Accepted Manuscript

SCAB3 Is Required for Reorganization of Actin Filaments during Light QualityChanges

Chongwu Wang, Yuan Zheng, Yang Zhao, Yi Zhao, Jigang Li, Yan Guo

PII: S1673-8527(15)00036-3

DOI: 10.1016/j.jgg.2015.02.005

Reference: JGG 345

To appear in: Journal of Genetics and Genomics

Received Date: 4 November 2014

Revised Date: 11 February 2015

Accepted Date: 13 February 2015

Please cite this article as: Wang, C., Zheng, Y., Zhao, Y., Zhao, Y., Li, J., Guo, Y., SCAB3 Is Requiredfor Reorganization of Actin Filaments during Light Quality Changes, Journal of Genetics and Genomics(2015), doi: 10.1016/j.jgg.2015.02.005.

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service toour customers we are providing this early version of the manuscript. The manuscript will undergocopyediting, typesetting, and review of the resulting proof before it is published in its final form. Pleasenote that during the production process errors may be discovered which could affect the content, and alllegal disclaimers that apply to the journal pertain.

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

1

SCAB3 Is Required for Reorganization of Actin Filaments during Light Quality

Changes

Chongwu Wang a, Yuan Zheng b, Yang Zhao a, Yi Zhao a, Jigang Li a ,Yan Guo a*

a State Key Laboratory of Plant Physiology and Biochemistry, College of Biological

Sciences, China Agricultural University, Beijing 100193, China

b School of Life Science & Technology, Nanyang Normal University, Nanyang

473061, China

*To whom correspondence should be addressed.

Keywords: Arabidopsis; Cytoskeleton; Actin; Far red light

For correspondence:

Yan Guo

State Key Laboratory of Plant Physiology and Biochemistry

College of Biological Sciences

China Agricultural University

Beijing 100193

P.R. China

E-mail: guoyan@cau.edu.cn

Phone: 86-10-62732030

Fax: 86-10-62732030

1

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

2

Abstract 1

2

The STOMATAL CLOSURE-RELATED ACTIN BINDING PROTEIN (SCAB) 3

family is plant-specific, and its members all contain a novel actin binding domain. 4

Here, we report that SCAB3, a homolog of SCAB1, binds, stabilizes and bundles 5

actin filaments. The SCAB3 promoter contains a cis-element which could be bound by 6

the FHY3/FAR1 transcription factors. Consistently, the expression of SCAB3 is 7

induced when plants were transferred from white light to far red light (T-Far Red) 8

conditions. The scab3 mutants show defects in the control of hypocotyl elongation 9

under T-Far Red condition, which may result from an impaired reorganization of actin 10

filaments. Together, our results suggest that SCAB3 plays an important role in plant 11

growth under changes of light conditions possibly by regulating actin filament 12

dynamics. 13

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

3

INTRODUCTION 1

Photomorphogenesis refers to light-mediated development of plants. In the 2

absence of light, plants develop an etiolated growth pattern (Huang et al., 2014). 3

Etiolation of the seedlings induces elongation of hypocotyl, which may facilitate to 4

emerge from the soil. Higher plants have evolved a network of multiple 5

photoreceptors, including phytochromes, cryptochromes, and phototropins to monitor 6

the changes of light environment (Casal et al., 2014; Possart et al., 2014). The far-red 7

(FR) sensing pathway is comprehensively characterized (Sharrock and Quail, 1989; 8

Somers et al., 1991; Nagatani et al., 1993; Yanovsky et al., 2000; Hudson et al., 2003; 9

bin Yusof et al., 2014). PhyA is the receptor for FR. Under FR light condition, plants 10

exhibit a light-dependent high-irradiance response (HIR), including inhibition of 11

hypocotyl elongation, opening of apical hook, expansion of cotyledons, accumulation 12

of anthocyanin, and FR preconditioned blocking of greening (Casal et al., 2014). 13

Previous studies have identified two loci, FAR-RED ELONGATED HYPOCOTYL 3 14

(FHY3) and FAR-RED IMPAIRED RESPONSE 1 (FAR1), as two positive regulators 15

specifically for phyA-mediated HIR in response to FR light (Wang and Deng, 2002; 16

Hudson et al., 2003; Lin and Wang, 2004; bin Yusof et al., 2014). The fhy3 far1 17

mutants show elongated hypocotyls under continuous FR light (FRc). 18

Actin filaments (MFs) are the main composition of cytoskeletons which are 19

found in all eukaryotic cells. Actin can be present either as a free monomer named 20

G-actin, or as part of a linear polymer microfilament named F-actin, both of which are 21

essential for actin functions. In plant cells less than 10% of actin is in the filamentous 22

form, whereas in yeast or animal cells, the majority of actin is filamentous, suggesting 23

that the MFs of plant cells are remarkably dynamic (Snowman et al., 2002). Actin 24

plays an important role in cell division, material transportation, cell movement, and 25

cell expansion. Although previous reports suggest that reorganization of MFs plays an 26

important role during plant responses to environmental changes such as conversion of 27

light quality (Sakurai et al., 2005; Kadota et al., 2009; Iwabuchi and Takagi, 2010; 28

Ichikawa et al., 2011; Whippo et al., 2011; Wen et al., 2012), little is known about the 29

details of this process. In this report, we show that SCAB3, a SCAB family protein, 30

regulates hypocotyl elongation during changes of light quality. 31

32

RESULTS 33

34

SCAB3 is an actin binding protein and contains a SCAB family actin binding 35

domain 36

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

4

In Arabidopsis, there are two SCAB1 like proteins, designated as SCAB2 and 1

SCAB3, all of which contain a conserved domain for actin binding (Fig. 1A). 2

Phylogenetic analysis of the Arabidopsis SCAB family is shown in Fig. 1B. In this 3

study, we focus on functional characterization of SCAB3, encoding a protein of 490 4

amino acids. 5

To determine the subcellular localization of SCAB3, GFP reporter was fused to 6

the N-terminus of SCAB3, and the GFP-SCAB3 fusion is under the control of the 35S 7

promoter. The resulted construct was transformed into the wild-type Arabidopsis 8

protoplasts [Columbia-0 (Col-0)]. GFP-SCAB3 was detected in fibrous structural 9

networks in the cytoplasm (Fig. 1C), suggesting that SCAB3 also co-localized with 10

the plant cytoskeletal system. To determine the spatial relationship between SCAB3 11

filamentous structure and microtubules (MTs) and microfilaments (MFs), the 12

protoplasts expressing GFP-SCAB3 were treated with latrunculin A (LatA) or 13

oryzalin. LatA is an inhibitor of actin polymerization that disrupts actin filaments by 14

binding actin monomers, whereas oryzalin disrupts MTs by binding α-tubulin. After 15

15 min treatment with 100 nmol/L Lat A, the GFP-SCAB3 network was disrupted in 16

most of the examined cells (Fig. 1D). By contrast, after 15 min treatment with 10 17

µmol/L oryzalin, the filamentous structure remained intact in most of the examined 18

cells (Fig. 1E). These results suggest that GFP-SCAB3 associates with MFs rather 19

than MTs. 20

SCAB3 binds and bundles F-Actin 21

To determine the activity of SCAB3 on MFs, actin cosedimentation assay was 22

used to investigate whether SCAB3 binds F-actin directly in vitro. His-SCAB3 was 23

purified from E. coli DL21, incubated with preformed F-actin and then pelleted by 24

centrifugation at 150,000 g. In the F-actin-free controls, only a small amount of 25

SCAB3 was detected in the pellets (Fig. 2A, lanes 6); however, SCAB3 was 26

obviously coprecipitated in the presence of F-actin (Fig. 2A, lanes 4). The control 27

(His-tag) remains in the supernatant regardless of absence (Fig. 2A, lane 7) or 28

presence of F-actin (Fig. 2A, lane 9). These results suggest that SCAB3 binds F-actin 29

directly. 30

To explore how SCAB3 binding influences actin filaments, we examined the 31

effects of SCAB3 on F-actin bundling by low-speed centrifugation (13,000 g) analysis. 32

Preassembled F-actin (2 mmol/L) was incubated with increasing concentrations of 33

SCAB3 and centrifuged at 13,000 g for 30 min. The supernatants and pellets were 34

analyzed by SDS-PAGE (Fig. 2B). Although most of the F-actin appeared in the 35

supernatant in the presence or absence of SCAB3 following low-speed centrifugation, 36

the amount of F-actin in the pellet fraction increased in proportion to the SCAB3 37

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

5

concentrations. These results suggest that SCAB3 bundles actin filaments in vitro. 1

SCAB3 stabilizes actin filaments in vivo 2

In order to determine the biological functions of SCAB3 in Arabidopsis, two 3

T-DNA (Agrobacterium tumefaciens-transferred DNA) insertion mutants, scab3-1 4

(SALK_113771) and scab3-2 (SALK_009823), were obtained from the Arabidopsis 5

Biological Resource Center (ABRC) (Fig. 3A). The expression level of SCAB3 was 6

determined by real-time qRT-PCR (Fig. 3B), and the data suggest that these are null 7

mutants of SCAB3. 8

To investigate the regulatory effects of SCAB3 on actin filaments in Arabidopsis, 9

the Pro35S: Lifeact-GFP [for expression of the first 17 aa of actin binding protein 140 10

(Riedl et al., 2008; Era et al., 2009; Vidali et al., 2009)] was transformed into the 11

wild-type, scab3-1 and scab1-1 plants, respectively. The transgenic lines were treated 12

with 500 nmol/L Lat A. The actin filament depolymerization in hypocotyl epidermal 13

cells was assessed by monitoring the Lifeact-GFP signal. After 1-hour of Lat A 14

treatment, actin filament shortening was detected in scab3-1 mutant, while most of the 15

actin filaments in scab1-1 were depolymerized (Fig. 3C). By contrast, the actin 16

network was slightly affected in the wild-type plants. After 1.5-hour Lat A treatment, 17

the actin cytoskeleton was depolymerized in both scab3-1 and scab1-1 cells; however, 18

the bundled actin filaments were still present in the wild-type transgenic plants. These 19

observations suggest that SCAB3 is required for stabilizing actin filaments in 20

Arabidopsis. 21

Expression pattern of SCAB3 in Arabidopsis 22

To investigate the expression pattern of SCAB3, a 2015-bp DNA fragment 23

upstream of the SCAB3 translation start site (ATG) was fused to the β-glucuronidase 24

(GUS) reporter gene. The resulting construct was transferred to the wild-type 25

Arabidopsis plants, and 6 independent T2 lines were analyzed by GUS staining. The 26

GUS signal was detected strongly in the hypocotyls of seedlings, and also in leaves 27

and flowers of mature plants (Fig.4, A−D). To confirm these results, total RNA was 28

extracted from various tissues of 1-month-old plants and 10-day-old seedlings, and 29

then reverse transcribed and subjected to real-time qRT-PCR analysis. SCAB3 was 30

highly expressed in stems and flowers of mature plants, and in hypocotyls of 31

seedlings (Fig. 4E). 32

SCAB3 is required for T-Far Red induced hypocotyl elongation 33

It was interesting to notice that in the promoter region of SCAB3, there was a 34

binding cis-element (CACGCGC) for FAR1/FHY3, two transcription factors involved 35

in the phyA signaling pathway (Lin et al., 2007; Li et al., 2011). Consistent with this, 36

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

6

a previous genome-wide survey of FHY3 binding site indicated that SCAB3 is a direct 1

target of FHY3 (Ouyang et al., 2011). To further confirm this conclusion, we 2

performed chromatin immunoprecipitation followed by quantitative PCR 3

(ChIP-qPCR) assays using transgenic seedlings expressing 3Flag-FHY3-3HA 4

(Ouyang et al., 2011). This assay revealed a specific enrichment of the SCAB3 5

promoter fragment containing the FHY3 binding site (Fig. 5A), indicating that FHY3 6

directly binds to the SCAB3 promoter in vivo. 7

To further investigate whether the expression of SCAB3 is regulated by different 8

light conditions, both real-time qRT-PCR analyses (Fig. 5B) and GUS staining (Fig.5, 9

C−K) were performed. Our data showed that the SCAB3 expression was prominently 10

induced when plants were transferred from white light to far red light (T-Far Red) 11

(Fig. 5). We thus examined how phyA and phyB regulate SCAB3 expression. 12

Interestingly, we observed that SCAB3 expression is down-regulated by phyA in most 13

of the tested conditions/transfers, suggesting that SCAB3 may play a role in 14

phyA-mediated signaling pathway. 15

Then, we examined if the scab3 mutants showed defects under different light 16

conditions/transfers. The wild-type, scab3-1 and scab3-2 seeds were either grown in 17

the dark, continuous white, blue, red and far red light conditions, respectively (Fig. 18

6A), or transferred to these respective light conditions after 3 days’ incubation in 19

white light (designated as T-Dark, T-Blue, T-Red and T-Far Red, respectively) (Fig. 20

6B). The hypocotyls of both scab3-1 and scab3-2 were significantly shorter than 21

those of the wild-type seedlings under T-Far Red condition, whereas no significant 22

phenotypes were observed under other light conditions/transfers (Fig. 6). These 23

results suggest that SCAB3 plays an important role in light-mediated hypocotyl 24

growth during white light to far red light change. 25

MF network is more filamentous in scab3 during T-Far Red condition 26

Our data indicate that SCAB3 is required for stabilizing MFs and T-Far red 27

induced hypocotyl elongation. Thus, we examined if the scab3 mutants were 28

defective in MF reorganization under T-Far Red light condition. Under white light 29

condition, MFs were formed as fine networks in both Col-0 and scab3 (Fig. 7A, upper 30

line). Under far red light condition, MFs were more bundled along with the long axis 31

of hypocotyl cells in both Col-0 and scab3 (Fig. 7A, middle line). In T-Far Red light 32

condition, however, MFs in scab3 mutant showed similar organization as that under 33

white light condition, and were still able to form the network (Fig. 7A, lower line). 34

Consistent with these observations, the hypocotyl length of scab3 was shorter than 35

that of the wild type (Fig. 7B), suggesting that SCAB3 may control hypocotyl cell 36

elongation under T-Far red condition partially through regulation of MF 37

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

7

reorganization. 1

2

DISCUSSION 3

As previously reported, SCAB is an actin binding protein family which contains 4

a novel actin binding domain (Zhao et al., 2011; Zhang et al., 2012). The actin binding 5

motif is highly conserved among different members of the SCAB family. In this 6

research, we demonstrate that SCAB3, similar as SCAB1, can bind and bundle 7

F-actin in vitro and stabilizes F-actin in vivo, although the activities are lower than 8

those of SCAB1. 9

Compared with SCAB1 which is expressed in all of the tested Arabidopsis tissues 10

(Zhao et al., 2011), SCAB3 has a more specific expression pattern than SCAB1: it has 11

a higher expression level in hypocotyls. Notably, expression of SCAB3 in hypocotyls 12

was induced by the T-Far Red condition. This result is consistent with the previous 13

report that the promoter region of SCAB3 contains a FHY3/FAR1 binding motif (Li et 14

al., 2011; Ouyang et al., 2011). This expression pattern suggests that SCAB3 may 15

play a role in regulating hypocotyl elongation. By transferring seedlings from 16

continuous white light to far red light, scab3 mutants showed a defect in hypocotyl 17

elongation. Consistent with the F-actin bundling function of SCAB3, the MFs of 18

scab3 are less bundled than Col-0 in the T-Far Red condition. Our results suggest that 19

during light quality conversion (T-Far Red), SCAB3 is highly expressed and it can 20

bundle actin filamentous to promote hypocotyl cell elongation. 21

Chlorophyll absorbs light most strongly in the blue portion of the electromagnetic 22

spectrum, followed by the red portion, which correspond to the light wave length of 23

430−450 nm and 640−660 nm, respectively. During plant growth, leaves of the upper 24

part shelter most of the blue and red light from the plants. If plants grow under 25

insufficient light intensity, stem etiolation happens and plants grow longer to gain 26

enough light. We propose that SCAB3 might work during this condition to promote 27

plant elongation. 28

29

MATERIALS AND METHODS 30

31

Expression analyses 32

Total RNA was extracted by TRIGene (Genstar, China) from 10-day-old 33

seedlings grown on Murashige and Skoog (MS) medium. Total RNA was reverse 34

transcribed by PrimeScript RT reagent Kit with gDNA Eras (TaKaRa, Japan). The 35

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

8

cDNAs were amplified with the following primers: SCAB3 F, SCAB3 R; and EF1a F, 1

EF1a R. EF1a (At5g60390) was used as an internal control. All of the primers were 2

listed in Table S1. 3

Plant materials 4

The scab3-1 (SALK_113771) and scab3-2 (SALK_009823) were obtained from 5

the ABRC. The T-DNA insertions were confirmed by the gene-specific primers and 6

the T-DNA left border specific primers. 7

Seeds were germinated and seedlings were grown erectly on MS media (pH 5.8) 8

at 23°C under continuous white light. For the hypocotyl phenotype analysis, seedlings 9

were germinated and grown under different continuous light, or under white light 10

firstly for three days, and then transferred to indicate light conditions. Light intensities 11

are 60 µmol/m2s for white light, 5 µmol/m2s for blue light, 30 µmol/m2s for red light 12

and 30 µmol/m2s for far red light, respectively. 13

Plasmid construction and generation of transgenic Arabidopsis plants. 14

To generate the GFP-SCAB3 construct, the coding region of SCAB3 was 15

amplified by PCR from Arabidopsis cDNA, and then the PCR fragments were 16

inserted into the binary vector pCAMBIA1205-GFP in Sal I and Kpn I sited to 17

produce the pCAMBIA1205-GFP-SCAB3 vector. 18

To generate the SCAB3-promoter::GUS reporter, a fragment containing the 19

scab3 promoter (2015 base pairs upstream of the ATG) was PCR amplified from the 20

Arabidopsis genomic DNA, and then the PCR fragments were inserted into the binary 21

vector pCAMBIA1391 in Sal I and BamH I to produce the pCAMBIA1391-SCAB3 22

vector. 23

The plasmids were introduced into A. Tumefaciens GV3101 and transformed into 24

Arabidopsis. 25

Protein expression and purification 26

For generating His-tag fusion protein, SCAB3 CDS was cloned into the pET28a 27

vector. The plasmid was transformed into BL21 (DE3.0) cells. The His-SCAB3 28

protein was purified from the soluble fraction using Ni-NTA agarose (Qiagen, USA) 29

according to the manufacturer’s protocol. 30

Subcellular localization of SCAB3 31

The plasmids of pCAMBIA1205-SCAB3-GFP were purified by CsCl gradient 32

centrifugation. Protoplast preparation and transformation were performed as described 33

previously (Sheen, 2001). After overnight incubation at 23°C, the protoplasts were 34

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

9

harvested and treated with or without 100 nmol/L Lat A or 10 µmol/L oryzalin. 1

Fluorescence images were taken with a Zeiss LSM510 Meta confocal microscope 2

using a Plan-Apochromat 633/1.4 oil immersion differential interference contrast lens 3

in multitrack mode. GFP were excited at 488 nm. 4

F-Actin cosedimentation assay 5

SCAB3 was dialyzed for 1 hour against 1×KMEI buffer (10 mmol/L imidazole, 6

100 mmol/L KCl, 1 mmol/L MgCl2 and 1 mmol/L EGTA, pH 7.0). Protein 7

concentration was determined using BCA Protein Assay Kit (Genstar). Actin was 8

purified from rabbit skeletal muscle acetone powder as described in Pardee and 9

Spudich (1982) in G buffer (5 mmol/L Tris-HCl, pH 8.0, 0.2 mmol/L ATP, 0.1 10

mmol/L CaCl2, 0.5 mmol/L DTT, and 0.01% NaN3). For high-speed cosedimentation 11

assay, proteins were mixed with 2 mmol/L preformed F-actin, and incubated in 50 µL 12

volume of 1×KMEI buffer for 1 hour at 23°C. The samples were centrifuged at 13

150,000 g for 30 min at 23℃. Proteins in supernatants and pellets were analyzed by 14

SDS-PAGE, respectively. For low-speed cosedimentation assays, SCAB3 was 15

incubated with 2.0 mmol/L preassembled F-actin for 1 hour at 23°C. After 16

centrifugation at 13,000 g for 30min at 23°C, the supernatants and pellets were 17

separated and subjected to SDS-PAGE, and visualized by Coomassie Blue staining. 18

The amounts of actin in the pellets were quantified using ImageJ 1.38x (Wayne 19

Rasband, USA). 20

F-Actin depolymerization assay in hypocotyl epidermal cells 21

Five-day-old transgenic seedlings harboring Pro35S::lifeact-GFP were used for 22

F-actin depolymerization assay in hypocotyl epidermal cells. The seedlings were 23

treated with 500 nmol/L Lat A for 0.5, 1 or 1.5 hours, respectively. The status of actin 24

filaments were observed on a LSM510 Meta confocal microscope (Zeiss, Germany) 25

using a Plan-Apochromat 633/1.4 oil objective. The cells with a random localized 26

dot-like GFP fluorescence were considered as depolymerized F-actin. 27

Promoter-GUS analysis 28

GUS staining of the T2 transgenic lines was performed as described in Zhao et al. 29

(2007). Samples were incubated in reaction buffers containing 100 mmol/L sodium 30

phosphate, pH 7.0, 0.1% Triton X-100, 3 mmol/L 31

5-bromo-4-chloro-3-indolyl-b-glucuronic acid, and 8 mmol/L β-mercaptoethanol in 32

the dark for 8 hours at 37°C for tissue specific assay or 4 hours for detecting SCAB3 33

expression level under different light condition. Seedlings were then immersed in 75% 34

ethanol at 37°C to extract chlorophyll. 35

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

10

1

SUPPLEMENTAL DATA 2

Table S1. Primers used in this study. 3

4

ACKNOWLEDGMENTS 5

We thank the Arabidopsis Biological Resource Center for providing the Arabidopsis 6

T-DNA insertion mutant seeds. This work was supported by the National Transgenic 7

Research Project (Grant No. 2013ZX08009002), NSFC international collaborative 8

research project (Grant No. 31210103903) and Foundation for Innovative Research 9

Group of the National Natural Science Foundation of China (Grant No. 31121002). 10

11

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

11

REFERENCES 1

2

bin Yusof, M.T., Kershaw, M.J., Soanes, D.M., and Talbot, N.J. (2014). FAR1 and 3

FAR2 regulate the expression of genes associated with lipid metabolism in the rice 4

blast fungus Magnaporthe oryzae. PLoS One 9, e99760. 5

Casal, J.J., Candia, A.N., and Sellaro, R. (2014). Light perception and signalling by 6

phytochrome A. J. Exp. Bot. 65, 2835-2845. 7

Era, A., Tominaga, M., Ebine, K., Awai, C., Saito, C., Ishizaki, K., Yamato, K.T., 8

Kohchi, T., Nakano, A., and Ueda, T. (2009). Application of Lifeact reveals 9

F-actin dynamics in Arabidopsis thaliana and the liverwort, Marchantia 10

polymorpha. Plant Cell Physiol. 50, 1041-1048. 11

Huang, X., Ouyang, X., and Deng, X.W. (2014). Beyond repression of 12

photomorphogenesis: role switching of COP/DET/FUS in light signaling. Curr. 13

Opin. Plant Biol. 21C, 96-103. 14

Hudson, M.E., Lisch, D.R., and Quail, P.H. (2003). The FHY3 and FAR1 genes 15

encode transposase-related proteins involved in regulation of gene expression by 16

the phytochrome A-signaling pathway. Plant J. 34, 453-471. 17

Ichikawa, S., Yamada, N., Suetsugu, N., Wada, M., and Kadota, A. (2011). Red 18

light, Phot1 and JAC1 modulate Phot2-dependent reorganization of chloroplast 19

actin filaments and chloroplast avoidance movement. Plant Cell Physiol. 52, 20

1422-1432. 21

Iwabuchi, K., and Takagi, S. (2010). Actin-based mechanisms for light-dependent 22

intracellular positioning of nuclei and chloroplasts in Arabidopsis. Plant Signal. 23

Behav. 5, 1010-1013. 24

Kadota, A., Yamada, N., Suetsugu, N., Hirose, M., Saito, C., Shoda, K., Ichikawa, 25

S., Kagawa, T., Nakano, A., and Wada, M. (2009). Short actin-based mechanism 26

for light-directed chloroplast movement in Arabidopsis. Proc. Natl. Acad. Sci. USA 27

106, 13106-13111. 28

Li, G., Siddiqui, H., Teng, Y., Lin, R., Wan, X.Y., Li, J., Lau, O.S., Ouyang, X., 29

Dai, M., Wan, J., Devlin, P.F., Deng, X.W., Wang, H. (2011). Coordinated 30

transcriptional regulation underlying the circadian clock in Arabidopsis. Nat. Cell 31

Biol. 13, 616-622. 32

Lin, R., and Wang, H. (2004). Arabidopsis FHY3/FAR1 gene family and distinct 33

roles of its members in light control of Arabidopsis development. Plant Physiol. 34

136, 4010-4022. 35

Nagatani, A., Reed, J.W., and Chory, J. (1993). Isolation and initial characterization 36

of Arabidopsis mutants that are deficient in phytochrome A. Plant Physiol. 102, 37

269-277. 38

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

12

Ouyang, X., Li, J., Li, G., Li, B., Chen, B., Shen, H., Huang, X., Mo, X., Wan, X., 1

Lin, R., Li, S., Wang, H., Deng, X.W. (2011). Genome-wide binding site analysis 2

of FAR-RED ELONGATED HYPOCOTYL3 reveals its novel function in 3

Arabidopsis development. Plant Cell 23, 2514-2535. 4

Possart, A., Fleck, C., and Hiltbrunner, A. (2014). Shedding (far-red) light on 5

phytochrome mechanisms and responses in land plants. Plant Sci. 217-218, 36-46. 6

Riedl, J., Crevenna, A.H., Kessenbrock, K., Yu, J.H., Neukirchen, D., Bista, M., 7

Bradke, F., Jenne, D., Holak, T.A., Werb, Z., Sixt, M., and Wedlich-Soldner, R. 8

(2008). Lifeact: a versatile marker to visualize F-actin. Nat. Methods 5, 605-607. 9

Sakurai, N., Domoto, K., and Takagi, S. (2005). Blue-light-induced reorganization 10

of the actin cytoskeleton and the avoidance response of chloroplasts in epidermal 11

cells of Vallisneria gigantea. Planta 221, 66-74. 12

Sharrock, R.A., and Quail, P.H. (1989). Novel phytochrome sequences in 13

Arabidopsis thaliana: structure, evolution, and differential expression of a plant 14

regulatory photoreceptor family. Genes Dev 3, 1745-1757. 15

Snowman, B.N., Kovar, D.R., Shevchenko, G., Franklin-Tong, V.E., and Staiger, 16

C.J. (2002). Signal-mediated depolymerization of actin in pollen during the 17

self-incompatibility response. Plant Cell 14, 2613-2626. 18

Somers, D.E., Sharrock, R.A., Tepperman, J.M., and Quail, P.H. (1991). The hy3 19

long hypocotyl mutant of Arabidopsis is deficient in phytochrome B. Plant Cell 3, 20

1263-1274. 21

Vidali, L., Rounds, C.M., Hepler, P.K., and Bezanilla, M. (2009). Lifeact-mEGFP 22

reveals a dynamic apical F-actin network in tip growing plant cells. PLoS One 4, 23

e5744. 24

Wang, H., and Deng, X.W. (2002). Arabidopsis FHY3 defines a key phytochrome A 25

signaling component directly interacting with its homologous partner FAR1. 26

EMBO J. 21, 1339-1349. 27

Wen, F., Wang, J., and Xing, D. (2012). A protein phosphatase 2A catalytic subunit 28

modulates blue light-induced chloroplast avoidance movements through regulating 29

actin cytoskeleton in Arabidopsis. Plant Cell Physiol. 53, 1366-1379. 30

Whippo, C.W., Khurana, P., Davis, P.A., DeBlasio, S.L., DeSloover, D., Staiger, 31

C.J., and Hangarter, R.P. (2011). THRUMIN1 is a light-regulated actin-bundling 32

protein involved in chloroplast motility. Curr. Biol. 21, 59-64. 33

Yanovsky, M.J., Whitelam, G.C., and Casal, J.J. (2000). fhy3-1 retains inductive 34

responses of phytochrome A. Plant Physiol. 123, 235-242. 35

Zhang, W., Zhao, Y., Guo, Y., and Ye, K. (2012). Plant actin-binding protein SCAB1 36

is dimeric actin cross-linker with atypical pleckstrin homology domain. The J. Biol. 37

Chem. 287, 11981-11990. 38

Zhao, Y., Zhao, S., Mao, T., Qu, X., Cao, W., Zhang, L., Zhang, W., He, L., Li, S., 39

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

13

Ren, S., Zhao, J., Zhu, G., Huang, S., Ye, K., Yuan, M., and Guo, Y. (2011). The 1

plant-specific actin binding protein SCAB1 stabilizes actin filaments and regulates 2

stomatal movement in Arabidopsis. Plant Cell 23, 2314-2330. 3

4

5

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

14

FIGURE LEGENDS 1

2

Fig. 1. SCAB3 is a homolog of SCAB1 which contains an actin binding domain. 3

A: The homologs of SCAB3 from Arabidopsis were aligned using DNAMEN. The 4

conserved actin-binding region was selected and viewed using GeneDoc software 5

(http://www.nrbsc.org/gfx/genedoc/). B: Phylogenetic tree showing the relationship of 6

SCAB3 and its homologs. C: 35S::GFP-SCAB3 transiently transformed protoplasts 7

were shown as a control. D: 35S::GFP-SCAB3 transiently transformed protoplasts 8

were treated with 100 nmol/L Lat A for 15 min. E: 35S::GFP-SCAB3 transiently 9

transformed protoplasts were treated with 10 µmol/L oryzalin for 15 min. 10

Fig. 2. SCAB3 binds F-actin. 11

A: A high-speed cosedimentation assay was used to assess SCAB3 binding to F-actin. 12

Cosedimentation experiments were performed with 3 mmol/L SCAB3 and His-tag in 13

the presence or absence of 2 mmol/L F-actin. After centrifugation at 150,000 g, 14

proteins in the supernatant (S) and pellet (P) were resolved by SDS-PAGE and 15

visualized by Coomassie Blue staining. His-tag was used as the negative controls. B: 16

A low-speed cosedimentation assay was used to assess the bundling activity of 17

SCAB3. Increasing concentrations of SCAB3 were incubated with 2 mmol/L F-actin 18

and the reactions were centrifuged at 13,000 g. Equivalent amounts of supernatant (S) 19

and pellet (P) were separated by SDS-PAGE. 20

Fig. 3. SCAB3 bundles F-actin. 21

A: Structure of SCAB3. The filled black boxes indicate exons, and the lines between 22

the boxes indicate introns. The insertion sites of two T-DNA lines are also indicated. 23

B: Real-time qRT-PCR analyses showing the expression of SCAB3. C: Actin filament 24

organization in hypocotyl epidermal cells from Col-0 (upper line), scab3-1 mutant 25

(middle line), and scab1-1 (lower line) plants expressing 35S::lifeact-GFP before and 26

after 1 or 1.5 h of Lat A treatments. 27

Fig. 4. Expression pattern of SCAB3. 28

A−D: The SCAB3 expression pattern as indicated by the ProSCAB1::GUS reporter in 29

seedlings (A), flowers (B), siliques (C) and leaves (D). E: Expression of SCAB3 in 30

various Arabidopsis tissues. Total RNA was extracted from the roots, stems, leaves, 31

flowers and siliques, respectively from the 1-month-old WT plants. Total RNA of 32

hypocotyl and cotyledon was extracted from the 10-day-old WT seedlings. 33

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

15

Fig. 5. The SCAB3 expression is altered during light quality conversion. 1

A: ChIP-qPCR assays showing that the SCAB3 promoter fragments containing the 2

putative FHY3-binding site were specifically enriched in the ChIP assays. An exon 3

region (Exon) of actin was used as the negative control for the ChIP-qPCR 4

experiment. B: Real-time qRT-PCR analyses showing SCAB3 expression under 5

different light conditions. C-K: The expression pattern of SCAB3 under different light 6

conditions indicated by the ProSCAB3::GUS reporter under light (C), Blue (D), 7

T-Blue (E), Red (F), T-Red (G), Far Red (H), T-Far Red (I ), Dark (J) and T-Dark (K ) 8

conditions. 9

Fig. 6. scab3 mutants are defective in hypocotyl elongation under T-Far condition. 10

A: Phenotypes of scab3 mutants under dark (Dark), blue (Blue), red (Red) and far red 11

(Far Red) light conditions. Seedlings were germinated and grown under different 12

continuous light conditions, or under white light conditions firstly for three days, and 13

then transferred to indicate light conditions for additional seven days. Light intensities 14

are 60 µmol/m2s for white light, 5 µmol/m2s for blue light, 30 µmol/m2s for red light 15

and 30 µmol/m2s for far red light. B: scab3 shows defects in hypocotyls elongation 16

under white to far red (T-Far Red) condition. No obvious differences were observed 17

between Col-0 and scab3 when seedlings were transferred from white to dark (Dark), 18

blue (Blue) and red (Red), respectively. C: Average hypocotyl lengths of the seedlings 19

shown in Fig. 5A. D: Average hypocotyls lengths of the seedlings shown in Fig. 5B. 20

The graphs were analyzed using ImageJ with the plugins Hig Skewness and 21

KbiPlugins (available at http://hasezawa.ib.k.u-tokyo.ac.jp/zp/Kbi/HigStomata). 22

Fig. 7. The scab3-1 mutant contains a more filamentous MF network and a shorter 23

cell length in hypocotyl. 24

A: MFs network of Col-0 (left) and scab3-1 (right) under white (upper line), far red 25

(middle line) or T-Far Red (lower line) light conditions. Confocal images of epidermal 26

cells were taken from the middle part of hypocotyls. B: Average cell lengths in 27

hypocotyls shown in Fig. 7A. 28

29

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

1

Table S1. Primers used in this study. 1

Primer name Sequence

SCAB3 F GCTGTCTCGAGGATGGATCAC

SCAB3 R GTAACACTGCAATCGAAAGCG

EF1a F TGAGCACGCTCTTCTTGCTTTCA

EF1a R GGTGGTGGCATCCATCTTGTTACA

scab3-1 F GCAAACAAAAGACGAGACCAG

scab3-1 R AACATGTCCCTCCAAAGAAGC

scab3-2 F AATCATCTGGACCAAGCAGTG

scab3-2 R CAAACAAAGTCTCGGCTCTTG

LBa1 TGGTTCACGTAGTGGGCCATCG

SCAB3CDSForword Sal I ACGCGTCGAC ATGACGAAAGTGTGTCCTGAAATAG

SCAB3CDSReverse Kpn I GGGGTACC ATCATCTGGACCAAGCAGTGTAAC

SCAB3promoterForword Sal I ACGCGTCGAC AATGCATCTCTCATTATAGTAC

SCAB3promoterReverse BamH I CGGGATCC TTATCTCCGGATCTTTATCTG

SCAB3CDSForword BamH I CGGGATCC ATGACGAAAGTGTGTCCTGAAATAG

SCAB3CDSReverse Sal I ACGCGTCGAC ATCATCTGGACCAAGCAGTGTAAC

2

3