oct1-15-1999.pdf - Panun Kashmir

http://panunkashmir.org/blog

LARGEST CIRCULATED ENGLISH MONTHLY OF J&K A News Magazine of Kashmiri Pandit Community

KKaasshhmmiirr SSeennttiinneell October 1-15, 1999

ii PPaannuunn KKaasshhmmiirr PPuubblliiccaattiioonn

Page Intentionally Left Blank


PPaannuunn KKaasshhmmiirr PPuubblliiccaattiioonn iii

KKaasshhmmiirr SSeennttiinneell

October 1st - 15th, 1999 VOL. 5, NO: 17

October 1-15, 1999

Copyright © 1999-2020 by Panun Kashmir ((http://panunkashmir.org/))

AAllll rriigghhttss rreesseerrvveedd.. NNoo ppaarrtt ooff tthhiiss ppuubblliiccaattiioonn mmaayy bbee rreepprroodduucceedd iinn wwhhoollee oorr iinn ppaarrtt,, oorr ssttoorreedd iinn aa rreettrriieevvaall

ssyysstteemm,, oorr ttrraannssmmiitttteedd iinn aannyy ffoorrmm oorr bbyy aannyy mmeeaannss,, eelleeccttrroonniicc,, mmeecchhaanniiccaall,, pphhoottooccooppyyiinngg,, rreeccoorrddiinngg,, oorr

ootthheerrwwiissee,, wwiitthhoouutt wwrriitttteenn ppeerrmmiissssiioonn ooff PPaannuunn KKaasshhmmiirr.. FFoorr ppeerrmmiissssiioonn rreeggaarrddiinngg ppuubblliiccaattiioonn,, sseenndd aann ee--mmaaiill

ttoo

wweebbmmaasstteerr@@PPaannuunnKKaasshhmmiirr..oorrgg


PPaannuunn KKaasshhmmiirr PPuubblliiccaattiioonn v

CCCCCCCCoooooooonnnnnnnntttttttteeeeeeeennnnnnnnttttttttssssssss

page

1 EDITORIAL ........................................................................................................................ 1-2

2 EC PLAYS DOWN POSTAL BALLOT FRAUD.............................................................. 2-2

3 PERILS OF REGIONALISM.............................................................................................. 3-4

4 REGIONAL POLITICS WILL CRIPPLE GOVERNANCE.............................................. 4-5

5 BJP PLAYS FOOTBALL WITH KP ACTIVISTS............................................................. 5-7

6 INDIA IN SIEGE................................................................................................................. 6-8

7 ‘POLITICAL PROCESS IS A SHAM’-PANUN KASHMIR .......................................... 7-10

8 THREE SHRINES OF KHIR BHAWANI........................................................................ 8-11

9 PANDIT PREM NATH SHASTRI ................................................................................... 9-13

10 LETTERS .................................................................................................................... 10-14

11 NEWS BRIEFS............................................................................................................ 11-16

12 CHRONOLOGY OF EVENTS ................................................................................... 12-20

13 THOSE WHO LEFT US ............................................................................................. 13-23


2-2 PPaannuunn KKaasshhmmiirr PPuubblliiccaattiioonn

11111111 EEEEEEEEDDDDDDDDIIIIIIIITTTTTTTTOOOOOOOORRRRRRRRIIIIIIIIAAAAAAAALLLLLLLL

CCOOMMEE PPUUBBLLIICC

THE demand by the American Senators to the US President for appointing a special envoy on Kashmir

underlines the imperialist mindset behind it. Despite the rejection of this demand by the US government,

its subtle diplomatic monoeuvres indicate a different story.

Recently Pakistan’s high profile diplomat Mr Niaz Naik told the Pakistani media that India and Pakistan

had virtually agreed on the final deal on Kashmir. This deal, which Naik named “Chenab Solution”,

envisaged a two stage formula. In the first stage LoC was to be converted into an international border.

Subsequently the dilution of sovereignity was to be conceded to the respective regions through a regional

plebiscite under a time bound frame. Offically both the governments have contradicted the statement of

Mr Naik. Only a few days back Mr Naik was again in India creating doubts about these denials. More

intriguing is the BJP’s choice of Mr R.K. Mishra as its special envoy in the secret parleys. Mr Mishra the

former editor-in-chief of the pro-left Patriot has been known for his strong anti-BJP views.

The general impression among the concerned Indian Public is that some sort of secret mediation on

Kashmir, brokered by US, is on. The Congress Party did raise some serious issues in this context but its

protestations, in view of its low credibility, were lost in the din.

In view of the opportunistic nature of the Indian political class, the issue of national security particularly

with regard to Jammu and Kashmir cannot be left simply to the ruling leadership. Time has come when

the nation has to do some plain speaking to the ruling elite about the so-called track-2 approach and

backroom diplomacy on Kashmir.

The pronouncements of senior BJP leaders that ‘India still suffers from the cold war mentality against

Americans’ is disturbing. Besides it also indicates radical shift in Indian Foreign Policy about which

every body in the country continues to be in dark. It is imperative that the BJP leadership comes public on

its cryptic diplomacy on Kashmir.

22222222 EEEEEEEECCCCCCCC PPPPPPPPLLLLLLLLAAAAAAAAYYYYYYYYSSSSSSSS DDDDDDDDOOOOOOOOWWWWWWWWNNNNNNNN PPPPPPPPOOOOOOOOSSSSSSSSTTTTTTTTAAAAAAAALLLLLLLL BBBBBBBBAAAAAAAALLLLLLLLLLLLLLLLOOOOOOOOTTTTTTTT FFFFFFFFRRRRRRRRAAAAAAAAUUUUUUUUDDDDDDDD

VVOOTTIINNGG SSCCHHEEMMEE FFOORR NNOO FFRRAANNCCHHIISSEE

Special Correspondent

While the Chief Election Officer ordered an inquiry into the alleged fraud in the issuance of postal ballot

papers meant for displaced Kashmiris from, Bijbehara assembly segment, the office of the Election

Commissioner appears to have embarked upon diversionary tactics to play down the entire fraud. What

irks the Election Commission most can be summed up in the words of CEO SV Bhave, “The matter is of

serious nature and needs to be investigated as to how PDP activists got hold of the ballot papers.” That

the entire procedure of casting postal ballots by the displaced voters has been subverted to rig the voting

in favour of a particular party does not appear to concern the Election Commission as much.

The local media in Jammu brought to the fore what the termed as the ‘biggest poll fraud’, during the

ongoing polls in Jammu and Kashmir after the unearthing of a large number of postal ballot papers which

were stamped allegedly in favour of the ruling party. Though the concerned voters never applied for these

ballots, as required under the rules, their ballot papers were issued intriguingly by the office of the

Election Commission. Most of the declaration forms, which are a requirement for applying for the postal

ballot, are also reported to have been clandestinely verified either by zonal officers or through fake seals

and forged signatures of gazetted officers. It is also being said that those involved in casting bogus votes

had attested the applications themselves and then submitted to the Assistant Returning Officer.

Another intriguing aspect of this controversy of fraudulent polling through bogus postal ballots is that the

newly formed regional outfit of People’s Democratic Party claimed to have seized 2700 postal ballots

from the residence of former MLC Bhushan Lal Bhat on NC. Sh Ved Mahajan convenor of PDP claimed

that a team of their activists caught the former MLC Mr Bhat red handed in the wee hours on September

16th while he and his associates were busy casting them in favour of the NC candidate for the Bijbehara

assembly constituency. Mr Mahajan demanded a CBI inquiry into the whole affair and said that the


PPaannuunn KKaasshhmmiirr PPuubblliiccaattiioonn 2-3

present elections in the state were a farce and the Election Commission and ruling National Conference

are holding polls in complicity.

Rebutting the claims of PDP, Sh BL Bhat claimed innocence and threatened that he will file a defamation

petition against the local paper which brought out the story. Sh Bhat instead is reported to have blamed

BJP for misusing postal ballots. Interestingly Mr Bhat was seen actively canvassing amongst his Pandit

acquaintances pleading them to play down the whole issue as it may cause embarassment for the country

in the international fora.

The complicity of employees in the Election Commission in the entire episode cannot be ruled out. The

major flaw in the entire process of casting of votes by displaced Kashmiris through postal ballots has been

the practice by the Returning Officers of sending the blank ballot papers in the name of applicants not on

their house addresses but in bulk to zonal officers of displaced camps or prominent persons of particular

areas. The office of the Chief Electoral Officer for the state accepts this to be a loophole in the procedure

of postal ballot polling but claims that this practice was more because of non-availability of the proper

addresses of the displaced applicants.

The scrutiny by our investigating team revealed that through fake attestations various vested interests

apply for postal ballots giving a common address for communication. The Returning Officers very

casually post the postal ballots to these addresses which are then sent back after stamping them in favour

of a particular contesting candidate. “The first step which CED should have taken, even without enquiry

was to suspend the concerned officers who were responsible for sending postal ballots in bulk only to

particular addresses, instead of the home address of the applicants,” said Sh Kuldeep Raina General

Secretary of Panun Kashmir.

The explanations by the Election Commission that they have to send the postal ballots to the respective

zonal officers because the proper addresses of applicants are not available is ridiculous and also smacks of

complicity. The residential tenements in the displaced camps are not only properly demarcated but are

easy to locate than in other places. Many observers wonder as to why Election Commission did not

choose to have polling booths around Pandit localities, where proper polling would have decreased the

chances of bogus voting.

The entire controversy however, has once again brought to the focus more fundamental questions with

regard to the issue of voting in exile. “The process of exercising franchise in exile is farcical”, said Prof

ML Koul who has written many books on Kashmir. “We are being asked to vote for a constituency where

our homes have either been destroyed or illegally occupied. We are not aware of the issues of our

constituency. Nor are the contesting candidates in position to address our problems in exile,” Mr Koul

said. Another prominent intellectual of the community Prof BL Fotedar said,” Isn’t it ridiculous to vote

for an area where I can’t live. Displacement of Pandits poses a fundamental challenge to Indian Nation

which the GOI circumvents by enacting a farce of our participation in elections”.

Dr Shakti Bhan the leading Gynecologist and Head of Daughters of Vitasta while commenting on the

postal ballot rigging, summed up the irony of the entire situation, “voting in exile for us has been actually

a cosmetic exercise to tell people of India that we have not been excluded from the democratic process.

Voting in exile has been basically a no franchise for us.”

Meanwhile, taking note of the criticism of the Election Commission by Panun Kashmir, Chief Electoral

Officer Sh S.V. Bhave held a meeting with the Panun Kashmir delegation on Sept 28, 1999. Panun

Kashmir delegation was lead by Dr Ajay Chrungoo and the its other members were Sh. Kuldeep Raina,

Prof. M.K. Teng and Prof. B.L. Fotedar. CEO is reported to have assured Panun Kashmir of all possible

measures to correct the process of polling through postal ballot and punish the guilty involved in the

bogus postal ballot voting. Dr Ajay Chrungoo disclosed to the KS Correspondent after the meeting that

PK had not only demanded action against the guilty but also urged the Election Commission to review

afresh the entire political process in the state.



33333333 PPPPPPPPEEEEEEEERRRRRRRRIIIIIIIILLLLLLLLSSSSSSSS OOOOOOOOFFFFFFFF RRRRRRRREEEEEEEEGGGGGGGGIIIIIIIIOOOOOOOONNNNNNNNAAAAAAAALLLLLLLLIIIIIIIISSSSSSSSMMMMMMMM

By C.P. Bhambhri

The changing political landscape has brought into focus the new emerging role of regional parties. Mr P.

Chidambaram recently highlighted this fact before a distinguished group of international business leaders

by observing that the regional parties are “close to the people and impatient to develop India”. Not only

this. The Chief Ministers, who represent the regional parties and aspirations, are “actively involved in

deciding national affairs”.

It is essential to demystify the reality or regional parties and politics for properly understanding the real

challenges of emerging regionalism in India. Every single state in the southern, eastern north-eastern,

northern and north-western regions is involved in either inter-state boundary or river water disputes. Since

every regional party is co-terminus with its state boundaries, these parties cannot negotiate with their

neighbours because of the fear of alienation of local state sentiment on the basis of which these parties

come to power.

Mr Parkash Singh Badal raised the demands of Punjab and Mr Bansi Lal of Haryana, a neighbouring

Chief Minister of a regional party, vetoed Mr Badal’s demand because the regional parties of Punjab and

Haryana have to take care of their respective regional sentiments. Mr Chandrababu Naidu of Andhra

Pradesh, Mr Karunanidhi of Tamil Nadu or Mr Mahanta of Assam may be experiencing new freedom in

the context of regionalisation of Indian politics, but these Chief Ministers have not been able to find any

solution on their own to either inter-state river water disputes like Cauvery or Almatti or inter-tribal or

intra-tribal fratricidal wars in north-east India. Regional parties are nurtured and nourished by local

sentiments and it is impossible for them to resolve inter-state disputes without a powerful arbiter i.e. an

effective Central government.

The regional parties represent local caste and class interests and these interests come into conflict with

either the neighbouring states or with larger social goals of development of India. The Akali Dal of

Punjab represents caste, community and class interests of the Jat Sikh capitalist farmer and Mr Badal

emerged as a lobbyist of his social constituency by raising the issue of the minimum support price for

wheat. Further, he has issued a warning to the whole country that if the support price for wheat is not

enhanced to Rs 550 or Rs 650 per quintal, the official procurement agencies will not be able to induce the

farmer to sell his products to them and the modified Public Distribution System will not succeed in the

absence of new incentives to the producers of wheat.

Mr Bansi Lal of Haryana, leader of the Haryana Vikas Party, also jumped on the bandwagon of Mr Badal,

to win over the support of the farmers of Haryana. Many illustrations like these can be mentioned to

prove that the socalled regional parties are neither socially neutral nor a great model of good governance.

Fiscal deficit, populist schemes, and bankruptcy of the State Electricity Boards are the highlights of

governance by the regional parties. Not only this. Many regional parties have not been able to provide an

alternative of model governance as compared with the erstwhile governments of the Congress Party.

The Janata Dal and the Bahujan Samaj Party governments of Uttar Pradesh and Bihar are in no way an

improvement over the Congress governments of these states. Like the erstwhile Congress state

governments, many regional parties have consciously obstructed the development of local democratic

institutions in their states. It may be mentioned that the Left Front Government of West Bengal and the

Left Democratic Front or the United Democratic Front Governments of Kerala have shown many

innovations in governance but the explanation in these cases is that they are regional governments led by

parties which have a national perspective as distinguished from the pure regional parties like the DMK-

AIADMK. TMC, TDP, AGP, Akali Dal, VHP, or the Janata Dals. Regional parties have actively

followed the practice of erstwhile Congress governments in breaking and bending the state civil services

for purely partisan purposes.

The upshot of the above argument is that it is wrong to romanticize the regional parties. These parties

have not shown any new quality of governance. Not only this. Many regional parties have intensified the

feelings of parochialism and language fanaticism. The Kannada Development Authority is fanatically

promoting the cause of Kannada language without learning a lesson from West Bengal where the policy



of devaluing of the English language brought disastrous consequences for the people of that state. Bihar

and Uttar Pradesh have entered the dark ages in the field of education because of the ill-conceived

language policy of the Hindi enthusiasts of these states.

Jean Dreze and Amartya Sen have come to a tragic conclusion about UP by observing that “the region is

characterised inter alia by exceptionally high levels of mortality, morbidity, undernutrition, illiteracy, and

social inequality, and a slow pace of poverty decline” and their considered judgement is that the total

failure of public services or governance is responsible for the present dismal situation of UP as compared

to the other backward states. The powerful regional leaders of UP and Bihar like Mr Mulayam Singh

Yadav, Ms Mayawati and Mr Laloo Prasad Yadav have not shown any capacity to pull out UP and Bihar

from backwardness.

The governance of India requires a political arrangement which responds to the needs of unity and

diversity. The recent truck drivers strike is the best illustration of the existing inter-linkages in India. The

national market can get regionalised and balkanised if regions are allowed to manage them according to

their local needs and priorities. An active role of the Central government is essential to maintain a proper

balance between the local needs of regions and the national and international priorities of India.

Europe has taken more than forty years to realise that a unified Common European Market will provide

scales of economy to compete with the continental-sized economy of the US. India has a natural

advantage of large size and resources which are found all over the country, and an ineffective Central

government and local-oriented regional parties pulling in different directions will lead to internal regional

civil conflict on the movement of goods and services.

Punjab and Haryana have given a warning that wheat is not available except on the terms and conditions

laid down by Mr Badal and Mr Bansi Lal. The ULFA or ASSU-AGP in Assam may follow Mr Badal and

Mr Bansi Lal and stop the flow of oil to the country. The Deve Gowda government was inherently

fractured to manage the affairs of India with a perspective which included national and local priorities of

governance. It was a sum-total of regional parties, groups and leaders and showed its weaknesses while

dealing with pressures from regional parties and leaders.

Hence, individuals and leaders who are glorifying the emergence of new cooperative federalism in India

are actually rationalising the ineffectiveness of the Central government to provide an all-India perspective

for national development in the context of the New Global World Order. The Telugu Desam Party chief,

Mr Chandrababu Naidu, wants that Article 356 of the Constitution should be deleted, and the Deve

Gowda government, the heroic model of Mr Naidu, imposed President’s rule in Uttar Pradesh.

The so-called Gujral doctrine and Mr Farooq Abdullah’s dreams of state autonomy can succeed only if

the Central government occupies a pre-eminent position in the governance of the country and regional

formations can expect resolution of their legitimate demands only if the Centre functions in a proper

manner.

Source: Hindustan Times

44444444 RRRRRRRREEEEEEEEGGGGGGGGIIIIIIIIOOOOOOOONNNNNNNNAAAAAAAALLLLLLLL PPPPPPPPOOOOOOOOLLLLLLLLIIIIIIIITTTTTTTTIIIIIIIICCCCCCCCSSSSSSSS WWWWWWWWIIIIIIIILLLLLLLLLLLLLLLL CCCCCCCCRRRRRRRRIIIIIIIIPPPPPPPPPPPPPPPPLLLLLLLLEEEEEEEE GGGGGGGGOOOOOOOOVVVVVVVVEEEEEEEERRRRRRRRNNNNNNNNAAAAAAAANNNNNNNNCCCCCCCCEEEEEEEE

Democratic political process in India has witnessed the gradual emergence of regional parties as an

alternative to the Congress. Whenever the Congress has been made to vacate political space, the voters

have opted for regional leaders and parties.

The DMK/AIADMK has successfully marginalised the Congress in Tamil Nadu and there is the Akali

Dal in Punjab and Telugu Desam in Andhra Pradesh. Further, except the Congress, other all-India

political alternatives like the BJP and the two Communist Parties are strong in only a few states.

The CPI-M is strong in West Bengal, Tripura and Kerala and the BJP has shown effective political

presence in Himachal Pradesh, Rajasthan, Uttar Pradesh and Madhya Pradesh. The Janata Dal has

autonomous state party units and its all-India claim is a political fiction because Biju Patnaik of Orissa,

Laloo Prasad Yadav of Bihar, Ramakrishna Hegde and H.D. Devegowda of Karnataka are purely regional

leaders who operate under an abstraction known as the Janata Dal.

The post-1989 phase of Indian politics has been a definite break with the past. Strong regional parties and

leaders have successfully challenged the Congress party. Hence it is essential to analyse the support base



of the regional parties and their role in Indian politics.

In a multicultural, multilingual and multireligious country like India, a political party may emerge to

promote and protect distinct cultural or language identity. The DMK/AIADMK has been perceived by the

Tamilians as defenders of the Dravidian culture; the Akali Dal in Punjab has openly mixed religion with

politics to project itself as the defender of the Sikh identity.

Continuing electoral defeats of the Congress Party and the emergence of regional political formations is

integrally linked with the changes which are taking place in the power structure and social relations in

rural India. During 1960s, new social forces emerged in rural society because of the implementation of

land reforms. These new agrarian classes also belonged to the category of backwards in the caste

hierarchy in India.

NEW landlords or peasant proprietors became uncomfortable in the caste and class coalition of the

Congress party of the 1950s and 1960s, and sections of middle peasantry and backward castes started

walking out of the Congress after its electoral defeat of 1967.

Chaudhary Charan Singh who was the most articulate caste and class leader of the emerging peasant

castes floated Bharatiya Kranti Dal which was the first peasant-based regional party in Uttar Pradesh.

Since 1967, the Congress party has been making every effort to maintain its support base among the

emerging powerful middle peasantry and it has been a difficult journey for the party.

Veerappa Moily in Karnataka was making every effort to secure the support of dominant peasant castes

like Vokkaligas and Lingayats for the Congress. These dominant castes shifted their support to the Janata

Dal and the Congress party lost the elections in Karnataka.

The Congress party is involved in a basic struggle to win over the surplus producing peasantry in rural

India and Balram Jakhar and Rajesh Pilot make every effort to promote and protect the interests of rich

farmers and mobilise their support for the Congress.

Two inter-related questions arise here with regard to the emergence of the regional parties and declining

political power of the Congress. Why is it that the upwardly mobile middle peasant of the backward

castes are leaving the Congress in favour of regional parties? And what are the implications for the

governance of India in the context of emerging regionalism in politics?

The surplus generating peasantry wants State governments which will accord highest priority to their

demands like high procurement prices, power and irrigation, subsidies, reservations in public services and

educational institutions without the creamy layer among the dominant backward castes being excluded.

Regional political parties and leaders can be relatively more accommodative than an all-India party which

has to harmonise many conflicting and competing social interests.

Every regional party claims to care for ‘national interests’ but objectively regional leaders protect and

promote exclusive regional interests. Political parties operate on the basis of their social base. The farmers

of Karnataka and Tamil Nadu look towards their own regional party for the Kaveri waters.

The all-India institutions of the Government cannot operate without a politically strong Central

Government. The CBI raid on Darul-Uloom Nadwatul Ulema brought this fact into sharp focus--the Chief

Minister of a regional party was interested in his electoral constituency instead of national interests.

Mulayam Singh Yadav was the first person to delegitimise an all-India institution of governance to win

the favour of his local social support.

Such illustrations can be multiplied to prove that the emerging regionalisation of politics and the

declining political power of the Central government will create situations of ‘immobilism’ in governance

in India. Regional parties of economically developed States will come into conflict with regional parties

of the backward States and arbiter will be required to implement the provisions of the Indian Constitution

to deal with such inter-State conflicts.

The votaries of regionalism in the absence of effective Central government should be concerned about the

serious crisis of governance in India.

--Source: Hindustan Times

C.P. Bhambhri is a Professor of Political Science at the Jawaharlal Nehru University.



55555555 BBBBBBBBJJJJJJJJPPPPPPPP PPPPPPPPLLLLLLLLAAAAAAAAYYYYYYYYSSSSSSSS FFFFFFFFOOOOOOOOOOOOOOOOTTTTTTTTBBBBBBBBAAAAAAAALLLLLLLLLLLLLLLL WWWWWWWWIIIIIIIITTTTTTTTHHHHHHHH KKKKKKKKPPPPPPPP AAAAAAAACCCCCCCCTTTTTTTTIIIIIIIIVVVVVVVVIIIIIIIISSSSSSSSTTTTTTTTSSSSSSSS

Political Correspondent

Presenting Kashmiri Pandit as the ‘ethnic other’ constituted one of the most important components of the

Muslim subnationalist politics in the state. It helped in the sharpening of the Muslim communal identity.

However, the politics of bias and marginalisation practised by the state BJP vis-a-vis Kashmiri Pandits

defies logic.

For last one decade the entire organisational structure of Sang Parivaar as existed in Kashmir before

forced exile of Kashmiri Pandits, has been either dismantled or relegated to a position of no-consequence.

Almost entire cadre base of Kashmir BJP-RSS as existed before exodus in 1989 has been replaced by

now. These cadres who had been witness to the evolution of BJP-RSS in Kashmir valley had started

posing inconvenient questions to the RSS-BJP leadership in the state and had become suspect. Those old

cadres which chose to remain within the fold are also not treated better and are being subjected to

persistent humiliation by treating them as expendible. The humiliating treatment meted out to the senior

party activist Sh Opinder Bhat recently by the BJP high command amply reveals this attitude.

Sh Opinder has been working in various capacities at the BJP office in Jammu since his displacement

from Kashmir. Till recently he was one of the few party functionaries in BJP office who somehow had

managed to steer clear of the intra-party squabbles. Following the assassination of the BJP nominee for

Anantnag parliamentary constituency Gulam Hyder Noorani, BJP had announced the candidature of Dr

Abdur Rehman Sheikh. However, Sheikh’s failure in filing his nomination papers as a result of the

abduction of his son at Qamarwari, made BJP High Command to search for an alternative candidate.

As per reliable sources the President of the State BJP Unit Sh Daya Krishen Kotwal is reported to have

directed Opinder Bhat to make preparations for filing in his nomination papers as an alternative to Dr AR

Sheikh. Surprised by the sudden developments Sh Opinder is said to have reluctantly started preparations

to leave for Srinagar only to honour the directives of the State Party President. However as per reports, at

the very last moment he was communicated that the party high command had decided to change its choice

in favour of Showkat Wani as the new BJP candidate for Anantnag. The story would have ended right

here, had the party unit in Anantnag not spilled the beans. Dr Abdur Rehman openly voiced the

resentment on behalf of BJP Party Unit in Anantnag condemning the arbitrary way of functioning by Sh

Vivek, the Organising Secretary of BJP in the state. Dr Rehman blamed the new BJP candidate Showkat

Wani for the abduction of his son in connivance with some surrendered militant groups, only to sabotage

his candidature. He expressed surprise as to how the unanimous choice of the party unit in Anantnag in

favour of Sh Opinder was ignored.

The apparently stunned BJP high command instead of looking into the allegations made by Dr Abdur

Rehman resorted to tactics which only reflected its mindset vis-a-vis the displaced Pandits. Through a

press-note which was carried by the local daily, it virtually disowned Opinder Bhat as a party functionary.

The local BJP described Sh Opinder as a person who was working with them only for last few years. The

Kashmiri Hindu activists in Sangh Parivaar were at a loss to explain such a volte face by the BJP high

command.

The entire decision of replacing the candidature of Dr Abdur Rehman with Mr Showkat Wani whose

credentials have been dubious, as per reliable sources, is being attributed to a select coterie within BJP

which is believed to be advocating a pro-NC line. It is not clear whether the Election Committee of BJP

decided the candidature of Sh Showkat Wani after following the due procedure laid down by Party or the

decision was taken by Sh Vivek in consultation with another former organising secretary of the BJP who

is supposed to be the main strength of this pro-NC cotrie in BJP.

Inner party sources, on the condition of anonymity, have disclosed that the decision to nominate Sh

Showkat Wani had very little to do with elections in Anantnag. It was mainly to convey to the state party

president Sh Daya Krishan Kotwal his place in the power politics of the party. Sh Opinder became a

scape goat in this intra party power game. The confidence and appreciation of the up coming party unit in

the Valley for Opinder only added to his cup of woes as it alarmed the party high ups in Jammu who are

averse to any prominent role of a Kashmiri Pandit in the affairs of the Valley.



Sh L Moza had also suffered almost a similar humilation when subsequent to his contesting elections in

the Valley in 1996, he was replaced as the head of the migrant cell of the party.The prominence he got in

the media during his election campaign had raised a many eyebrows in the party high command in

Jammu, particularly the pro-NC lobby. The better presentability and articulativeness of Sh L Moza, which

in any other situation would have been his asset, became his liability. At that time Moza’s replacement

was attributed to his non-RSS backround. However Sh Opinder’s life long services in RSS mission was

no immunity to save him from intra-party slander campaigns.

The attitude of the local BJP toward Kashmiri Pandits hierarchy is brought out by another incident

reported by local media in Srinagar. The state BJP was in search of the party office in Srinagar. The local

Muslims were reluctant to help BJP in this venture. The BJP unit in Srinagar chose the easier way and

forced their way into the house a Kashmiri Pandit widow in her absence. When the old lady returned and

objected to their presence she was manhandled. This matter was taken up with the state President of BJP

who chose to ignore the entire event. Subsequently Kashmir BJP occupied more houses abondoned by

Kashmiri Pandits as their election campaign offices.

The feeling of being an expendable factor appears to be growing sharply among the displaced Kashmiri

Pandits involved particularly with the Sang Parviaar activities. However, it is yet to find a purposeful

expressions. Many old BJP-RSS activists confide privately that they are tight lipped only not to weaken

their larger struggle.

66666666 IIIIIIIINNNNNNNNDDDDDDDDIIIIIIIIAAAAAAAA IIIIIIIINNNNNNNN SSSSSSSSIIIIIIIIEEEEEEEEGGGGGGGGEEEEEEEE

By Dr. M.K. Teng

The Sanskritisation of Himalayan hinterland extending from Afghanistan to the Mongolian deserts of

Gobi, was brought about by the Hindus of Kashmir. The periodisation of the history of proto-Aryan

culture in India, must be reviewed now and rescued from the colonial concepts of the race movements

across India. The divide that has been, so far claimed to intervene between the proto-Aryan India and the

Sanskrit culture of the Indo-Gangetic India, is imaginary and unfounded in sociological data. The

civilisation of India, as conceived in colonial frames of reference, was confined to boundaries which

never existed in the history of India. Indian civilisation was always a totality, with its Sanskrit

substructure, of which the Hindus in Kashmir formed an inseparable part.

The Muslim expansion into India, was the first assault on the modes of the Sanskrit society. The

civilisational conflict inherent in the Muslim expansion in India, characterised the entire course of history,

which followed right up to the end of the British colonial empire in India.

The Hindus of Kashmir, so far, they were not exposed to the Muslim expansion, evolved the aspects of

the Indian civilisation, which marked a rare intellectual brilliance, in integrating the Vedic spiritual

culture into a single unity. The Semitic expansion into India suddenly put the Hindus in Kashmir on the

frontline of a conflict, which later continued for a millennium, and which consumed them ruthlessly, till

the Sikhs came to their rescue. When Ranjit Singh wrested Kashmir from the Durani Afghans, he was

stunned to learn from a census, he had ordered to be conducted that of the quarter a million of the

population of Kashmir, who were Hindus at the time of the Muslim conquest of the Valley, hardly twenty

eight thousand survived. The rest had been converted or killed.

The reductionist rationa-lisation of the cultural change, claimed more by the Indian scholars of the history

of Northern India, than the British and the European scholars, forms part of the post-colonial expressions

of Indian reaction to Muslim dominance. Few societies in the world have accepted change in their

tradition and the mores of their ethics out of recognition of a symbiosis in cultural confrontation. Indeed

the rise of semitic religions in the west, the supersession of Budhism over the Bon, Confucianism and

Taoism, in Far East, was a consequence of powerful military and violent struggle. Northern India, more

specifically Kashmir, could not be an exception.. The Jengezide Mongols, who spread across Asia, into

the Middle East and then South Europe, carried the nascent ingredients of the early Budhism with their

vast expansion and destroyed everything that came in their way. Kublai Khan, the grandson of Changis,

enforced the Buddhist faith in most of the Central Asia and far East. The phenomenon of the extinction of



the Sanskrit Hindus and their cultural heritage in Kashmir, was a part of the same historical process,

which determined the rise of Christianity and Islam. Inquisition was a principal feature of all semitic

faiths and it continues to be so even now. Pakistan represents the same tradition.

Martyrdom in Kashmir must, therefore be visualized in the process of Indian history. Unfortunately for

this country, inspite of the great renaissance, the exposure of its people to British liberalism, led to the

leadership of the Indian liberation movement, to override the assertion of the Muslim India for a separate

political wheitage fact, which led straight to the partition. The leadership of the Congress, sought a

reconciliation with the Muslims with the help of the inertness of the Hindu civilisation suppressed into

subordination over a millinium. It had a direct impact on the Northern India, which was ultimately broken

up and ravaged.

The, partition, the logical consequence of the attempt to seek a reconciliation of the national identity of

India, with the quest for a Muslim power in India, did not end, the basic conflict, which had its roots,

spread over the centuries of Muslims rule in India. Akbar the great Mughal, erroneously venerated for

religious tolerance, was as committed to the Islamisation of India, as Babar was. He changed the

strategies the earlier Mughals had followed. Not surprisingly therefore, the process of the destruction the

Hindus undertaken in Kashmir was as rigorous during the Mughal rule as it was during the Muslim

Saltanate. The Muslim struggle for ascendence in the north crystalised in seeking to integrate the Muslim

majority provinces in India, into the Muslim State of Pakistan. In the princely. States, which were not

even remotely linked with the partition of the British India and the creation of Pakistan, the Muslims

demanded the Muslim majority for their Muslim commonwealth. They swallowed Kalat, against the will

be of its ruler, flushed out Hindus from Bahawalpur, to annex it to Pakistan and then invaded Jammu and

Kashmir a Muslim majority princely state.

In the invasion of Jammu and Kashmir, around thirty eight thousand Hindus and Sikhs were killed.

Perhaps, the number would have been far larger, but for the heroic resistance the Hindu officers and men

of the State army offered to the invaders. The Muslim officers and ranks deserted the State army, when

the invaders rolled into the State. Perhaps, few of the hundred thousand Hindus, trapped in the Kashmir

Valley would have survived, if Brigadier Rajinder Singh and the handful of his gallant men, would not

have laid down their lives and delayed the entry of the invaders into the Uri bowl, for two and a half

critical days, which earned moments of reprieve for Maharaja Hari Singh and his Hindu subjects.

Four decades after the partition, the civilisational conflict, manifested itself in a different form, and struck

the Hindus in Kashmir and Jammu, with a ferocity, no less in its severety, than fascism, before the second

world war. Beside the genocide the Hindus faced, their whole community was forced out of Kashmir.

Later the hatchet fell on the Hindus in the Muslim majority regions of the Jammu province. Hindus are

actually paying the forefiet, for a leadership in India, which has failed to realise the historical import of

the civilisational conflict, in which the Hindus have been on the frontline. Where do we find the martyrs,

in a struggle, which has a history of centuries. Martrydom for Hindus, has indeed, been the only way to

their freedom.

The war of subversion being waged in Jammu and Kashmir must be visualised in its proper perspective as

a part of the Muslim crusade to extend Muslim power into India. The terrorist violence in Kashmir

commenced with the genocide of the Hindus and their exodus from Kashmir. The battle lines were not

drawn inadvertently, but with a deliberate intent which had an ideological basis in the long civilisational

struggle for which Northern India was the battle ground. The Hindus in Kashmir, who formed the

northern most salient of the Sanskrit civilisation, remained for more than six centuries on the frontline of

the great civilisational conflict. Slowly they were consumed in the long struggle. Those left alive,

continue resistance to the various forms of ideological precedence the Muslims claimed.

In his presidential address to the first All India States Peoples Conference, held in Kathiawar in 1929,

Pandit Shankar Lal Koul, a Kashmiri-speaking Hindu, called for the recognition of the in alienable unity

of the States and the British India, which he proclaimed formed one and an indivisible nation. Lalla

Muluk Raj Saraf joined the conference as a delegate from Jammu. The Indian leaders dragged their feet

and refused to integrate the liberation movement in the states with the national movement in the British

India. The Muslims in India had a deep interest in the segregation of the states from the British India, for



the states spread over nearly half the territory of the British empire in India and were populated by a

hundred million Hindus. Indeed the Muslim League insisted upon the exclusion of the states from the rest

of India as a basis for any constitutional settlement of the Indian question.

The fundamental conflict between the assertion Shankar Lal Koul made in his presidential minute to the

All India States People’s Conference and the Muslim League came to surface when the Muslims cut away

a part of the Northern Indian to form the State of Pakistan. They insisted upon the dissolution of the

Paramountancy to swallow not only the Muslim ruled States in India, which they claimed on the basis of

prescription, but the Muslim majority states as well, which they claimed on the basis of the right to

precedence of the Muslim majority in such states. The inability of the Indian leadership to resist the lapse

of the paramountancy again pushed the Hindus in Jammu and Kashmir to the frontline.

The subversive war being waged in the North of India, is the part of the same historical and elemental

conflict. The Indian civilisation is in a state of siege. The Indian people must redeem their pledge to

freedom. The siege must be broken.

The Author is the internationally acclaimed Kashmir expert who has retired as the Head of the Deptt. of

Political Sciences of Kashmir University.

77777777 ‘‘‘‘‘‘‘‘PPPPPPPPOOOOOOOOLLLLLLLLIIIIIIIITTTTTTTTIIIIIIIICCCCCCCCAAAAAAAALLLLLLLL PPPPPPPPRRRRRRRROOOOOOOOCCCCCCCCEEEEEEEESSSSSSSSSSSSSSSS IIIIIIIISSSSSSSS AAAAAAAA SSSSSSSSHHHHHHHHAAAAAAAAMMMMMMMM’’’’’’’’--------PPPPPPPPAAAAAAAANNNNNNNNUUUUUUUUNNNNNNNN KKKKKKKKAAAAAAAASSSSSSSSHHHHHHHHMMMMMMMMIIIIIIIIRRRRRRRR

K.S. Correspondent

JAMMU: Panun Kashmir raised some basic questions about the outlook of Government of India on the

political process in the state of Jammu and Kashmir, while addressing a press conference in Press Club,

Jammu on 25th Sept. 1999. The press conference was organised by Panun Kashmir to express its views

on the on going elections in the state in general and the fraudulent use of postal ballots in particular. The

press conference was jointly addressed by Dr Ajay Chrungoo Chairman Political Affairs and Prof M.K.

Teng Head of its Advisory Committee of Panun Kashmir.

‘We have taken a serious note of the evidence brought to the fore by the local media with regard to the

fraudulent polling through postal ballots in the recently conducted elections in the state’, Dr Ajay said and

censured the Election Commission for trying to play down the entire event. He further expressed his

grave concern, ‘that right from its inception, the procedure of postal ballot devised by the Election

Commission for the participation of exiled community in the polling has been allowed to be used with

impunity in such a way that the entire process has become a ploy to disinherit the Hindus of Kashmir of

their right to franchise.”

PK leaders described the inquiry ordered by the Chief Electoral Officer of the State into the matter only a

diversionary ploy. ‘By now action should have been already taken against the erring officers. We have a

situation where a local political party claims to have seized more than 2000 postal ballots from the

premises of the persons belonging to another political party. Election Commission accepts that the postal

ballots have not gone to the individuals who are supposed to have applied for them, but have been sent in

bundles to the local zonal officers. Who within the Election Commission is responsible for sending

Kashmiri Pandit postal ballots to selected individuals”? commented Prof M.K. Teng while describing the

role of Election Commission.

The press conference became surcharged when Panun Kashmir leaders questioned the genunity of the

political process initiated by Government of India 1996. “Such a process, instead of building faith in

Indian democracy, has only degenerated into a sort of referendum for secessionism in the state,” Dr Ajay

said. He further commented that, “the implications of Muslim boycott in Srinagar, Rajouri, Poonch and

Doda are grave for the nation. No less dangerous will be the implications of the verdicts which were

manipulated through participation in Baramullah Constituency.”

Highlighting the inertia of the Election Commission Dr MK Teng asked, “who is responsible for boycott

in Srinagar? Ruling party for last one year has been claiming this area to be almost normal. If such a

boycott is possible in Srinagar without the perceptible threat of violence, how could relatively higher

polling take place in areas of Baramullah where terrorist threat continues to loom large?” PK leaders

opined that the boycott in Srinagar and coerced polling in Baramullah appears more a ploy to ensure the



victories of candidates belonging to a particular party. They stressed that, “the underlying message of the

poll boycott in Srinagar which was claimed to be normal and higher polling in Baramullah needs to be

understood. Political process in J&K means the rule of a single chosen political party”.

Panun Kashmir leaders opined that outlook of both Government of India as well as the Election

Commission of India with regard to political process in the state was flawed. “It has been our contention,

right since 1996, that the dangers of conducting elections in a subverted polity with a collapsed

institutional framework are grave for the nation. Besides the approach of embarking upon ensuring right

of franchise of displaced Kashmiris without ensuring their right to live created a farcical election process

right at its inception in 1996”, Dr Ajay commented while elaborating his views on the political process.

Dr Teng rediculed the attempts to equate the non-participation of Kashmiri Pandits with that of Hurriyat

boycott. He said, “Hurriyat boycott was because it doesn’t recognise elections under Indian constitutional

arrangement. For us participation in meaningless. Isn’t it rediculous to vote for the issues in a

constituency from which I have been thrown out, my properties destroyed or usurped.”

Panun Kashmir questioned the wisdom of the Election Commission to have agreed to conduct elections in

a state where an internal war is going on for a decade. “The Election Commission appears to have become

an instrument in the hands of Ministry of Foreign Affairs of Government of India and has allowed itself

to be used to further a political line in regard to Jammu and Kashmir,” Dr Ajay said. Elaborating the same

Dr MK Teng said that Kashmiri Pandits cannot ignore the harmony of action between Government of

India, Election Commission and the various regimes in the state to convince the world that the people of

Jammu and Kashmri state have all the freedom to realise its Islamic destiny in a secular society of India.

He said, “the promotion of Islamisation has become an end of the political process rather than

establishment of a democratic society.”

Panun Kashmir demanded the Election Commission to constitute an enquiry committee of experts to

assess the implications of ensuring right to vote for a group whose right to life in his homeland has been

denied. Such a committee should also go into the entire process of voting through postal ballots and fix

the responsibility for the fraudulent use of postal ballots.

Concluding the press conference Dr Ajay Chrungoo urged Government of India to review its outlook on

the socalled political process in the state which is merely symolic. He emphasised that, “Both the Election

Commission and Government of India have put the nation in an embarassing situation in which Pan-

Islamic operations and the so-called democratic process have become mutually complimentary in th

state.”

88888888 TTTTTTTTHHHHHHHHRRRRRRRREEEEEEEEEEEEEEEE SSSSSSSSHHHHHHHHRRRRRRRRIIIIIIIINNNNNNNNEEEEEEEESSSSSSSS OOOOOOOOFFFFFFFF KKKKKKKKHHHHHHHHIIIIIIIIRRRRRRRR BBBBBBBBHHHHHHHHAAAAAAAAWWWWWWWWAAAAAAAANNNNNNNNIIIIIIII

TTuullaa--MMuull,, MMaannii GGaamm,, RRaaiitthhaann ffrroomm KKoosshheerr EEnnccyyccllooppaaeeddiiaa--VVooll.. 11 && 22 CCuullttuurraall AAccaaddeemmyy

Original--Moti Lal Saqi

Translation--Dr. R.L. Bhat

TULA-MUL

Tula-Mul is also known as Ragniya Asthapan and Kshir-Bhawani both in and outside Kashmir. The

tirtha, lies 22 km to the South of Srinagar. Kshir-Bhawani asthapan is among the tirthas of Kashmir, well-

known outside Kashmir too. Non Kashmir yatris flock there for Darshanas.

The historical antecedents of Kshir-Bhawani, go back to very ancient times, as per the traditions. It is said

that Ragniya Devi came to Kashmir from (Sri) Lanka in the era of Ramayana. Though Ragniya is a rupa

of Durga, this one is a Vaishnav rupa in Kashmir Ragniya is also known as Tripura, while in (Sri) Lanka,

the Mother Goddess was called Shayama. Sita too, is believed to have been an incarnation of Ragniya.

Ragniya Mahatmya has it that those who meditate on Panch Dashi Mantra during Nav-reh, Mother

Ragniya grants their wish.

It is said that the night during which Mother Goddess came from (Sri) Lanka to Kashmir was Christened

Ragniya Ratri In Kashmir a number of shrines are deciated to Mother Goddess at Tiker, Bhuvaneshvar,

Manzgam (Noor-abad) Bheda, Lo-qraer-pur, Mani-gam, Rai-than and Baed-pur, but the Shrine at Tul-

Mul is the most famous one and hence the focus of yatris. 360 springs (nagas) are said to have gathered



there. Ragniya is a Sattavie form of Mother Goddess, i.e. the form of tranquility and bliss.

The first mention of Tula-Mula in Raj-Tarangni comes in Jaya Peda’s reign when the Brahmins of Tula-

Mula agitated against him. The protest of Brahmin fraternity indicates that Tula-Mula commanded much

importance in Jaya Peda’s time, because of which many Brahmins congregated there.

The river on whose bank, Tula-Mul stands, has been called Chandra-Bhaga in Nilamat Purana. This

Chandra-Bhaga is the branch of Indus which flows by Tula-Mula and finally merges in Veth (Jehlum).

Another tradition says that in the year 4041 Sapta Rishi over a thousand years ago, when the location of

Tula-Mul Tirth had been lost to the people as the whole area of Tula-Mula had been inundated by water.

Krishna Pandit, a devotee of the Devi, located it again, in that year. The reason for (Jesht) Ashtami being

the day of fasting for Devi, is said to be the fact that its was in the night of (Jesht) Ashtami, that Devi

came to Krishna Pandit in a dream and told him that she would lead him through water to the location of

her asthapana, the next day. This is said to have happened exactly so and Krishna Pandit drone pegs

around the place to demarcate it. Later when the flood ebbed the shrine was established a new.

Abul Fazl writes that Tula-Mula is an area of fifty kharwars which gets flooded in summer. About the

marsh, he says, that when the waters recede, people catch ½ to 1 kg fish from under the mud.

Dara Shikoh’s advisor, Maharishi Shyam Sunder Koul who was a Shakta-Margi, had a strange experience

at Tula-Mula when his meat-dishes turned into vegetable ones. Devis’ devotees have a firm belief that the

waters of spring, in which Devi’s shrine is located, changes colour.

Krishna Kar, attained spiritual height at this spring, during Aurangzeb’s reigin (1659 AD).

Today the shrine is spread over an approximate area of 20 miles, which contains Dharam-salas etc. The

area around the spring is floored in marble.

Though there is a festival at Tula-Mula on every Ashtami of full-moon fortnight, the grand festival of the

year is held on the Jesht Ashtami, in which people from Kashmir and outs-side take part.

The Devi temple of Tula-Mula is said to have been damaged in 14th or (and?) 15th centuries. The temple

that was damaged (destroyed?), was also situated in the middle of the spring like the present temple. This

came to light when the foundation for the new (today’s) temple was being laid. The (ancient) temple had

been built of beautifully carved flat stones, that were 9 feet in length and 3 feet in breadth. Besides a

number of murtis were recovered which had great splendour and beauty. Maharaja Pratap Singh built a

small marble temple in 1912 AD, on the foundation of that ancient temple. The small stone icon, adorning

this temple is believed by experts to be more than 600 years old.

The original name of Main Gam is MaYA Gram. The village is situated above Lar on the right-bank of

Indus, a little to the interior, between 540-12(E) longitude and 340-17’ (N) latitude, at a distance of 20

kilometres from Srinagar.

In the village proper, no ancient remains are found (now) but above the village on the foot of hill there is

a heap of tiles, about which (M.Aurel) Stein writes that a temple existed there. On this path, enroute to

Mahind Marg, there was a pond enclosed in stone-work with an in let in the north.

This spot is now called vata-shun. Haider Malik Chadoora calls this spring “Votur-Gang”, and relates that

its defiling, brought a fear of a snow-fall in Summer Hassan supported Haider Malik and has called it

‘votur-nag’. Now this spring is used by the water-works department (PHE) as a water-source.

A mela is held at this spring, on the 12th of the bright-half of Shravana. It has been called Achha-ra-na

Nag in Harmukh Mahatamya.

Raithan is to the North-West of Srinagar 32 km away. Near the village, between the Son-moi river and the

road, there a very large stone which the Hindus have been worshipping since time immemorial as a form

of Goddess Ragniya.

Till 1975, we were not aware of any historical significance of this place. In that year the people of the

area decided to build a Dharamshala and a wall around the shrine and started digging near the Ragniya

aakar. During this (digging) stone murti were found in two layers. The murtis in the upper layer related to

the Hindu period and those below to the Buddhism. A specimen of wood-carving and a foundation of an

ancient temple were also unearthed. Besides, charcoal mixed in earth was also found which indicated the

destruction of the shrine by fire in some early time. The foundation of the small edifice is in front of the

stone towards north. Its lay-out points to a stupa having existed there. This is not surprising since the



remains of a Boddh-Vihara existed, till only a short while ago in Arigam, just a little below Raithan. This

indicates that Buddhist activities continued in the area for a long time. A little below Raithan, to the left

of the road, there is a udara, which is even today called Raza-Geer (Raj Gadi-Capital). People say that

coins of different period were found during ploughing.

Gh Ahmad Mahjoor, had collected many of these coins from the people. Mahjoor had been the patwari of

Raithan, Ari-gam and Gra-veth, for a long time (before independence).

The murtis, that were exacavated during digging, have got broken for the lack of caution. Most of the

murtis are of soft-stone (lime-stone) which is not found in the vicinity. The murtis of Buddhist period are

from the view point of craftsmanship and art much graceful, (but) those of the Hindu era do not possess

that finesse and instead give the impression of crudity. It appears that these are related to the 11th and

12th centuries when the sculpture in Kashmir had decayed. However, the three-faced, green stone Vishnu,

that has been found there is much graceful. Probably, it has been brought to the place from somewhere

else. A similiar three-faced Vishnu has been found earlier at vont-i-pur (Avantipura).

Thus the Raithan shrine has have passed through three stages. First there had been a Buddhist shrine, then

its became a Vishnu shrine and now it is a place for worship of Devi.

99999999 PPPPPPPPAAAAAAAANNNNNNNNDDDDDDDDIIIIIIIITTTTTTTT PPPPPPPPRRRRRRRREEEEEEEEMMMMMMMM NNNNNNNNAAAAAAAATTTTTTTTHHHHHHHH SSSSSSSSHHHHHHHHAAAAAAAASSSSSSSSTTTTTTTTRRRRRRRRIIIIIIII

EEPPIITTOOMMEE OOFF KKPP IIDDEENNTTIITTYY

By Vijay Tikoo

In his last words Pandit Prem Nath Shastri attributes the success of his ‘Vijyeshwar Panchang’ to not as

much to his own efforts but the overwhelming support of the Kashmiri Pandit Community. These words

from a man who knew that his death was not far away convey both a sense of accomplishment as well as

feeling gratitude Pandit Prem Nath had reluctantly agreed to give up the job in state education department

after completing his education and join his father and Guru Pandit Aftab Sharma to bring out the

Kashmiri Panchang ‘Vijyashwari Jantri’ now a household name amongst Kashmiri Pandits.

In fact ‘Vijyeshwar Panchang’ over the years has become one of the most important guides for the

Kashmiri Pandit Community in their day to day socio-religious dealings. Not that Kashmiri Pandit

Community did not have alternative ‘Panchangs’ to adopt. In fact Brahman Maha Mandal of Kashmir for

quite sometime has been taking out a ‘Panchang’ which many Kashmiri scholars opined was more

accurate. Yet the Pandit Community almost through a silent consensus chose ‘Vijyeshwar Jantri’ as a

guide in their socio-religious dealings. Perhaps for its better presentability and simple language. Or with

this confidence that the family of Prem Nath Shastri had carried on this task for three centuries and shall

ensure its continuity in the future as well.

Pandits recognise ‘Vijyeshwar Jantri’ as one of the most important institutions for maintaining their

identity during such times when pressures for dissolution of the same are multiplying.

Pandit Prem Nath Shastri’s role during his life time did not remain confined to just carrying ahead a

family tradition but in institutionalising it in such a way that its relevance in the social life of Kashmiri

Pandits only increased with each day. During the years in exile, ‘Vijyeshwar Jantri’ became the most

important instruments for Kashmiri Pandit to holding on to his identity. When the news of the demise of

Pandit Prem Nath Shastri broke out, displaced Pandits received it with a stunning silence. Pandit Prem

Nath Shastri through ‘Vijyeshwar Jantri’ and numerous other works endeavoured to protect Kashmiri

Pandit identity and with his demise people feel as if a fulcrum around which they could rebuild their

socio-cultural fabric in exile was lost.

During the years after the forced exodus of Kashmiri Pandits in 1989, Sh Prem Nath Shastri had become

acutely conscious and concerned about the dangers to the cultural identity of Kashmiri Pandits in exile.

‘Our ritual traditions have become as important as they were never before. Not in their negative

degenerated form, but in their positive essence. Our traditions will hold us together in exile,” he once said

to us while thinking aloud on the tragedies that befell upon Kashmiri Pandits. Not surprisingly, he

undertook the arduous task of commenting and explaining the main ritual traditions of Kashmiri Pandits.

He brought out small booklets, audio cassettes on the significance and performance of almost all



important religious traditions and rituals of Kashmiri Pandits. These capsules like Karam Kand Deepak,

Shivratri Puja, Sandiya, Antim Sanskar, Janam Din Puja has had a marked impact on the Kashmiri Pandit

Social life in exile. While as in the Valley such ritual traditions were the forte of only a small section of

‘Gaurs’-the priestly class of Kashmiri Brahmins, in exile through these simplified and written and audio

capsules practice of the ritual traditions has become possible for one and all. Very gradually the families

of displaced Kashmiri Pandits have become active participants in their religious traditions. The simple

and erudite expositions of Shastri Ji both in written and audio forms on such works like Panchastavi,

Bhawani Sahsranama, Mahimnapaar, Bhagwat Geeta, verses of Lal Ded have been a profound attempt to

bring the spiritual tradition of Kashmiri Pandits within the reach of the displaced Hindu society from

Kashmir.

Shastri Ji also understood very well the importance of preserving the Kashmiri language for the survival

of Kashmiri Pandits as a distinct entheno-religious group. In all his public discourses and social

interactions Pandit Prem Nath Shastri would urge the new generation to speak Kashmiri language, and

transmit it to the coming generations. He also wanted the digeneous script for Kashmir to be revived. In

fact his ‘Sharda Primer’ has been one of the few attempts to revive ‘Shardha Script’ amongst Kashmiri

Pandits.

In his day to day living Shastri Ji was an epitome of traditional Kashmiri Pandit living. He always wore

the traditional Kashmiri Pandit Pheren and the turban. His living room reflected not only the style but also

the discipline of a Kashmiri Brahmin scholar. No chairs, arrangement of books on the rack, his writing

desk, everything bore a traditional mark, besides his strict working schedule. But most significant was his

own personality which was typically a Kashmiri Pandit type. The glow on his face, inquisitiveness of

eyes, soft but stern voice and the aura of discipline. He appeared deeply orthodox by looks. But just a

small conversation with him would convince about his flexibility of thought.

During his last days he had developed taste for listening to the ‘audio cassettes’ of Osho. His son had to

purchase Rs 10,000 worth cassettes which Pandit Shastri would listen while fighting his disease. ‘He

(Osho) has been misunderstood by the people of India. But I am a Kashmiri Brahmin. I cannot deny him

his due,’ he would tell his family during his last days.

One of the last wishes of Pandit Prem Nath Shastri had been to publish a ‘Panchang’ for Jammu. Most of

the work on the same has been already completed under his supervision. His sons as a tribute to him are

going to bring out the first issue of ‘Ranvireshwar Panchang’ very soon. When one of us pointed out to

the eldest son of Pandit Shastri that the mantle of the social and religious responsibility, which Shastri Ji

had carried on his shoulders, now fell on him, he was overwhelmed and said with moist eyes in all

humility, “I am feeling the weight. But I will do my best with your co-operation”.

1111111100000000 LLLLLLLLEEEEEEEETTTTTTTTTTTTTTTTEEEEEEEERRRRRRRRSSSSSSSS

JJ&&KK iinnssuurrggeennccyy aanndd PPaakk bbaannddmmaasstteerr

Sir,

KS is a marvellous paper and in fact the only voice of Kashmiri Pandits. The presentation of information

is quite appreciable. I hope that you will send me KS regularly. There are hundreds of Kashmiri families

settled in Rajasthan. I will try my best to make your paper popular in entire Rajasthan. I will also like to

write for your paper.

Er. Vinod Pandit

Itarana Road, Alwar (Rajasthan)

Sir,

I have been a regular subscriber of this paper from its very inception. You have through this paper created

an awareness among the intellectuals of the state and outside the state about the true picture of J&K State.

This paper needs to be strengthened and made weekly if not a daily news paper.

P.N. Bhan



Laxmi Nagar, Temple

Jammu.

Sir,

The insurgency in J&K which started since Jan 1990 was mainly due to culmination of religious

indoctrination and by vicious propaganda from the madrassas of Jamat-i-Islami. Jamat preached and is

still preaching and propagating, religious ideology and it plays upon the religious sentiments of Sunni

Muslims to achieve a destination as conceived in Nizam-e-Mustafa. Its religious ideology created and is

still creating bad sentiments against the Hindus of J&K. It preaches intolerance and bigotory at its core. It

produces proud Mujahids who create barbarit against the Hindus of J&K. Ali Shah Gilani was preaching

against the secular character of India and was posing it as a great threat to Sunni Muslims of Kashmir.

The socalled Mujahideen created atrocities on the innocent KP which will bring shame to Hitler and

Musolini even.

Jamat preached assured insurgency as the best means of freeing Kashmir from secular India. The Jamat

brain washed the minds of young Muslim Sunni youths against the Hindus of J&K through its training

centres.

Hurriyat Conference continues dance to the tunes of their Pak bandmaster. Recently it gave again a call

for poll boycott in J&K. Pak failed in its evil designs to annex J&K in 1989-90 when it started insurgency

in 1990 in Kashmir. US and Britain fish in the troubled waters for their personel interests. India warned

Pak to stop terrorists and close of its training camps in Pakistan before any talks.

-Omkar Nath Moza

Jammu

Sir,

Thanks for your Kargil issue. It is an encyclopaedia that spans vast tracts that pertain to Kashmir history.

It’s a memorable piece on Kashmirology that each lover of that region should cherish and preserve. I have

circulated it amongst a few Kashmiri Pandits residing at Ajmer. They echo my voice that it is a flower of

prolonged gardening of tender shoots of that rare culture. Fie upon those who have resolved to ruin the

culture in their marauding zeal. Fie upon us that we have succumbed to their predatorship.

The wheel shall come full circle and the predators shall rue the crime. The vast horizon that encompasses

these diaboloical efforts has been crystallized by you.

It even includes the brilliant hero of 1948 invasion the great Col Chweng Rinchen. He deserves to be paid

tributes by denizens of the entire country. I propose to bring his heroic deeds to the notice of my state

citizens variously. I suggest you kindly send a copy of this issue to each of the winning parliamentarian

subsequent to the elections in the offing. What other tributes to pay to the massive efforts of your

contributors Shri Dhar Kaul Dullo is another hero commanding our highest commendation. May your

endeavours bear fruit.

DC Sharma

68-L.I.C. Colony,

Ajmer

Sir,

Hope the news paper of the community will prove to be a milestone in highlighting problems of this

peace loving and learned community. I pray for the success and longevity of this Kashmir Sentinel.

--R.K. Saraf

Jammu

Sir,

I down below quote a few verses of Vasudev Reh for the attention of dear Dr Chrangoo.

“Me Vaaraah Vonuy Yath Chha Sahlaab Yivavun - Yi Zaanakh Ti Kar Vakh Ma Raavar Kadam Tul - P-

azis Hol Vouchhuth, Saath Gav, Vuchh Havvah dol - Khabar Kus Nabuk Ruuph Peyi Aazmaavun”.

--Omkar Aima

Bombay



1111111111111111 NNNNNNNNEEEEEEEEWWWWWWWWSSSSSSSS BBBBBBBBRRRRRRRRIIIIIIIIEEEEEEEEFFFFFFFFSSSSSSSS

BBOORRDDEERR MMIIGGRRAANNTTSS SSUUSSPPEENNDD SSTTRRIIKKEE

KS Correspondent

JAMMU, Sep 28: Joint Action Committee spearheading a 70 day long agitation of border migrants of

Akhnoor tehsil has decided to suspend their strike following the assurance of central government to look

into their problems. Special Secretary Home Affairs, Mr TR Kakkar visited Jammu on the directions of

Home Minister LK Advani to take stock of the situation this followed the killing of a border migrant and

injuries to many others in police lathicharge and subsequent Jammu bandh. Senior BJP leader Krishan Lal

Sharma also flew from New Delhi to show solidarity with these migrants. He represented them in the

talks and announced compensation of Rs 1 lac to the family of deceased, Shamsher Singh and 50,000 to

the injured, Balbir from BJP.

Representatives of border migrants held meeting with visiting Home Secretary who showed helplessness

to accept their demands on spot but assured to take up the matter with Home Minister LK Advani.

Divisional Commissioner and IGP, Jammu were present in the meeting who were criticised by the

agitation leaders for their criminal silence.

Unified Hqrs reviewed situation of border migrants in a meeting headed by

Dr Farooq Abdullah. A magisterial enquiry was ordered and people were asked to up hold communal

harmony.

Meanwhile, Vaid Vishnu Dutt and Gurcharan Singh Charak have demanded relief to border migrants on

pattern of Kashmir migrants.

AAKK--4477 RRIIFFLLEESS FFOORR VVDDCCSS

KS Correspondent

JAMMU, Sep 28: Special Secretary, Home Ministry TR Kakkar reiterated Central governments’

commitment to equip VDC’s with sophisticated weapons and said that 3500 AK-47 rifles have been

already sanctioned for the purpose. He said that 1200 wireless sets will be issued to these VDC’s to over

come communication gap. Mr Kakkar added that 5430 SPO posts have been sanctioned besides the

existing 17000 posts. He said that the Central government has provided adequate funds for salary of

SPO’s and VDC’s.

PPaakk ppuuttss pprreeccoonnddiittiioonn oonn CCTTBBTT

ISLAMABAD, Sep 27: Pakistan has put pre-conditions on signing CTBT recognising Pak a nuclear

country, adjusting loans and resolution of Kashmir issue-to sign Comprehensive Test Ban Treaty (CTBT).

PPAAKKIISSTTAANN AATTTTEEMMPPTT FFRRUUSSTTRRAATTEEDD

KS Correspondent

JAMMU, Sep 29: India made it clear to the global community that Kashmir is an integral part of India

and indicated its readiness to hold composite dialogue with Pakistan if she (Pakistan) adheres to the

principles that are integral to Shimla agreement and Lahore declaration.

Addressing United Nations General Assembly on Sept 23, the Indian Foreign Minister Jaswant Singh said

that India puts no pre-conditions to start dialogue with Pakistan if she abjures violence and cross border

terrorism. He described Kashmir “core of Indian nationhood” and not the “core issue” as propagated by

Pakistan. Mr Singh expressed his views on global issues like CTBT, reforms and expansion of UN

Security Council and global terrorism.

Pakistani representative foreign minister Sartaj Aziz threatened missile and nuclear enhancement

charging India for arms race. Launching tirade against India, he accused it of fomenting terrorism in their

country and repression in Kashmir. He demanded plebiscite in Kashmir.

Mr Jaswant Singh met number of world leaders on the side lines of the assembly convention and

discussed bilateral matters and other essential matters of international importance with them. Mr Singh

met US secretary for state Madline Albright and discussed bilateral issues. Albright appreciated Indian



restraint during Kargil crisis and shared India’s concern over cross border terrorism.

Ms Albright had a meeting with Pak foreign minister Sartaz Aziz and expressed her concern over

Talibanisation of Pakistan polity. She also rejected demand of US mediation over Kashmir and asked

Aziz to solve all issues with India bilaterally.

MMIILLIITTAANNTTSS AATTTTAACCKK SSEECCRREETTAARRIIAATT

KS Correspondent

SRINAGAR, Sep 29: Militants today launched attack on high security area, civil secretariat at summer

capital srinagar. Seven security personnel were wounded in the attack.

Militants fired at least five grenades by a Rocket Projectile Guns (RPGs) from a running vehicle. The

grenades landed inside the secretariat complex causing panic among the people. Earlier, had militants

gunned down a policemen and injured another in adjoining Batmaloo area.

Police claimed to have identified the culprits and launched a manhunt to nab them. Official spokesman

blamed Hurriyat Conference for the attack and referred to the recent statement of Yasin Malik, chairman

JKLF, of direct action in this regard. The police has registered an FIR against Hurriyat leaders Yasin

Malik, Javid Mir and Bashir Tota for their involvement in the attack. Earlier also militants had made

successful attacks on well fortified security installations.

AASSHHOOKK KKOOUULL’’SS DDEEMMIISSEE MMOOUURRNNEEDD

KS Correspondent

JAMMU, Sep 30: Various religious and social organisations including Pushkar Swami Seva Ashram have

mourned the demise of Mr Ashok Koul, a reputed Kashmiri Bajan Singer and Social Worker . Mr Koul

breathed his last on 25th Sep 99 at Jaipur after brief illness at the age of 47.

Mr Ashok Koul was born in a respectable family at Karapora Khuski, Rainawari Srinagar and had his

earlier education from DAV School Rainawari. From his childhood, he had developed interest in the

service to humanity and music. He used to attend Bajan-Kirtan at Shankracharya alongwith his father.

Mr Koul associated himself with “Pushkar Seva Ashram Lok Bhawan, Anantnag” in 1980 and worked for

the development of the shrine. He became a deciple of “Posh Bab” and recited Bhajans and and Kirtans

for nights together.

His Bajan cassettes Posh-Dall, Posh-Pooja and Paunchastvi, Mahimnapar etc are being played in

Kashmiri Pandit households and temples.

SSIIKKHHSS RREESSEENNTT MMUUSSLLIIMM PPGGPPCC CCHHIIEEFF

KS Correspondent

Sikh community of Pakistan has expressed strong resentment to the appointment of a Muslim as chief of

Pakistan Gurdwara Prabandak Committee (PGPC). They described appointment of former ISI chief Javed

Nasir as chairman of PGPC as sacrilegious and feared persecution by the establishment. They wondered if

a Sikh can be asked to head the Haj committee. They also complained that the Sikh shrines are not being

maintained and many Sikhs have resigned from the committee in protest.

NNOOIIDDAA KKPP BBOODDYY

KS Correspondent

NEW DELHI, Sep 18: Kashmiri Pandits residing at NOIDA have constituted a body christened as

“Kashmiri Migrants Welfare Association NOIDA.” Messers ML Koul, Ashok Manvati, LN Koul and

Kuldeep Khasu, DL Dhar and CL Pandit, PL Koul have been appointed president, general secretary, vice-

presidents, joint secretaries and the treasurer respectively. The committee has other 15 executive

members.

HHUURRRRIIYYAATT LLEEAADDEERRSS PPRREEVVEENNTTEEDD

KS Correspondent



NEW DELHI, Sep 23: The emigration authorities today disallowed Hurriyat leaders Mirwaz Umar

Farooq and Abas Ansari from leaving the country to attend organisation of Islamic Conference (OIC)

meet at New York.

DDAARR BBLLAAMMEESS NNCC

KS Correspondent

SRINAGAR, Sep 24: Janata Dal (United) candidate from Anantnag parliamentary constituency and

former Union Minister of State for Home, Mohd Maqbool Dar has blamed National Conference of

encouraging militancy and appealed to the voters of Anantnag constituency to stop boycott and vote.

Addressing a press conference, while comparing Farooq Abdullah and his ministry with “Ali Baba

Chalees Chor” (Ali Baba and his forty theives), he said that NC is looting people with both hands and

corruption is at height. He said that ministers are constructing palatial Bungalows like ‘Sheesh Mahal’ at

Bathindi and other places.

PPSSAA EENNFFOORRCCEEDD OONN HHUURRRRIIYYAATT

KS Correspondent

SRINGAR, Sep 25: The State government has decided to detain separatist leaders under Public Safety

Act (PSA) and detained, Hurriyat leaders-Ghulam Ahmed Gulzar, Ghulam Mohd Sankar, Maqbool Sofi,

Abdul Ahad Deenthoo, Khizar Mohd Ganai, Azad Ahmad Bangroo and Abdul Rashid Shigan. They were

lodged at Udhampur jail. Syed Ali Shah Geelani and Prof Gani were also held under PSA and detained at

Srinagar jail.

IISSII HHAANNDD IINN MMOOUULLVVII’’SS KKIILLLLIINNGG

KS Correspondent

NEW DELHI, Sep 26: Former chairman JKLF Hashim Qureshi held Pakistan’s ISI responsible for killing

of religious leader Moulvi Farooq in 1990 in Srinagar. He said that as Farooq was asking Kashmiri youth

for talking of only independence and not accession with Pakistan he was silenced by ISI agents. He

described Ammanullah Khan as a puppet in the hands of ISI. Mr Qureshi revealed these facts in his book:

Kashmir-The Unveiling Truth.

SSRRIINNAAGGAARR TTIIMMEESS EEDDIITTOORR AATTTTAACCKKEEDD

KS Correspondent

SRINAGAR, Sep 28: Militants launched a grenade attack on the residence of Srinagar Times editor Sifi

Ghulam Ahmed at Buchwara, Dalgate. However, there was no damage.

LLOOCC CCRROOSSSSIINNGG

KS Correspondent

JAMMU,: JKLF chief Amman Ullah Khan is garnering support to his plans of crossing LoC in J&K on

4th October, 1999. He has urged youth to take part in the crossing. Mr Khan is planning the crossing to

focus international attention on Kashmir and reported attempts of converting LoC into international

border.

While India has asked Pakistan to make it sure that sactity of LoC is not violated there are reports that Pak

may not stop the JKLF activists from crossing LoC to make Indian army to do the job. Pakistan is

plannnig so to escape opposition from Kashmir groups in many foreign countries who think that Pak

sabotaged Kashmir cause during Kargil crisis END

PPAAKK MMEERRCCEENNAARRIIEESS IINN RRUUSSSSIIAA

KS Correspondent

JAMMU: About 2000 Islamic militants have entered Russian Republic from Chechanaya to trigger fresh

violence is Dagestan and surrounding areas.

The Islamic militants triggered heavy blasts in multi-storeyed buildings and army barracks killing more



than 200 people. Russia quickly reacted and attacked. However, there is reportedly high concentration of

militants across Chechanya border to sneak into Russia and militants have threatened to take the war deep

into the heart land of Russia.

Russian President Boris Yelstin has appealed to people to ready themselves to fight international

terrorism saying, “terrorism has declared war on the people of Russia.” There are reports about Pak

mercenaries fighting alongwith other Islamic terrorists against the Russia force. Reportedly more than

2000 Islamic terrorists have been eliminated by Russia in rataliatory action during last week.

AARRMMYY RREEVVAAMMPP

KS Correspondent

NEW DELHI, Sep 15: Amidst reports of large scale concentration of mercenaries in many pocket of J&K

State and governments renewed resolve to crush militancy, a revamp in Army in J&K is under way to

facilitate deployment of more personnel. As per official sources, the 15 Corps, which was incharge of

Kashmir and Ladakh region, will now look after Kashmir only while Ladakh region will be looked after

by 14 Corps.

GGOOVVTT RREESSPPOONNSSIIBBLLEE FFOORR RREEVVIIVVIINNGG MMIILLIITTAANNCCYY -- KKUUKKAA PPAARRAAYY

KS Correspondent

SRINAGAR, Sep 16: Chairman J&K Awami League and MLA Kuka Parray launched a scathing attack

on the ruling National Conference and State government and accused the government of reviving

militancy in J&K.

Addressing election rallies in Baramulla parliamentary constituency he claimed that normalcy would have

returned if Farooq government had heeded to our warnings in time. He accused National Conference for

raising non-issues and described governments achievements of employment drive as a campaign of jobs

on sale.

Mr Parray also lambasted Hurriyat Conference and PDP in his speeches.

BBJJPP NNOOMMIINNEEEE FFOORRCCEEDD TTOO OOPPTT OOUUTT

KS Correspondent

SRINAGAR: After elemination of BJP’s Anantnag parliamentary constituency candidate Hyder Noorani,

the new nominee of the party (Dr) Abdul Rehman Sheikh was forced to opt out of the race as his 7 year

old son was abducted by gunmen on the day of filing of his nomination. Subsequently, BJP fielded

Showkat Hussain Wani from the constituency.

Surprisingly, Rehman Sheikh blamed surrendered militants for abduction and said that he was facing

threat from Showkat Hussain Wani, who happens to be a surrendered militant. He claimed that the

abductors have demanded Rs 5 lac as ransom and he talked about it to Union Home Minister. He said that

he and Mr Abdul Rashid Kabuli are opposed to induction of surrendered militants in the party fold. Next

day, his son was released against a reported ransom of 2.5 lac.

Later Sheikh termed BJP’s decision to nominate Wani as disasterous and wanted party high command to

take serious note of the developments.

LLAADDEENN DDEECCLLAARREESS JJIIHHAADD AAGGAAIINNSSTT IINNDDIIAA

KS Correspondent

JAMMU: As per reports from Islamabad, the fugutive Osama Bin Laden, a notorious terrorist, has

declared Jihad against India and asked his caders and other militant groups in Pakistan to join hands to

target India.

Bin Laden who is based in Afghanistan has described US and India as enemies and appaled for combined

efforts of Pak based terrorist groups.

Laden had earlier declared war against USA, He is wanted in Washington who had launched a missile

attack on his suspected hideouts in Afganistan earlier. Mr Laden and his followers are reportedly in

possession of dreaded weaponary including stinger missiles.



Reacting to the Bin Ladens reported Jihad against India, Union Home Minister Lal Krishan Advani

vowed to fight religious terrorism tooth and nail. Talking to reporters at Bubaneshwar (Orrisa), he said

that terrorists are mistaken if they understand that India is a “soft state” and asserted that the Jihad will be

crushed with same firmness as the intrusion in Kargil. Advani claimed to have launched systematic drive

to neutralise ISI modules in India.

Meanwhile, Hurriyat Conference debunked Laden and said that he has no role in Kashmir movement.

Hurriyat leader and its former chairman Umar Farooq said that he has no locus standi in the Valley and

his aim is to spread Islamic Jehad. Umar Farooq who was in New Delhi for his mission to go to USA to

attend OIC meet described Kargil instrusion uncalled for which damaged the separatist cause.

He claimed that supporters of our movement in the-US, UK and France had to intervene to censure

Pakistan.

The chairman of All India Muslim Shariet Board chairman Dr Mohd Amaan Khan described Ladens

Jihad against India against tenants of Islam and said what to call of an individual even no country has

right to declare Jihad against India inhabiting second largest Muslim population after Indonesia.

HHUUMMAANN BBOOMMBBSS

KS Correspondent

AMRITSAR, Sep 19: An obnoxious plan of ISI to target top politicians was foiled when Punjab police

forced two human bombs-Manjit Singh and Amrik Singh to surrender.

DG Punjab Police Sarabjit Singh said that the militants revealed about the efforts of ISI and Babhar

Khalsa International (BKI) to sabotage election process and recruit more Sikhs for arms training.

LLAADDAAKKHH SSCCOOUUTTSS HHOONNOOUURREEDD

KS Correspondent

LEH, Sep 18: Ladakh scouts who played a valiant role during Kargil war and dislodged the intruders from

important peaks, was honoured today with “Chief of the Army Staff Banner”.

Presenting the honour at a glittering function at scouts headquarters, General VP Malik appreciated the

meritorious performance of Ladakh scouts in operation Vijay which will be enshrined in the annals of

Indian victory.

CCEENNTTRREE BBLLAAMMEEDD FFOORR LLOOWW TTUURRNNOOUUTT

KS Correspondent

JAMMU, Sep 22: Senior National Conference leader and ministers for Parks and Gardens, Peerzada

Ghulam Ahmad Shah held centre and security forces responsible for low turn out in parliamentary

elections in the state.

In an interviews to JKNL, local edition of Indian Express, Mr Shah wondered how security forces ensured

a reasonable turn out during 1996 elections when militancy was at height. He said that centre and security

forces were trying to show failure of NC government. Mr Shah blamed centre for sheilding surrendered

militants and creating a financial crunch in the state.

Mr Shah described PDP as a creation of intelligence Bureau (IB) funded by Central government.

Mr Shah also justified use of security forces to ensure voting to frustrate evil designs of Pakistan.

1111111122222222 CCCCCCCCHHHHHHHHRRRRRRRROOOOOOOONNNNNNNNOOOOOOOOLLLLLLLLOOOOOOOOGGGGGGGGYYYYYYYY OOOOOOOOFFFFFFFF EEEEEEEEVVVVVVVVEEEEEEEENNNNNNNNTTTTTTTTSSSSSSSS

August 14 to September 15

Aug 14: Continuing their attacks on security establishments, militants attacked RR Brig HQR Manasbal,

RR patrol party and ITBP camp Magam while a total of 14 people-9 army men, 2 counter insurgents and

3 militants-were killed in Kashmir Valley. Police rounded up 95 suspects, including criminals, on eve of

independence day in Jammu.

Aug 15: Militants failed to disrupt Independence day functions while 2 HM militants were killed in

Kokernag (Anantnag). Valley observed a near total bandh in response to militants call. A cop was killed

in cross firing with militants at Bapp Sarar and militants blasted the re-inforcement vehicle killing 3



SPO’s and injuring 12 others in Sudh Mahadev in Udhampur district.

Aug 16; 11 civilians, including 7 in Zirhama (Kupwara) blast, were killed in militancy related incidents in

Kashmir valley while 2 jawans and a civilian were killed in Rajouri district. 1 militant was killed and 3

cops injured in an encounter at Sabjian, Mandi. 1 jawan and 2 militants were killed in an un-successful

attempt of Pak to capture an Indian post in Ramgarh sector. Farooq Abdullah attended annual Havan at

Nagdandi and hoped of early return of migrnats.

Aug 17: 1 teacher and 2 militants were killed in an encounter at Khalba, Thannamandi (Rajouri) while 2

jawans were killed and 2 injured in two different encounters in Doda district. 4 militants, 1 BSF jawan

and a civilian got killed in militancy related incidents in Kashmir valley. A rocket reportedly fired from

Fallan Mandal area on LoC aiming army establishment landed in Greater Kailash area without causing

any harm.

Aug 18: 2 MiG-21 crashed in Srinagar soon after take off from Srinagar air base. Militants attacked PCR

Doda, CRPF patrol at Thatri (Doda) and STF post at Baljarlan (Rajouri) but there was no loss of life from

either side. A LET militant operating in J&K was arrested in Hyderabad.

Aug 19: 16 people including 9 militants and 5 security force personnel were killed in different militancy

related incidents in Kashmir valley while 2 girls were killed in Pak shelling in Uri sector. Militant,

gunned down a surrendered militant in Thannamandi area of Rajouri district.

Aug 20: Security forces eliminated 3 militants in Kupwara while militants liquidated 2 SSB drivers in

Srinagar city and an Army source in Rafeeabad. Farooq Abdullah ordered crime branch inquiry in the

massacre of Mohra Bichar, Surankot on the intervening night of 28-29 June.

Aug 21: 2 Foreign militants, 3 army personnel and 1 civilian were killed in a fierce encounter at Achabal.

While 1 alleged militant was killed in Uri. 1 militant was killed at Dhara Jarian, Thannamandi. union

Home Secretary is on a visit to state to review security scenario and poll arrangements.

Aug 22: Militants shot dead an army source in Latishat, Sopore and injured 3 counter insurgents in an

attack at Ikhwan and SOG camp at Wawoora (Lolab). Police foiled an attempt of militants to strike in

Jammu by recovering consignments including 15 kg RDX in a village near border in Akhnoor. One

militant was arrested in Kishtwar.

Aug 23: Militants killed an NC activist in Srinagar city in their anti-election operation while 2 BSF

jawans and 2 militants were killed in other militancy related incidents in Valley. Police today arrested 2

arms smugglers and ISI activist and remaining consignment of RDX in Akhnoor. One person was killed

in Pak shelling in Kargil on Srinagar-Kargil highway, one militant was killed in an encounter at Khari

Marg (Rajouri).

Aug 24: Army killed 2 foreign mercenaries in an encounter at Bothal Ghai, Rajouri while 2 infilitrators

were killed and 3 nabbed in RS Pura sector. Two brothers were injured in a blast at Dalal (Poonch).

Aug 25: Security forces eliminated 5 mercenaries in Rajouri and Poonch districts while 1 cop and 1

civilian were killed and 5 injured in these operations. Militants shot down a constable and army source in

Kashmir valley and injured 2 BSF cops and 11 civilians in a blast in Anantnag. SOG, RR also raided the

residence of an under secretary in Home department and demanded Pakistani weapon which as per their

version was in possession of her brother.

Aug 26: Militants gunned down an ex-serviceman, police cop and a civilian and injured 7 persons

including security personnel in different militancy related incidents in Kashmir valley. Army and SOG

killed 2 more militants in Poonch district. Army recovered arms including anti-tank mine in Akhnoor

sector. Senior Hurriyat leaders were put on house arrest for anti-election campaign.

Aug 27: Security forces eliminated 8 militants in a fierce encounter at Gopalpora (Anantnag) while 4

persons were injured in a grenade explosion in Srinagar city. Army gunned down 2 mercenaries in

Jhangar, Nowshera in Rajouri district.Militants kidnapped and later killed a police constable at Gurnal

(Banihal).

Aug 28: Militants killed a civilian and a counter insurgent while forces eliminated 3 militants in Kashmir

valley. Meanwhile, a civilian and 1 RR jawan were killed in Gopalpora encounter 1 army jawan was

killed in Pak firing in RS Pura sector.

Aug 29: In their anti-poll campaign militants launched their attack on NC and PDP in Anantnag district



killing PDP activist and injured many others. Militants also killed an army source and injured 6 television

crew members in Srinagar city. Two women were killed in an explosion at Bhatti Mohalla (Doda) while a

civilian was at Gulhati (Rajouri).

Aug 30: Security forces gunned down 9 foreign militants at Astanwari forest in Kupwara district losing a

major and a jwan. Militants ambushed a vehicle and killed 4 police personnel at Sheerabad, Baramulla.

Elsewhere in Valley militants gunned down 5 persons including 3 counter insurgents. 1 militant was

killed and a civilian injured in Doda district while a tragedy was averted by timely detection of IED on

National Highway at Ramban.

Aug 31: Security forces eliminated 8 militants-6 in Nowgam sector and two in Lolab valley-while a

soldier was killed in Nowgam operation and a surrenderd militant and 3 civilians were killed by militants

in Kashmir valley. Militants attacked police posts in Doda district. Delhi police arrested 2 Kashmiri

militants and recovered 10 kg RDX from them in Delhi.

Sep 1: Army foiled an attempt of ISI to disrupt poll process by eliminating 8 infiltrating mercenaries at

Rani post in Poonch district. 2 RR jawans and a civilian were killed in an encounter at Chatla, Doda.

Troops eliminated a mercenary in Lolab, Kupwara while militants killed a woman in Bandipora and a

civilian was killed in cross firing in Handwara.

Sep 2: BSF killed 4 militants in two different encounters at Kalaban and Mandi forests in Poonch district

while bid to blow a Gurdwara and a school in Rajouri district was foiled by timely detection of IEDS. In

Kashmir valley 9 persons including 2 army personnel, 1 BSF jawan, 2 militants and a NC activist were

killed in militancy related incidents.

Sep 3: An army prsonnel and a militant were killed in different incidents in Poonch district while a bomb

was neutralised in Surankot area. A handicapped young girl was molested and later killed by militants in

Rajouri district. Militants continued their attacks on mainstream politicians to intimidate people for poll

boycott. Meanwhile, Farooq Abdullah vowed to crush the militancy as army in now back to take on

militants.

Sep 4: A BSF cop was killed by a group of 3 militants who stormed an office complex in Handwara and

later were killed by para troopers. In other militancy related incidents 6 militants were eliminated while

militants launched pre-poll attacks on various places including MLAs hostel across Kashmir valley. Army

avoided major tragedy by timely detection of 6 IEDs’ on Rajouri-Darhal road. Militants gunned down 2

civilians, one each in Rajouri and Doda district. Valley observed a near total bandh in response to

Hurriyat call to oppose elections.

Sep 5: 3 militants were killed in Kashmir valley while a youth was shot dead by militants in Banihal.

Indian Army destroyed a Pak ammunition dump in Turtuk sector in relations to Pak shelling.

Sep 6: 4 militants were eliminated by forces in Rajouri, Udhampur and Doda districts while a youth was

kidnapped by militants in Ramban area. 2 militants were killed by ITBP in Kokernag area while a civilian

was killed by militants in Bandipore. Meanwhile, an army Havaldar died accidently in Jammu region and

a JCO gunned down 2 colleagues in Kupwara district.

Sep 7: Militants eliminated BJP’s Anantnag candidate Hyder Noorani along with another activist and

driver in a landmine at Thajiwara (Kanelwan) while 5 persons-1 soldier, 1 militant and 3 civilians were

killed in other militancy related incidents in Valley.

Sep 8: 12 persons-8 militants, 3 ex-militants, 1 army havaldar were killed in militancy related incidents in

Kashmir valley. While 2 militants were killed and 2 army jawans injured in Jammu region. Army also

recovered 24 kgs of explosives from Chandi Marh (Poonch).

Sep 9: 11 BJP workers and 2 cops were injured when militants attacked a campaigning vehicle in Doda

town. Security forces eliminated 3 militants, including dreaded Moosa Talibani alias doctor of Pakistan,

at Sabjan (Rajouri). Militants gunned down 3 persons includinjg a SPO in Kashmir valley. Pak intruders

killed 2 army jawans and injured 14 others in Hiranagar area.

Sep 10: While former Union State Home Mminister Mr Maqboor Dar escaped unhurt in militant attack,

militants gunned down a Congress activist and security forces eliminated 4 militants in Kashmir valley.

Militants attacked a police post set up for safe guard of minority community at Kashihama (Baramulla)

and escaped with police weaponry. Security forces killed 2 infilitrators and recovered 40 kg RDX in



Rajouri sector. Security forces recovered 3 AK-47 rifles and other ammunition in Hiranagar sector. A

militant’s hideout was destroyed by RR in Banihal (Doda).

Sep 11: 7 persons-2 RR jawans, 3 militants, 1 army source and a civilian woman-were killed in militancy

related incidents in Kashmir valley. 2 Pak intruders were killed by forces in Ramgarh sector while

Tahreek Jehad Islami province chief Shikara was killed at Nadyali (Surankot) and 1 SPO was killed by

militants at Nalthi-Seoj Dhar (Bhadarwah).

Sep 12: 3 person including a counter insurgent were killed by militants in Kashmir valley while militants

attacked RR camp Budgam. 5 Pak army intruders were eliminated by BSF and 4 others were injured in

Chhamb sector.

Sep 13: Militants made unsuccessful attempt on life of Mustafa Kamal, Mufti Mohd Sayeed, Mehbooba

Mufti and Javed Shah while 9 security persons and party activists were injured in these attacks. Militants

killed chief election agent of Azad Nabi contesting from Anantnag along with his sister-in-law, while a

village headman was injured at Hardpora (Anantnag). Militants also killed a former JKAP constable.

Police arrested 2 absonconding Pakistanis in Hiranagar while Kashmiri militants who had come on rescue

mission managed their escape-3 BSF jawans were injured when they killed a Pak intruder and injured

other 2 Ramgarh sector. Militants fired rockets on Budhal town killing a civilian at bus stand Budhal.

Sep 14: Militants killed 2 persons in Tral area and launched a rocket attack on BSF camp. Militants shot

dead a civilian at Basoi Dhok in Budhal (Rajouri) while an army camp and Lance Naik were reportedly

killed in an encounter with militants in Poonch district.

Sep 15: 2 militant and 7 civilians were killed when the militants were preparing an IED which blasted in

the house at Pahaldaj (Handwara). 6 more militants were killed in different encounters in North Kashmir

while militants killed 2 civilians and injured 27 CRPF men in a blast at Sopore. Pakistan again targetted

Pallanwala and 2 civilians were killed in Pak firing

1111111133333333 TTTTTTTTHHHHHHHHOOOOOOOOSSSSSSSSEEEEEEEE WWWWWWWWHHHHHHHHOOOOOOOO LLLLLLLLEEEEEEEEFFFFFFFFTTTTTTTT UUUUUUUUSSSSSSSS

Kashmir Sentinel and Panun Kashmir Foundation mourn their sad demise and pray for the peace to the

departed souls.

1. Sh Shamboo Nath Mattoo, R/o 81-Mandir Bagh Gowkadal Srinagar; presently at 59-A Pamposh

Shalimar Garden Ext-II Sahibabad. 30/8/99

2. Sh. Raj Rani Parimoo W/o Late Sh Arjan Nath Parimoo, R/o Badiyar Balla. 1/9/99

3. Pt. Prem Nath Shastri C/o Vijeyshwar Parivar Ajit Colony Gole Gujral Jammu. 26/8/99

4. Smt. Kamlawati Gurtoo W/o Sh Raghunath Gurtoo, R/o Badiyar Payeen Sgr; presently at 151-B, Ram

Vihar Old Janipur, Jammu. 3/9/99.

5. Smt Soomawati Raina W/o Late Sh Amarnath Raina, R/o Village Akoora Mattan, Kmr; presently at

116 MLA’s Hostel Old Block, Jammu. 5/9/99.

6. Sh Kashi Nath Bhat, R/o 149 Sathu Payeen Barbarshah. 31/8/99

7. Sh. Mahadev Lal Kher, R/o Achan, Verinag; presently at 8A Hydel Society Sector-46, Faridabad.

1/9/99.

8. Sh Kashi Nath Tickoo S/o Late Sarwanand Tickoo, R/o Habba Kadal, Sgr; presently at D/239 Lower

Shiv Nagar behind AG’s Office, Jammu. 16/9/99

9. Smt Arandati Nagri W/o Late Sh Raj Nath Nagri, R/o Karfali Mohalla Habba Kadal, Sgr; presently at

Sector-15 Block No: 10 Sarwal, Jammu. 3/9/99

10. Sh Gopi Nath Pandit S/o Late Shivjee Pandit, R/o Fatehpora, Anantnag; presently at Jawahar Nagar,

Udhampur. 2/9/99

11. Sh Shyam Lal Bhan, R/o Chinkral Mohalla, Sgr; presently at A-405 Gitanjali Aptt. Delhi-92. 2/9/99

12. Sh. Omkar Nath Pandita (Retd. Senior Lecturer), R/o Kachwa Muquam (Baramulla) at present 470,

Phase Ist Muthi Camp Jammu. 7/9/99.

13. Sh Triloki Nath Parimoo S/o Late Sh Tarachand Parimoo, R/o Houe No: 218, Police Lines

Udhampur. 8/9/99.

14. Sh Shamboo Nath Koul S/o Late Kantha Koul, R/o Village Salia District Anantnag; presently at Qtr.

No: 628 (Jhiri Phase) Nagrota Migrant Camp. 8/9/999



15. Smt. Kamlawati W/o Late Anandji Bachloo, R/o Battapora Sopore, presently at Laxmi Puram Sector

B-1, Chinore, Bantalab. 9/9/99

16. Sh. Shyam Lal Thusoo, R/o Golaingoo Kupwara; presently at Q.No: 560 Block-F, Mishriwala Camp,

Jammu. 8/9/99

17. Smt Shyam Rani Dhar W/o Sh V.N. Dhar, R/o Tullamulla Ganderbal, Sgr; presently at K.B. Nagar,

Bantalab, Jammu. 10/9/99.

18. Sh Niranjan Nath Koul S/o Late Sh Keshav Nath Koul, R/o Rainawari, Sgr; presently at 45-B,

Bhawani Nagar, Talab Tillo, Jammu. 10/9/99

19. Pt. Soom Nath Koul S/o Late Sh Dina Nath Koul, R/o Kharyar IInd Bridge Srinagar, presently at

Bhagwati Nagar, Sector-1, Canal Road, Jammu. 12/9/99.

20. Smt. Shobawati Bhat W/o Late Sh Raghunath Bhat, R/o Purshyar Habba Kadal Srinagar; presently at

537-A Colnol’s Colony Bohri, Jammu. 12/9/99

21. Smt. Roop Rani Koul W/o Late Amarnath Koul, R/o Bul Bul Lanker Srinagar; presently at 666-A,

Talab Tillo, Near Jain Colony, Jammu. 12/9/99.

22. Pt Kashi Nath Bhat, R/o Tulmula; presently at 237/3 Anderaws Ganj New Delhi. 12/9/99.

23. Smt. Rupawati Raina W/o Sh. Swarup Nath Raina, R/o Budhmulla-Baramulla; presently at 303

Sector: 9, Faridabad. 11/9/99

24. Smt. Kamla Zutshi W/o Sh Gopi Nath Zutshi, R/o Karafeli Mohalla Sgr; R/o Vikas Lane Lane No: 1,

Shakti Nagar, Jammu. 15/9/99.

25. Sh. Shakti Magazine W/o Late Shivjee Magazine, R/o 17-B, Shastri Nagar, Jammu. 12/9/99.

26. Sh. Pitamber Nath Moza S/o Shiv Jee Moza, R/o Mattan District Anantnag, Kmr; presently at Sharda

Colony Patoli Brahman, Akhnoor Road, Jammu. 14/9/99

27. Smt. Mohini Lahori W/o Sh. Sham Sunder Lahori, R/o Batapora, Shopian; presently at 138-H. Sector-

1, Durga Nagar, Jammu. 19/9/99.

28. Pt. Jia Lal Koul (Katal), R/o Karapora Khushki, Rainawari, Sgr; presently at Govindpura Pir Baba

Morh Chatta, Jammu.

29. Smt. Poshkuj W/o Late Shamboo Nath Pandita, R/o Lok Bhawan (Larkipora) Anantnag; presently at

Nagrota Camp (Qtr. No: 264/265), Jammu. 20/9/99

30. Sh Jia Lal Koul S/o Late Sh Narayan Koul, R/o House No: 105, Lane-4, Anand Nagar Bhori, Talab

Tillo, Jammu. 23/9/99.

31. Sh. Brij Mohan Koul (Pehelwan), R/o Safapora; presently at House No: 215, Sector: 5, Trikuta Nagar,

Jammu. 22/9/99.

32. Smt. Shobawati Gurtoo W/o Late Radha Krishen Gurtoo, R/o Badiyar Payeen Nai Sarak, Sgr;

presently at 151-B, Ram Vihar Old Janipora, Jammu. 24/9/99.

33. Sh. Ashok Koul S/o Late Sh T.N. Koul, R/o Karapora Khushki Rainawari; presently at Qtr. No: 152B,

Lawan Marg, Institutional Area, Jhalana Dungri, Jaipur. 25/9/99.

34. Sh. Shiban Lal Koul S/o Sh. Lassa Koul, R/o Chandergund, Shopian, Kashmir. 23/9/99.

35. Smt Roopaji (Choti) W/o Late Sh Brij Nath Pandita (Bagh), R/o Nowgam Achabal; presently at Qtr.

No: 252, Nagrota Camp, Jammu.

36. Sh. Shyam Lal Mussa, S/o Late Sh Tikka Ram Mussa, R/o Mattan, Kashmir; presently at Ploura,

Jammu. 26/9/99.

37. Sh. Ashok Raina S/o Late Dina Nath Raina, R/o Trisal Pulwama, presently at H.No: 422, Sector: 2,

Vinayak Nagar, Muthi, Jammu. 25/9/99.

38. Sh. Radha Krishen Raina, R/o Batpora, Kanihama Magam; presently at Shastri Niwas No: 15,

Rajpora, Shakti Nagar, Jammu. 26/9/99

39. Sh. Shiv Jee Bhat (Gusani) S/o Late Pt. Lassa Bhat, R/o 110-Lal Mandi Srinagar. 28/9/99.

40. Smt. Chand Rani Handoo W/o Shri H.No: Handoo, R/o Khah Bazar Anantnag; presently at 18-B,

Gandhi Nagar, Jammu. 28/9/99



AA PPaannuunn KKaasshhmmiirr PPuubblliiccaattiioonn (( hhttttpp::////PPaannuunnKKaasshhmmiirr..oorrgg ))

oct1-15-1999.pdf - Panun Kashmir

Documents

Transcript of oct1-15-1999.pdf - Panun Kashmir