© 1995 Oxford University Press Human Molecular Genetics, 1995, Vol. 4, No. 4 731-739

Three genes that escape X chromosome inactivationare clustered within a 6 Mb YAC contig and STS mapinXp11.21-p11.22Andrew P.MMIer1-2, Karen Gustashaw1, Daynna J.Wolff1, Sue H.Rider3, Anthony P.Monaco3, Brian Eble4,David Schlessinger4, Jerome L.Gorski5, Gert-Jan van Ommen6, Jean Weissenbach7 and Huntington F.Willard1*department of Genetics and Center for Human Genetics, Case Western Reserve University School of Medicine, 10900 Euclid Avenue,Cleveland, OH 44106, department of Genetics, Stanford University, Stanford, California 94306, USA, 3ICRF Laboratories, Institute of MolecularMedicine, John Radcliffe Hospital, Headington, Oxford OX3 9DU, UK, 4Department of Molecular Microbiology, Washington University School ofMedicine, 660 South Euclid Avenue, St Louis, MO 63110, departments of Pediatrics and Human Genetics, University of Michigan, Ann Arbor,Ml 48109, USA, department of Genetics, Leiden University, Leiden, the Netherlands and 7lnstitut Pasteur and Genethon, Paris, France

Received January 19, 1995; Revised and Accepted February 8, 1995 GenBank accesssion nos: G02061-G02O82 (incl.;

In order to study the distribution of genes that escapeX chromosome inactivation, a high density yeastartificial chromosome (YAC) contig and STS mapspanning approximately 6 Mb has been constructedin Xp11.21-p11.22. The contig contains 113 YACsmapped with 53 markers, including 10 genes. Fourgenes have been assayed for their expression statuson both the active and inactive human X chromo-somes, and these data have been combined withprevious results on two other genes in the contig.Three of these genes escape X inactivation and havebeen localized to a single YAC clone of -1075 kb. Theother three genes are subject to inactivation, withtwo of them lying among the genes that escapeinactivation. These results suggest that there areboth regional control signals as well as gene-specificelements that determine the X inactivation status ofgenes on the proximal short arm of the human Xchromosome.

INTRODUCTION

X chromosome inactivation is the process whereby one of thetwo X chromosomes of normal females is inactivated early indevelopment in order to compensate for the dosage differenceof X-linked genes between males and females (1). The mechan-ism of X inactivation is unknown; however, the isolation of agene, XIST, which maps to the X inactivation center and isexpressed exclusively from the inactive X chromosome mightaid in the understanding of how this complex developmentalprocess occurs (2).

A puzzling feature of X inactivation has been the findingof certain genes that 'escape' inactivation and are expressedfrom both the active and inactive X chromosomes (3-7). Tobegin to understand why these genes escape X inactivation,we have examined the expression pattern of several geneswithin Xpl 1.21-pi 1.22 and have analyzed the distribution ofgenes within this region that escape inactivation. If a gene

contains a specific sequence within the promoter or anothersuch element that marks the locus in such a way that the geneescapes X inactivation, these genes would be expected to berandomly distributed with respect to genes that are subject toinactivation. In contrast, if a chromosomal domain or regionis marked to escape inactivation, perhaps through a particularlocal chromatin structure, the genes that escape inactivationwould be expected to be clustered within specific regions.

The pseudoautosomal region and the neighboring region ofX—Y homology do contain clusters of genes that escapeinactivation (e.g. 5,6). The pseudoautosomal region, however,may represent a special case, in that it does not need to bedosage compensated and the neighboring region might haveonly recently become X-specific due to the relocation duringevolution of the pseudoautosomal boundary from a positiononce proximal to these genes (8). Other genes that have beenshown to escape X inactivation appear to be distributed widelyalong the X chromosome (9), but at a resolution too low toprovide useful information about potential clustering.

To address this question of local versus region-specificinactivation patterns, we have chosen to examineXpl 1.21 - p i 1.22 in some detail. This region is early replicating(10-12) and appears to be a site of histone H4 acetylation(13) on the inactive X chromosome, providing cytologicalindications that it might contain genes that escape inactivation.Other evidence, such as the structure of bipartite Barr bodiesformed from isodicentric chromosomes (14) and the locationof chromosomal rearrangements in Turner syndrome (15), areconsistent with this possibility. Two genes in this region havealready been shown to escape X inactivation, DXS1272E (alsoknown as XE169 and SMCX) (7,16) and DXS423E (17), whilea third gene in Xpll, UBE1, mapping ~8 Mb distal to thesetwo genes (9), also escapes inactivation (3). Localization ofthese genes in relation to other genes that are either subject toor escape from X inactivation should further the understandingof X chromosome inactivation.

Yeast artificial chromosomes (YACs) can be used as a toolto isolate an entire chromosome region in a set of overlappingclones and, therefore, allow one to easily characterize largesegments of the human genome (18-20). We describe here a

*To whom correspondence should be addressed

at Tufts U

niversity on Decem

ber 28, 2012http://hm

g.oxfordjournals.org/D

ownloaded from

732 Human Molecular Genetics, 1995, Vol. 4, No. 4

YAC contig covering approximately 6 Mb spanning from themost centromeric marker on the short arm of the X chromosometo the OATL2 cluster in Xp 11.22, including 113 YACs and 53markers. This contig is then used to further characterize theproximal short arm with respect to X-chromosome inactivation.

RESULTS

Assembly of the contig in Xpll.21-pll.22Five different YAC libraries were used to build a 6 Mbcontig in Xp 11.21 (see Materials and Methods). Nine STSs(DXS423E, DXS991, DXS741, ALAS2, DXS679, DXS422,DXF34S1, 0ATL2, and 2:93) (Table 1) were originally usedto isolate a series of YAC clones that were used to generatefour individual contigs. Ligation-mediated PCR (LM-PCR)(21) was used to isolate end-clones, which were used sub-sequently to isolate additional YAC clones. YAC end-cloneswere again isolated as needed to fill the remaining gaps andto add depth to the map. In addition, the CEPH-Genethondatabase (19) was used to identify YACs that either mappedto the region on the basis of their STS content or appeared tocontig with YACs that had already been placed in the contigon the basis of their repetitive element content.

To assemble the contig, the STS content of the YACs wasdetermined using the original set of STSs, newly developed

YAC end-clone STSs, and newly published STSs (Table 1).Positive and negative PCR data were used to assemble a contigon the basis of STS content (Fig. 1). Markers could beunambiguously ordered along the chromosome except for sixpairs and one group of three markers, each of which cosegreg-ates in all of the YACs tested. Based on the most parsimoniousmarker order, seven YACs appear to contain internal deletions.Three of these deletions involve a single marker, 8045EL,which is an end-clone from YAC 8045. The other four deletionsoccur at various places in the contig (Fig. 1). The computerprogram SEGMAP (22) was used to confirm the order of theSTSs and the placement of the YAC clones.

The contig was unambiguously oriented on the X chromo-some using a pair of somatic cell hybrids that each containone of the two derivative chromosomes of an X;17 translocation(hybrids L62-3A and A62-1 A-4b; 23). This t(X;17) breakpointfalls in the distal third of the contig and allowed us to placemarkers initially in one of two intervals defined by thistranslocation. In addition, radiation hybrid (RH) mapping (24)suggested an order for a subset of markers in the region:Xpter-/lLAS'2-DXS741 -A/7WDL/-DXS14-DXZ1. Ourcontig data are in agreement with this order and correspondwell with the distances estimated from the RH map. Our dataare also consistent with the placement of YAC clones andSTSs in a smaller contig covering three loci in the mostproximal part of this contig (25).

Table 1. Previously unpublished STS markers and primer sequences used to construct the map. The primer sequences are all given in a 5' —3' orientation alongwith the size of the PCR product in basepairs

Probe Locus Primer Sequence Product Size Probe Locus Primer Sequence Product Size

D58-1

SB1.8-3'

SB1.8-5'

X2

yXp1S6A

yXp166A

2:30

cpx210

CSB-0 6

SWXD421

2:93

1424AR

DXS14

0XS423E

DXS423E

DXS429

DXS579

DXS580

DXS741

ZXDA

ZXDB

SSX

FQD1

MTHFDL1

ACTL1

51 3

TTCTACCCATCTGAAACACTGGGGTCCTTGGGGCTCACTATT

TAGCTCACATTCTGCCTCCCCCCTTCTGGAAACCCTTAGC

CAGGGTGCTGT6GAATCTATTTTGTCATACTCCTGCGCCA

ATATGACTCTGTTCCACCCGCACTTCCCCAATCAATACCC

CAGGTATTGCTGGTAGAAATGATGAGTGGATTGGTGGGTTC

TGATGGAACAAAACCACACAGTTTCTTGTAAGCCACATAGCG

TGCAQGTCGTGGTGAAGAGACTTCTGACAATCCTATGGGT

CAATCCTGTGAGGTCCTTATGGCTCAATTAAGGTGGGAGGCAG

AGCTTGGATCATAACTGTGTAGGCATTGTGGTTTATCCACTTTCTAG

TGATGAGAAQCAGAACGTGGCGCTAACATCGAACTCTTGG

GAGCATCGTCTGGGACTACTGCTCCCCGAATGGGAATAGAT

TCAAGTCACTCAGTTGAAGGACATGATCCCAATCTCTTCAGCAG

ACCACGCCATCCTGCGTCTGCAGCTCGTAGCTCTTCTCC

GAAGAGTGAGGATAACTTGGCATGTCATTTATTGTGTTGCTGG

GACCTTTCAGTGCAGTGGCTACTGCACCCTAGAACTCCTG

GCCCCTAAAGCCTAGGACAGGTACCTCGCCCACTTGAAAA

127 bp

278 bp

101 bp

268 bp

112 bp

127 bp

173 bp

223 bp

120 bp

151 bp

1S6bp

130 bp

213 bp

85 bp

211 bp

140 bp

15C10L

4385RL

8045EL

8046AL

8O49RL

806OAR

8O57AL

80SSPL

8O58RR

8O69RL

8072RL

8073RL

662 AR

680 AL

710AL

OATL2-7RL

5' 31

AAAATGCTTTGGCTGACACCTAGGAGCCCAGTGCTCAGTT

AATTCTCTGCCTGTGATGGCGAAGCGCTGAGCACACAGTA

TAAACAATAAACCACCACAGGGTTTGTGTCATCTGGTTTGGC

CATCCACATGGTCACTCTGGCCTGGAGAAGTACCCAGCAG

CAGGGGATCAACTTCAGCATCTTTTACAACCATTTTCAGGGC

CCTGGCCTGAGATACCATTTCCCAAATTGCCTCCACAG

GGTTCAGCTGATCACCAATGAGGTCAGGCAGCAAAAATTCC

GAAGTCCATTGAGCTTCCTCAGTACCTGACTTTTCAATTCCCA

TTGACTGTAATGTGACTTGGGGTGTGATGTCCCAGAAGGTGA

TCTCTGTGATCTGACCCTTTCCCTCAGGCAGTTAGGTGCTATCA

GGGAACTTACAGGATGAGTCAATAGCCGGTCTTACTCAAACTATCC

GAGGTTCTGTAAAATACAAGGGATCCCAGCAGTGTTTTGTCG

CTCGCTCTCTCTTTCTCTCCCTTTTCCAAGGTTGTGAAGGG

GGGAAATCAGCGCTACTGTGCACTATGCCAGGTCCCTCAT

CCAATCAGAGAAACAGAGAGAACTCTTTTCCTTTCAGGAGTCTG

TACAGGAAAACAAGCATCAAGCTGGTTCTGTTGGAGAGAATACA

182 bp

196 bp

187 bp

117bp

106 bp

154 bp

248 bp

176 bp

173 bp

107 bp

191 bp

98 bp

188 bp

113bp

125 bp

151 bp

at Tufts U

niversity on Decem

ber 28, 2012http://hm

g.oxfordjournals.org/D

ownloaded from

Human Molecular Genetics, 1995, Vol. 4, No. 4 733

Fluorescence in situ hybridization (FISH) and localizationof distal and proximal markers on the X chromosomeFISH was used to confirm the orientation and the location ofthe contig on the human X chromosome. Cosmid probes fortwo loci, ZXDA and DXS1000, were isolated from the ICRFReference Library (26). ZXDA lies at the proximal edge of thecontig while DXS1000 lies at the distal boundary of the contig.These cosmids were hybridized along with an X chromosomealpha satellite probe (DXZ1) to both metaphase and interphasenuclei (Fig. 2). The ZXDA cosmid signal and the DXZ1 signallie side by side in both the metaphase and interphase nuclei.Based on the very close proximity of the signals (27), thissuggests that the proximal end of the contig is likely only afew hundred kilobases away from the DXZ1 DNA. In contrastto the ZXDA and DXZ1 signals, the DXS1000 cosmid signalis easily separated from the proximal region on both metaphasechromosomes and interphase nuclei, clearly delineating theregion that is covered by this contig. Based on similar studies

of other probes (27), the distance between DXS1000 andZXDA would be on the order of several megabases.

It is important to note, however, that if the chromatinbetween ZXDA and the DXZ1 array is hypercondensed ininterphase nuclei (reflecting its proximity to centromeric heter-ochromatin), the above estimate would become invalid. Onthe X chromosome, the alpha satellite array itself does indeedappear to be hypercondensed, as this ~3 Mb stretch of DNA(28) produces a small compact FISH signal, which one wouldnot expect for two different probes hybridizing to sites 3 Mbapart. While there is currently no evidence that the regionsbordering the DXZ1 repeats are similarly hypercondensed,these estimates must remain somewhat uncertain.

Chimerism of YAC clones and estimation of the size ofthe contigIn order to approximate the size of the contig more accurately,we needed to identify a series of non-chimeric YACs that

Telomere Centromere

438760238043

743c10

Figure 1. YAC contig and STS map in Xpl 1.21. The chromosome is indicated by the dark line with bidirectional arrows with the centromere to the right andthe telomere to the left. Loci and probes are ordered across the top of the diagram, as determined by STS content, parsimony and the program SEGMAP. Genesare labeled in a larger bold typeface. Small boxes connecting markers denote STSs that cannot be ordered relative to each other. Individual YAC clones areshown as lines along with their names. The length of the line corresponds only to STS content and not to the actual size of the YAC. The t(X;l7) (23) thatallows the orientation of the contig on the chromosome is indicated by the wavy line.

at Tufts U

niversity on Decem

ber 28, 2012http://hm

g.oxfordjournals.org/D

ownloaded from

734 Human Molecular Genetics, 1995, Vol. 4, No. 4

Figure 2. FISH analysis of cosmids for proximal and distal loci in the contig. X alpha satellite (DXZ1) is shown in red, the proximal cosmid for ZXDA isshown in green, and the distal cosmid for DXSIOOO is shown in purple. Panels A and B show interphase nuclei following FISH. Note the proximity of ZXDAto the alpha satellite signal. Panels C and D show prometaphase chromosomes following FISH.

covered the entire region. This was done initially by isolation ofboth end-clones from a YAC using LM-PCR and subsequenttesting for X linkage using somatic cell hybrids (see Materialsand Methods). Only three of 19 YACs so tested were foundto be non-chimeric by this method (Table 2). Alternatively,FISH was used to identify non-chimeric YACs. With this lessrobust approach (see Materials and Methods), 12 of 19 YACstested appeared to be non-chimeric (Table 2).

In order to estimate the size of the YAC contig, we combinedthe chimerism data with YAC sizes determined by PFGE orobtained through the CEPH-Genethon database. A minimumdistance was derived by summing the sizes of four non-overlapping, non-chimeric YACs (967d4, 743c 10, 8059 and973d2). This gives a minimum distance of approximately 3.6Mb between DXS1000 and MTHFDL1. This approach excludesfrom this distance estimate regions covered by 15 markers notcontained in these four YACs. A maximum distance was thendetermined by summing the sizes of eight YACs ( OATL2.7,967d4, 8049, 743c 10, 680hll, 973d2, 4887 and 5007) thatcovered the entire contig with a minimum set of overlaps,

producing an estimate of 7.1 Mb. However, the regions coveredby 15 markers are included twice in this estimate. The unstableregion around the STS 8045EL also complicates any distanceestimate. Additionally, the program SEGMAP (22) was usedto estimate the size of the contig between 6.3 and 6.8 Mb.Considering all of these approaches, we estimate the size ofthe contig to be ~6 Mb.

X-inactivation analysisTwo genes mapping within the contig, DXS1272E andDXS423E, have previously been shown to escape X inactiva-tion (7,16,17). In order to determine the X-inactivation statusof four additional genes in the distal half of the contig, anRT-PCR-based assay (29) was used on a set of somatic cellhybrids that retain either an active X or an inactive Xchromosome. Three of these genes, DXS 1013E, DXS1008Eand DXS6672E are expressed sequence tags (ESTs), while theother gene, SSX, was recently reported to be involved intranslocations associated with synovial sarcoma (30). Becausewe were unable to determine if DXS1008E and DXS6672E

at Tufts U

niversity on Decem

ber 28, 2012http://hm

g.oxfordjournals.org/D

ownloaded from

Human Molecular Genetics, 1995, Vol. 4, No. 4 735

Table 2. YAC clones used in this study

YACs

915a10

0ATL2-1

OATL2-10

8073

778f1

OATL2-7h

4326

2269

2270

967d4

4927

4593

4385

4640

3895

1758

8057

679d6

2919

4426

6091

8071

8072

799d9

3818652 e10

690(6710C7

80493819175060828047291580504987602380438048

864c12743c10

80468045804429188063

693 e8872M2

355480621422

649f630238061

822d8810h9

1424

Size

•1250

570

300

650

•1790

1075

340

100

610

"1630

195

240

235

185

220

370

265

•830

230

255

195

1100,920

800

380

170320,850

250490670

90170215

1100450460255120355

1080•1740•122012501450

460,290205

1050•660,810,1670

•1050120680315

•390295

1100•1590*840350

I

U_

imer

ic-

O

+

+

-

+

-

-

-

-

rx

5

imer

ic-

+

-

+

+

+

+++-

+

+

+

+

Library

CEPH

ICRF

ICRF

ICRF

CEPH

ICRF

U.P.

W.U.

W.U.

CEPH

U.P.

ICRF

U.P.

U.P.

U.P.

W.U.

ICRF

CEPH

W.U.

U.P.

U.P.

ICRF

ICRF

CEPH

U.P.CEPHCEPHCEPHICRFU.P.

W.U.U.P.

ICRFW.U.ICRFU.P.U.P.

ICRFICRF

CEPHCEPHICRFICRFICRFW.U.ICRF

CEPHCEPH

U.P.ICRFW.U.

CEPHU.P.

ICRFCEPHCEPH

W.U.

Reference #

y900C0122

F15E1

I300F10

I145H12

F21G5

y900G0923

F16B1

F18G5

F10F11

E117A7

y900D0592

E58H12

F16E6

F34E10

y900F1217

y900G04127

F9H5

y900C05164F9H6

E177H2F34E1

y900B08126E97F2

y901G01Y16F22D8

F33C11y900C0265

V900H06139

y900D0165y900C10124

y900H0969E115A2

y900D06116

F7B3y900C0648

E97C3

F1B12y900F0736

E204G11

YACs

3039

5466

967h8

857g12

5110

2920

2921

2922

662c2

696h4

680h11

8059

810 66

945 e12

8058

8060

4692

1761

1762

1763

3414

876h6

785b6

794 e2

973d2yXp156

8051622C32914805380524311

685b5yXp166

29132916440129173272470247155005308048875006

662g25007686734254443227322742275500822728041

Size

290

315

"820

•1200

345

340

145

90

•380

330

945

480

*760

•1490

600

450

280

260

180

225

300

•710

700

800

•280135380360580900870260

400,800120295250325945270295265

750,650300280850

540,6001000270210210345345345

1000530200

ICOLL

imer

ic-

o

-

-

+

-

-

+-

+

-

-

+

+

+

iroQ__l

imer

ic-

.cO

+

+

-

-

+

+

+

+

Library

U.P.

U.P.

CEPH

CEPH

U.P.

W.U.

W.U.

W.U.

CEPH

CEPH

CEPH

ICRF

CEPH

CEPH

ICRF

ICRF

U.P.

W.U.

W.U.

W.U.

U.P.

CEPH

CEPH

CEPH

CEPHLeiden

ICRFCEPH

W.U.ICRFICRFU.P.

CEPHLeiden

W.U.W.U.U.P.

W.U.U.P.U.P.U.P.

ICRF

U.P.U.P.

ICRFCEPHICRF

W.U.U.P.U.P.

W.U.W.U.W.U.ICRFW.U.ICRF

Reference #

F1D4

F27D12

F23G1

E4B10

E28H4

E162B1

y900H1054

y900F0519

y900C09142

F19C9

E28B1

E29F2

E50G10

F5E4

y900A0215

E208C4y900G11162

y900B0259F15C10

E18A8E79C3F16C5E80A3F3G10F19D7

F19E8y900C0829

F1G9F21D1

y900D1218

y900H0915B174A9

F5F3F16F11

I65C8I274E2

I86B8y900F02103

I142D2y900D02122

Our YAC clone names are shown to the left with the reference number or library position shown adjacent

to the library of origin. Clones originating from the W.U. or U.P. libraries should contain the prefix

'yWXD'. Clones originating from the CEPH library should contain the prefix 'yhCEPH'. The size of YAC

clones are given in kilobases. An * by the size means that the size was obtained through the CEPH-

Genethon database and not confirmed in our labs. We identified six clones that showed two prominent

bands on PFGE sizing gels and the sizes of both of those YACs are listed. The chimeric status for selected

YAC clones is shown as determined by either FISH or by the isolation of end-clones of the YAC using

LM-PCR (see Materials and Methods). A ' + ' means that the YAC is chimeric and a ' - ' means the YAC

appears to be non-chimeric.

at Tufts U

niversity on Decem

ber 28, 2012http://hm

g.oxfordjournals.org/D

ownloaded from

736 Human Molecular Genetics, 1995, Vol. 4, No. 4

A. Xa, Xa2 Xi, Xi2 Xi3 Xi4 M

RT

DXS1008E

DXS6672E

SSX

DXS1013E

inactive Xs (Xi) were used, as well as a mouse control. Primerswere used that amplify the same size product in both genomicDNA and cDNA, so cDNA synthesis reactions without reversetranscriptase were run in all cases to control for genomic DNAcontamination in the RNA samples. These controls wereconsistently negative. As shown in Figure 3, SSX is clearlyexpressed in both the Xa hybrids and in three of the four Xihybrids; a fainter product can be seen in the other inactive Xhybrid. DXS1008E, DXS6672E, and DXS1013E were allexpressed in the Xa hybrids but showed no expression in theXi hybrids (Fig. 3A). These data suggest that, in this hybridsystem, SSX escapes inactivation while the three ESTs aresubject to inactivation.

Consideration of these four genes in combination withDXS1272E and DXS423E on the YAC contig reveals theorder: Xpter - SSX - DXS6672E - DXS1008E - DXS1272E- DXS423E - DXS1013E-Xcen (Figs I and 3B). Thus, atleast three genes that escape inactivation are clustered withinthe distal portion of the YAC contig.

B.

OMb 1 Mb 2 Mb

SSX DXS6672E DXS1008E DXS1272E DXS423E DXS1013E

Figure 3. (A) RT-PCR analysis of X inactivation. RNA samples werereversed transcribed either in the presence ( + RT) or the absence (-RT) ofreverse transcriptase. Xa are active-X containing hybrids (Xa rAHAllaBa,Xa2-t60-12); Xi are inactive-X containing hybrids (Xi r t l l-4Aaz5, Xi2-t48-la-lDaz4a, Xi3-t75-2maz34-4a, Xi4-t86-Blmazlb-3a) (54). M refers to themouse cell line tsAls9 and it is used as a control for the mouse background.Because these primer pairs amplify the same size product from both genomicDNA and cDNA, female genomic DNA is loaded as a positive control. (B)Summary of expression data from the active (Xa) and inactive (X;j Xchromosome for six genes in Xpl 1.21 - p i 1.22. Maximum distances betweenmarkers are shown above the chromosome. This estimate is based on the sizeof YAC OATL2-7h, which contains the markers DXS6672E, DXS1008E,SSX, DXS1272E, and DXS423E.

are the same or different genes based on their map position,we examined the expression pattern of these two transcripts.No specific signals were detected on Northern blots, so weperformed PCR on several different cDNA libraries to deter-mine if these transcripts were expressed in the same tissues.We detected PCR products from a frontal cortex cDNA libraryand a heart cDNA library with DXS1008E, while DXS6672Eproduced a product only from a fetal brain cDNA library (datanot shown). Combinatorial PCR was also performed betweenthe primers for these two ESTs, and these failed to produce aspecific product. These data suggest that the genes are different,although formally the different expression patterns couldrepresent alternatively spliced products of a single gene.

RT—PCR was used to test for the expression of these fourgenes in a series of hybrid cell lines (Fig. 3A). Two hybridscontaining active X chromosomes (Xa) and four containing

DISCUSSION

We describe the generation of a YAC contig spanning anestimated 6 Mb of DNA in the most proximal part of the shortarm of the human X chromosome. The contig contains 113YAC clones mapped with 53 markers, including sevenGenethon (CA)n repeats (DXS1000, DXS988, DXS1204,DXS1199, DXS991, AFM137xell and AFMa230vcl). Tworegions within the contig appear to be either unstable orunclonable in yeast. The distal region of the contig appears tobe unstable as there are three independent YACs that showboth size and STS content differences between individualisolates of the YAC clones (data not shown). We have includedin the contig only the largest YACs that are positive for thelargest number of STSs. Another YAC, yWXD2269, appearsto contain multiple internal deletions as compared with apartial cosmid contig in the region (data not shown). Theregion around the STS 8045EL appears to be unstable also.Three YAC clones appear to be deleted for this marker while13 different YACs terminate just prior to this marker.

This region of the X chromosome borders the centromericregion proximally. Results obtained using FISH suggest thatthe most proximal marker is no more than a few hundredkilobases away from the alpha satellite DNA (Fig. 2). Attemptsto extend this contig to the DXZ1 repeats have failed thus far,perhaps due to the nature of the YAC libraries that we havescreened. These libraries are constructed from partial EcoRldigests of genomic DNA. This biases the library becauseEcoRl rarely cuts within the DXZ1 repeats (31) and, therefore,most alphoid sequences would lie on very large EcoRl frag-ments that would tend to be underrepresented in a typicalYAC library (32-34). PI clones generated from partial Sau3Aldigests may be better suited for these studies (35).

Because we are interested in the process of X inactivation,the expression pattern of several genes in the contig wasexamined to determine if they are subject to or escape fromX inactivation. ZXDA and ZXDB have been shown previouslyto be subject to inactivation (36). ALAS2 is an erythroid-specific gene and, therefore, cannot be tested in our hybrid-based assay (29). Two other genes, DXS1272E (XEJ69, SMCX)(7,16) and DXS423E (17) have been shown previously to

at Tufts U

niversity on Decem

ber 28, 2012http://hm

g.oxfordjournals.org/D

ownloaded from

Human Molecular Genetics, 1995, Vol. 4, No. 4 737

escape X inactivation and, in this study, have been colocalizedto two independent YAC clones. Four additional genes havebeen localized in the contig, three in the distal region nearDXS1272E and DXS423E, and one near the middle of thecontig. The more proximal gene, DXS1013E, is subject toinactivation, as are the two other ESTs, DXS1008E andDXS6672E, which lie at the very distal end of the contig (Fig.3A). An additional gene, SSX, which appears to be involvedin synovial sarcoma tranlocations, escapes X inactivation (Fig.3A) and maps distal to both DXS6672E and DXS1008E(Fig. 3B). Thus, while genes that escape X inactivation areinterspersed with two that are subject to inactivation, it isnotable that three genes that escape X inactivation are alllocalized within a single non-chimeric YAC clone of-1075 kb.

These expression data provide some insight into the basisfor certain genes escaping X inactivation. If a gene escapes Xinactivation due to specific sequences or elements that areassociated with the gene itself (either in the promoter, withinthe transcript itself, or 5' or 3' to the gene), then there is noreason to believe that these genes would be clustered withina given chromosomal region. Alternatively, the finding thatgenes that escape inactivation are clustered—as shown here—supports the existence of regional control mechanisms thatinfluence the expression of genes contained therein.

It is not necessary that the clustering of genes with respectto X inactivation be exclusive; indeed, such exceptions to theoverall chromosomal context may prove to be quite informat-ive. The presence of gene-specific elements that influence theinactivation status of X-linked genes must be considered dueto the presence of inactivated genes within this cluster (Fig.3B). Further, there are examples of single genes, such asRPS4X in Xql3 (4), that escape X inactivation without anyevidence for clustering of other genes that escape inactivationnearby (9,37). The isolation of additional transcripts in regionsthat contain one or more genes that escape inactivation isneeded to further identify both gene- and region-specificcontrol elements that determine epigenetic states of geneexpression.

Regional control of X inactivation might be explained by aunique chromatin structure or domain that makes that regionaccessible to transcription factors (and/or resistant to X inac-tivation factors) that are excluded from the remainder of theinactive X chromosome. Chromosomally regulated domainssuch as these have been proposed in the context of imprintingas well (38,39). In addition to expression data, replicationstudies of three imprinted regions, the Prader-Willi/Angelmansyndrome region on human chromosome 15, the Igf2r region,and the HI9//gf-2 region, have shown asynchronous replicationbetween the two homologous sets of alleles (40,41). Thissuggests that these three regions constitute domains of DNAthat show both replication timing differences and expressiondifferences between homologous chromosomes and, further,indicates that it is the chromosomal region itself that confersthese properties.

The data presented here are reminiscent of the study ofimprinting in the Prader—Willi/Angelman syndrome criticalregion, which contains multiple genes that are imprintedinterspersed with non-imprinted genes (38). Together, theimprinting and X inactivation data suggest that both regionalcontrol mechanisms and gene-specific control elements influ-ence gene expression within chromosomal domains. Expression

of individual genes within regulated domains most likelydepends not only on the proper chromatin context, but also onthe gene itself, c«-acting factors, and promoter strength.Viewed in this light, the decision of whether a gene is subjectto or escapes from inactivation may reflect a hierarchy ofeffects involving chromosomal control elements as well asregulatory sequences associated with individual genes.

MATERIALS AND METHODS

Generation of STS markers

A series of DNA markers had previously been placed within Xpl 1.21 - p i 1.22(9,23). These included the markers DXS14, DXS422, DXS423E, DXS429,and MTHFDL1. In addition, two Notl linking clones (42), 2:30 (DXS741)and 2:93 were mapped to this region (R.Lafreniere, unpublished observations).Cloned probes for DXS14 (p58-l), DXS429 (X2), DXS741 (2:30), and 2:93were sequenced in order to develop specific STSs. The MTHFDL1 STS wasdeveloped utilizing a single base pair deletion found in the X-linked pseudogenebut not in the published cDNA sequence (43). Genomic phage that wereisolated with the probes cpx210 (DXS422) and SB 1.8 (DXS423E) weresubcloned and sequenced to generate STSs. The DXS422 probe is specificfor the ZXDA gene (36). An STS specific for ZXDB was obtained from asubclone of a genomic phage specific for this loci. The STS SB 1.8-5' wasgenerated from sequence data from the 5' end of the DXS423E gene (C.Cooper,personal communication). The STSs for the loci DXS579 and DXS580were developed by sequencing an Alu —PCR product generated from thecorresponding YAC clone (yXpl56 and yXpl66, respectively). The ACTL1STS was developed using one primer specific for this X-linked locus (44) andone primer based on a consensus sequence of P- and y- actin (45). This STSdoes not appear to be specific for ACTLI in human genomic DNA due to thehigh degree of sequence homology throughout the actin gene family. Primersfor SSX (30) and FGDI (46) were developed from the published sequences.The primer sequences and product sizes for previously unpublished STSs aregiven in Table 1. Primer sequences for other STSs were obtained either fromGDB (DXS1008E, DXS1013E, DXS1302), from the CEPH-Genethon database(DXS988, DXS991, DXSI000, DXS1199, DXS1204), or from the literature(ALAS2 (47), DXS674 and DXF34S1 (48), DXS390 (25), DXS6672E (49),DXS1272E (7)). Previously unpublished STSs have been submitted to theGenome Data Base (GDB).

YAC library screening

The YAC libraries used in this study were developed at Centre d'Elude duPolymorphisme Humain (CEPH) (34), Washington University (W.U.) (32),The Imperial Cancer Research Fund (ICRF) (33) and the University ofPennsylvania (U.P.) (50). Probes for DXS423E and OATL2 (51) were used toscreen the ICRF library by filter hybridization. Other markers were used in aPCR-based strategy to screen the W.U., UP. and ICRF libraries. The CEPHlibrary, plates 613 through 804 (CEPH 'A' Human YAC DNA Pools, ResearchGenetics, Huntsville, AL), were screened with an initial set of markers whichallowed us to identify a series of YAC clones. These clones were then usedto identify overlapping YACs through the CEPH-Genethon database (19).Additional YACs were identified in the database on the basis of PCR screeningwith five Genethon CA repeats that map to the region. YACs yXpl56 andyXpl66 had previously been mapped to the pericentromeric region of the Xchromosome by FISH (52).

STS content mapping

PCR was used to place most of the markers into the contig. PCR was carriedout in a Perkin-Elmer 9600 with approximately 20 ng of YAC DNA and 1U.M of each primer in a reaction volume of 25 nl with 2.0 raM MgCl2. ThePCR conditions included an initial heat denaturation at 95°C for I minfollowed by 30 cycles of 94°C, 15 s; 55°C, 15 s; 72°C, 40 s with a finalextension cycle at 72°C for 7 min. All STSs were specific under theseconditions except for 2:93 (anneal at 65°C) and DXS429 (anneal at 60°C).Four markers (8049AR, 743AR, 8060RR, 8059ER) were mapped on Southernblots as described previously (23) due to the repetitive nature of the probesand the inability to make specific STSs for these markers. Pulsed field gelelectrophoresis was used to determine the size of YAC clones. Agarose plugswere prepared and YAC sizes were determined as previously described (37).

at Tufts U

niversity on Decem

ber 28, 2012http://hm

g.oxfordjournals.org/D

ownloaded from

738 Human Molecular Genetics, 1995, Vol. 4, No. 4

Isolation of end-clones from YACs

YAC end-clones were isolated using ligation-mediated PCR (LM-PCR) asdescribed (21). Briefly, YAC DNA was digested with either Alul, Rsal, PvuW,or £coRV followed by addition of a PCR linker. PCR was then performedusing a linker primer and a primer specific for either the left or the right armof the YAC. Two sets of PCR using nested vector primers were used to isolatethe end-clones. End-clones were then tested on human genomic DNA, amouse-human hybrid retaining the X chromosome as the only human materialand mouse genomic DNA. End-clones that hybridized to both the human andX-hybrid but not to the mouse were directly sequenced on an ABI 373ADNA Sequencer. The program PRIMER (v0.5, Whitehead Institute forBiomedical Research) was used to select primers that were then tested onhuman genomic DNA and an X-chromosome mapping panel (23) to confirmthe location of each STS in Xpl 1.21—pi 1.22 prior to STS content mapping.The nomenclature for YAC end-clone STSs is based on the parental YACname, followed by the first letter of the restriction enzyme used, followed byeither L for the left end or R for the right end of the YAC. Sequence dataand primer sequences have been submitted to GenBank and GDB, respectively.

Using LM-PCR, a YAC was determined to be non-chimeric only if bothends were isolated and both mapped to the correct region of the X chromosome.If only one end of a YAC was isolated and determined to be X-linked, wewere unable to determine whether the YAC was chimeric or non-chimeric.However, if only one end of a YAC was isolated and found to map elsewhere,we could conclude that the YAC was indeed chimeric, regardless of the otherend of the YAC. This conservative approach skewed our results and allowedus to identify predominately chimeric YACs.

Fluorescence in situ hybridization

DNA was isolated from cosmids according to standard procedures. CosmidICRFclO4M24l4 (DXS1000) was labeled with biotin and ICRFc 100G11100(ZXDA) was labeled with digoxygenin, both by nick-translation (GIBCO/BRL); additional DNase was added to obtain fragments that were 200-400 bp in size. Unincorporated nucleotides were removed by spin columncentrifugation. The probes were ethanol-precipitated with Cot-1 DNA (GIBCO/BRL), and resuspended in 50% formamide/2xSSC/IO% dextran sulfateovernight at 37°C. The probes were denatured at 70°C for 10 min andreannealed at 37°C for 2.5 h. A small amount of denatured SpectrumOrangeX chromosome alpha satellite probe (Imagenetics) was added to the cosmidmixture just before application to the slides. Slides were incubated overnightat 37°C and washed the next morning in 50% formamide/2xSSC followedby 2XSSC. The biotin signal was detected with Cy5-avidin (BDS) using oneround of amplification with anti-avidin antibody (Oncor). The digoxygeninsignal was detected with fluorescein-labeled anti-digoxygenin (Oncor). Thechromosomes were counterstained with DAPI.

Image analysis was performed with a Zeiss Axioplan microscope using a63 X, 1.25 N.A. Plan Neofluar oil immersion objective. Images were acquiredwith a cooled charge coupled device (CCD) camera (Photometries) andcontrolled via a computer interface software package (CCD Image Capture)developed by T.Rand at Yale University. Image enhancement was done withAdobe Photoshop 2.5 (Adobe). The images were pseudocolored and mergedusing the Gene Join software, also developed by T.Rand. Photographs weremade from slides imaged with a Montage FR2 film recorder (PresentationTechnologies).

Chimerism of selected YAC clones was determined by FISH using totalDNA from appropriate YAC clones as described (53). A YAC was determinedto be non-chimeric if the probe gave a consistent signal only in proximal Xp.If more than one signal was seen consistently on another chromosome orelsewhere on the X chromosome, the YAC was determined to be chimeric. Aseries of YACs that spanned the region were used as FISH probes. Thisapproach skewed our results towards finding non-chimeric clones becauseYACs were selected on the basis of being positive for a large number ofXpl 1.21 - p i 1.22 markers relative to the size of the YAC.

RT-PCR analysis

The somatic cell hybrid panel that was used to determine expression fromboth active and inactive X chromosomes has previously been described(29,54). RNA was isolated from cell lines using RNAzol (Cinna/Biotecx)with two sequential extractions of the RNA to completely eliminate DNAcontamination. The reverse transcription was done as previously described(35). cDNA samples were diluted 1:2 and 1 JJ.1 was subjected to PCR withgene-specific primers. PCR conditions consisted of an initial heat denaturationat 95°C for 2 min followed by 35 cycles of 94°, 15 s; 55°, 15 s; 72°, 40 s ina 50 nl reaction with 1.5 mM MgCl2. The primers used for RT-PCR werethe same as those used for the STS mapping except for DXS1013E which

were: F-tacaggctgtaaacagtacagacat; R-tttgccatctgaaggacctta. This amplifies anapproximately 700 bp product. Products were run out on 2.0% agarose gelsand visualized with ethidium bromide.

ACKNOWLEDGMENTSWe gratefully acknowledge members of the Willard Laboratory for helpfuldiscussions and input and Greg Matera for the use of the CCD microscopesystem and computer software. We thank Brigid McCauley for analysis withthe SEGMAP program. This work was supported by NIH grants GM45441and HG00107 to H.F.W., NS30771 to J.L.G., and a NIH Human GenomeCenter award to D.S. A.P. Monaco was funded by the ICRF, the EuropeanCommunity Genome Analysis Program and HFSPO.

REFERENCES

1. Lyon, M. F. (1961) Gene action in the X-chromosome of the mouse (Musmusculus LJ. Nature, 190, 372-373.

2. Brown, C. J., Ballabio, A., Rupert, J. L., Lafreniere, R. G., Grompe, M.,Tonlorenzi, R. and Willard, H. F. (1991) A gene from the region of thehuman X inactivation centre is expressed exclusively from the inactiveX chromosome. Nature, 349, 38-44.

3. Brown, C. J. and Willard, H. F. (1990) Localization of a gene that escapesinactivation to the X chromosome proximal short arm: Implications forX inactivation. Am. J. Hum. Genet., 46, 273-279.

4. Fisher, E., Beer-Romero, P., Brown, L., Ridley, A., McNeil, J.,Lawrence, J., Willard, H. F, Bieber, F. and Page, D. (1990) Homologousribosomal protein genes on the human X and Y chromosomes: Escapefrom X inactivation and possible implications for Turner syndrome. Cell,63, 1205-1218.

5. Goodfellow, P., Pym, B., Mohandas, T. and Shapiro, L. J. (1984) The cellsurface antigen locus, MIC2X, escapes X-inactivation. Am. J. Hum.Genet., 36, 777-782.

6. Shapiro, L. J., Mohandas, T, Weiss, R. and Romeo, G. (1979) Non-inactivation of an X-chromosome locus in man. Science, 204, 1224-1226.

7. Wu, J., Ellison, J., Salido, E., Yen, P., Mohandas, T. and Shapiro, L. J.(1994) Isolation and characterization of XE169, a novel human gene thatescapes X-inactivation. Hum. Mol. Genet, 3, 153-160.

8. Ellis, N., Yen, P., Neiswanger, K., Sahpiro, L. J. and Goodfellow, P. N.(1990) Evolution of the pseudoautosomal boundary in old world monkeysand great apes. Cell, 63, 977-986.

9. Willard, H. F., Cremers, F., Mandel, J. L., Monaco, A. P., Nelson, D. L.and Schlessinger, D. (1994) Report of the Fifth International Workshopon Human X Chromosome Mapping. Cytogenet. Cell Genet., 67,295-358.

10. Willard, H. F. and Latt, S. A. (1976) Analysis of deoxyribonucleic acidreplication in human X chromosomes by fluorescence microscopy. Am.J. Hum. Genet., 28,213-227.

11. Willard, H. F. (1977) Tissue-specific heterogeneity in DNA replicationpatterns of human X chromosomes. Chromosoma, 61, 61-73.

12. Schwemmle, S., Mehnert, K. and Vogel, W. (1989) How does inactivationchange timing of replication in the human X chromosome? Hum. Genet.,83, 26-32.

13. Jeppeseon, P. and Turner, B. M. (1993) The inactive X chromosome infemale mammals is distinguished by a lack of histone H4 acetylation, acytogenetic marker for gene expression. Cell, 74, 281-289.

14. Therman, E., Sarto, G. E., Disteche, C. and Denniston, C. (1976) A possibleactive segment on the inactive human X chromosome. Chromosoma, 59,137-145.

15. Therman, E. and Susman, B. (1990) The similarity of phenotypic effectscaused by Xp and Xq deletions in the human female: A hypothesis. Hum.Genet, 85, 175-183.

16. Agulnik, A. I., Mitchell, M. J., Mattei, M., Borsani, G., Avner, P. A.,Lerner, J. L. and Bishop, C. E. (1994) A novel X gene with a widelytranscribed Y-linked homologue escapes X-inactivation in mouse andhuman. Hum. Mol. Genet, 3, 879-884.

17. Brown, C. J., Miller, A. P., Carrel, L., Rupert, J., Davies, K. E. andWillard, H. F. (1995) The DXS423E gene in Xpl 1.21 escapes Xchromosome inactivation. Hum. Mol. Genet., in press.

18. Schlessinger, D., Little, R. D., Freije, D., Abidi, F., Zucchi, I., Porta, G.,Pilia, G., Nagaraja, R., Johnson, S. K., Yoon, J., Srivastava, A., Kere, J.,Palmieri, G., Ciccodicola, A., Montanaro, V., Romano, G.,Casamassimi, A. and D'Urso, M. (1991) Yeast artificial chromosome-based genome mapping: Some lessons from Xq24-q28. Genomics, 11,783-793.

at Tufts U

niversity on Decem

ber 28, 2012http://hm

g.oxfordjournals.org/D

ownloaded from

Human Molecular Genetics, 1995, Vol. 4, No. 4 739

19. Cohen, D., Chumakov, I. and Weissenbach, J. (1993) A first-generationphysical map of the human genome. Nature, 366, 698-701.

20. Foote, S., Vollrath, D., Hilton, A. and Page, D. (1992) The human Ychromosome: Overlapping DNA clones spanning the euchromatic region.Science, 258, 60-66.

21. Kere, J., Nagaraja, R., Mumm, S., Ciccodicola, A., D'Urso, M. andSchlessinger, D. (1992) Mapping human chromosomes by walking withsequence-tagged sites from end fragments of yeast artificial chromosomeinserts. Genomics, 14, 241-248.

22. Green, E. D. and Green, P. (1991) Sequence-tagged site (STS) contentmapping of human chromosomes: theoretical considerations and earlyexperiences. PCR Methods Applications, 1, 77-90.

23. Lafreniere, R. G., Brown, C. J., Powers, V. E., Carrel, L., Davies, K. E.,Barker, D. F. and Willard, H. F. (1991) Physical mapping of 60 DNAmarkers in the p21.1—>q21.3 region of the human X chromosome.Genomics, 11, 352-363.

24. Gorski, J. L., Boehnke, M, Reyner, E. L. and Burright, E. N. (1992) Aradiation hybrid map of the proximal short arm of the human Xchromosome spanning incontinentia pigmenti 1 (IP1) translocationbreakpoints. Genomics, 14, 657-665.

25. Reed, V., Rider, S., Maslen, G., Hatchwell, E., Blair, H. J., Uwechue, I.C, Craig, I. W., Laval, S. R , Monaco, A. P. and Boyd, Y. (1994) A 2-Mb YAC contig encompassing three loci (DXF34, DXS14, and DXS390)that lie between Xp 11.2 translocation breakpoints associated withincontinentia pigmenti type 1. Genomics, 20, 341-346.

26. Lehrach, H., Ormanac, R., Hoheisel, J., Larin, Z., Lennon, G., Monaco, A.P., Nizetic, D., Zehetnet, G. and Poutska, A. (1990) In K. E. Davies andS. M. Tilghman (eds), Genome Analysis Volume I: Genetic and PhysicalMapping. Cold Spring Harbor Laboratory Press, Cold Spring Harbor,NY, pp. 39-81.

27. van den Engh, G., Sachs, R. and Trask, B. J. (1992) Estimating distancefrom DNA sequence location in cell nuclei by a random walk model.Science, 257, 1410-1412.

28. Mahtani, M. M. and Willard, H. F. (1990) Pulsed-field gel analysis ofalpha-satellite DNA at the human X chromosome centromere: high-frequency polymorphisms and array size estimates. Genomics, 7,607-613.

29. Brown, C, Flenniken, A., Williams, B. and Willard, H. F. (1990) Xchromosome inactivation of the human TIMP gene. Nucleic Acids Res.,18,4191-4195.

30. Clark; J., Rocques, P. J., Crew, A. J., Gill, S., Shipley, J., Chan, A. M.L., Gusterson, B. A. and Cooper, C. S. (1994) Identification of novelgenes, SYT and SSX, involved in the t(X;18)(pll.2;qll.2) translocationfound in human synovial sarcoma. Nature Genet., 7, 502-508.

31. Willard, H. F., Waye, J. S., Skolnick, M. H., Schwartz, C. E., Powers, V.E. and England, S. B. (1986) Detection of restriction fragment lengthpolymorphisms at the centromeres of human chromosomes by usingchromosome-specific alpha satellite DNA probes: implications fordevelopment of centromere-based genetic linkage maps. Proc. Natl Acad.Sci. USA, 83, 5611-5615.

32. Burke, D. T., Carle, G. F. and Olson, M. V. (1987) Cloning of largesegments of exogenous DNA into yeast by means of artificial chromosomevectors. Science, 236, 806-812.

33. Larin, Z., Monaco, A. P. and Lehrach, H. (1991) Yeast artificialchromosome libraries containing large inserts from mouse and humanDNA. Proc. Natl Acad. Sci. USA, 88, 4123^127.

34. Albertsen, H. M., Abderrahim, H., Cann, H. M., Dausset, J., Le Paslier,D. and Cohen, D. (1990) Construction and characterization of a yeastartificial chromosome library containing seven haploid human genomeequivalents. Proc. Natl Acad. Sci. USA, 87, 4256-4260.

35. Pierce, J. C, Sauer, B. and Steinberg, N. (1992) A positive selectionvector for cloning high molecular weight DNA by the bacteriophage PIsystem: Improved cloning efficacy. Proc. Natl Acad. Sci., 89, 2056-2060.

36. Greig, G. M., Sharp, C. B., Carrel, L. and Willard, H. F. (1993) Duplicatedzinc finger protein genes on the proximal short arm of the human Xchromosome: isolation, characterization and X-inactivation studies. Hum.Mol. Genet., 2, 1611-1618.

37. Lafreniere, R. G., Brown, C. J., Rider, S., Chelly, J., Taillon-Miller, P.,Chinault, C , Monaco, A. P. and Willard, H. F. (1993) 2.6 Mb YACcontig of the human inactivation center region in Xql3: physical linkageof the RPS4X, PHKA1, X1ST and DXS128E genes. Hum. Mol. Genet., 2,1105-1115.

38. Nakao, M., Sutcliffe, J. S., Durtschi, B., Mutirangura, A., Ledbetter, D.H. and Beaudet, A. L. (1994) Imprinting analysis of three genes in thePrader—Willi/Angelman region: SNRPN, E6-associated protein, and PAR-2 (D15S225E). Hum. Mol. Genet., 3, 309-315.

39. Zemel, S., Bartolomei, M. S. and Tilghman, S. M. (1992) Physical linkageof two mammalian imprinted genes, H19 and insulin-like growth factor2. Nature Genet., 2, 61-65.

40. Kitsberg, D., Selig, S., Brandeis, M., Simon, I., Keshet, I., Driscoll, D.J., Nicholls, R. D. and Cedar, H. (1993) Allele-specific replication timingof imprinted gene regions. Nature, 364, 459—463.

41. Knoll, J. H. M., Cheng, S. and Lalande, M. (1994) Allele specificityof DNA replication timing in the Angelman/Prader—Willi syndromeimprinted chromosomal region. Nature Genet., 6, 41—46.

42. Arenstorf, H. P., Kandpal, R. P., Baskaran, N., Parimoo, S., Tanaka, Y.,Kitajima, S., Yasukochi, Y. and Weissman, S. M. (1991) Constructionand characterization of a Not\—BsuE linking library from the human Xchromosome. Genomics, 11, 115-123.

43. Italiano, C, John, S., Hum, D., MacKenzie, R. and Rozen, R. (1991) Apseudogene on the X chromosome for the human trifunctional enzymeMTHFD. Genomics, 10, 1073-1074.

44. D'Esposito, M., Pilia, G. and Schlessinger, D. (1994) BLOCK-based PCRmarkers to find gene family members in human and comparative genomeanalysis. Hum. Mol. Genet., 3, 735-740.

45. Gunning, P., Ponte, P., Okayama, H., Engel, J., Blau, H. and Kedes, L.(1983) Isolation and characterization of full length cDNA clones forhuman a-, (5- and y-actin mRNAs: skeletal but not cytoplasmic actinshave an amino-terminal cysteine that is subsequently removed. Mol. Cell.Biol, 3, 787-795.

46. Pasteris, N. G., Cadle, A., Logie, L. J., Porteous, M. E. M., Schwartz, C.E., Stevenson, R. E., Glover, T. W., Wilroy, R. S. and Gorski, J. L. (1994)Isolation and characterization of the faciogenital dysplasia(Aarskog — Scott syndrome) gene: a putative Rho/Rac guanine nucleotideexchange factor. Cell, 79, 669-678.

47. Cotter, P. D., Willard, H. E, Gorski, J. L. and Bishop, D. F. (1992)Assignment of human delta-aminolevulinate synthase (ALAS2) to a distalsubregion of band Xp 11.21 by PCR analysis of somatic cell hybridscontaining X;autosome translocations. Genomics, 13, 211-212.

48. Reed, V., Laval, S., Maslen, G. and Boyd, Y. (1993) Partial sequencedata from three evolutionarily conserved loci from the proximal shortarm of the human X chromosome; assignment of DXF34S1 to Xpl 1.21-cen: Cytogenet. Cell Genet., 62, 153-155.

49. Wehnert, M., Lindsay, E. A., Baldini, A., Lee, C. C. and Caskey, C. T.(1993) Characterization and physical mapping of X-chromosome-specificcDNAs. Am. J. Hum. Genet., 53, 1369A.

50. Lee, J. T., Murgia, A., Sosnoski, D. M., Olivos, I. M. and Nussbaum, R. L.(1992) Construction and characterization of a yeast artificial chromosomelibrary for Xpter—Xq27.3: A systematic determination of cocloning rateand X-chromosome representation. Genomics, 12, 526-533.

51. Mitchell, G. A., Looney, J. E., Brody L. C , Steel, G., Suchanek, M.,Engelhardt, J. E, Willard, H. F. and Valle, D. (1988) Human ornithine-5-aminotransferase: cDNA cloning and analysis of the structural gene.J. Biol. Chem., 263, 14288-14295.

52. Driesen, M., Wapenaar, M., Rasch, M., Meershoek, E. and van Ommen, G.(1991) Isolation and regional assignment of 28 YACs from theXpter-Xp21/Xcen region. Cytogenet. Cell Genet., 58, 2062.

53. Wolff, D. J., Brown, C. J., Schwartz, S., Duncan, A., Surti, S. andWillard, H. F. (1994) Small marker X chromosomes lack the X inactivationcenter: Implications for karyotype/phenotype correlations. Am. J. Hum.Genet., 55, 87-95.

54. Willard, H. F., Brown, C. J., Carrel, L., Hendrich, B. and Miller, A. P.(1993) Epigenetic and chromosomal control of gene expression: molecularand genetic analysis of X chromosome inactivation. Cold Spring HarborQuant. Symp. Biol, 58, 315-322.

at Tufts U

niversity on Decem

ber 28, 2012http://hm

g.oxfordjournals.org/D

ownloaded from