FEMS Immunology and Medical Microbiology 41 (2004) 161–167

www.fems-microbiology.org

The Helicobacter pylori plasticity region locus jhp0947–jhp0949is associated with duodenal ulcer disease andinterleukin-12 production in monocyte cells

Ramon de Jonge a,b, Ernst J. Kuipers a, Sabine C.L. Langeveld a, Ruud J.L.F. Loffeld c,Jeroen Stoof a, Arnoud H.M. van Vliet a, Johannes G. Kusters a,*

a Department of Gastroenterology and Hepatology, Room L-459, Erasmus MC-University Medical Center Rotterdam,

Dr. Molewaterplein 40, 3015 GD Rotterdam, The Netherlandsb Department of Gastroenterology, VU University Medical Center, Amsterdam, The Netherlandsc Department of Internal Medicine, de Heel Zaans Medisch Centrum, Zaandam, The Netherlands

Received 23 December 2003; received in revised form 12 February 2004; accepted 2 March 2004

First published online 9 April 2004

Abstract

Colonization with Helicobacter pylori always results in chronic gastritis, which is controlled by infiltration of mononuclear cells

and the subsequent release of cytokines like interleukin (IL)-12. To identify H. pylori factors involved in inducing cytokine pro-

duction in mononuclear cells, a random H. pylori mutant library was screened for the inability to induce IL-12 production in

monocyte THP-1 cells. Of the 231 random mutants screened, one mutant (M1) showed a consistent twofold decrease in the amount

of IL-12 induction compared to the parental strain 1061 (P < 0:01). Further characterization of mutant M1 revealed that the

kanamycin resistance cassette had integrated in the jhp0945 gene, which is situated in an H. pylori strain-specific plasticity region.

Three reference strains possessing this plasticity region induced significantly higher amounts of IL-12 when compared to the

H. pylori 26695 reference strain, which does not possess this plasticity region. The role in disease outcome of jhp0945 as well as the

neighbouring plasticity region genes jhp0947 and jhp049 was assessed in a Dutch population cohort. Firstly, the presence of jhp0947

was completely linked with that of jhp0949 and was roughly associated with jhp0945 (P ¼ 0:072), but not with the cag pathogenicity

island (PAI) (P ¼ 0:464). The presence of the jhp0947 and jhp0949 genes, but not of jhp0945, was significantly associated with

duodenal ulcer disease when compared to gastritis (P ¼ 0:027). Therefore, the jhp0947–jhp0949 locus may be a novel putative

H. pylori marker for disease outcome independent of the cag PAI.

� 2004 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.

Keywords: Helicobacter pylori pathogenesis; Cytokine; Virulence factors; Plasticity region; IL-12

1. Introduction

Colonization of the human stomach with Helicobac-

ter pylori leads to chronic gastritis, which may further

complicate into peptic ulceration, atrophic gastritis and

gastric adenocarcinoma [1]. Colonization with H. pylori

is also characterized by massive infiltration of poly-

morphonuclears (PMNs) and mononuclear cells, which

* Corresponding author. Tel.: +31-10-463-2982; fax: +31-10-463-

2793.

E-mail address: j.g.kusters@erasmusmc.nl (J.G. Kusters).

0928-8244/$22.00 � 2004 Federation of European Microbiological Societies

doi:10.1016/j.femsim.2004.03.003

are hallmarks for inflammation. In addition, increase of

the local production of pro-inflammatory cytokines likeinterleukin (IL)-8, IL-12, IL-1b, TNFa and IFN-c has

been reported in vivo in H. pylori-positive patients, as

well as in vitro using H. pylori stimulated epithelial and

mononuclear cells [2–6].

The cytotoxin-associated gene (cag) pathogenicity is-

land (PAI) was the first H. pylori factor for which a role

in host cell cytokine production was demonstrated [7].

The cag PAI is present in 50–70% of H. pylori isolatesfrom Western populations, and in 90% or more of the

strains in Eastern populations [1]. It plays an important

. Published by Elsevier B.V. All rights reserved.

162 R. de Jonge et al. / FEMS Immunology and Medical Microbiology 41 (2004) 161–167

role in the induction of IL-8 production in gastric epi-

thelial cells [7]. Although IL-8 is an important factor of

the innate host immune response during initial H. pylori

colonization, it is not required for development of the

pro-inflammatory T helper 1 (Th1) immune response.Proliferation of naive Th lymphocytes towards the

inflammatory Th1 cells, which are abundantly present

during H. pylori colonization [8], is regulated by the re-

lease of IL-12 by mononuclear cells [9]. Although IL-12

has recently been shown to be essential for protection

againstH. pylori [10], prolonged production of IL-12 and

thus activation of the pro-inflammatory Th1 immune

response is associated with the development of pepticulcer disease [11]. Although we have previously demon-

strated that H. pylori mediated IL-12 production in

monocyte cells is not dependent on the cag PAI [5], many

of the H. pylori genes that play an essential role in IL-12

production by mononuclear cells are still unknown.

In a previous study we described a technique for

random direct insertion mutagenesis in H. pylori [12]. In

the present study, a set of such H. pylori random mu-tants has been evaluated for their ability to induce IL-12

production in monocyte cells. Subsequent analysis

revealed that integration of the kanamycin resistance

cassette in the H. pylori strain-specific plasticity region

jhp0947–jhp0949 gene resulted in a significantly de-

creased production of IL-12. Subsequently, the presence

of jhp0945, jhp0947 and jhp0949 in a set of H. pylori

isolates obtained from a well-characterized Dutch pa-tient population cohort was assessed. This showed that

the presence of jhp0947 and jhp0949 is significantly

associated with development of duodenal ulcer disease.

2. Materials and methods

2.1. Culture conditions

The H. pylori cag-positive strains J99, 26695, G27

[13], the cag-negative strain 1061 [14], and a set of 231

random mutants derived from a random H. pylori 1061

mutant library [12] were routinely cultured on Columbia

agar plates supplemented with 7% lysed horse blood and

Dent selective supplement (Oxoid, Basingstoke, UK),

further referred to as Dent plates. When appropriate,Dent plates were supplemented with 20 mg l�1 kana-

mycin. Broth cultures were grown in Brucella broth

supplemented with 3% Newborn Calf Serum (Invitro-

gen-Life technologies, Paisley, Scotland) to yield

approximately 108colony forming units (cfu) ml�1.

H. pylori was routinely grown for 24–48 h at 37 �C in an

atmosphere of 5% O2, 10% CO2, and 85% N2.

Human monocytic THP-1 cells were cultured inRPMI 1640 medium containing GlutamaxI supple-

mented with 10% fetal calf serum (Gibco BRL, Paisley,

Scotland) (RPMIþ). Cell suspensions were seeded in 24-

wells microtiter plates (Costar, Cambridge, MA) and

incubated at 37 �C in a 5% CO2 incubator until a cell

density of 106 cells ml�1 was obtained. Subsequently, the

cells were washed with phosphate buffered saline and

harvested by centrifugation at 370g for 10 min. Forsubculturing, cells were diluted in RPMIþ to a final

concentration of 105 cells ml�1.

2.2. H. pylori mediated IL-12 production in THP1

monocyte cells

Wild-type H. pylori 1061 and the 231 random

H. pylori mutants were screened for their capacity toinduce IL-12 production in monocyte THP-1 cells, using

an assay as described previously [5]. THP-1 cells (4� 105

cells ml�1) were incubated for 24 h after which the cells

were stimulated with H. pylori (bacteria: cell ratio 100:1)

for 24 h. As a negative control, THP-1 cells were stim-

ulated with H. pylori for less than 5 min. The amount of

the IL-12 p40 protein in cell culture supernatants was

determined by sandwich ELISA (BioSource Interna-tional, Nivelles, Belgium). The lower limit of detection

for IL-12 was 50 ng l�1. Only those mutants which

showed a decrease in H. pylori mediated IL-12 produc-

tion of >30% when compared to the wild-type strain

1061 in at least three independent induction experiments

were included in subsequent stimulation assays.

2.3. Characterization of the integration site of the

kanamycin resistance cassette

Determination of genes affected by the integration of

the kanamycin resistance cassette was essentially per-

formed as described previously [15,16]. Genomic H. py-

lori mutant and wild-type DNA was digested with CfoI

(0.5 U ll�1) and specific CfoI linkers (2 pmol ll�1; Table

1) were ligated with 0.15 U ll�1 T4 ligase (Promega,Leiden, The Netherlands) with addition of 0.1 M NaCl

and 100 ng ll�1 BSA at 37 �C for at least 2 h. Subse-

quently, PCR experiments using a combination of CfoI

adapter primers (0.5 pmol ll�1) and primers specific for

the kanamycin resistance (kanR) cassette (0.2 pmol ll�1)

were performed to selectively amplify the genome frag-

ment containing the kanR cassette. Fragments were am-

plified in PCR buffer containing 3 mM MgCl2 and 0.02U ll�1 Taq (Promega) in 40 cycles at 95 �C for 30 s, 65 �Cfor 30 s with a decrease of 1 �C per cycle to a minimum of

55 and 72 �C for 45 s, using the primers listed in Table 1.

The resultedPCR fragmentswere cloned into pGEMTeasy

(Promega) and subjected to sequence analysis.

2.4. Identification of the plasticity region genes and the

cag PAI in H. pylori isolates

Chromosomal DNA was purified using standard

protocols from a total of 45 H. pylori clinical isolates

Table 1

Oligonucleotide primers used in this study

Primer Sequence (50–30)a

CfoI adapter linker 1 GACGATGAGTCCTGAACG

CfoI adapter linker 2 TTCAGGACTCATC

CfoI adapter primer ACGATGAGTCCTGAACG

KanR-1296F TGGTATGACATTGCCTTCTG

KanR-61R TGGGTTTATCGATGATAAGC

JHP0945-4600F ACTCCAGCCAGTATTGTAAA

JHP0945-F TTCAAGTGGTGGCTCTGTAG

JHP0945-R-T7b ctaatacgactcactatagggagaTTCTTGCGAG-

TTAGGATTGG

JHP0947-F ATAGGCCCTTTCAAGGATAG

JHP0947-R-T7b ctaatacgactcactatagggagaCGTCAGCAGG-

AATAATATCT

JHP0949-F ATAGGAGTGGGTGCTTACTT

JHP0949-R-T7b ctaatacgactcactatagggagaAGCAACAACA-

AAGGCATGTA

UreA-F ATGAAACTCACCCCAAAAGA

UreA-R-T7b ctaatacgactcactatagggagaGGAAGTGTGA-

GCCGATTTGA

CagA-F GCCACTACTACCACCGACAT

CagA-R CGTTGTGAGCCTGTGAGTTG

CagE-F TGTTTGGTTTCCCTGAAACT

CagE-R AGCTTGGCTCTAATAATCCTaPrimer sequences were based onH. pylori strains 26695 [19] and J99

[18].b Primers contained a 50-extension with T7 promoter sequence

(lowercase) for the creation of an antisense RNA probe.

0

300

600

900

1200

1500

1800

2100

25 100 200 500

H. pylori : cellratio

IL-1

2 (p

g/m

l)

*

Fig. 1. Production of IL-12 after stimulation of monocyte THP-1 cells

withH. pylori parental strain 1061 (open bars) or the mutant strain M1

derived from a randomH. pylori 1061 mutant library [12] (closed bars).

Monocyte cells were stimulated with H. pylori at different bacteria:cell

ratios. * P < 0:01. Error bars represent the standard error of the mean

of at least four independent experiments.

R. de Jonge et al. / FEMS Immunology and Medical Microbiology 41 (2004) 161–167 163

[17]. Nineteen of the H. pylori strains were isolated from

patients with duodenal ulcer disease, whereas 26 strains

were isolated from patients with chronic active gastritis

only, as diagnosed by routine endoscopy and biopsy

sampling. Purified chromosomal DNA was digestedwith HindIII, size fractionated by agarose gel electro-

phoresis, denatured and transferred to nylon mem-

branes (Roche diagnostics, Mannheim, Germany) as

described previously [15]. Internal DNA fragments of

jhp0945 (246 bp), jhp0947 (1233 bp), jhp0949 (787 bp)

and ureA (435 bp) were amplified using primers listed in

Table 1, and used for the production of antisense RNA

probes labeled with digoxigenin by in vitro transcriptionusing T7 RNA polymerase (Roche diagnostics). Hy-

bridization and stringency washes were performed at 50

and 68 �C respectively, and bound probe was detected

with the DIG-Detection Kit (Roche) and the chemilu-

minescent substrate CPD-Star (Amersham, Pharmacia,

Roosendaal, The Netherlands). The presence of the

cagA and cagE genes as markers for the cag PAI was

assessed by PCR with primers listed in Table 1.

2.5. Statistical analysis

Statistical analysis was performed using Fischer’s

exact test. Backward LR binary logistic regression

analysis was performed to determine which putative

H. pylori virulence factor was most discriminating for

disease outcome. P < 0:05 was considered significant.

3. Results

3.1. Identification of H. pylori loci involved in IL-12

production in THP-1 monocytes

The average induction of IL-12 by wild-type H. pylori

1061 was 808� 104 pg/ml. One random H. pylori mu-

tant, designated M1, showed over a twofold decrease in

induced production of the pro-inflammatory cytokine in

monocyte THP-1 cells (386� 66 pg/ml, P < 0:01)(Fig. 1). Deficiency in induced IL-12 production of

H. pylori mutant M1 was observed at various bacteria:

cell ratios (Fig. 1). To ensure that the IL-12 deficientphenotype was not caused by an unrelated secondary

mutation, the parental H. pylori strain 1061 was trans-

formed with genomic DNA of H. pylori mutant M1,

yielding many kanR retransformants (>1000 cfu lg�1

DNA). Of these retransformants, 10 independent kanR

mutants were selected. Subsequent screening experi-

ments showed that all selected kanR retransformants

were similarly affected in their ability to induce IL-12production in THP-1 cells (data not shown).

3.2. Identification of H. pylori genes associated with

induced IL-12 production in monocyte cells

To evaluate the integration site of the kanR in the

genome of mutant M1, genomic DNA of both the

H. pylori mutant M1 and the wild-type strain 1061 wasdigested with CfoI. Adapter-ligation based amplification

experiments with primers based on the kanR cassette

and the CfoI adapters on the digested genome of both

H. pylori strains resulted in numerous DNA fragments

per strain. One DNA fragment of approximately 250 bp

164 R. de Jonge et al. / FEMS Immunology and Medical Microbiology 41 (2004) 161–167

was markedly present in the digested genome fragment

pool of mutant M1, but was absent in that of the wild-

type strain. This DNA fragment contained the 50 end of

the kanR cassette as well as a region with no obvious

differences in amino acid sequence to the jhp0945 gene ofH. pylori strain J99 [18]. Disruption of jhp0945 by the

kanR cassette in H. pylori mutant M1 was confirmed by

additional PCR experiments on genomic DNA of H.

pylori mutant M1 using primers specific for jhp0945 and

the kanR cassette.

The H. pylori strain specific jhp0947–jhp0949 locus

is part of a region of 38 open reading frames

Fig. 2. Genetic variability of the jhp0945–0947–0949 genes in H. pylori clinic

the jhp0947 gene and flanking regions of the H. pylori J99 strain. The vertica

(ORFs) of strain J99 are indicated by arrows and numbered sequentially, be

pylori strain 26695 is indicated below the number of the J99 ORF. The shaded

RNA probes for Southern blot hybridization. (B) The genetic variability of th

isolates as determined by Southern hybridization. Hybridization with the ur

experiment is shown here. The positions of relevant markers are shown on t

(Fig. 2A), which has been termed a plasticity region

[18,19] and is present in H. pylori strain J99 [18], but

not in strain 26695 [19]. To further substantiate a link

between the plasticity region and IL-12 production in

THP-1 cells, we determined the ability to induce IL-12of the plasticity-region-positive H. pylori reference

strains J99 and G27 and the plasticity-region negative

strain 26695. H. pylori J99 and G27 induced high

levels of IL-12 production (954� 124 pg/ml and

773� 21 pg/ml IL-12, respectively), whereas H. pylori

26695 was only a poor IL-12 inducer (299� 16 pg/ml

IL-12).

al isolates. (A) Genetic organization of the plasticity region containing

l line indicate the end of the plasticity region. The open reading frames

low the arrows. The corresponding homologous gene, if present in H.

fragments show the DNA fragments used for development of antisense

eH. pylori genes jhp0945, jhp0947 and jhp0949 of eight clinicalH. pylori

eA gene is included as positive control. A representative hybridization

he right, probes used are indicated on the left.

R. de Jonge et al. / FEMS Immunology and Medical Microbiology 41 (2004) 161–167 165

3.3. The presence of the H. pylori jhp0947 and jhp0949

genes is associated with duodenal ulcer disease

The presence of the plasticity region thus correlated

with IL-12 induction. Previous studies have suggestedthat such an induction in vivo correlates with more se-

vere disease outcome [11]. Therefore, we studied the

association of the H. pylori plasticity region genes

jhp0945, jhp0947 and jhp0949 with disease outcome in a

Dutch population cohort [17], using Southern hybrid-

ization with jhp0945–0947–0949 specific probes (Fig. 2).

Hybridization with the ureA gene was used as positive

control, while a cag PAI-specific PCR used to confirmthe association between the cag PAI and disease out-

come, and to determine the association between the

plasticity region and the cag PAI. Fig. 2B shows a rep-

resentative example of the Southern hybridizations used

in our analyses.

All H. pylori strains tested positive for ureA. The cag

PAI was present in 95% of the duodenal ulcers strains,

while only 68% of the H. pylori strains isolated fromgastritis patients were positive for the cag PAI

(P ¼ 0:056). The plasticity region genes jhp0945,

jhp0947, and jhp0949 were present in 40%, 33%, and

33% of all H. pylori strains tested respectively. The

presence of the jhp0947 gene was completely linked with

that of jhp0949 and was roughly associated with jhp0945

(P ¼ 0:072), but not with the cag PAI (P ¼ 0:464). Theplasticity region gene jhp0947 was present in 19% and53% of H. pylori strains isolated from patients with

gastritis and duodenal ulcer respectively (P ¼ 0:027),while jhp0945 was present in 37% and 42% of duodenal

ulcer and gastritis strains respectively (P ¼ 0:767) (Table2). Both jhp0947 0949 and the cag PAI were present in a

single strain in 25% of the H. pylori population, and this

was highly associated with the presence of duodenal

ulcer (P ¼ 0:0045). Binary logistic regression analysis,which was performed to determine the most discrimi-

nating H. pylori factor in disease outcome, showed that

both the presence of jhp0947 and jhp0949 (P ¼ 0:014) aswell as the cag PAI (P ¼ 0:023) were significantH. pylori

Table 2

Association of the presence of H. pylori plasticity region genes with

disease outcome

Disease

outcome

No. of

patients

jhp0945

N (%)

jhp0947–jhp0949a

N (%)

Duodenal ulcer 19 7(37) 10(53)

Gastritis 26 11(42) 5(19)

Total 45 18(40) 15(33)

P-valueb 0.767 0.027a The presence of jhp0947 and jhp0949 is completely linked in all

H. pylori isolates tested.b P value indicating the relation between the presence of the re-

spective gene and duodenal ulcer disease, as determined by Fisher’s

exact test. P < 0:05 were considered significant (bold).

predictive factors for duodenal ulcer when compared to

gastritis.

4. Discussion

Colonization with H. pylori induces an influx of im-

mune cells into the gastric mucosa, and subsequent

production of IL-12 and other cytokines. IL-12 polar-

izes naive T-cells to the pro-inflammatory Th1 type, and

prolonged activation of the Th1 immune response may

result in severe tissue damage such as peptic ulcer dis-

eases [9,11]. Colonization of H. pylori is strongly asso-ciated with increased IL-12 production by mononuclear

cells. Indeed, we have previously demonstrated that

many H. pylori strains are able to induce IL-12 pro-

duction in monocyte cells and that this occurs inde-

pendently of the H. pylori cag PAI [5]. However,

H. pylori factors that play a role in H. pylori mediated

IL-12 production in monocyte cells are still largely

unknown.In this study we show that disruption of the jhp0945–

0947–0949 locus in H. pylori strain 1061 significantly

decreased its ability to induce IL-12 production in

monocyte THP-1 cells. While we cannot exclude the

possibility of polar effects, we have characterized the

presence of three large genes within the jhp0944–jhp0950

locus in such a way that almost the entire locus was

covered (Fig. 2A). In addition, the ability to induceH. pylori mediated IL-12 production was completely

associated with the presence of the jhp0945, jhp0947, and

jhp0949 genes in the high IL-12 inducing H. pylori

strains J99, G27, 1061 and conversely the absence of

these genes in the low IL-12 inducing H. pylori strain

26695.

The jhp0947 gene is homologous to jhp0938 (hp0990)

and jhp253 (hp1333), which all encode for hypotheticalproteins. Interestingly, the N-terminal site of JHP0947 is

also homologous to that of JHP0477 (HP0528), which is

part of the cag PAI and has been identified as an im-

portant building block for the type IV secretion system

encoded by the cag PAI [20]. Similar to jhp0477, jhp0947

is part of a region of numerous ORFs, which has been

identified as a plasticity region (jhp0914–jhp0951) [18,19].

Plasticity regions are often associated with increasedvirulence, and the jhp0947 gene has already been pro-

posed to be a novel virulence factor of H. pylori, albeit

not independent of the cag PAI [22]. Therefore the

presence of the H. pylori plasticity region genes jhp0945,

jhp0947 and jhp0949 was analyzed in a well defined

Dutch study population. Since the jhp0946 and jhp0948

have already been designated pseudo-genes [21], they

were not included in our analyses. Southern hybridiza-tion analysis of 45 clinical H. pylori isolates confirmed

the heterogeneity in the presence of the plasticity region

genes jhp0945, jhp0947, and jhp0949 in the tested

166 R. de Jonge et al. / FEMS Immunology and Medical Microbiology 41 (2004) 161–167

H. pylori strains. The presence of jhp0947 and jhp0949,

but not jhp0945 is significantly associated with duodenal

ulcer compared to gastritis. This observation is in

agreement with a previous study [22], although in that

report, the jhp0947 and jhp0949 genes were not com-pletely linked, and were associated with the presence of

the cag PAI. These differences may well reflect the

geographic variation of the H. pylori isolates used in

both studies. Indeed, geographic differences in the

presence and expression of H. pylori factors have been

reported for several H. pylori virulence factors, includ-

ing the cag PAI [23,24]. The presence of both jhp0947–

0949 and the cag PAI is highly associated with duodenalulcer disease when compared to gastritis, which is in the

agreement with the concept that expression of multiple

H. pylori virulence factors increases the pathogenicity of

the bacterium.

In conclusion, the jhp0947 and jhp0949 genes proba-

bly play an important role in H. pylori-mediated IL-12

production in monocyte cells in vitro, and the presence

of jhp0947 and jhp0949 are significantly associated withdevelopment of duodenal ulcer disease in vivo. It is

tempting to speculate that proteins encoded by jhp0947

or jhp0949 interact with monocyte cells to stimulate IL-

12 production leading to a pro-inflammatory Th1 re-

sponse, which on its turn results in increased tissue

damage and disease outcome. The presence of jhp0947

and jhp0949 was not linked with the presence of the cag

PAI in our study, and therefore, the jhp0947–0949 locusmay act as a novel H. pylori marker for disease outcome

in Western populations independent of the cag PAI.

Acknowledgements

We thank R.G.J. Pot for excellent technical assis-

tance. This study was supported by a grant from theUniversitair Stimulerings Fonds (USF) of the Vrije

Universiteit, Amsterdam, The Netherlands to E.J.K.

References

[1] Kuipers, E.J. (1998) Review article: relationship between Helico-

bacter pylori, atrophic gastritis and gastric cancer. Aliment.

Pharmacol. Ther. 12, 25–36.

[2] Meyer, F., Wilson, K.T. and James, S.P. (2000) Modulation of

innate cytokine responses by products of Helicobacter pylori.

Infect. Immun. 68, 6265–6272.

[3] Mohammadi, M., Czinn, S., Redline, R. and Nedrud, J. (1996)

Helicobacter-specific cell-mediated immune responses display a

predominant Th1 phenotype and promote a delayed-type hyper-

sensitivity response in the stomachs of mice. J. Immunol. 156,

4729–4738.

[4] Karttunen, R.A., Karttunen, T.J., Yousfi, M.M., el-Zimaity,

H.M., Graham, D.Y. and el-Zaatari, F.A. (1997) Expression of

mRNA for interferon-gamma, interleukin-10, and interleukin-12

(p40) in normal gastric mucosa and in mucosa infected with

Helicobacter pylori. Scand. J. Gastroenterol. 32, 22–27.

[5] de Jonge, R., Kusters, J.G., Timmer, M.S., Gimmel, V.,

Appelmelk, B.J., Bereswill, S., van Vliet, A.H.M., Meuwissen,

S.G., Kist, M., Vandenbroucke-Grauls, C.M.J.E. and Kuipers,

E.J. (2001) The role of Helicobacter pylori virulence factors in

interleukin production by monocytic cells. FEMS Microbiol. Lett.

196, 235–238.

[6] Guiney, D.G., Hasegawa, P. and Cole, S.P. (2003) Helicobacter

pylori preferentially induces interleukin 12 (IL-12) rather than

IL-6 or IL-10 in human dendritic cells. Infect. Immun. 71, 4163–

4166.

[7] Sharma, S.A., Tummuru, M.K., Miller, G.G. and Blaser, M.J.

(1995) Interleukin-8 response of gastric epithelial cell lines to

Helicobacter pylori stimulation in vitro. Infect. Immun. 63, 1681–

1687.

[8] D’Elios, M.M., Manghetti, M., De Carli, M., Costa, F., Baldari,

C.T., Burroni, D., Telford, J.L., Romagnani, S. and Del Prete, G.

(1997) T helper 1 effector cells specific for Helicobacter pylori in

the gastric antrum of patients with peptic ulcer disease. J.

Immunol. 158, 962–967.

[9] Trinchieri, G. (1995) Interleukin-12: a proinflammatory cytokine

with immunoregulatory functions that bridge innate resistance

and antigen-specific adaptive immunity. Annu. Rev. Immunol. 13,

251–276.

[10] Hoffman, P.S., Vats, N., Hutchison, D., Butler, J., Chisholm, K.,

Sisson, G., Raudonikiene, A., Marshall, J.S. and Veldhuyzen van

Zanten, S.J. (2003) Development of an interleukin-12-deficient

mouse model that is permissive for colonization by a motile

KE26695 strain of Helicobacter pylori. Infect. Immun. 71, 2534–

2541.

[11] Bauditz, J., Ortner, M., Bierbaum, M., Niedobitek, G., Lochs, H.

and Schreiber, S. (1999) Production of IL-12 in gastritis relates to

infection with Helicobacter pylori. Clin. Exp. Immunol. 117, 316–

323.

[12] deJonge, R., Bakker, D., van Vliet, A.H.M., Kuipers, E.J., Van

denbroucke-Grauls, C.M.J.E. and Kusters, J.G. (2003) Direct

random insertion mutagenesis ofHelicobacter pylori. J. Microbiol.

Meth. 52, 93–100.

[13] Covacci, A., Censini, S., Bugnoli, M., Petracca, R., Burroni, D.,

Macchia, G., Massone, A., Papini, E., Xiang, Z., Figura, N. and

Rappuoli, R. (1993) Molecular characterization of the 128-kDa

immunodominant antigen of Helicobacter pylori associated with

cytotoxicity and duodenal ulcer. Proc. Natl. Acad. Sci. USA 90,

5791–5795.

[14] Goodwin, A., Kersulyte, D., Sisson, G., VeldhuyzenvanZanten,

S.J., Berg, D.E. and Hoffman, P.S. (1998) Metronidazole resis-

tance in Helicobacter pylori is due to null mutations in a gene

(rdxA) that encodes an oxygen-insensitive NADPH nitroreduc-

tase. Mol. Microbiol. 28, 383–393.

[15] Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular

cloning, a laboratory manual, 2nd ed. Cold Spring Harbor

Laboratory, Cold Spring Harbor, NY.

[16] Kwon, Y.M. and Ricke, S.C. (2000) Efficient amplification of

multiple transposon-flanking sequences. J. Microbiol. Meth. 41,

195–199.

[17] Loffeld, R.J.L.F., Werdmuller, B.F., Kusters, J.G. and Kuipers,

E.J. (2000) IgG antibody titer against Helicobacter pylori

correlates with presence of cytotoxin associated gene A-positive

H. pylori strains. FEMS Immunol. Med. Microbiol. 28, 139–

141.

[18] Alm, R.A., Ling, L.S., Moir, D.T., King, B.L., Brown, E.D.,

Doig, P.C., Smith, D.R., Noonan, B., Guild, B.C., deJonge, B.L.,

Carmel, G., Tummino, P.J., Caruso, A., Uria-Nickelsen, M.,

Mills, D.M., Ives, C., Gibson, R., Merberg, D., Mills, S.D.,

Jiang, Q., Taylor, D.E., Vovis, G.F. and Trust, T.J. (1999)

Genomic-sequence comparison of two unrelated isolates of

the human gastric pathogen Helicobacter pylori. Nature 397,

176–180.

R. de Jonge et al. / FEMS Immunology and Medical Microbiology 41 (2004) 161–167 167

[19] Tomb, J.F., White, O., Kerlavage, A.R., Clayton, R.A., Sutton,

G.G., Fleischmann, R.D., Ketchum, K.A., Klenk, H.P., Gill, S.,

Dougherty, B.A., Nelson, K., Quackenbush, J., Zhou, L.,

Kirkness, E.F., Peterson, S., Loftus, B., Richardson, D., Dodson,

R., Khalak, H.G., Glodek, A., McKenney, K., Fitzegerald, L.M.,

Lee, N., Adams, M.D., Hickey, E.K., Berg, D.E., Gocayne, J.D.,

Utterback, T.R., Peterson, J.D., Kelley, J.M., Cotton, M.D.,

Weidman, J.M., Fujii, C., Bowman, C., Watthey, L., Wallin, E.,

Hayes, W.S., Borodovsky, M., Karpk, P.D., Smith, H.O., Fraser,

C.M. and Venter, J.C. (1997) The complete genome sequence of

the gastric pathogen Helicobacter pylori. Nature 388, 539–547.

[20] Tanaka, J., Suzuki, T., Mimuro, H. and Sasakawa, C. (2003)

Structural definition on the surface of Helicobacter pylori type IV

secretion apparatus. Cell Microbiol. 5, 395–404.

[21] Occhialini, A., Marais, A., Alm, R., Garcia, F., Sierra, R. and

Megraud, F. (2000) Distribution of open reading frames of

plasticity region of strain J99 inHelicobacter pylori strains isolated

from gastric carcinoma and gastritis patients in Costa Rica. Infect.

Immun. 68, 6240–6249.

[22] Santos, A., Queiroz, D.M., Menard, A., Marais, A., Rocha, G.A.,

Oliveira, C.A., Nogueira, A.M., Uzeda, M. and Megraud, F.

(2003) New pathogenicity marker found in the plasticity region

of the Helicobacter pylori genome. J. Clin. Microbiol. 41, 1651–

1655.

[23] Yamaoka, Y., Kodama, T., Gutierrez, O., Kim, J.G., Kashima,

K. and Graham, D.Y. (1999) Relationship between Helicobacter

pylori iceA, cagA, and vacA status and clinical outcome: studies in

four different countries. J. Clin. Microbiol. 37, 2274–2279.

[24] de Jonge, R., Pot, R.G.J., Loffeld, R.J.L.F., van Vliet, A.H.M.,

Kuipers, E.J. and Kusters, J.G. (2004) The functional status of the

Helicobacter pylori sabB adhesin gene as a putative marker for

disease outcome. Helicobacter 9, 158–164.