wijesinghe D.G.N.G. 89

Tropical Agricultural Research

Documents

Transcript of Tropical Agricultural Research