Ž .Parasitology International 49 2000 309]320

The Trypanosoma cruzi genome contains ion motiveATPase genes which closely resemble Leishmania

proton pumpsq

John C. Meadea,U, Chunling Lib, Jonathan K. Stilesa,1,Michelle E. Moateb, Jeffrey I. Penny c, Sanjeev Krishnac,

Richard W. Finley b

aDepartment of Microbiology, Uni ersity of Mississippi Medical Center, 2500 North State Street, Jackson, MS 39216-4505,USA

bDi ision of Infectious Diseases, Department of Medicine, Uni ersity of Mississippi Medical Center, 2500 North State Street,Jackson, MS 39216-4505, USA

cDepartment of Cellular and Molecular Sciences, St. George’s Hospital Medical School, Cranmer Terrace, London SW 17ORE, UK

Accepted 30 August 2000

Abstract

DNA fragments homologous to members of the family of P-type ion-motive ATPases were identified inŽ .Trypanosoma cruzi by polymerase chain reaction PCR amplification. The sequence of one fragment, which closely

Ž . qresembled 87% identity the tandemly linked proton pumps in Leishmania, was used to characterize the H -ATPaseŽ .genes in T. cruzi. The T. cruzi proton pump locus contains four tandemly repeated genes TCH1-4 separated by 1.1

kb intergenic regions. The nucleotide sequence of one cloned gene of the tandem array contains a 2775 nt openreading frame encoding a predicted 101 908-Da protein of 925 amino acids. The TCH genes are expressed as 3.8 and4.9 kb polyadenylated transcripts in the epimastigote stage; expression of both transcripts is reduced in metacyclictrypomastigotes. Results of 59 and 39 RACE transcript mapping indicate that the 3.8 kb message is generated from

Ž .within the tandemly repeated locus. The 3.8 kb TCH transcript has the T. cruzi mini-exon appended to a short 40 ntŽ .59 untranslated region UTR and has a 927 nt 39 UTR. The full peptide sequence of the T. cruzi proton pump is

Abbre¨iations: PCR, polymerase chain reaction; TCH, Trypanosoma cruzi proton ATPase; nt, nucleotide base; kb, kilobase pairs;UTR, untranslated region; ORF, open reading frame; kDa, kilodaltons; RACE, rapid amplification of cDNA ends

q Note: Nucleotide sequences data reported in this paper are available in the GenBankTM database under the accession numbersAF000161, AF004423 and AF004424.

U Corresponding author. Tel.: q1-601-984-1914; fax: q1-601-984-1708.Ž .E-mail address: jmeade@microbio.umsmed.edu J.C. Meade .

1Present address: Department of Microbiology and Immunology, Morehouse School of Medicine, 720 Westview Drive, Atlanta,GA 30310-1495.

1383-5769r00r$ - see front matter Q 2000 Elsevier Science Ltd. All rights reserved.Ž .PII: S 1 3 8 3 - 5 7 6 9 0 0 0 0 0 6 1 - 1

( )J.C. Meade et al. r Parasitology International 49 2000 309]320310

80% identical to the Leishmania pump but lacks the extended carboxyl tail present in the Leishmania ATPase. Anantibody that recognizes the 110-kDa Leishmania dono¨ani proton pump cross-reacts with a 100-kDa protein inlysates of T. cruzi epimastigotes. Q 2000 Elsevier Science Ltd. All rights reserved.

Keywords: Trypanosoma cruzi; Proton motive ATPase; Trypanosomatidae; Leishmania; P-type ATPase

1. Introduction

Trypanosoma cruzi, a parasitic hemoflagellateof the family Trypanosomatidae, has a complexlife cycle with morphologically distinct stages inits insect and mammalian hosts. The epimastigotestage resides within the alimentary tract of redu-viid insects, an environment that can vary fromacidic to alkaline, while T. cruzi trypomastigotesare present in the blood and tissues of vertebratehosts where they invade a variety of cell types.After entry via a process that involves lysosomalrecruitment, trypomastigotes escape from thehighly acidic lysosomal vacuoles into the pH neu-tral cytoplasm and propagate as obligate intracel-lular amastigotes. The factors controlling pHhomeostasis under the fluctuating external pHmilieu encountered by the different T. cruzi de-velopmental stages are not well defined. In yeast,plants and protozoans, an electrogenic plasmamembrane P-type Hq-ATPase participates in theregulation of intracellular pH. P-type ATPasesare vanadate sensitive, single subunit, ion or ami-nophospholipid translocators containing severalwell conserved motifs, including an essential as-partate residue that is phosphorylated during the

w xreaction cycle 1]3 .An ATP-dependent Hq extrusion mechanism

with characteristics of P-type ion-motive pumpshas been implicated in maintenance of internal

Ž .pH pH and recovery from acid loads in T. cruziiw xepimastigotes 4 . This activity is supported by an

inward directed Kq channel and a Cly channel,and functions in amastigote and trypomastigote

w x qstages 5 . In addition, a P-type H -ATPase activ-ity present in T. cruzi developmental forms, par-ticipates in the acidification of internal compart-

w xments 6 . Studies in Leishmania, a related para-site in the family Trypanosomatidae, also demon-strate the involvement of an electrogenic protonmotive P-type ATPase in nutrient acquisition and

w xmaintenance of pH 7]10 . A pair of tandemlyilinked, developmentally regulated ATPases havebeen isolated from the L. dono¨ani genomew x11,12 , and phylogenetically group with the class

w xof plant and fungal P-type proton pumps 1,3 .Similarities in phylogeny and life cycle of theseparasites, as well as the crucial role of Hq ions intheir physiology, suggested that T. cruzi possessedHq-ATPase genes similar to the Leishmania pro-ton pumps. In this study we characterize atandemly repeated locus of P-type Hq-ATPasesin Trypanosoma cruzi that are highly similar totheir Leishmania homologues.

2. Materials and methods

2.1. Organisms

Trypanosoma cruzi Sylvio-X10r7 epimastigoteswere cultured at 288C in Liver-Infusion-Tryptosemedium supplemented with 10% heat-inactivated

Ž . w xfetal bovine serum HIFBS 13 . Leishmaniadono¨ani Ethiopian strain L82 promastigotes werecultured at 268C in HOMEM media supple-mented with 15% HIFBS and 25 mgrml gen-

w xtamycin sulfate 14 . Trypanosoma and Leishma-nia parasites were harvested for nucleic acid

Ž 7isolation in mid-logarithmic phase 1]2=10.cellsrml at 1100=g with two washes in phos-

Žphate-buffered-saline PBS; 137 mM NaCl, 15.3.mM Na HPO , 1.5 mM KH PO , 2.7 mM KCl .2 4 2 4

2.2. Nucleic acid isolation

Trypanosoma cruzi X10r7 genomic DNA wasisolated using the DEPC-Triton X-100 method

w xdescribed by Riley and Krieger 15 and X10r7total cellular RNA was extracted with Tri ReagentŽ .Molecular Research Center, Cincinnati, OH .

( )J.C. Meade et al. r Parasitology International 49 2000 309]320 311

Trypanosoma cruzi CL strain DNA and total RNAfrom T. cruzi Y strain metacyclic trypomastigotesand Y and CL strain epimastigotes was supplied

w xby C. Hadaris 16 . Messenger RNA was isolatedŽfrom total RNA with Oligotex resin Qiagen,

.Valencia, CA . RNA and DNA were quantitatedby 260 nm UV spectrophotometry and RNA qual-ity was verified by ethidium bromide staining ofaliquots after electrophoresis through agarosegels.

2.3. Polymerase chain reaction

Oligonucleotide primers for PCR amplificationof T. cruzi P-type ATPases incorporated the

w xcodon bias observed in T. cruzi genes 17 andwere designed to recognize two highly conservedamino acid motifs of cation ATPase genes,the ATP phosphorylation site, DKTGTLT, and

w xthe ATP binding site, TGDGVND 1 . The 59Ž . Ž .primer was the 20-mer, GA C,T AAGAC G,T -

Ž . Ž . Ž .GG C,T AC G,T CT G,T AC, and the 39 anti-Ž . Ž .sense primer the 20-mer, TC A,G TT A,C -

Ž . Ž . Ž . ŽAC A,G CCGTC A,G CC A,C GT Fig. 2, nt.2216]2235 and 2969]2988 . Negative controls,

which omitted T. cruzi template DNA, were in-cluded in each amplification experiment.

2.4. Genomic libraries

A T. cruzi X10r7 genomic DNA library wasŽconstructed by ligation of size selected 12]22

.kb , partial Sau3A I digested, DNA into bacterio-phage lambda EMBL3 arms and packaged. TheSau3A I library, approximately 20 000 plaques,was plated on E. coli LE392 cells, transferred tonylon membranes, and screened with a 773 nt

Ž .PCR fragment as hybridization probe Fig. 1 .Four positive plaques, selected by two rounds ofscreening, each contained an array of tandemlyrepeated fragments. The sequence of four restric-

Ž .tion fragments from one lambda plaque a27was determined; 1.0, 2.4 and 2.8 kb Pst I and 3.9kb Xho I fragments.

2.5. Southern and Northern blot analysis

Southern blots for mapping the TCH genomicŽlocus contained T. cruzi X10r7 genomic DNA 5

. Žmg digested with eight single Sac I, Hind III,.Xho I, Pst I, P¨u II, Sph I, Xba I, and Sma I

Žand 15 double Hind III plus Sac I, Xho I, Pst I,P¨u II, or Sph I; Xho I plus Sac I, Pst I, P¨u II,or Sph I; Sac I plus Xba I, P¨u II, Pst I or Sph I;

.P¨u II plus Sph I and Xba I plus Pst I restric-

Fig. 1. Physical map of the Trypanosoma cruzi proton ATPase genomic locus. The hatched boxes represent predicted protein codingregions. The direction of transcription is from left to right. The boundaries of lambda clone a27 and fragments subcloned forsequencing are indicated below the locus. The boundaries of DNA fragments used as probes in Southern mapping and Northernanalysis; genomic clones Xho I]Pst I, Pst I]Pst I, Sph I]Xho I and the PCR, 59 RACE and 39 RACE fragments, are delineated

Ž . Ž . Ž . Ž . Ž .above the locus. Restriction sites: Hind III H , Pst I P , Sac I S , Sph I Sp , Xho I X .

( )J.C. Meade et al. r Parasitology International 49 2000 309]320312

tion endonuclease combinations. Blots were hy-bridized at 428C to six radiolabelled probes; 773nt PCR, 1035 nt Pst I]Pst I, 731 nt Sph I]Xho I,879 nt Xho I]Pst I, 765 nt 39 RACE and 593 nt

Ž59 RACE fragments Fig. 1; PCR, P]P, Sp-X,. ŽX-P, 39, 59 . For Northern blot analysis, mRNA 2

.mg was resolved in standard formaldehydeagarose denaturing gels, transferred to nylonmembranes, and hybridized at 428C with radi-olabelled 773 nt PCR or 765 nt 39 RACE products.Blots were washed to a final stringency of 0.2 X

Ž .SSC 30 mM NaCl, 3 mM sodium citrate , 0.5%Ž .sodium dodecyl sulfate at 458C Northerns or

Ž .558C Southerns and exposed for autoradiogra-phy at y708C.

2.6. DNA sequence analysis

PCR products and genomic clones were se-quenced by the dideoxy chain termination method

Žusing a modified T7 polymerase Sequenase;.United States Biochemical, Cleveland, OH . In-

ternal oligonucleotide primers were designed tocomplete the sequence on both strands. DNAsequence data were deposited in GenBank under

Ž .the accession numbers AF004423 TCH1 ,Ž . Ž .AF004424 TCH2 , and AF000161 TCH 2 and 3 .

2.7. 59 and 39 mapping of TCH transcripts

TCH cDNA specific for 59 transcript terminiwas produced by reverse transcription with a 16-mer antisense oligonucleotide located within theTCH coding region, GCTTCACAAGATCACCŽ .Fig. 2, nt 1682]1697 . The 59 ends of TCH cDNAwere PCR amplified using the same 16-mer anti-sense primer and a 28-mer primer, CGCTAT-TATTGATACAGTTTCTGTACTA, designed tobind the 39 nt mini-exon appended to T. cruzi

w xtranscripts 18 . The genomic location of the 39ends of TCH transcripts was determined, by PCRamplification of TCH transcript termini fromcDNA reversed transcribed from 1 mg total RNA

Žusing oligo dT primer, with a 39 RACE kit Gibco,.Grand Island, NY using the manufacturer’s uni-

versal amplification primer as 39 antisense primerand a 59 20-mer primer GATTCACCACACT-

Ž .GTTGAGG, Fig. 2, nt 278]297 and 4139]4158 .

2.8. Antibody preparation

The large cytoplasmic loop of the L. dono¨aniŽ . ŽATPase 1A LDH1A peptide Fig. 3, aa 313]625

.of LD1A was PCR amplified using 59 senseprimer GAATTCACGACGCTGGCGGT and 39antisense primer, GAATTCTTAGCGCG-CAGCGTCCGT. This fragment was expressed as

Ž .a maltose binding protein MBP -LDH1A fusionŽpeptide in pMAL-c2 New England Biolabs, Bev-

.erly, MA . Isolation of fusion peptide and purifiedLeishmania peptide after MBP cleavage by factorXa, were as per manufacturer’s directions. Rabbitsused in preparation of antibody were given threesubcutaneous injections of 100 mg purified 45-kDaLeishmania LDH1A cytoplasmic loop peptide; inComplete Freund’s Adjuvant on day 1, in Incom-plete Freund’s Adjuvant on day 14, and without

Ž .adjuvant phosphate-buffered saline on day 28.Sera were collected prior to the initial injectionand 7 days after the final boost and stored in thepresence of 0.01% thimerosal.

2.9. Western blot analysis

Leishmania dono¨ani or T. cruzi X10r7, ;1]2=107 parasites, were harvested by centrifugation,washed twice in PBS and resuspended in 500 ml

ŽSDS-PAGE sample buffer 50 mM TRIS, pH 6.8,100 mM dithiothreitol, 2% sodium dodecyl sul-

.fate, 1% bromphenol blue, 10% glycerol contain-ing a protease inhibitor cocktail of Leupeptin,

ŽAprotinin, EDTA and Pefabloc Boehringer.Mannheim, Indianapolis, IN . Cell lysates were

prepared by heating at 908C for 5 min and 20 mlof lysate was loaded on a standard Laemmli 12%SDS-PAGE gel with both stacking and separatinggel. Electrophoresis was performed at 16 mA forstacking and at 30 mA for 4 h in the separationgel. The proteins in the gel were electrophoreti-cally transferred to a nitrocellulose membraneand analyzed for reactivity to the Leishmania

Ž .anti-proton pump primary antibody 1:1000 usinga chemiluminescence ECL Western blotting de-

Žtection system Amersham Life Science, Arling-.ton Heights, IL .

( )J.C. Meade et al. r Parasitology International 49 2000 309]320 313

Fig. 2. Nucleotide and deduced protein sequence of the completeTCH3 gene and partial TCH2 ORF. Nucleotides are numbered inthe right margin, amino acids in the left margin. The locations of the mini-exon and polyadenylation splice sites are indicated byvertical arrows. PCR amplification primers are overscored with solid arrows, 59 and 39 RACE primers are overscored with a dashedarrow.

( )J.C. Meade et al. r Parasitology International 49 2000 309]320314

Ž . Ž .Fig. 3. Comparison by alignment of the T. cruzi ATPase protein TCH3 with the Leishmania dono¨ani ATPase 1A LDH1Aw xproton pump 11 . A period indicates the presence in LDH1A of the identical residue observed in the Trypanosoma peptide; a dash

Ž q.indicates a gap that was introduced to preserve optimal alignment. The locations of 121 residues conserved in proton ATPases Hw x q ŽU .are indicated in the third line 19 . H specific residues identical in TCH3 are indicated by an asterix , changes are noted by the

Ž .single letter amino acid code. Ten hydrophobic membrane spanning domains H1]H10 in the TCH3 peptide are overscored.

3. Results

3.1. Cloning and sequence of T. cruzi proton pumps

Oligonucleotide primers based on conservedw xP-type ATPase amino acid motifs 1 were utilized

to PCR amplify ATPase sequences from T. cruzi

genomic DNA. DNA fragments of 1022, ;950and 773 nt were produced; the predicted peptidesequence of the 773 nt band was 87% identical tothe analogous region of the Leishmania proton

Ž .pumps Fig. 3, aa 347]604 . The peptide sequenceof the 1022 nt fragment also contained signaturemotifs characteristic of P-type ion-motive AT-

( )J.C. Meade et al. r Parasitology International 49 2000 309]320 315

Ž .Pases data not shown . Four lambda phage clonesthat hybridized with the 773 nt PCR product wereisolated from a partial Sau3A I digested T. cruzigenomic DNA library in lambda EMBL 3. South-ern blot hybridization to the 773 nt PCR productindicated that the lambda isolates contained atandemly linked array of T. cruzi proton pumps.DNA sequence was determined for four restric-tion fragments from lambda isolate a27; 3.9 kbXho I, 2.4 kb Pst I and 2.8 kb Pst fragmentswhich hybridized to the 773 nt fragment and a 1.0kb Pst I fragment which hybridized to the 3.9 kbXho I probe. Fig. 1 illustrates the relationship ofthese subclones to the tandemly linked gene arraypresent in lambda clone a27 and the T. cruziproton pump gene locus. The 2.4 kb Pst I frag-ment contained the BamH IrSau3A I cloningsite which marks the 59 end of the cloned T. cruziDNA in lambda a27 and encoded the carboxyl508 residues of the first ATPase gene in the array,designated as TCH1, and 787 nt of its 39 UTR.Comparison by alignment of the nucleotide se-quences of the subclones indicated that the 39end of the 3.9 kb Xho I fragment was identical tothe 59 end of the 2.8 kb Pst I fragment. Theoverlapping 3.9 kb Xho I and 2.8 kb Pst I frag-

Ž . Ž .ments Fig. 2 contained 94 nt 30 amino acids atthe 39 end of a second proton ATPase geneŽ .TCH2 , a 1083 nt intergenic region, the complete2778 nt sequence of proton pump TCH3, and 786

Ž .nt of the TCH3 39untranslated region UTR . The1.0 kb Pst I subclone contained 302 nt of 59UTR

Ž .and the initial 245 residues 735 nt of protonATPase TCH2. Nucleotide polymorphismsbetween the 1.0 kb Pst I and 3.9 kb Xho Ifragments exclude a location 59 of TCH3 for thisfragment and the lack of a Pst I site in TCH4Ž .Fig. 1 also eliminates this location.

Ž .A 2799 nt open reading frame ORF wasobserved in the overlapping Xho I]Pst I frag-

Ž .ments Fig. 2, nt 1154]3952 . The first methionineinitiation codon was located 25 nt into this ORFand the peptide coding sequence terminated witha TAA codon at nt 3953]3955. The TCH3 ORFencoded a peptide of 925 amino acids with apredicted mass of 101 908 kDa. There was noevidence of introns in the TCH3 sequence, as hasalso been noted for other T. cruzi genes. The

hydropathy profile of TCH3 contained structurescharacteristic of P-type ion motive ATPases; fouramino and six carboxyl membrane spanning do-

Ž .mains overscored in Fig. 3 flanking a 307 aminoacid cytoplasmic loop, a smaller hydrophilic loopŽ .129 aa between membrane spanning domainsH2 and H3, and alpha helical stalk regionsflanking the cytoplasmic faces of H1]H5. Thecodon usage for TCH3 was similar to that re-ported for other T. cruzi genes and exhibited a65.7% third position GC bias with an overall

w x54.8% GC content in the ORF 17 . The 1083 ntintergenic sequence between TCH2]3, however,had a pronounced AT bias of 59.0%.

A high degree of sequence conservation withinthe TCH locus was apparent in comparisons ofthe cloned TCH fragments. The sequence of thepartial TCH2 ORF in the 3.9 kb Xho I subcloneŽ .Fig. 2, nt 1]94 was identical to the correspond-ing segment of TCH3 in the 2.8 kb Pst I subcloneŽ .Fig. 2, nt 3862]3955 , but 2 nt changes werenoted in comparing the available 39 UTR se-

Žquences of TCH2 and TCH3 Fig. 2, nts 95]881.and 3956]4741 . The partial TCH1 ORF in the

2.4 kb Pst I subclone exhibited 3 nt substitutionsversus the corresponding 1527 nt in TCH3 coding

Ž .sequences Fig. 2, nt 2429]3955 , predicting twoamino acid changes, Thr to Lys and Thr to AlaŽ .Fig. 2, aa 838 and 882 . Five nt polymorphisms in

Ž .the 787 nt partial 39 UTR of TCH1 2.4 kb Pst IŽ . Ž .vs. TCH2 3.9 kb Xho I or TCH3 2.8 kb Pst I

were also noted. The sequence of a 1.0 kb Pst Ifragment containing additional TCH2 59 UTRand ORF sequences differed at 2r302 nt posi-tions with the TCH2]TCH3 intergenic sequenceand at 2r735 nt with the TCH3 ORF in the 3.9kb Xho I subclone; predicting two amino acid

Žsubstitutions, Gly to Asp and Ala to Val Fig. 2,.aa 45 and 119 . The presence of such minor nt

polymorphisms between members of tandem genearrays has been observed in other Leishmaniaand Trypanosoma loci.

3.2. Genomic organization of the TCH locus

Southern blots containing T. cruzi genomicDNA, single or double digested with a battery ofrestriction endonucleases, were hybridized to

( )J.C. Meade et al. r Parasitology International 49 2000 309]320316

Žprobes isolated from lambda a27 data not.shown . The probes, shown in Fig. 1, were 1035 nt

Pst I]Pst I, 731 nt Sph I]Xho I, 879 nt XhoI]Pst I fragments from lambda clone a27, the773 nt PCR fragment and the 593 nt 59 RACEand 765 nt 39 RACE products isolated duringtranscript mapping of the TCH genes. Results ofthese experiments produced the genomic organi-zation of the TCH locus depicted in Fig. 1. Therewere four copies of the T. cruzi proton pumpŽ .TCH1-4 organized as a tandemly linked array

Žwith a repeat unit length of 3.9 kb Fig. 2, nts.1]3867 . The detection of additional bands that

hybridized primarily with probes from the 59 por-Žtions of TCH genes 59 RACE, PCR and 1035 nt

. ŽPst I]Pst I but not with 39 TCH probes 731 nt.Sph I]Xho I and 39 RACE also indicate the

presence of a related gene located elsewhere inthe genome. Data from restriction mapping andthe sequence of lambda a27 subclones showed ahigh degree of identity between TCH1]3 and theintergenic regions in the tandem array. However,several lines of evidence indicate that TCH 4,especially the 39 portion of the TCH4 ORF andits 39UTR diverge from the corresponding regions

Ž .of TCH1]3. i Restriction site polymorphisms atthe 39 portions of TCH4 were noted; TCH4 lacksthe Xho I site present at the carboxyl end of theTCH1]3 ORFs and has new Hind III and Sph I

Ž .sites located in the 39UTR. ii The 779 nt XhoI]Pst I probe from the 39 end of TCH3 hy-bridized poorly on Southern blots to DNA frag-

Ž .ments which include the 39 end of TCH4. iii The39 RACE clone, when used as probe on Southernblots, hybridized to DNA fragments containingthe 39ends of TCH1]3 but not to fragments con-taining TCH4 39sequences. The 59 UTRs ofTCH1]4, however, are better conserved as a 59RACE probe generated during transcript map-ping experiments hybridizes to DNA fragmentscontaining the 59 portions of all four TCH genes,although a Pst I site present in the TCH1]3ORFs was absent in TCH4.

3.3. Comparison of the TCH peptide to Leishmaniaproton pumps

The TCH3 peptide was closely related to

Leishmania proton pumps; TCH3 was 80% identi-Žcal 86% similar including conservative amino

.acid substitutions to the L. dono¨ani ATPase 1AŽ .proton pump Fig. 3 . The amino acid differences

between TCH3 and LDH1A were clustered at theamino and carboxyl terminal domains of the pep-tides. The hydropathic profiles of the two pep-tides were nearly identical; however, TCH3 lackeda 44 amino acid extension present in the carboxyltail of the Leishmania pumps. The significance ofthese missing amino acids in the T. cruzi peptidesis not clear at this point. The involvement ofcarboxyl regulatory regions in modulating pump

w xactivity in several ion motive ATPases 2 and thedifferential transcript expression of the twoLeishmania proton pumps whose peptides differat their 39 ends suggests a regulatory function for

w xthis extended Leishmania carboxyl tail 12 . TheŽ .TCH3 peptide contained 72 of 121 60% identity

consensus proton pump specific residues identi-fied in an alignment of protozoan, yeast and plant

w xproton pumps 19 , and exhibited an additional 15Ž .conservative substitutions 71.9% similarity with

this consensus. The TCH3 peptide shared identi-cal amino acids with LDH1A at 116r121 of theplant and fungal Hq specific residues, including85r87 of the residues conserved between TCH3

q Ž .and the H consensus Fig. 3 .

3.4. Transcription of the T. cruzi proton pumps

Northern blot analysis of TCH expression in T.cruzi demonstrated that two transcripts, 3.8 kband 4.9 kb, were recognized by hybridization tothe TCH 773 nt PCR fragment. The two tran-scripts were equally abundant in total RNA andmRNA fractions of T. cruzi X10r7 epimastigotesŽ .Fig. 4, left panel, lanes 1 and 2 , but in Y strainepimastigotes the 3.8 kb transcript was predomi-

Ž .nate Fig. 4, left panel, lane 3 . Expression of the3.8 kb transcript was also greater in T. cruzi Ystrain trypomastigotes, although overall levels ofboth transcripts were reduced relative to epi-

Žmastigote stage expression Fig. 4, left panel, lane.4 . The faint 4.9 kb band in trypomastigotes was

more clearly evident in longer exposures of theŽ .Northern blot in Fig. 4 data not shown . The size

of the 3.8 kb message was consistent with tran-

( )J.C. Meade et al. r Parasitology International 49 2000 309]320 317

Fig. 4. TCH transcription in Trypanosoma cruzi NorthernŽ .blots probed with radiolabelled TCH 773 nt PCR left panel

Ž .or 765 nt 39 RACE right panel fragments. Lane 1, 20 mgstrain X10r7 epimastigote total RNA; lane 2, 4 mg strainX10r7 epimastigote mRNA; lane 3, 4 mg Y strain epimastig-ote mRNA and lane 4, 4 mg Y strain metacyclic trypomastig-ote mRNA.

scription from internal genes in the cloned TCHtandem gene array. However, the 4.9 kb messagewas too large to derive from internal members

Ž .TCH2]3 of this array 3.9 kb repeat unit , butcould originate from the TCH genes flanking thetandem gene array with either an extended 59UTR if transcribed from TCH1 or an extended 39UTR if transcribed from TCH4.

In order to clarify mRNA expression from theTCH tandem locus, the 59 and 39 ends of TCHtranscripts were mapped using RT-PCR witholigonucleotide primers based on the TCH 3 nu-cleotide sequence. A 59 RACE experiment, usinga 28-mer primer designed to recognize the 39 ntT. cruzi mini-exon sequence and an antisenseprimer internal to the 59 end of the TCH 3 ORFŽ .Fig. 2, nt 1682]1697 , amplified 593 nt fragmentsfrom both T. cruzi X10r7 and CL strain totalRNA. The sequence obtained from these 59RACE clones located the mini-exon splice site 39to an AG dinucleotide, 40 nt upstream of the

Ž .methionine initiation codon Fig. 2, nt 1136]1137and included 33 nt of the T. cruzi mini-exonsequence. The sequence of the 59 RACE cloneswas nearly identical to that reported for TCH3Ž .Fig. 2, nt 1138]1697 ; the X10r7 strain 59 RACEproduct revealed 4 nt differences and the CL

strain 59RACE product exhibited 7 nt differences.The 59 RACE clones also showed nt polymor-phisms with TCH2 in the 1.0 kb Pst I subcloneindicating that the 59 RACE clones must origi-nate from TCH1 or TCH 4. The X10r7 strain 593nt 59 RACE product, when used as probe onSouthern blots, hybridized to DNA restrictionfragments which contained the 59 portions ofTCH 1]4.

A 39 RACE experiment using a primer specificfor sequences downstream of TCH genes 2 and 3Ž .Fig. 2, nt 278]297 and nt 4139]4158 amplified a765 nt fragment, which mapped the TCH 39

Žpolyadenylation site to a GAA trinucleotide Fig..2, nt 1019]1021 . The single 39 RACE band pro-

duced suggests that transcribed genes within thearray utilize similar 39 polyadenylation sites. The765 nt product sequence closely matched the cor-responding region in the TCH2 ORF and 39 UTRsequence from the 3.9 kb Xho I subcloneŽ .763r765 nt as well as the partial TCH1 ORF

Ž .and 39 UTR from the 2.4 kb Pst I 599r604 ntŽ .and 1.0 kb Pst I 144r145 nt subclones, and the

TCH ORF and 3 UTR from the 2.8 kb Pst IŽ .subclone 603r604 nt . The 59 and 3 mapping

experiments show that a 3746 nt message, exclu-sive of the mini-exon and poly A tail, was tran-scribed from genes within the TCH tandem locus.The polyadenylation and mini-exon splice siteswere located 116 nt apart in the TCH intergenicregion. The 765 nt 39 RACE product was used asprobe on Northern blots and hybridized to the 3.8kb TCH message but not to the 4.9 kb message in

ŽT. cruzi epimastigotes and trypomastigotes Fig. 4,.right panel, lanes 1]4 . In addition, this 39 RACE

product hybridized to bands on Southern blotswhich include the intergenic regions downstreamof TCH1]3, but not to sequences downstream of

Ž .TCH4; confirming that the smaller 3.8 kb tran-script is derived from TCH genes 1]3 and sug-gesting that the 4.9 kb transcript originates from

Ž .the last gene TCH4 in the array.

3.5. Reacti ity of T. cruzi protein with anti-Leishmania proton pump antibody

The high degree of identity between the T.cruzi and Leishmania proton pump peptides, par-

( )J.C. Meade et al. r Parasitology International 49 2000 309]320318

Žticularly in the large cytoplasmic loop 87% iden-.tity , suggested that an antibody prepared against

this region in the Leishmania pump might recog-nize the T. cruzi proton pump. A polyclonal anti-body present in the sera of rabbits immunizedwith a fusion peptide encoding the large cyto-plasmic loop of L. dono¨ani Hq-ATPase 1A wasused to probe a SDS-PAGE Western blot con-taining whole cell lysates of L. dono¨ani and T.cruzi parasites. The Leishmania proton pumpantibody recognized a protein band of approxi-mately 110-kDa and a less intense band at 90-kDain Leishmania cell lysates and a smaller peptide

Ž .of 100-kDa in Trypanosoma cruzi Fig. 5 , indicat-ing recognition of similar antigenic epitopes inthe Hq pumps of both parasites. The size differ-ential of the peptides recognized was consistentwith the smaller size of the T. cruzi peptiderelative to the Leishmania Hq pump, 925 vs. 975amino acids, predicting proteins of 101.9 and 107.4kDa, respectively. The faint ; 90-kDa bandobserved in the Leishmania lysate was mostprobably a degradation product of the 110-kDapeptide. The 90-kDa band was not present inWestern blots using freshly prepared Leishmanialysates but was only observed when stored sam-ples that had been through a freeze]thaw cyclewere analyzed.

4. Discussion

This report has identified a tandemly repeatedlocus of four P-type Hq-ATPase genes in T. cruziwhich are expressed as two transcripts, 3.8 and 4.9kb, in both epimastigotes and trypomastigotes.The TCH locus resembles previously character-ized T. cruzi genes with a distinct codon usagepattern, an overall GC bias in the protein codingsequence, a GC bias in the third codon position, astrong AT bias in intergenic regions, the absenceof introns in the peptide coding sequence, andthe presence of a spliced leader sequence ap-pended to the TCH3 transcript. The first three

Ž .genes in the array TCH1]3 share a high degreeof homology; few nt differences were observed incomparing the coding and UTR sequences of

Fig. 5. Western blot analysis showing the reactivity of a Leish-mania proton pump polyclonal antibody against T. cruzi mem-brane protein. Lane 1, L. dono¨ani whole cell lysates; lane 2,T. cruzi X10r7 strain whole cell lysates.

TCH3 and the partial TCH1 and TCH2 frag-ments, Southern mapping of the locus did notdetect any restriction site polymorphisms betweenTCH1]3 and no differences were noted in theintensity of hybridization signals from TCH1]3fragments. The TCH4 gene, however, is divergent

Ž .from TCH1]3; there is a loss of 59 Pst I and 39Ž .Xho I coding region restriction sites, loss of a 39

Ž .UTR Pst I site, gain of 39 UTR Hind III andSph I sites, and DNA fragments containing the 39coding segment and 39 UTR of TCH4 hybridizepoorly with probes from TCH3. The 3.8 kb mes-sage was shown to derive from internal membersof the array, the 4.9 kb message most likely origi-nates from the 39 flanking gene, TCH4. The gen-eration of variably sized transcripts from tandemlylinked gene loci has been noted for other try-panosomatid genes, such as T. cruzi calmodulin,

Ž .Leishmania surface glycoprotein gp 63 and thew xLeishmania proton ATPases 12,20,21 .

The T. cruzi proton pumps were closely relatedto the tandemly liked pair of Leishmania Hq-

( )J.C. Meade et al. r Parasitology International 49 2000 309]320 319

ATPases, as seen by the high degree of sequenceidentity and the recognition of a 100-kDa peptidein T. cruzi whole cell lysates by an anti-Leish-mania proton pump antibody. The two Leishma-nia ATPase genes differ at the carboxyl terminus

Žand in the insect form the smaller transcript 5.0. Ž .kb from the upstream gene LDH1A predomi-

Ž .nates, while the larger transcript 5.5 kb from theŽ .downstream gene LDH1B is expressed in statio-

nary phase promastigotes and amastigotes. Therole of the differences in the 39 coding regionsnoted in the Leishmania pumps and in the T.cruzi Hq-ATPases between TCH1]3 and TCH4 isnot known, but pump activity is regulated throughthe C-terminus in other ion-motive P-type AT-Pases. Glucose stimulation of the yeast Hq-ATPase and acid activation and Hsp30 and 14-3-3protein regulation in plant proton pumps havebeen localized to the C-terminus of the peptidesw x 2q22]25 . In the plasma membrane Ca -ATPasethe C-terminus functions as an autoinhibitory do-main which can be inactivated by calmodulin

w xbinding 26 .The expression of Hq-ATPase isoforms with

differing carboxyl termini in T. cruzi might alsoreflect differing cellular localizations for the iso-forms. Loss of a structural signal in the COOH-terminal tail of truncated plasma membraneCa2q-ATPase results in incorrect protein localiza-

w xtion 27 . A plasma membrane P-type ATPaseactivity has been characterized in T. cruzi epi-mastigotes and evidence for involvement of bothV-type and P-type Hq-ATPase activities in theacidification of internal compartments of epi-mastigotes, with the P-type activity relativelyweaker in trypomastigotes and amastigotes, has

w xalso been reported 4]6 . Based on kinetic char-acteristics, ion effects and inhibitor profiles, theauthors hypothesized that the V-type Hq activitycorrelated with acidocalcisomes, an acidic Ca2q

storage compartment, and P-type Hq activity cor-responded to reservosomes, an organelle lackingin amastigote and trypomastigote forms.

The isolation of the P-type ATPase genes of T.cruzi will now permit functional analysis of theirrole in parasite metabolism via gene knockouts,site directed mutagenesis, transient transfec-tion, expression in heterologous systems such as

oocytes and antibody production for protein local-ization and inhibition. In addition, Trypanosomacruzi and Leishmania are significant causes ofmorbidity and mortality in tropical areas and cur-rent drug regimens for treatment are proble-matic; complicated by adverse side effects, risingdrug resistance and inadequate clearance of para-sites. The observation that proton pumps analo-gous to the Leishmania and Trypanosoma AT-Pases are not present in mammalian cells offersthe possibility of exploiting differences in theirion pumps in the biologically based design of newtherapeutic interventions. The feasibility of tar-geting ion pumps is evident from the clinical useof drugs such as omeprazole to inhibit the humangastric HqrKq-ATPase and decrease stomachacidity, and cardiac glycosides for treatment ofheart attack by specific inhibition of the heart

q q w xNa rK -ATPase 28,29 .

Acknowledgements

This work was supported in part by PublicHealth Service grant AI33536 to J.C.M. from theNational Institutes of Health.

References

w x1 Fagan MJ, Saier Jr. MH. P-type ATPases of eukaryotesand bacteria: Sequence analyses and construction ofphylogenetic trees. J Mol Evol 1994;38:57]99.

w x2 Møller JV, Juul B, le Maire M. Structural organization,ion transport, and energy transduction of P-type AT-Pases. Biochim Biophys Acta 1996;1286:1]51.

w x3 Axelsen KB, Palmgren PG. Evolution of substrate speci-ficities in the P-type ATPase superfamily. J Mol Evol1998;46:84]101.

w x4 Van Der Heyden N, Benaim G, Docampo R. The roleof a Hq-ATPase in the regulation of cytoplasmic pH inTrypanosoma cruzi epimastigotes. Biochem J 1996;318:103]109.

w x5 Van Der Heyden N, Docampo R. Intracellular pH inmammalian stages of Trypanosoma cruzi is Kq-depen-dent and regulated by Hq-ATPases. Mol Biochem Para-sitol 2000;105:237]251.

w x q6 Scott DA, Docampo R. Two types of H -ATPase areinvolved in the acidification of internal compartments inTrypanosoma cruzi. Biochem J 1998;331:583]589.

w x7 Zilberstein D, Dwyer DM. Proton motive force-drivenactive transport of D-glucose and L-proline in the proto-

( )J.C. Meade et al. r Parasitology International 49 2000 309]320320

zoan parasite Leishmania dono¨ani. Proc Natl Acad SciUSA 1985;82:1716]1720.

w x8 Glaser TA, Baatz JE, Kreishman CP, Mukkada AJ. pHhomeostasis in Leishmania dono¨ani amastigotes andpromastigotes. Proc Natl Acad Sci USA 1988;85:7602]7606.

w x9 Zilberstein D, Dwyer DM. Identification of a surfacemembrane proton-translocating ATPase in promastig-otes of the parasitic protozoan Leishmania dono¨ani.Biochem J 1988;256:13]21.

w x10 Liveanu V, Webster P, Zilberstein D. Localization ofthe plasma membrane and mitochondrial Hq-ATPasesin Leishmania dono¨ani promastigotes. Eur J Cell Biol1991;54:95]101.

w x11 Meade JC, Shaw J, Lemaster S, Gallagher G, StringerJR. Structure and expression of a tandem gene pair inLeishmania dono¨ani that encodes a protein structurallyhomologous to eukaryotic cation transporting ATPases.Mol Cell Biol 1987;7:3937]3946.

w x12 Meade JC, Hudson KM, Stringer SL, Stringer JR. Atandem pair of Leishmania dono¨ani cation transportingATPase genes encode isoforms that are differentiallyexpressed. Mol Biochem Parasitol 1989;33:81]92.

w x13 Camargo EP. Growth and differentiation in Try-panosoma cruzi I. Origins of metacyclic trypomastigotesin liquid media. Rev Inst Med Trop Sao Paulo1964;6:93]100.

w x14 Berens RL, Brun R, Krassner SM. A simple monophasicmedium for axenic culture of hemoflagellates. J Para-sitol 1976;62:360]365.

w x15 Riley DE, Krieger JN. Rapid and practical DNA isola-tion from Trichomonas ¨aginalis and other nuclease-richprotozoa. Mol Biochem Parasitol 1992;51:161]164.

w x16 Thertulien R, Simpson-Haidaris PJ, Haidaris CG. Intra-cellular location of a Trypanosoma cruzi kDNA minicir-cle transcript using RNA: RNA in situ hybridization. JEukar Microbiol 1994;41:402]407.

w x17 Alonso G, Guevara P, Ramirez JL. Trypanosomatidaecodon usage and GC distribution. Mem Inst OswaldoCruz 1992;87:517]523.

w x18 McCarthy-Burke C, Taylor ZA, Buck GA. Characteriza-tion of the spliced leader genes and transcripts in Try-panosoma cruzi. Gene 1989;82:177]189.

w x19 Wach A, Schlesser A, Goffeau A. An alignment of 17deduced protein sequences from plant, fungi, and ciliate

Hq-ATPase genes. J Bioenerg Biomemb 1992;24:309]317.

w x20 Chung SH, Swindle J. Linkage of the calmodulin andubiquitin loci in Trypanosoma cruzi. Nucl Acids Res1990;18:4561]4569.

w x21 Ramamoorthy R, Swihart KG, McCoy JJ, Wilson ME,Donelson JE. Intergenic regions between tandem gp63genes influence the differential expression of gp63 RNAsin Leishmania chagasi promastigotes. J Biol Sci1995;270:12133]12139.

w x22 Portillo F, Eraso P, Serrano R. Analysis of the regula-tory domain of yeast plasma membrane Hq-ATPase bydirected mutagenesis and intragenic suppression. FEBSLett 1991;287:71]74.

w x23 Braley R, Piper PW. The C-terminus of yeast plantmembrane Hq-ATPase is essential for the regulation ofthis enzyme by heat shock protein Hsp30, but not forstress activation. FEBS Lett 1997;418:123]126.

w x24 Jahn T, Fuglsang AT, Olsson A et al. The 14-3-3 proteininteracts directly with the C-terminal region of the plant

Ž .plasma membrane H q -ATPase. Plant Cell 1997;9:1805]1814.

w x25 Morsomme P, Dambly S, Maudoux O, Boutry M. Singlepoint mutations distributed in 10 soluble and membraneregions of the Nicotiana plumbaginifolia plasma mem-brane PMA2 Hq-ATPase activate the enzyme and mod-ify the structure of the C-terminal region. J Biol Chem1998;273:34837]34842.

w x26 Enyedi A, Vorherr T, James P et al. The calmodulinbinding domain of the plasma membrane Ca2q pumpinteracts both with calmodulin and with another part ofthe pump. J Biol Chem 1989;264:12313]12321.

w x27 Zvaritch E, Vellani F, Guerini D, Carafoli E. A signalfor endoplasmic reticulum retention located at the car-boxyl terminus of the plasma membrane Ca2q-ATPaseisoform 4CI. J Biol Chem 1995;270:2679]2688.

w x28 Pope AJ, Sachs G. Reversible inhibitors of the gastricŽ q q.H rK -ATPase as both potential therapeutic agentsand probes of pump function. Biochem Soc Trans1992;20:566]572.

w x29 Eakle KA, Kim KS, Kabalin MA, Farley RA. High-af-finity ouabain binding by yeast cells expressing Naq,Žq. q Žq.K -ATPase alpha subunits and the gastric H , K -

ATPase beta subunit. Proc Natl Acad Sci USA1992;89:2834]2838.