1 23

Archives of VirologyOfficial Journal of the VirologyDivision of the International Union ofMicrobiological Societies ISSN 0304-8608 Arch VirolDOI 10.1007/s00705-013-1814-4

The molecular characterisation of a Sida-infecting begomovirus from Jamaica

Cheryl Stewart, Tatsuya Kon, MariaRojas, André Graham, Darren Martin,Robert Gilbertson & Marcia Roye

1 23

Your article is protected by copyright and

all rights are held exclusively by Springer-

Verlag Wien. This e-offprint is for personal

use only and shall not be self-archived

in electronic repositories. If you wish to

self-archive your article, please use the

accepted manuscript version for posting on

your own website. You may further deposit

the accepted manuscript version in any

repository, provided it is only made publicly

available 12 months after official publication

or later and provided acknowledgement is

given to the original source of publication

and a link is inserted to the published article

on Springer's website. The link must be

accompanied by the following text: "The final

publication is available at link.springer.com”.

ANNOTATED SEQUENCE RECORD

The molecular characterisation of a Sida-infecting begomovirusfrom Jamaica

Cheryl Stewart • Tatsuya Kon • Maria Rojas •

Andre Graham • Darren Martin • Robert Gilbertson •

Marcia Roye

Received: 4 April 2013 / Accepted: 1 July 2013

� Springer-Verlag Wien 2013

Abstract The complete DNA sequence of both genome

components of a new begomovirus (Sida golden mosaic

Buckup virus-[Jamaica:St. Elizabeth:2004]; SiGMBuV-

[JM:SE:04]) was determined from a field-infected Sida sp.

sample from Buckup, St. Elizabeth, Jamaica. Phylogenet-

ically, both genome components of SiGMBuV-[JM:SE:04]

are most closely related to malvaceous weed-infecting

Floridian and Mexican begomoviruses. Its DNA-B is a

recombinant molecule, the majority of which was derived

from a virus resembling Sida yellow mosaic Yucatan virus-

[Mexico:Yucatan:2005] (SiYMYuV-[MX:Yuc:05]), while

nucleotides 43-342 were derived from a virus resembling

Sida golden mosaic virus-[United States of America:Flor-

ida] (SiGMV-[US:Flo]). Symptomatic infectivity of our

cloned SiGMBuV-[JM:SE:04] components was confirmed

in Nicotiana benthamiana.

Most agriculturally important geminiviruses belong to the

genus Begomovirus and are estimated to be responsible for

billions of dollars worth of lost production, especially in

tropical locales [5, 13]. Begomoviruses endemic to the

Western Hemisphere have bipartite genomes organised on

two DNA molecules. The sequences of the cognate DNA-

A and DNA-B of a begomovirus are divergent except for

200 base pairs, called the common region (CR) [9]. The

epidemiology of begomoviruses is incomplete without the

study of weeds, as crop-infecting begomoviruses may have

arisen from endemic weed-infecting ones [2], and there are

weed-infecting begomoviruses that can infect crops [1]. It

has been suggested that Sida spp. should strongly influence

the evolution of geminiviruses since these weeds are

perennial, ubiquitous and host members of at least 26 be-

gomovirus species [2, 5]. The aim of this work was to

molecularly characterise, and explore the infectivity of, the

cloned components of Sida golden mosaic Buckup virus, a

new begomovirus isolated from Sida sp. in Jamaica.

DNA was extracted [4] from four Sida spp. plants dis-

playing yellow mosaic symptoms. Degenerate primers [10]

were used to generate 1.3-kb amplicons of both the DNA-A

and DNA-B from one sample, which were cloned (TOPO

TA Cloning Kit, Invitrogen). The 50-ll PCR reaction

consisted of 300 ng of template DNA, 2.5 mM each dNTP,

0.2 lM each primer, and Taq DNA polymerase (NEB; used

according to the manufacturer’s instructions). The ampli-

fication programme had an initial denaturation at 94 �C for

3 minutes, followed by 30 cycles each of 30 seconds at

94 �C, 1 minute at 55 �C and 2 minutes at 72 �C and a final

extension at 72 �C for 10 minutes. Clones were sequenced

by Macrogen Inc. (South Korea). Based on this sequence,

overlapping primers were designed that would amplify the

entire DNA-A (pBuNdeIv2278/pBuNdeIc2253; ATTGC

CATATGAATCGTTAGCTGACTGC/ TCGATCATATG

CCAAGGCGTTGAACG; the NdeI restriction site is

highlighted) and the DNA-B (pBuSacIv2594/pBuSacIc2563;

CGATCGAGCTCTCTCAAACTTTCTCATTC/ CGATAGA

GCTCAACCGGGGTACACACTTC; the SacI restriction site

is highlighted). Another DNA-B primer pair (pBuMPv2480/

C. Stewart (&) � A. Graham � M. Roye

Biotechnology Centre, 2 St. John’s Close, University of the West

Indies, Mona, Kingston 7, Jamaica

e-mail: cherylsstewart@gmail.com

T. Kon � M. Rojas � R. Gilbertson

Department of Plant Pathology, University of California Davis,

1 Shields Avenue, Davis, CA 95616, USA

D. Martin

Institute of Infectious Disease and Molecular Medicine,

University of Cape Town, Observatory 7925,

Republic of South Africa

123

Arch Virol

DOI 10.1007/s00705-013-1814-4

Author's personal copy

pBuNSPc279; GTAAAGCGTTCATGAGAAGTTCTT

ACTTCC /ACTCAGCAACATCGTCCAGAATCAGACA

CG) was used to screen samples for this virus. Full-length

amplicons were generated using Pfu Turbo proofreading

DNA polymerase (Stratagene) under the conditions outlined

above and cloned (Zero Blunt TOPO PCR Cloning Kit,

Invitrogen). Select clones were sequenced at the UCDNA

Sequencing Facility at the University of California Davis

(UCD). The sequences were analysed as described previously

[12]. The alignments were additionally analysed for recom-

bination using RDP3 [8], using the program’s default settings

and only accepting as significant evidence of recombination

signals detected by four or more of the seven distinct

recombination detection methods implemented in this

software.

The two DNA-A (HQ008338, JX162591) and DNA-B

(HQ009518, JX162592) clones were isolated from the

same sample and were almost identical, sharing a 99.8 %

sequence identity. (Clones HQ008338 and HQ009518 were

isolated previously; [12]). The CRs of the DNA-A and

DNA-B clones shared 95.7 % identity. Comparative

nucleotide sequence analysis revealed that both the DNA-

A and DNA-B components of SiGMBuV were most clo-

sely related to Sida yellow mosaic Yucatan virus (Si-

YMYuV), sharing 87 % and 79.2 % identity, respectively

(Table 1). Since the DNA-A of SiGMBuV falls below the

ICTV-recommended 89 % species demarcation threshold

[5], it may belong to a new species, which we propose be

named ‘‘Sida golden mosaic Buckup virus-[Jamaica:St.

Elizabeth:2004]’’ (SiGMBuV-[JM:SE:04]). Phylogenetic

analysis suggests that SiGMBuV-[JM:SE:04] was most

closely related to SiYMYuV-[MX:Yuc:05] and Sida

golden mottle virus-[United States: Florida] (SiGMoV-

[US:Flo]; [12]). The CR of SiGMBuV-[JM:SE:04] con-

tained the expected motifs, although there is an imperfectly

repeated iteron (TACCCC…GGGGTA…GGGTTA). The

iteron-related domain of this begomovirus contained the

conserved phenylalanine residue (SIKRFKVS).

Recombination has been shown to contribute to the

diversity of begomoviruses and could potentially be

responsible for the emergence of novel begomoviruses as

agronomic threats. We therefore assessed the genome of

SiGMBuV-[JM:SE:04] for evidence of recombination. The

various recombinant detection methods implemented in the

computer program RDP3 [8] indicated that SiGMoV-

[US:Flo] and SiYMYuV-[MX:Yuc:05] DNA-A compo-

nents were recombinant, with parental sequences related to

the DNA-A of SiGMBuV-[JM:SE:04] DNA-A. The RDP3

analysis of 68 representative sequences indicated, for all

seven recombination detection methods, strong support

(p=8.6 9 10-5 for the 3SEQ method to p = 6.9 9 10-12 for

the RDP method) for bases 43-342 of the SiGMBuV-

[JM:SE:04] DNA-B arising from a virus closely related to

Sida golden mosaic virus-[United States of America:Flor-

ida] (SiGMV-[US:Flo]; AF039841) and the rest of its

sequence from a virus closely related to SiYMYuV-

[MX:Yuc:05].

The cloned components were tested for their infectivity.

Gold particles were coated with 5 lg of each SiGMBuV

component, which were used to bombard Nicotiana

benthamiana and Sida spp. plants at the 2- to 3-leaf stage

(Dupont PDS-100 Biolistic System). Negative control

Table 1 Pairwise comparisons

(%) of the DNA-As and DNA-

Bs of selected geminiviruses

that are at least 65 % similar to

SiGMBuV-[JM:SE:04]

*, Begomoviruses isolated from

Jamaica; –, sequence not

available

Virus Accession number SiGMBuV-[JM:SE:04]

DNA-A

SiGMBuV-[JM:SE:04]

DNA-B

AbMV-[DE] X15983, X15984 80.1 66.8

AbMV-[US:Haw] U51137, U51138 79.4 66.9

AbMV-[ZA:CT:07] AM886130 – 69.8

CdTV-Sb[MX:Sin:05] DQ347945 81.8 –

CoYSV-[MX:Yuc:05] DQ875868 DQ875869 81.7 72.4

MaYMJV* FJ600482, FJ600484 80.1 61.5

OYMMV-[MX:Maz3:04] DQ022611 82.7 –

SiGMCRV-[CR] X99550, X99551 80.0 62.4

SiGMHV-[HN] Y11097, Y11098 83.8 65.2

SiGMoV-[US:Flo] GU997691, GU997692 86.0 75.3

SiGMV-[US:Flo] AF039841 – 70.6

SiYMYuV-[MX:Yuc:05] DQ875872, Q875873 87.0 79.2

SiYVV-[HN] Y11099, Y11100 83.4 64.8

ToMoV-[PR:04] AY965900, AY965901 78.7 67.3

ToMoV-[US:Flo:89] L14460, L14461 79.6 65.8

WGMSTV-[JM:Alb:05]* DQ395343, EU158095 81.1 65.1

C. Stewart et al.

123

Author's personal copy

plants were bombarded with gold particles only, while the

positive control plants were bombarded with bean dwarf

mosaic virus-[Colombia:1987] (BDMV-[CO:87]). The

plants were maintained in a growth chamber at 25 �C,

50 % relative humidity and 16 h of light in every 24 h

cycle and observed for symptoms. The youngest leaves of

symptomatic N. benthamiana from this experiment were

ground in phosphate buffer, and the resulting sap was used

to inoculate Celite-abrased leaves of healthy N. benth-

amiana and Sida spp. plants at the 2- to 3-leaf growth

stage. N. benthamiana plants (2/8) bombarded with SiG-

MBuV-[JM:SE:04] had leaf curling and yellow mosaic

(Fig. 1A, B) 13 days post-inoculation (dpi). DNA extracted

from 6 out of 8 N. benthamiana plants produced PCR

amplicons with PBC1v2039/PCRc2, pBuSacIv2594/pBu-

SacIc2563 and with pBuNdeIv2278/pBuNdeIc2253, sug-

gesting that six were infected (four asymptomatically). N.

benthamiana plants (2/4) to which SiGMBuV-[JM:SE:04]

had been sap transmitted produced symptoms of blistering,

leaf curling and yellow mosaic 21 dpi (Fig. 1C) and gen-

erated amplicons with PBC1v2039/PCRc2 and

pBuMPv2480/pBuNSPc279.

Partial tandem repeat clones were used to inoculate N.

benthamiana, S. lycopersicum, Malvastrum americanum

and Sida spp. using methods described previously [7].

Negative control plants were inoculated using A. tum-

efaciens that had not been transformed. Inoculated plants

were maintained under the abovementioned conditions and

were subsequently tested for the presence of this virus by

extracting DNA from two newly emerged leaves and using

the degenerate begomovirus, specific or overlapping

primers as before. All five of the N. benthamiana plants

agroinoculated with these clones displayed leaf curling,

yellow mosaic and blistering by 19 dpi (Fig. 1D) and

generated amplicons with PAC1v1978/PAV1c715 and

pBuMPv2480/pBuNSPc279. Neither the five SiGMBuV-

[JM:SE:04] agroinoculated S. lycopersicum nor the five M.

americanum plants developed symptoms. The presence of

begomovirus was, however, detected by PCR in three of

the S. lycopersicum (PAC1v1978/PAV1c715 and

pBuMPv2480/pBuNSPc279) plants and four of the M.

americanum (pBuMPv2480/pBuNSPc279) plants. Despite

the infectivity of the cloned viruses in N. benthamiana,

none of the inoculated Sida plants (four subjected to

Fig. 1 Infectivity studies of SiGMBuV-[JM:SE:04] in Nicotiana

benthamiana. A. N. benthamiana bombarded with gold particles 42

dpb. B. N. benthamiana subject to particle bombardment with

SiGMBuV-[JM:SE:04] monomers 42 days post-bombardment (dpb).

Note the blistering, leaf curling and yellow mosaic of the SiGMBuV-

[JM:SE:04]-infected plant. C. Blistering, yellow mosaic and leaf

curling of N. benthamiana after sap transmitting SiGMBuV-

[JM:SE:04] from particle-bombarded N. benthamiana to uninfected

N. benthamiana seedlings, 32 days post-inoculation (dpi). D. N.

benthamiana agroinjected with SiGMBuV-[JM:SE:04]. The plant

showed symptoms of leaf curling, yellow mosaic and blistering 19 dpi

Sida-infecting begomovirus from Jamaica

123

Author's personal copy

particle bombardment, four subjected to sap transmission

and five subjected to agroinoculation) displayed symptoms

of infection or produced amplicons with the pBuN-

deIv2278/pBuNdeIc2253 primer pair.

Since Sida is host to at least four viruses in Jamaica [3,

6, 11, 12] and SiGMBuV-[JM:SE:04] can asymptomati-

cally infect tomato, Sida may provide an environment for

mixed infection and recombination. The fact that the

SiGMBuV-[JM:SE:04] DNA-B is recombinant lends cre-

dence to the idea that Sida-infecting begomoviruses may be

participating in the evolution of agriculturally relevant

begomoviruses in Jamaica. Our SiGMBuV-[JM:SE:04]

clones are clearly biologically active and are members of a

lineage of primarily Sida-infecting Caribbean, Mexican

and Floridian begomoviruses, and our infectivity results

indicate that members of this species may pose a threat to

Jamaican tomato production.

Acknowledgments Funding was provided by the School of Grad-

uate Studies and Research and the Principal’s New Initiative Fund,

University of the West Indies, and by the Department of Plant

Pathology, University of California Davis.

References

1. Al-Aqeel HA (2003) Characterisation of two begomoviruses

isolated from Sida santaremensis Monteiro and S. acuta Burm f.

MSc. Thesis, University of Florida. http://etd.fcla.edu/UF/

UFE0002838/alaqeel_h.pdf. Accessed 24 Mar 2010

2. Andrade EC, Manhani GG, Alfenas PF, Calegario RF, Fontes

EPB, Zerbini FM (2006) Tomato yellow spot virus, a tomato

infecting begomovirus from Brazil with a closer relationship to

viruses from Sida sp. forms pseudorecombinants with begom-

oviruses from tomato but not from Sida. J Gen Virol

87:3687–3696

3. Collins AM (2009) Molecular characterisation of the geminivi-

ruses infecting Wissadula amplissima in Jamaica. PhD thesis,

University of the West Indies, Mona

4. Dellaporta SL, Wood J, Hicks JB (1983) A plant DNA mini-

preparation: Version II. Plant Mol Biol Rep 1:19–21

5. Fauquet CM, Briddon RW, Brown JK, Moriones E, Stanley J,

Zerbini M, Zhou X (2008) Geminivirus strain demarcation and

nomenclature. Arch Virol 153:783–821

6. Graham AP, Stewart CS, Roye ME (2007) First report of a be-

gomovirus infecting two common weeds: Malvastrum america-

num and Sida spinosa in Jamaica. Plant Pathol 56:340

7. Kon T, Dolores LM, Bajet NB, Hase S, Takahashi H, Ikegami M

(2003) Molecular characterisation of a strain of Squash leaf curl

China virus from the Philippines. J Phytopathol 151:535–539

8. Martin DP, Lerney P, Lott M, Moulton V, Posada D, Lefeuvre P

(2010) RDP3: A flexible and fast computer program for analyzing

recombination. Bioinformatics 26:2462–2463

9. Rojas MR, Hagen C, Lucas WJ, Gilbertson RL (2005) Exploiting

chinks in the plant’s armour: evolution and emergence of gem-

iniviruses. Annu Rev Phytopathol 43:361–394

10. Rojas MR, Gilbertson RL, Russell DR, Maxwell DP (1993) Use

of degenerate primers in the polymerase chain reaction to detect

whitefly-transmitted geminiviruses. Plant Dis 77:340–347

11. Roye ME, McLaughlin WA, Nakhla MK, Maxwell DP (1997)

Genetic diversity among geminiviruses associated with the weed

species Sida spp., Macroptilium lathyroides and Wissadula am-

plissima from Jamaica. Plant Dis 81:1251–1258

12. Stewart CS, Kon T, Gilbertson RL, Roye ME (2011) First report

of the complete sequence of Sida golden yellow vein virus from

Jamaica. Arch Virol 156:1481–1484

13. Varma A, Malathi VG (2003) Emerging geminivirus problems: a

serious threat to crop production. Annals Appl Biol 142:145–164

C. Stewart et al.

123

Author's personal copy