Thalassaemia-like carriers not linked to the b-globin gene cluster

The b-thalassaemias are a very heterogeneous group of

autosomal recessive disorders characterised by reduced (b+)or absent (b�) production of b-globin chains (Weatherall et al,

2001). To date, approximately 200 different molecular defects

affecting the b-globin gene and leading to the b-thalassaemia

phenotype have been reported (Huisman et al, 1997). Homo-

zygosity or compound heterozygosity for b-thalassaemia

usually result in the severe transfusion-dependent thalassaemia

major phenotype or, more rarely, in the milder non-transfu-

sion dependent variety referred to as thalassaemia intermedia.

These milder forms are produced from homozygosity or

compound heterozygosity for mild or silent b-thalassaemia

mutations or from the coinheritance of homozygosity for a

typical severe b-thalassaemia mutation with some ameliorating

genetic determinants, such as a-thalassaemia or hereditary

persistence of fetal Hb. Even more rarely, thalassaemia

intermedia is caused by double heterozygosity for typical

b-thalassaemia and the triple a globin gene rearrangements or

heterozygosity for hyperunstable Hb molecules. The large

majority of the b-thalassaemia heterozygotes show the typical

phenotype of the b-thalassaemia carrier state, namely low

mean corpuscular volume (MCV) and mean corpuscular

haemoglobin (MCH), high HbA2 levels, and unbalanced

globin chain synthesis. A minor group, dubbed silent b-thalassaemia, display normal red blood cell indices and

normal/border-line HbA2 levels, and are defined solely by

unbalanced globin chain synthesis (Gonzalez-Redondo et al,

1989; Ristaldi et al, 1990; Rosatelli et al, 1995; Moi et al, 2004).

A few subjects of Italian, English, and Portuguese origin who

present a b-thalassaemia-like carrier phenotype (b-thalas-saemia like determinant) with completely normal b-globingene sequences have been reported (Murru et al, 1992; Thein

et al, 1993; Pacheco et al, 1995). Furthermore, the co-inher-

itance of such a b-thalassaemia-like determinant with typical

b-thalassaemia has been postulated to explain the thalassaemia

intermedia phenotype manifested by otherwise typical hetero-

Valeria Faa,1 Alessandra Meloni,1

Loredana Moi,2 Giuseppe Ibba,2

Maurizio Travi,3 Antonio Vitucci,4

Antonio Cao1 and Maria Cristina

Rosatelli2

1Istituto di Neurogenetica e Neurofarmacologia,

CNR, Cagliari, 2Dipartimento di Scienze

Biomediche e Biotecnologie, Universita degli Studi,

Cagliari, 3IRCCS Ospedale Maggiore Policlinico

Mangiagalli e Regina Elena, Milano, and4Divisione di Ematologia II, Universita di Bari,

Bari, Italy

Received 29 August 2005; accepted for

publication 14 November 2005

Correspondence: Maria Cristina Rosatelli,

Dipartimento di Scienze Biomediche e

Biotecnologie, Universita di Cagliari, via

Jenner s/n, 09121, Cagliari, Italy.

E-mail: rosatelli@mcweb.unica.it

Summary

This study describes the largest series reported to date, of individuals

belonging to unrelated families carrying a b-thalassaemia-like phenotype in

whom the b-globin gene was found to be structurally intact by sequence

analysis. This genetic determinant appears haematologically heterogeneous,

displaying either a silent b-thalassaemia-like phenotype or a typical

b-thalassaemia carrier-like phenotype in different families. Compound

heterozygosity for both b-thalassaemia-like determinant and typical

b-thalassaemia allele resulted either in thalassaemia intermedia or

thalassaemia major. By linkage analysis both the silent and the typical

b-like determinants were found not to be linked to the b-globin cluster.

Sequence analysis of the hypersensitive site cores of locus control region and

of the genes coding for the transcription factors erythroid Kruppel-like factor

and nuclear factor (erythroid-derived 2) were normal. b-globin mRNA levels

determined by real-time polymerase chain reaction were reduced in both

types of b-like carriers. These results indicate the existence of causative

genetic determinants not yet molecularly defined, but most likely, resulting

from either the reduction or loss of function of a gene coding for unknown

transcriptional regulator(s) of the b-globin gene. The knowledge of these

rare b-thalassaemia-like determinants have implications for clinical and,

especially, prenatal diagnosis of b-thalassaemia.

Keywords: b-thalassaemia, gene expression, globin genes, quantitative

polymerase chain reaction, transcription factors.

research paper

doi:10.1111/j.1365-2141.2005.05915.x ª 2006 Blackwell Publishing Ltd, British Journal of Haematology, 132, 640–650

zygotes for b-thalassaemia (Rund et al, 1997; Gasperini et al,

1998; Ho et al, 1998a,b). In these cases, however, the severe

phenotype may be related to the presence of a somatic mosaic

of the stem cell pool for an acquired deletion involving the b-globin gene cluster and making a clone of erythroid precursor

de facto hemizygous for the b-thalassaemia mutation, as

recently reported in three families (Badens et al, 2002;

Galanello et al, 2004). The postulated unknown b-thalas-saemia-like determinant(s) may lie either within the locus

control region (LCR) or in the 3¢ b-globin enhancer (Grosveld,

1999; Li et al, 1999). However, in the best characterised cases

reported so far, the b-like determinants appeared unlinked to

the b-globin gene cluster. Therefore, this thalassaemia-like

phenotype most likely depends on the defective function of a

trans-acting erythroid-specific transcription factor, of which

possible candidates are erythroid Kruppel-like factor (EKLF)

(Miller & Bieker, 1993), nuclear factor (erythroid-derived 2)

(NF-E2 (Andrews et al, 1993), or GATA-1 (Weiss & Orkin,

1995). The first molecularly characterised condition so far

described that shows a thalassaemia phenotype not caused by

the defective function of any gene of the a or b-globin gene

cluster is the ATR-X syndrome [Online Mendelian Inheritance

in Man (OMIM) number 301040], which is characterised by

syndromic mental retardation and the a-thalassaemia pheno-

type resulting from a molecular defect in an X-linked gene

coding for a trans-acting chromatin-remodelling protein called

ATR-X (Gibbons et al, 1995). Quite recently a b-thalassaemia-

like phenotype was found to result from a defect of either a

general transcription factor, i.e. transcription factor IIH

(TFIIH), or of an erythroid-specific factor, GATA-1 with

mutations lying in its N-finger. However, in both cases the

b-thalassaemia phenotype is associated with other features,

namely trichothiodystrophy in the mutation of the TFIIH gene

and macrothrombocytopenia in the GATA-1 mutations

(Nichols et al, 2000).

In the past few years, while carrying out the molecular

characterisation of over 8000 subjects with the phenotype of

high HbA2 b-thalassaemia or silent b-thalassaemia, we detec-

ted several b-thalassaemia-like carriers, in whom the b-globingene was found to be structurally intact by sequencing analysis.

Herein, we report studies that include linkage analysis to the

b-globin gene cluster, sequence analysis of hypersensitive site

(HS) cores of LCR, NF-E2, and EKLF, and quantitative

b-globin mRNA analysis on these subjects with the aim of

characterising molecularly these atypical b-thalassaemia-like

phenotypes.

Patients and methods

Patients

This study includes 11 unrelated families of Italian origin with

several members displaying b-thalassaemia-like haematological

features. The pedigrees of these families are shown in

Figures 1–3.

The propositi in families A (II-1) and B (III-1 and III-2),

were affected by transfusion-dependent thalassaemia major,

while in families C (II-9) and K (II-1 and II-2) they presented

the phenotype of thalassaemia intermedia. The remaining

families included only subjects with the heterozygous

b-thalassaemia-like condition. Prenatal diagnoses by fetal

globin chain synthesis was carried out in families F, H, and I.

Methods

DNA analysis DNA extraction was performed according to

standard procedures (Miller et al, 1998). Informed consent

was obtained in all cases before the collection of blood samples.

Screening for common b-thalassaemia mutations in the

Mediterranean population was carried out on amplified DNA

by reverse dot blot hybridisation (Saiki et al, 1989). The

presence of unknown mutations was investigated by denatur-

ing gradient gel electrophoresis (DGGE) (Myers et al, 1985;

Cai & Kan, 1990; Rosatelli et al, 1992). Because these

techniques may fail to detect the molecular defects causing

b-thalassaemia, the b-globin gene was completely sequenced

from position )158 5¢ to the Cap site to position +60 3¢ fromthe polyadenilation signal, according to the dideoxy-chain

termination method of Sanger et al (1977) using the Big Dye

Terminator cycle sequencing kit (Applera, Norwalk, CT, USA).

Sequencing reactions were run on ABI PRISM 3100 (Applera).

b-Globin haplotypes were determined by studying 10

polymorphic sites along the b-globin cluster by restriction

enzyme digestion of amplified DNA fragments. The polymor-

phic loci analysed were HincII e, XmnI 5¢ Gc, HindIII Gc,HindIII Ac, HincII 5¢wb, HincII 3¢wb, HinfI 5¢b, RsaI 5¢b,HinfI 3¢b, and HpaI 3¢b(Varawalla et al, 1992). Five more

polymorphic sites (C fi T at codon 2 of exon 1, C fi G at

nt 16, G fi T at nt 74, C fi T at nt 81, and T fi C at nt

666 of the second introne) were detected within the b-globingene by DGGE or sequencing analysis. In order to detect large

deletions of the b-globin cluster, Southern Blot analysis was

performed according to standard procedures (Southern, 1975).

Genomic DNA was digested with the following restriction

endonucleases: HindIII, EcoRI, BamHI, HpaI, and BglII and

hybridised with d, wb, Ac, Gc, and e probes, as well as the

minilocus SK-l LAR probe containing HS 1, 2, 3, 4 and the Gcpromoter (Antonarakis et al, 1982; Orkin et al, 1982).

The HS-1, HS-2, HS-3, and HS-4 core regions of the locus

control region, as well as the EKLF and the NF-E2 genes were

analysed by direct sequencing. The sequencing primers are

listed in Table I.

Determination of a-globin gene number was assessed as

described previously (Gossens et al, 1980). Presence of the

aaaanti)4.2 allele was excluded by Southern blot analysis. The

aaaanti-3.7 allele was excluded by polymerase chain reaction

(PCR) as previously described (Dode’ et al, 1992). Two non-

deletional forms of a-thalassaemia were screened for using

NcoI digestion of PCR products from the a2-and a1-globingenes (Pirastu et al, 1984; Moi et al, 1987).

b-Thalassaemia not Linked to the b-Globin Gene

ª 2006 Blackwell Publishing Ltd, British Journal of Haematology, 132, 640–650 641

RNA analysis Erythrocytes and reticulocytes were separated

from 10 ml of peripheral blood using Sigmacell Type 50 (Sigma,

St Louis, MO, USA) and alpha cellulose (Sigma) resins (Beutler

& Gelbart, 1986). Reticulocyte enrichment was performed using

Percoll and phosphate-buffered saline gradients. Cytoplasmatic

RNA was extracted from reticulocytes using TRIzol LS (Life

Technologies, Carlsbad, CA, USA) (Chomczynski & Sacchi,

1987). cDNA synthesis was performed with the High Capacity

cDNA Archive kit (Applera) used according to the

manufacturer’s instructions. As we found a strongly reduced

expression of several commonly used housekeeping transcripts

(b-actin, 18SRNA, b2 microglobulin, and GHPDH) in

reticulocytes and a-globin genes in our patients were

structurally intact, we used the cDNA of alpha globin genes as

an internal control. Primers and probes were designed to span

exon junctions in the fully processed message in order to

prevent reporting of amplification of any possible

contaminating genomic DNA. The design of primers and

probes was performed by the Primer Express v.2 (Applera)

software. The following primers and probes were used: b-globinforward primer, 5¢-CACCTTTGCCACACTGAGT-GA-3¢;

b-globin reverse primer, 5¢-GTGATGGGCCAGCACACA-3¢;b-globin TaqMan probe, 5¢-FAM- ATCCTGAGAACTTCAGG-

CTCCTGGGC-TAMRA-3¢; a-globin forward primer, 5¢-GC-ACGCTGGCGAGTATGG-3¢; a-globin reverse primer, 5¢-TCGAAGTGCGGGAAGTAGGT-3¢; a-globin TaqMan probe,

5¢-VIC- AGGCCCTGGAGAGGATGTTCCTGTC-TAMRA-3¢.cDNA was amplified both for the target gene (beta) and for

the control gene (alpha). For each gene we calculated the cycle

threshold (Ct). Quantitative real time-PCR assay was

performed in an ABI Prism 7000 Sequence Detection Systems

(Applied Biosystems, Foster City, CA, USA). Relative

quantification of beta transcripts was calculated by a

comparative method 2^-DDCt (Livak & Schmittgen, 2001).

Results

This study reports the largest series to date, of subjects from 11

unrelated families of Italian origin carrying ab-thalassaemia-like

determinant not linked to the b-cluster. The clinical and

haematological characteristics show marked heterogeneity,

which led to the identification of at least two different

maF Aβ 1SVI 1- 10

tneliS β ht- a essal im a t tiar

maF B

maF C

VCM 58bH ·21 5

2AbH ·3 0α/β ·2 60

FbH 1<

M VC 77bH ·9 6

Hb 2A ·4 3α/β+γ ·3 69

FbH ·8 9

VCM 77bH ·21 9

2AbH ·2 6α/β ·4 1

FbH 1<

VCM 87 77bH ·41 8 ·21 2

2AbH ·2 6 2·2α/β ·1 68 ·2 8HbF 1< 1<

hT la ma oj r

β 93

lahT ma roj

M VC 38 ·68 5bH ·8 1 ·01 3

Hb 2A ·2 7 2·9

21

1

I

II

III

1 2

1 2 3

1 2 T lah m roja

I

II

VCM 87 08

bH 61 ·61 2

2AbH ·2 66 ·2 92

α/β ·1 71 ·1 64

FbH 1< 1<

VCM 75 78bH 13·5 12·4

2AbH 2·29 2·91α/β 2·2 1·74HbF 1< 1<

VCM 67bH ·61 2

2AbH ·2 96α/β ·2 1

FbH 1<

β 93

lahT mretni de ai

lahT mretni de ai

I

II

1 2 3

4 5 6

1 2 3

7 8 9

paH l epytoB/A D/C

D/A D/B D/E

D/B D/D

paH l epyto/F G H/I

I/F I/F

wonK n β itatumeneg- no

VCM 62 71 73bH 11·8 13·1 7·7

2AbH 4·46 2·52 2·8α/β 2·54 1·99 α/β+γ ·3 90

FbH 1< 01

Fig 1. Pedigree of families A, B, and C showing the relevant haematological data and the b-globin cluster haplotype. b-globin haplotype analysis was

performed in families B and C, showing non-linkage of the b-thalassaemia trait with the b-globin gene cluster. The defined alleles (b IVS1-110

mutation in family A and b 39 mutation in families B and C) are indicated.

V. Faa et al

642 ª 2006 Blackwell Publishing Ltd, British Journal of Haematology, 132, 640–650

phenotypes of this b-like determinant, namely a silent b-thalas-saemia-like phenotype with low/normal MCV, normal HbA2

levels and markedly unbalanced globin-chain synthesis (type 1)

(families A, B and C) and a typical b-thalassaemia-like pheno-

type with low MCV–MCH, high HbA2 levels and unbalanced

globin chain synthesis (type 2) (families D, E, F, G, H, I, J and K).

In all members of these families, the silent as well the

typical b-like determinant showed a completely normal b-globin gene sequence from position )158 to the CAP site to

position +60 3¢ to the polyadenilation signal. Furthermore

the compound heterozygous state for the silent determinant

and a typical b-thalassaemia allele resulted either in the

phenotype of thalassaemia major (families A and B) or

intermedia (family C). On the contrary, compound hetero-

zygosity for the typical b-thalassaemia-like determinant and

typical b-thalassaemia allele produced either a fetus affected

by severe b-thalassaemia according to the very low b/c globin

chain synthesis ratio (family I) or patients with thalassaemia

intermedia (family K).

Type 1 silent b-thalassaemia-like determinant

The type 1 b-thalassaemia-like determinant was detected in

three families (A, B and C).

Family A In this family, the proband II-1 was affected by

transfusion-dependent thalassaemia major in spite of having a

b-globin gene affected by a typical b-thalassaemia mutation

(b+ IVS I-110) inherited from his father and a type 1 silent

b-thalassaemia-like determinant transmitted from his mother

(Fig 1). His mother (I-2) showed a silent b-thalassaemia-like

phenotype with MCV values of 85 fl, a HbA2 level of 3% and

an a/b ratio of 2Æ06.

Family B Three individuals (I-2, II-1 and II-2) were carriers of

the type 1 silent b-thalassaemia-like determinant (Fig 1). They

had MCV values of 77–78 fl and an a/b ratio of 4Æ1 in I-2, 1Æ86in II-1 and 2Æ8 in II-2. The husband of II-2 is heterozygous for

the b�39 mutation. Their two children III-1 and III-2, one of

maF D lacipyT β laht- ssa e im a t tiarmaF E

VCM 39bH ·01 9

2AbH ·5 5HbF 1<

VCM 67bH ·41 3

2AbH ·4 8α/β ·1 2HbF 1<

VCM 97 87bH ·31 2 ·31 8

2AbH ·5 3 5·4α/β ·1 2

FbH 1< 1<

I

II

III

1 2

1 2

1 2

VCM ·55 7bH ·11 5

2AbH ·6 1α/β ·3 1

VCM ·17 4bH 31

2AbH ·5 5α/β ·1 34

FbH 1<

1 2

1 2

1

β 93

VCM ·87 9bH ·31 4

2AbH ·5 7FbH 1<

I

II

III

maF F

VCM 64 5 1bH 10·6 1 0·8

2AbH 4·4 4 ·5

VCM ·97 6bH ·51 5

2AbH ·5 2α/β ·1 32

FbH 1<

I

II

1 2

1 2

β 93

maF G

VCM 82 7 9bH 11·9 1 3·2

2AbH 5·3 4 ·2α/β ·0 29 ·1 30

FbH 1< 1<

VCM 79bH 41

2AbH 8FbH 1<

I

II

1 2

1 2

paH l epytoM/L N /O

/L O /C C

C/L O /C

wonK n β itatum eneg- no

Fig 2. Pedigree of families D, E, F, and G showing the relevant haematological data and the b-globin cluster haplotype. b-globin haplotype analysis

was performed in family D, showing non-linkage of the b-thalassaemia trait with the b-globin gene cluster. The defined alleles (b 39 mutation in

families E and F) are indicated.

b-Thalassaemia not Linked to the b-Globin Gene

ª 2006 Blackwell Publishing Ltd, British Journal of Haematology, 132, 640–650 643

which died last year, were affected by transfusion-dependent

thalassaemia major. Both inherited the b�39 allele from their

father and the type 1 silent b-thalassaemia-like determinant

from their mother. Unexpectedly, this genetic combination led

to the production of a thalassaemia major phenotype.

Family C Six individuals from this family, i.e. I-1, I-2, II-1, II-2,

II-6 and II-8 were carriers of the type 1 silent b-thalassaemia-

like determinant (Fig 1). Their MCV varied from 71 to 80 fl,

and the a/b ratio from 1Æ17 to 2Æ2. HbA2 levels were within the

normal range. One second generation individual (II-9) had the

phenotype of thalassaemia intermedia (moderate spleen and

liver enlargement, Hb 7Æ7 g/dl; HbF 10%, a/b+c ratio 3.09).

She carried the codon 39 non-sense mutation, which was

probably inherited from her father (I-3), who was dead at the

time of examination and was reported to have been affected by

thalassaemia intermedia. The in trans b-globin gene was normal

and the triple a-globin gene arrangement was not detected. Her

brother (II-7) inherited the b�39 allele and showed the typical

b-thalassaemia carrier state phenotype. Her mother had low

MCV (69 fl), normal HbA2, and a balanced a/b ratio. Based on

these findings we postulate that, besides the b�39 allele, II-9

inherited the type 1 silent b-thalassaemia-like determinant

from her father. This genetic combination may be the reason

for the thalassaemia intermedia phenotype.

Type 2 typical b-thalassaemia-like carriers

The type 2 typical b-thalassaemia-like determinant was

detected in eight families (D, E, F, G, H, I, J and K).

Family D Four members of this family (I-2, II-1, III-1 and III-

2) in three generations carried the type 2 typical

b-thalassaemia-like determinant (Fig 2). The determinant

segregating in this family was characterised by a HbA2 level

of between 4Æ8% and 5Æ5%, borderline MCV-MCH, and

slightly unbalanced b-globin chain synthesis.

Family E Two individuals of this family, I-1 and II-1, were

carriers of type 2 typical b-thalassaemia-like determinant with

MCV values of 78Æ9 and 71Æ4 fl, and HbA2 levels of 5Æ7 and

5Æ5%, respectively (Fig 2). II-1 married a carrier of the b�39

maF H

VCM ·97 3bH ·31 2

2AbH ·4 8α/β ·1 23

FbH 1<

VCM 77 ·57 3bH ·51 3 ·31 1

2AbH ·4 9 4·7α/β ·1 54 ·1 43

FbH 1< 1<

1 2lacipyT β laht- ssa e im a

tiartmaF II

II

III

1 2 3 4 5

paH l /P epyto B Q /S

/B Q /P S /P Q /B S /B Q

VCM 67bH ·41 6

2AbH ·3 7FbH 1<

VCM 27bH ·41 3

2AbH ·3 9α/β ·1 97

FbH 1<

I

II

III

1 2

1 2

1

β/γ ·0 010

β 1SVI 1- 10

maF J

VCM 07bH 41

2AbH ·6 8FbH 1<

I

II

21

1

1 2

1 2 3

VCM 86bH 51

2AbH 6α/β ·2 30

FbH 1<

maF K

VCM ·77 5bH ·11 2

2AbH ·4 3

VCM 57·6 5 5·6 6 2bH 9·8 9 ·6 11·5

2AbH 8·4 7 4· 4 ·3

I

II

paH l epyto R/S /U T

β 1SVI 1-

lahT mretni de ai

R/U /T R /T R

β 93

wonK n β eneg-itatum no

VCM ·65 8bH ·9 1

2AbH ·4 6

Fig 3. Pedigree of families H, I, J, and K showing the relevant haematological data and the b-globin cluster haplotype. b-globin haplotype analysis was

performed in families H and K, showing non-linkage of the b -thalassaemia trait with the b-globin gene cluster. The defined alleles (b 39 mutation in

family H, b IVS1-110 mutation in family I, and b IVS1-1 mutation in family K) are indicated.

V. Faa et al

644 ª 2006 Blackwell Publishing Ltd, British Journal of Haematology, 132, 640–650

mutation. Their daughter (III-1), showed an MCV value of

55Æ4 fl, HbA2 level of 5Æ8%, and an a/b ratio of 3Æ1 at the age of22 months. She inherited the b�39 nonsense mutation from

her mother, and at last follow-up, at 9 years of age, her Hb was

11Æ5 g/dl, MCV 55Æ7 fl, and HbA2 level 6Æ1%.

Family F In this family subject I-1 was a carrier of the type 2

typical b-thalassaemia-like determinant with MCV values of

79Æ6 fl, HbA2 levels of 5Æ5%, and a/b ratio of 1Æ23 (Fig 2). He

married a carrier of the b�39 mutation (I-2) who showed the

typical features of the b-thalassaemia trait. The couple had two

pregnancies in which prenatal diagnosis was carried out by

both fetal DNA analysis and globin chain synthesis. In both

fetuses, DNA analysis showed heterozygosity for the b�39nonsense mutation. Fetal globin chain synthesis analysis

showed b/c ratios of 0Æ040 and 0Æ038. The fetuses were

considered heterozygotes for the b�39 nonsense mutation. The

haematological evaluation of the two children shown in

the figure was performed at 1 year of age and confirmed the

prenatal test.

Family G The three members of this family (I-1, II-1 and II-2)

displayed the type 2 typical b-thalassaemia-like determinant

(Fig 2). The determinant segregating in this family is

characterised by a HbA2 level of between 4Æ2 and 8%,

borderline MCV–MCH, and a normal b-globin chain

synthesis.

Family H Three individuals from this family, i.e. I-2, II-1 and

II-3 were carriers of the type 2 typical b-thalassaemia-like

determinant (Fig 3). Their MCV varied from 75 to 79 fl, their

HbA2 levels were between 4Æ7% and 4Æ9%, and their a/b ratio

from 1Æ32 to 1Æ54. Individual II-1 married a carrier of the b�39mutation showing the typical features of the b-thalassaemia

trait. The couple had two pregnancies in which prenatal

diagnoses was carried out by both fetal DNA analysis and

globin chain synthesis analysis. In both fetuses DNA analysis

showed heterozygosity for the b�39 nonsense mutation. Fetal

globin chain synthesis analysis showed b/c ratios of 0Æ035 and

0Æ040. The fetuses were considered heterozygotes for the b�39

Table I. Sequence primers used to study erythroid Kruppel-like factor (EKLF), nuclear factor (erythroid-derived 2 genes) (NF-E2) and hypersensitive

sites (HS) core regions.

Sequence

GeneBank

position

Annealing

temperature (�C)

EKLF

Forward TTTTTACCCAGCACCTGGAC 12856699 53

Reverse ACCTGGGACTACAGGCACA 12857394

Forward ACGAAGGTAGCCTGGGCAAC 12857349 57

Reverse GAGCCCCACCACTGCGG 12858099

Forward CCTCTGCGTCAGAGTGTCCA 12857899 57

Reverse CCCCGAGTCCAGTGCCCA 12858649

Forward GCCTCAGTACCAAGGGCA 12858520 53

Reverse TCAAAGGTGGCGCTTCATGT 12859242

NF-E2

Forward GGAGGGTTGGAGGAAGGACT 52972425 56

Reverse ACCAGGGGCAATCTAGAAAGTC 52972825

Forward TTAAGGGATTGATGAATCCAGCATGA 52978025 56

Reverse CCCAGTGCCTGGAGCATTAC 52978425

Forward TGTGGCAACTTTGTTTCCTTGTTAC 52979875 55

Reverse ACTCCACTGGGTACATCTCTAC 52980425

Forward GGATTATCCCTCAACTATAGCG 52980375 53

Reverse AACCTCTGGGCCAGCTCA 52981075

HSs

HS1

Forward CCTGGTATCCTAGGACCTGC 13141 55

Reverse CTGAAAGTAAACTTCCACAACCGC 13798

HS2

Forward TAAGCTTCAGTTTTTCCTTAGT 8484 55

Reverse CAGATCTGACCCCGTATGTGAGCAT 9224

HS3

Forward GACTCAGCAAACACAAGACCC 4511 55

Reverse GGGCTTCCATGTTTCCAGTGA 5281

HS4

Forward CACAACGACCCATATAGACA 68 52

Reverse GGAAATCATTTACTCCAGACTC 1528

b-Thalassaemia not Linked to the b-Globin Gene

ª 2006 Blackwell Publishing Ltd, British Journal of Haematology, 132, 640–650 645

nonsense mutation. The haematological evaluation of one

child (III-1) was performed at 1 year of age and confirmed the

prenatal test.

Family I Subject II-2 from this family was a carrier of the

b+ IVS-I nt110 mutation and had the typical features of the

b-thalassaemia trait. Her husband (II-1) and her mother-in-law

(I-2) have the typical haematological features of heterozygous

b-thalassaemia, but the b-globin gene was completely intact

(Fig 3). The couple presented with an ongoing pregnancy and

decided to have prenatal diagnosis. This was carried out both by

fetal DNA analysis and by globin chain synthesis. DNA analysis

of the fetus showed heterozygosity for the b+ IVS-I nt110

mutation. Fetal globin chain synthesis analysis showed very low

b-globin chain production (b/c 0Æ010) indicative of an affected

fetus. Because the fetus (III-1) was considered affected by

thalassaemia major resulting from the presence of the b+ IVS-I

nt110 mutation and an unknown molecular defect, the

pregnancy was terminated by the parents’ request.

Family J In this family, father and son were carriers of the type

2 typical thalassaemia-like determinant (Fig 3). MCV values

varied between 68Æ2 and 70 fl, and HbA2 between 6 and 6Æ8%.

II-1 had a a/b globin chain ratio of 2Æ03.

Family K In this family, two subjects, II-1 and II-2, were

affected by a thalassaemia intermedia phenotype (Fig 3). They

inherited only one b-globin gene affected by a typical

b-thalassaemia mutation (b+ IVS I-1) from their father and

a type 2 typical b-thalassaemia-like determinant transmitted by

their mother. The mother (I-2) had MCV values of 77Æ5 fl and

a HbA2 level of 4Æ3%. One individual in the second generation

(II-3) inherited the b+ IVS I-1 allele from her father and

showed the typical b-thalassaemia carrier state phenotype.

Haplotype analysis

b-Haplotypes were constructed from 10 restriction fragment

length polymorphisms: HincII e, XmnI 5¢ Gc, HindIII Gc,HindIII Ac, HincII 5¢wb, HincII 3¢wb, HinfI 5¢b, RsaI 5¢b,HinfI 3¢b, and HpaI 3¢b (Table II). A further five polymorphic

sites, located in the b-globin gene, were detected by DGGE at

codon 2 of exon 1 (C fi T), at nt 16 (C fi G), at nt 74

(G fi T), at nt 81 (C fi T), and at nt 666 (T fi C) of the

second intron.

Haplotype analysis of the b-globin gene cluster was

performed in families B, C, D, H, and K (Figs 1, 2 and 3).

In family B, patient III-1 was affected by thalassaemia major.

Haplotype analysis indicated that the codon 39 nonsense

mutation was linked to haplotype D ()++)+++) and the type

1 silent b-thalassaemia-like determinant was linked to haplo-

type B ()))))++). When the mother became pregnant

prenatal diagnosis was carried out. The fetus (III-2) showed

haplotype D/F, which suggested that he inherited only the

codon 39 nonsense mutation. The infant was born at term and

in spite of the fact that she was a simple heterozygote for the

codon 39 mutation, she was found to be affected by

thalassaemia major. Re-evaluation and extension of b-globinhaplotype analysis indicated that, in this family, the type 1

silent b-thalassaemia like determinant was most probably not

linked to the b-globin cluster (Fig 1, Table II). However, we

cannot rule out the remote possibility of linkage resulting from

a recombination event in the db-globin region in III-1.

In family D, b-globin haplotype analysis indicates that the

type 2 typical b-thalassaemia like determinant was most

probably not linked to the b-globin cluster (Fig 2, Table II).

However, as in family B, we cannot rule out the possibility of a

recombination event in the db-globin region in subject III-1.

In families C, H, K, b-cluster haplotypes analysis indicatedthat both the type 1 (family C) and the type 2 (families H and

K) b-thalassaemia-like determinants were not linked to the

b-globin gene cluster (Figs 1 and 3, Table II).

d-Globin gene analysis

The b-thalassaemia-like determinant segregating in families D

and G was characterised by a HbA2 level of between 4Æ8% and

8Æ0%, low/normal MCV-MCH, and a slightly unbalanced/

normal b-globin chain synthesis. These characteristics could

result from a mutation in the d-globin gene, determining a

high output of d-globin chains. However, analysis of d-globingene from position )520 to the CAP site to position +140 from

the polyadenilation site in these subjects showed totally normal

sequences.

Locus control region analysis

The HS-1, HS-2, HS-3, HS-4 core regions of the LCR were

analysed by direct sequencing of amplified DNA in families B,

C, D, E, F, G, I, J, and no variations from the wild-type

sequences were detected. LCR analysis was not carried out in

family A because no DNA was available, or in families H and K

as there is strong evidence that there is no linkage to b-globingene cluster.

Southern blot analysis

Southern blot analysis carried out with d, wb, Ac, Gc, and eprobes, as well as with the minilocus SK-l LAR probe

containing HS 1, 2, 3, 4 and the Gc promoter, excluded the

presence of b globin cluster gross deletions. The finding of

heterozygosity for both intragenic and extragenic polymorphic

markers (Table II) further support this conclusion.

Transcription factors analysis

Sequence analysis of the genes encoding for NFE2 and EKLF

transcription factors was performed in families B, C, D, E, F,

H, I, and J. In families A, G, and K, the analysis was not carried

out as no patient DNA was available.

V. Faa et al

646 ª 2006 Blackwell Publishing Ltd, British Journal of Haematology, 132, 640–650

In subject II-6 of family C, sequence analysis of the EKLF

gene detected heterozygosity for a nucleotide change C fi T

at codon 102, which resulted in a proline to leucine

substitution. In family D, besides heterozygosity for the

C fi T substitution at position 102 subjects I-2, II-1, III-1,

and III-2 showed a T fi C change in position 182,

determining a phenylalanine to leucine aminoacid substitu-

tion. However, sequence analysis of the EKLF gene from 200

chromosomes of normal individuals of the same Sardinian

origin detected both the C fi T and the T fi C nucleotide

substitutions in 49% and 14% respectively of the chromo-

somes investigated, indicating that these sequence variations in

the EKLF gene are simple polymorphisms that do not affect its

function. No sequence variations of this gene were detected in

b-thalassaemia-like carriers from families B, E, F, H, I, and J.

Sequence analysis of the NF-E2 gene showed wild-type

sequences in all b-thalassaemia-like carriers from these fam-

ilies.

Analysis of the GATA-1 gene was not carried out in our

families because the b-thalassaemia-like determinants did not

show an X-linked transmission pattern and none of the

investigated b-thalassaemia carriers showed macrothrombo-

cytopenia. Likewise, analysis of the TFIIH gene was not carried

out as none of the subjects investigated showed the phenotype

of trichothiodystrophy.

RNA analysis

Quantitative analysis of reticulocyte mRNA was performed in

some members of the reported 11 families. In family B

quantitative analysis was performed in patients I-2, II-2, and

III-2, showing a 70–80% b-globin gene mRNA reduction. In

this family the proband III-2 showed a 99% beta globin gene

mRNA reduction, in agreement with the b-thalassaemia major

phenotype.

Patients II-1 and III-2 of family D, I-1 of family F, and II-1

and II-2 of family G, showed a 60–65% b-globin gene mRNA

reduction.

Patients I-1 and II-1 of family E, and I-2, II-1, and II-3 of

family H showed a 70–80% b-globin gene mRNA reduction.

On patient II-1 of family J the analysis showed a 47% beta

globin gene mRNA reduction (Fig 4).

a-Globin gene analysis

a-Globin gene analysis excluded the presence of a-globin gene

deletion as well as a-globin gene implication.

Discussion

Understanding the regulation of the b-globin gene could have

relevant therapeutic implications for the treatment of wide-

spread diseases, such as thalassaemia and sickle cell disease. It

is well established that the regulation of the b-globin gene is

mainly controlled at the level of transcription and is mediatedTable

II.b-G

lobin

genecluster

representedbytheb-haplotypes

denotedbythepresence

(+)orabsence

())ofthe15

polymorphic

sites.

HincIIe

XmnI5¢

Gc

HindIIIGc

HindIIIAc

HincII5¢wb

HincII3¢wb

HinfI5¢b

RsaI5¢b

cod2

Cfi

T

IVSII-16

Cfi

G

IVSII-74

Gfi

T

IVSII-81

Cfi

T

IVSII-666

Tfi

CHinfI3¢b

HpaI

3¢b

A)

)+

)+

++

+)

++

))

))

B+

))

))

)+

+)

+)

))

++

C+

))

))

)+

+)

++

))

)+

D)

)+

+)

++

+)

+)

))

++

E)

)+

)+

++

+)

+)

))

++

F+

)+

)+

++

++

)+

++

++

G)

))

))

)+

+)

++

))

))

H+

)+

)+

++

+)

+)

))

++

I)

))

))

)+

+)

+)

))

+)

L)

)+

+)

))

+)

++

))

)+

M+

))

))

++

++

)+

++

+)

N+

))

))

)+

++

)+

++

++

O)

)+

+)

++

++

)+

++

++

P)

++

)+

+)

++

+)

))

)+

Q)

))

))

)+

+)

+)

))

++

R+

))

))

)+

+)

))

))

++

S+

++

)+

++

))

+)

++

)+

T)

)+

)+

+)

+)

)+

))

)+

U+

+)

))

)+

++

)+

+)

)+

b-Thalassaemia not Linked to the b-Globin Gene

ª 2006 Blackwell Publishing Ltd, British Journal of Haematology, 132, 640–650 647

by tissue-specific and general transcription factors. Despite

important progress in the identification of b-globin gene

regulators only two general (ATR-X and TFIIH) and one

tissue-specific (GATA1) factors have been so far associated

with human thalassaemia disease. It is likely that several of

these regulators could be identified by reverse genetic analysis,

studying those thalassaemia patients that have mutations not

linked to the b-globin gene cluster. In attempt to identify these

factors, we have carried out an extensive molecular analysis of

the largest series reported to date, of b-thalassaemia hetero-

zygous individuals carrying a b-thalassaemia determinant not

linked to the b-cluster, which in compound heterozygosity

with the typical b-thalassaemia carrier state led to thalassaemia

major or intermedia. These results furthermore indicated the

existence of a markedly heterogeneous group of b-thalas-saemia-like disorders not yet molecularly characterised.

In all of our cases, sequence analysis of the b-globin gene

failed to detect a disease-causing mutation. Likewise, no

deletion that may inactivate the b-globin gene leaving its

sequences intact was found in the b-globin gene cluster by

Southern blot analysis. In addition, heterozygosity for intra-

genic as well extragenic polymorphisms indicated the presence

of two b-globin genes. Furthermore, sequence analysis of the

core region of HS1, HS2, HS3, and HS4 showed a wild-type

sequence thus excluding involvement of these control regions

in determining the b-thalassaemia-like phenotype. Based on

their phenotypic characteristics these b-thalassaemia-like car-

riers were classified into two groups. The first is the type 1

silent b-thalassaemia-like determinant, and is characterised by

normal haematological parameters, normal HbA2, and unbal-

anced b-globin chains, thus displaying the phenotype of silent

b-thalassaemia. The second group showed the typical charac-

teristics of heterozygosity for b-thalassaemia with low MCV-

MCH, high HbA2, and unbalanced globin chain synthesis, and

has been designated as a type 2 typical b-thalassaemia-like

determinant. Both the silent and typical b-thalassaemia-like

phenotypes have low frequency, as they have been detected

following the molecular analysis of >8000 chromosomes of

individuals with a b-thalassaemia carrier phenotype. In several

of these families some individuals are affected either by

thalassaemia intermedia (families C and K) or by thalassaemia

major (families A, B and I). This is quite surprising,

particularly when considering the cases in families A and B,

where the interaction of the type 1 silent b-thalassaemia-like

determinant with typical b-thalassaemia mutation determined

a severe unbalanced globin chain synthesis resulting in a

thalassaemia major phenotype, in spite of the fact that the

clinical phenotype resulting from compound heterozygosity

for a classical silent b-thalassaemia mutation (i.e. mutations in

the distal CACCC box of the b globin gene) and a typical

b-thalassaemia mutation usually results in a mild phenotype

referred to as thalassaemia intermedia.

The presence in some carriers (families D and G) of type 2

typical b-thalassaemia-like determinants characterised by high

HbA2 associated with minimal changes in red blood cell

indices suggested that this trait could be due to a mutation in

the d-globin region causing an increased output in d-globinchains from the affected locus. Nevertheless the d-globin chain

sequence was normal.

Linkage analysis using b globin gene cluster haplotypes

showed that both the type 1 and the type 2 b-thalassaemia-

like determinants segregated independently of the b globin

gene complex, indicating absence of linkage to this chromo-

somal region. However in two families (B and D), linkage

could not be ruled out as there is a remote possibility of a

recombination event in the db-globin region in one member

of each family.

The data produced in this study clearly indicate that both

b-thalassaemia-like determinants severely curtail b-globinchain production. Defective b-globin chain output could

result from a reduced transcription of the b-globin gene or

from a translation defect of the b-globin mRNA. The

reduction in steady state b-globin mRNA levels in both types

of b-thalassaemia-like heterozygotes in some of the examined

families indicated that these b-thalassaemia-like phenotypes

are caused by a defect in the transcription of the b-globin gene.

Defective transcription of the b-globin gene may result from a

defective promoter of the b-globin gene or from a lesion in a

gene coding for a transcription factor that regulates its

function, such as EKLF, GATA-1, or NF-E2. Nevertheless,

sequence analysis of the genes coding for EKLF and NF-E2

showed a wild-type sequence, thus probably ruling out a

defective function of these transcriptional factors.

The gene coding for GATA-1 was not examined because

neither b-thalassaemia-like determinant in these families

showed an X-linked transmission pattern and none of the

studied b-thalassaemia carriers displayed macrothrombo-

cytopenias, which are always detected in the b-thalassaemia-

like carrier resulting from a defect in the GATA-1 gene.

0

20

40

60

80

100

120

Nor

mal I-2

II-2

III-2 II-1

III-2 I-1

II-1

I-1

II-1

II-2

I-2

II-1

II-3

II-1

%

B D E F G H J

Fig 4. Quantitative analysis of reticulocyte b-mRNA performed on

several subjects from families B, D, E, F, G, H, and J. A normal indi-

vidual shows 100% overall b-globin gene expression In families B, E,

and H the analysis shows 20–30% overall b-globin gene expression.

Patient III-2 from family B is affected by thalassaemia major and shows

1% of b-globin gene expression In families D, F, and G quantitative

analysis shows 35–40% overall b-globin gene expression. In family J

patient II-1 shows about 50% overall b-globin gene expression.

V. Faa et al

648 ª 2006 Blackwell Publishing Ltd, British Journal of Haematology, 132, 640–650

Likewise, analysis of the TFIIH gene was not carried out as

none of the subjects investigated showed the phenotype of

trichothiodystrophy.

The results produced in this study indicate that the gene(s)

involved in the determining b-thalassaemia-like phenotypes

most probably code(s) for an unknown crucial transcriptional

regulator of the b-globin gene function. The description of

b-like determinants that may lead, in the compound hetero-

zygous state with typical heterozygous b-thalassaemia allele, to

thalassaemia major or intermedia, indicate the need for clinical

as well forprenatal diagnosis to carry out appropriate family

studies. In these families, prenatal diagnosis was carried out in

two steps, of which the first consisted of mutation analysis for

the paternal or maternal typical b-thalassaemia mutation in

the fetal DNA. In cases where the fetus was found to be

heterozygous for the b-thalassaemia mutation, globin chain

synthesis analysis on fetal blood was performed to detect the

compound heterozygote state for the thalassaemia-like deter-

minant and typical b-thalassaemia. The only possibility to

identify the molecular defects responsible for both the type 1

and the type 2 b-thalassaemia-like determinants is a genome-

wide screen for polymorphisms (microsatellites or single

nucleotide polymorphisms) associated with b-thalassaemia-

like determinants. However, simulation analyses indicate that

the number of families enrolled so far is not sufficient for such

an analysis, considering also the marked heterogeneity of the

phenotypes segregating in these families. We hope to be able to

collect more families with segregating b-thalassaemia-like

conditions in the future and establish a national and interna-

tional collaboration to finally determine the molecular pathol-

ogy of this interesting group of patients. The molecular

definition of these cases is also very important as it may lead to

the discovery of further novel transcription factors regulating

the function of the b-globin gene.

Acknowledgements

This work was supported by grants from Assessorato Igiene e

Sanita, Regione Sardegna (LR n 11, 1990: ‘Patologia Molecol-

are genetica e terapia genetico-somatica della b-thalassaemia’

and Progetto di Prevenzione e Educazione Sanitaria: ‘Malattie

genetiche nella popolazione sarda: Talassemia, Apeced, Mal-

attia di Wilson’).

The authors would like to thank: Prof. Renzo Galanello

(Diparimento di Scienze Biomediche e Biotecnologie, Ospe-

dale Microcitemico, Cagliari, Italy) for confirming haemato-

logical data, Prof Maurizio Longinotti (Istituto di Ematologia,

Universita’ di Sassari, Sassari, Italy), Dr Matteo Francese

(Dipartimento di Pediatria Seconda, Universita’ di Napoli,

Napoli, Italy), and Prof. Elisa Calzolari (Dipartimento di

Medicina Sperimentale e Diagnostica, Universita’ di Ferrara,

Ferrara, Italy) for collecting samples performing haematolog-

ical analysis and clinical evaluation, Maria Demurtas for

technical support and all the families included in this study for

their cooperation.

References

Andrews, N.C., Erdjument-Bromage, H., Davidson, M.B., Tempst, P.

& Orkin, SH. (1993) Erythroid transcription factor NF-E2 is he-

matopoietic-specific basic leucine zipper protein. Nature, 362, 722–

728.

Antonarakis, S.E., Boehm, C.D., Giardina, P.J.V. & Kazazian, H.H.

(1982) Nonrandom association of polymorphic restriction sites in

the b-globin gene cluster. Proceedings of the National Academy of

Sciences of the United States of America, 79, 137–141.

Badens, C., Mattei, M.G., Imbert, A.M., Lapoumeroulie, C., Martini,

N., Michel, G. & Lena-Russo, D. (2002) A novel mechanism for

thalassaemia intermedia. Lancet, 359, 132–133.

Beutler, E. & Gelbart, T. (1986) The mechanism of removal of leu-

kocytes by cellulose columns. Blood Cells, 12, 57–64.

Cai, S.P. & Kan, Y.W. (1990) Identification of the multiple b-tha-lassemia mutations by denaturing gradient gel electrophoresis.

Journal of Clinical Investigation, 85, 550–553.

Chomczynski, P. & Sacchi, N. (1987) Single-step method of RNA

isolation by acid guanidium thiocyanate-phenol-chloroform

extraction. Analytical Biochemistry, 162, 156–159.

Dode’, C., Krishnamoorthy, R., Lamb, J. & Rochette, J. (1992)

Rapid analysis of -a3.7 thalassemia and aaaanti3.7 triplication by

enzymatic amplification analysis. British Journal of Haematology, 82,

105–111.

Galanello, R., Perseu, L., Perra, C., Maccioni, L., Barella, S., Longinotti,

M., Cao, A. & Cazzola, M. (2004) Somatic deletion of the normal

beta-globin gene leading to thalassaemia intermedia in heterozygous

beta-thalassaemic patients. British Journal of Haematology, 127, 604–

606.

Gasperini, D., Perseu, L., Melis, M.A., Maccioni, L., Sollaino, C.,

Paglietti, E., Cao, A. & Galanello, R. (1998) Heterozygous beta-

thalassemia with thalassemia intermedia phenotype. American

Journal of Hematology, 57, 43–47.

Gibbons, R.J., Picketts, D.J., Villard, L. & Higgs, D.R. (1995) Mutations

in a putative global transcriptional regulator cause X-linked mental

retardation with alpha-thalassemia (ATR-X syndrome). Cell, 80,

837–845.

Gonzalez-Redondo, J.M., Stoming, T.A., Kutlar, A., Kutlar, F., Lanclos,

K.D., Howard, E.F., Fei, Y.J., Aksoy, M., Altay, C., Gurgey, A., Basak,

A.N., Efremov, G.D., Petkov, G. & Huisman, T.H.J. (1989) A C-T

substitution at nt )101 in a conserved DNA sequence of the pro-

moter region of the b globin gene is associated with ‘silent’ b-tha-lassemia. Blood, 73, 1705–1711.

Gossens, M., Dozy, A.M., Embury, S.H., Zachariades, Z., Hadjiminas,

M.G., Stamatoyannopoulos, G. & Kan, Y.W. (1980) Triplicated

a-globin loci in humans. Proceedings of the National Academy of

Sciences of the United States of America, 77, 518–521.

Grosveld, F. (1999) Activation by locus control region? Current

Opinion in Genetics & Development, 9, 152–157.

Ho, P.J., Hall, G.W., Luo, L.Y., Weatherall, D.J. & Thein, S.L. (1998a)

Beta-thalassemia intermedia: is it possible consistently to

predict phenotype to genotype?. British Journal of Haematology, 100,

70–78.

Ho, P.J., Hall, G.W., Watt, S., West, N.C., Winperis, J.W., Wood, W.G.

& Thein, S.L. (1998b) Unusually severe heterozygous b-thalassemia:

evidence for an interacting gene affecting globin translation. Blood,

92, 3428–3435.

b-Thalassaemia not Linked to the b-Globin Gene

ª 2006 Blackwell Publishing Ltd, British Journal of Haematology, 132, 640–650 649

Huisman, T.H.J., Carver, M.F.H. & Baysal, E. (1997) A Syllabus of

Thalassemia Mutations. The Sickle Cell Anemia Foundation,

Augusta, GA, pp. 1–309.

Li, Q., Harju, S. & Peterson, KR. (1999) Locus control regions: coming

of age at a decade plus. Trends in Genetics, 15, 403–408.

Livak, K.J. & Schmittgen, T.D. (2001) Analysis of relative gene ex-

pression data using real-time quantitative PCR and the 2[-DD C(T)]

method. Methods, 25, 402–408.

Miller, I.J. & Bieker, J.J. (1993) A novel, erythroid b-thalassemia cell-

specific murine transcription factor that binds to the CACCC ele-

ment and is related to the Kruppel family of nuclear proteins.

Molecular Cellular Biology, 13, 2776–2786.

Miller, S.A., Dykes, D.D. & Polensky, H.F. (1998) A simple salting out

procedure for extracting DNA from human nucleated cells. Nucleic

Acids Research, 16, 1215.

Moi, P., Cash, F.E., Liebhaber, S.A., Cao, A. & Pirastu, M. (1987) An

initiation codonmutation (AUG fi GUG)of the humana1 – globingene: structural characterization and evidence for a mild thalassemic

phenotype. The Journal of Clinical Investigation, 80, 1416–1421.

Moi, P., Faa, V., Marini, M.G., Asunis, I., Ibba, G., Cao, A. & Rosatelli,

M.C. (2004) A novel silent b-thalassemia mutation in the distal

CACCC box affects the binding and responsiveness to EKLF. British

Journal of Haematology, 126, 881–884.

Murru, S., Loudianos, G., Porcu, S., Sciarratta, G.V., Agosti, S., Parodi,

M.I., Cao, A. & Pirastu, M. (1992) A b-thalassemia phenotype not

linked to the b-globin cluster in an Italian family. British Journal of

Haematology, 81, 283–287.

Myers, R.M., Fisher, S.G., Lerman, L.S. & Maniatis, T. (1985) Nearly all

single base substitutions in DNA fragments joined to a GC-clamp

can be detected by denaturing gradient gel electrophoresis. Nucleic

Acids Research, 13, 3131–3135.

Nichols, K.E., Crispino, J.D., Poncz, M., White, J.G., Orkin, S.H.,

Maris, J.M. & Weiss, M.J. (2000) Familial dyserythropoietic anaemia

and thrombocytopenia due to an inherited mutation in GATA-1.

Nature Genetics, 24, 266–270.

Orkin, S.H., Kazazian, H.H. Jr, Antonarakis, S.E., Goff, S.C., Boehm,

C.D., Sexton, J.P., Waber, P.G. & Giardina, P.J. (1982) Linkage of b-thalassemia mutations and b-globin gene polymorphisms with DNA

polymorphisms in human b-globin gene cluster. Nature, 296, 627–

631.

Pacheco, P., Peres, M.J., Faustino, P., Pischedda, C., Goncalves, J.,

Carvajales-Ramos, M., Seixas, T., Martins, M.C., Moi, P. & Lavinha,

J. (1995) Beta-thalassemia unlinked to the beta globin gene interacts

with sickle-cell trait in a Portuguese family. British Journal of Hae-

matology, 91, 85–89.

Pirastu, M., Saglio, G., Chang, J.C., Cao, A. & Kan, Y.W. (1984)

Initiation codon mutation as a cause of a-thalassemia. Journal of

Biological Chemistry, 259, 12315–12317.

Ristaldi, M.S., Murru, S., Loudianos, G., Casula, L., Porcu, S., Pigh-

eddu, D., Fanni, B., Sciarratta, G.V., Agosti, S., Parodi, M.I., Leone,

D., Camaschella, C., Serra, A., Pirastu, M. & Cao, A. (1990) The

C fi T substitution in the distal CACCC box of the b globin gene

promoter is a common cause of silent b-thalassemia in the Italian

polulation. British Journal of Haematology, 74, 480–486.

Rosatelli, M.C., Tuveri, T., Scalas, M.T., Leoni, G.B., Sardu, R., Faa, V.,

Meloni, A., Pischedda, M.A., Demurtas, M., Monni, G. & Cao, A.

(1992) Molecular screening and fetal diagnosis of b-thalassemia in

the Italian population. Human Genetics, 83, 590–592.

Rosatelli, M.C., Faa, V., Meloni, A., Fiorenza, F., Galanello, R.,

Gasperini, D., Amendola, G. & Cao, A. (1995) A promoter muta-

tion, C fi T at position )92, leading to a silent b-thalassemia.

British Journal of Haematology, 90, 483–485.

Rund, D., Oron-Karni, V., Filon, D., Rachmilewitz, E. & Oppenheim,

A. (1997) Genetic analysis of b-thalassemia intermedia in Israel:

diversity of mechanisms and unpredictability of phenotype. Ameri-

can Journal of Hematology, 54, 16–22.

Saiki, R.K., Walsh, P.S., Levenson, C.H. & Erlich, H.A. (1989) Genetic

analysis of amplified DNA with immobilized sequence-specific oli-

gonucleotide probes. Proceedings of the National Academy of Sciences

of the United States of America, 86, 6230–6234.

Sanger, F., Miicklen, S. & Coulson, A.R. (1977) DNA sequencing

with chain terminating inhibitors. Proceedings of the National

Academy of Sciences of the United States of America, 74, 5463–

5467.

Southern, E.M. (1975) Detection of specific sequences among DNA

fragments separated by gel electrophoresis. Journal of Molecular

Biology, 98, 503–517.

Thein, S.L., Wood, W.G., Wickramasinghe, S.N. & Galvin, M.C. (1993)

Beta-thalassemia unlinked to the beta-globin gene in an English

family. Blood, 81, 283–287.

Varawalla, N.Y., Fitches, A.C. & Old, J.M. (1992) Analysis of b-globinhaplotypes in Asian Indians: origin and spread of b-thalassemia on

the Indian subcontinent. Human Genetics, 90, 443–449.

Weatherall, D.J., Clegg, J.B., Higgs, D.R. & Wood, W.G. (2001) The

hemoglobinopathies. In: The metabolic and molecular bases of

inherited disease. (ed. by C.R. Scriver), pp. 4571–4636. McGraw-Hill,

New York.

Weiss, M.J. & Orkin, S.H. (1995) GATA transcription factors: key

regulators of hematopoiesis. European Journal of Biochemistry, 23,

99–107.

V. Faa et al

650 ª 2006 Blackwell Publishing Ltd, British Journal of Haematology, 132, 640–650