Mycobiota, Total Aflatoxins and Ochratoxin A of Cardamom Pods

Food Science and Technology Research, 24 (1), 87_96, 2018Copyright © 2018, Japanese Society for Food Science and Technologydoi: 10.3136/fstr.24.87

http://www.jsfst.or.jp

*To whom correspondence should be addressed. E-mail: [email protected]

Original paper

Mycobiota, Total Aflatoxins and Ochratoxin A of Cardamom Pods

Youssuf Gherbawy1,2* and Yassmin Shebany

1,2

1Biological Sciences Department, Faculty of Science, Taif University, Taif, Saudi Arabia2Botany Department, Faculty of Science, South Valley University, Qena, Egypt

Received April 27, 2015 ; Accepted September 16, 2015

Cardamom is added to Arabic coffee the most popular drink in Saudi Arabia, and used as an food additives in many dishes in Saudi kitchen, the mycological profile and mycotoxin contaminated of cardamom selling in different markets in western region (KSA) was studied. Using morphological criteria and internal transcribed space (ITS) region sequencing, 23 species belonged to 11 fungal genera were identified from 80 cardamom samples collected from the western region of Saudi Arabia. Aspergillus was the most common genus, followed by Penicillium and Cladosporium then Mucor. Total aflatoxins (AFs) was the predominant mycotoxins contaminating almost 67.5% of cardamom samples. While ochratoxin A (OTA) was found in 47.5% of the samples notably, 36.3% of them were contaminated with both AFs and OTA. The mean concentration of AFs and OTA in cardamom samples ranged from 42.7 to 164.7 ppb and from 30 to 78 ppb, respectively. Total aflatoxins and ochratoxin A potentials of the collected isolates of Aspergillus flavus, A. parasiticus, Aspergillus niger, A. ochraceous, Penicillium citrinum and P. verrucosum were detected. The species-specific primers for A. flavus (FLA1 and FLA2) and A. niger (ITS1 and NIG) were used to detect directly the contaminations of cardamom samples.

Keywords: aspergilli, enrichment, flourometer, PCR, spices

IntroductionElettaria cardamomum (the usual type of cardamom) is used as

a spice, a masticatory, and in medicine; it is also smoked sometimes. In Saudi Arabia, green cardamom powder is used as a spice for sweet dishes as well as traditional flavouring in coffee and tea. Cardamom pods are ground together with coffee beans to produce a powdered mixture of the two, which is boiled with water to make coffee. The countries in the western Asian region like Saudi Arabia, United Arab Emirates, and India have maximum consumption and these countries share around 60% of the world’s consumption (Chempakam and Sindhu, 2008).

Because of their tropical origin, and the methods used in their production, spices are frequently heavily contaminated with xerophilic fungi (Hocking, 1981; Pitt and Hocking, 2009). Aspergillus, Eurotium and Penicillium species are often the dominant flora of dried, whole or ground spices (Pitt and Hocking,

2009). Mycobiota of cardamom were studied in several places around the world (Hocking, and Pitt, 1988; E1-Kady et al., 1992; Banerjeea et al., 1993; Elshafie et al., 2002; Moorthy et al., 2010; Sumanth et al., 2010). Spices are largely produced in countries where tropical climates (high ranges of temperature, humidity and rainfall) are favorable to mycotoxins contamination (Hussain, et al., 2012). Furthermore, they are usually dried on the ground in the open air in poor hygienic conditions that even more promote growth of moulds and production of mycotoxins (Martins et al., 2001).

Afla toxins are toxic , mutagenic , carc inogenic and immunosuppressive agents, produced as secondary metabolites by the fungus A. flavus and A. parasiticus on a variety of food products. While ochratoxin A is reasonably anticipated to be a potent nephrotoxin in animals as well as in humans. Several works have been publ ished around the world focused on the

Y. Gherbawy & Y. Shebany88

contamination of different species with Aflatoxins (Aziz et al. 1998; Martins et al., 2001; Fazekas et al. 2005; Zinedine et al., 2006; Romagnoli et al., 2007) and ochratoxin A (Thirumala-Devi et al., 2001; Taniwaki et al., 2003).

In Saudi Arabia, two extensive studies (Bokhari, 2007; Hashem and Alamri, 2010) discussed the contamination of different kind of species with fungi and their toxins. None of those studies focused on cardamom and used molecular techniques in fungal identification and toxin detection. Therefore the aims of this work were : To determine the occurrence and load of fungi, the important foodborne pathogens, in particular, in cardamom offered for sale to consumers in the retail stores at Western region in Saudi Arabia; to analyze specifically the occurrence of Aspergillus section Flavi and Nigiri in these samples; to investigate the occurrence of aflatoxins and ochratoxin A using fluorometer technique; and to testing more reliable methods for detecting Aflatoxins - and ochratoxin A- producing fungi in the samples of cardamom directly.

Materials and MethodsSamples A total of 80 cardamom samples were collected from

different retailers agencies in the spice market of the western region of Saudi Arabia (Taif, Makkah, and Jeddah) during the months January and June 2014. Each sample was put into the sterile cellophane bag and then put into the sterile brown envelope and stored at 4℃ .Cardamom samples were usually found outside, kept in metal or plastic containers, wooden boxes or gunny bags.

Mycobiota determination Mycobiota of the collected samples was isolated by Agar Plate Method used Potato Dextrose Agar (PDA) supplemented with 0.5 mg Chloramphenicol /mL antibiotic is used to inhibit the bacterial growth (Hashem and Alamri, 2010). Five replicates were made and the plates were incubated at 25℃ for 5-7 days. The fungal species were identified and characterize based on their morphological characters and microscopic analysis by using taxonomic guides and standard procedures (Neergaard, 1973; Watanabe, 2002; Pitt and Hocking, 2009). The relative importance values (RIV) were calculated for each fungal species (Ali-Shtayeh et al., 1988).

Molecular identification of fungal isolates For DNA extraction, all the collected fungal isolates cultivated in tubes on PDA slants. Two ml of potato dextrose broth (PDB) poured into PDA tubes and vortexed to disperse the spores, and the spores-PDB mix poured into flasks containing 100 mL of PDB. Flasks incubated at room temperature without shaking for 2 to 3 days. The mycelium harvested by filtration, frozen at −80℃ during 30 min, lyophilized and stored at −80℃. The mycelium ground in liquid nitrogen in a sterile mortar to obtain a mycelium powder. The DNA extracted from 20 mg of mycelium powder using DNeasy plant mini kit. The DNA quantity and quality checked by electrophoresis on a 0.8% agarose gel revealed with ethidium bromide and visualized by UV trans-illumination. The internal transcribed

spacer (ITS) region of the ribosomal DNA (rDNA) amplified by PCR with the primers ITS1 (CTTGGTCATTTAGAGGAAGTAA) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al., 1990; Gardes and Bruns, 1993). PCR amplifications performed in a final volume of 50 μL by mixing 2 μL of DNA with 0.5 μM of each primer, 150 μM of dNTP, 6 U of Taq DNA polymerase and PCR reaction buffer. Amplification conducted in a thermal cycler with an initial denaturation of 3 min at 94℃, followed by 35 cycles of 1 min at 94℃, 1 min at 50℃, 1 min at 72℃, and a final extension of 10 min at 72℃. Aliquots of PCR products checked by electrophoresis on a 1% agarose gel revealed with ethidium bromide and visualized by UV trans-illumination. The PCR products sequenced using primers ITS1-F and ITS4. For each PCR product, sequences from both strands were assembled to produce a consensus sequence. Sequences were submitted to GenBank on the NCBI website (http://www.ncbi.nlm.nih.gov). Sequences obtained in this study were compared with the GenBank database using the BLAST software on the NCBI website (http://www.ncbi.nlm.nih.gov/BLAST/).

ITS sequence and phylogenetic analysis DNA sequences were aligned first with Clustal X 1.81(Thompson et al., 1997). TREECON (Van De Peer and De Wachter, 1994) for Windows (version 1.3b, 1998) was used to construct a neighbor-joining tree using Jukes-Cantor model (Jukes, and Cantor, 1969).

Detection of the natural occurrence of Aflatoxins Detection of total aflatoxins in cardamom samples were carried out according to VICAM Procedure (VICAM inc. 1999). Three replicates of each cardamom flour sample, equivalent to 50 g dry matter, were blended with 5 g of sodium chloride and 100 mL mixture of methanol and water (8:2 v/v) at high speed for 1 min using a blender. The mixture was filtered through fluted filter paper (Whatman 2 V, Whatman, Middlex). The filtrate (15 mL) was diluted (1:4) with distilled water, re-filtered through glass microfibre filter paper (Whatman, Middlex, UK). The filtrate (10 mL) was passed through an aflatest immunoaffinity columns (VICAM, Watertown, MA, USA) at a rate of 1-2 drops/second. Distilled water (10 mL) was passed through the column at 1-2 drops/second and repeated once more until no bubbles come through the column. Toxins were eluted from the columns with 1 mL HPLC grade methanol at the rate of 1-2 drops/second into a glass cuvette, mixed with freshly made 1 mL aflatest developer and its fluorescence measured in a precalibrated flourometer (VICAM V1 series 4, VICAM, Watertown, MA). LOD was interpolated at 1.0 µg/kg.

Detection of natural occurrence of Ochratoxin A. Ochratoxin A was measured using ochraprep immunoaffinity column procedure. Ten ml of diluted extract through the ochraprep immunoaffinity column was passed at a rate of about 1–2 drops/s, followed by column washing by buffer solution and 1.5 mL of ochratoxin elution solution through the ochraprep column at a rate of 1 drop/s. The collected sample eluted (1.5 mL) in a glass cuvette,

Mycobiota, Aflatoxins and Ochratoxin A in Cardamom 89

mixed well and placed the cuvette in a calibrated fluorometer and ochratoxin concentration was measured after 60 s.

Determination of toxigenic potential of fungi Aspergillus flavus and A. parasiticus are the most important species producing aflatoxins. Also, members of Aspergillus niger, A. ochraceus, Penicillim citrinum and P. verrucosum were reported previously as ochratoxin producers. So, Aflatoxin- and ochratoxin A- producing abilities of the above-mentioned species were performed by cultivating the fungal strains in Czapek Yeast extract agar (Ben Fredj et al., 2009) medium for 5 days at 25 ± 2℃. Three replications were maintained for each isolate. Total AFs and OTA were extracted by grinding the moldy agar (20 g) in warring blender for 5 min with methanol (100 mL) containing 0.5% NaCl and the above mentioned procedures were applied.

Molecular detection of mycotoxigenic fungi in cardamom samples Fungal DNA was isolated from cardamom samples by enrichment technique. One gram of the sample was cultured in Erlenmeyer flasks containing 50 mL of Potato Dextrose Broth tubes (PDB), which were incubated at 30℃ for 24 h in an orbital shaker (140 rpm). DNA extraction was carried out starting from 200 mg of filtered culture frozen with liquid nitrogen and ground using a mortar and a pestle. All extractions were carried out in triplicate. Elution was carried out in one step adding 100 μL of elution buffer (TE).

Aspergillus flavus Specific PCR assays were carried out using the primers FLA1 (5′-GTAGGGTTCCTAGCGAGCC-3′) and FLA2 (5′-GGAAAAAGATTGATTTGCGTTC-3′) for A. flavus. The PCR amplification protocol for A. flavus was as follows: 1 cycle of 5 min at 95℃, 26 cycles of 30 s at 95℃, 30 s at 58℃, 45 s at 72℃ and, finally, 1 cycle of 5 min at 72℃. PCR products were separated on a 1.3% (wt/vol) agarose gel, stained with ethidium bromide, the positive samples for Aspergillus flavus showed 500 bp size PCR products (González-Salgado et al., 2005a).

Aspergillus niger PCR assays were carried out using primer ITS1 (5′-TCCGTAGGTGAACCTGCGG-3′) in all cases combined with a species-specific primer: NIG (5′- CCGGAGAGAGGGGACG GC-3′) for A. niger The PCR amplification protocol used for A. niger was as follows: 1 cycle of 4 min 30 s at 95℃, 25 cycles of 30 s at 95℃ (denaturalization), 25 s at 66℃ (annealing), 40 s at 72℃ (extension) and finally 1 cycle of 5 min at 72℃. Amplification reactions were carried out in volumes of 25 μL containing 3 μL of template DNA, 1.25 μL of each primer (20 μL), 2.5 μL of 10· PCR buffer, 1 μL of MgCl2 (50 mM), 0.25 μL of dNTPs (100 mM) and 0.2 μL of Taq DNA polymerase (5 U/μL). PCR products were separated in 2% agarose ethidium bromide gels in 1 X TAE buffer (Tris acetate 40 mM and EDTA 1.0 mM). The DNA ladder 100 bp was used as molecular size marker and the positive sample for A. niger showed 420 bp PCR product (González-Salgado et al., 2005b).

Results and DiscussionMycobiota of cardamom samples Twenty-three species

belonged to 11 genera were collected from the different cardamom samples and identified from their morphological criteria and ITS sequence (Table 1 & Fig. 1). Sequences were submitted to GenBank on the NCBI website (http://www.ncbi.nlm.nih.gov). The sequence results were deposited in GenBank under accession numbers from LN835252to LN835274.

The average total counts of the collected fungi were 2.836X103 CFU (Table 1). In Egypt, E1-Kady et al. (1992) reported that the total average counts for fungi isolated from cardamom were 606.4.

The collected fungi belonged to six fungal orders (Eurotiales, Hypocreales, Sordariales, Capnodiales, Pleosporales and Mucorales). From order Eurotiales 11 species (8 aspergilli and 3 penicilli) were collected (Fig. 1). Aspergillus was the most common genus in the different cardamom samples tested. The genus was represented in 98.75% of the samples constituting 58.74% of the total count of fungi, and had RIV of 157.49. From Saudi Arabia, Aspergillus was contaminating all nut and dried fruit samples contributing 82% and 61.1% of the total fungal counts on DRBC and DG18 respectively (Alhussaini, 2012). Aspergillus flavus and A.niger were the most prevalent, they emerged from 95% and 90% of the samples, which comprising 29.97% and 25.74% of total fungi, and had RIV of 124.97 and 115.74, respectively. From Aspergillus 6 species (A. candidus, A. chevalieri, A. ochraceous, A. parasiticus, A. repens and A. terreus) were isolated in low or rare frequency of occurrence. In the Sultanate of Oman A. niger isolated with 65.9 CFU / g from 3 cardamom samples (Elshafie et al., 2002). From 5 samples of cardamom were collected from Jeddah (Saudi Arabia), Bokhari (2007) isolated Aspergillus flavus, A. niger, A. terreus and versicolor with average total counts ranged from 1.8 to 430.6 colony/ g. Four different aspergilli (Aspergillus niger; A. flavus, A. caespitosus and A. terreus) were isolated from green cardamom from three locations (Karur, Namakkal and Erode) in India from December 2009 to January 2010 (Sumanth et al., 2010). Recently Aspergillus parasiticus, A. niger, A. flavus and A. ochraceus were isolated from cardamom from India (Jeswal and Kumar, 2015).

Penicillium was isolated in a high frequency of occurrence which accounting 81.25% of the samples and 22.12% of total fungi and had RIV of 103.37. It was represented by 3 species (P. chrysogenum, P. citrinum and P. verrucosum) of which P. chrysogenum was the most prevalent which recovering from 65% of total samples and comprising 18.76% of total fungi. Also, Bokhari (2007) isolated Penicillium chrysogenum and P. verrucosum from 100 and 60% of cardamom samples collected from Jeddah, respectively. Penicillium brevicompactum was the only Penicillium species isolated from 10 samples of green cardamom in Aseer region (Hashem and Alamri, 2010). From India Penicillium citrinum and P. verrucosum were isolated from green cardamom, their average total counts were 1.8X102 and 2.2X102 CFU/g with incidences percentage 3.6 and 3.8% incidences, respectively (Jeswal and Kumar, 2015).


Cladosporium (represented by C. chadosporioides and C. herbarum) and Mucor (represented M. heimalis and M. racemosus) were recovered in moderate frequency which constituting collectively 8.4% of total fungi. The incidences of Cladosporium cladosporidies was 30% from Indian cardamom (Sumanth et al., 2010) while on another study in cardamom from India Cladosporium fulvum and C. oxysporum were the only Cladosprium spp. contaminated the investigated samples (Ramesh and Jayagoudar, 2013). The incidences of Mucor heimalis was 3.6% of total cardamom samples instigated in India (Jeswal and Kumar, 2015).

The remaining genera and species (Alternaria alternata, Chaetomium globosum, Curvularia lunata, Fusarium oxysporum, Phoma herbarum, Rhizopus oryzae, Rhizopus stolonifer and Syncephalastrum racemosum) were isolated with low frequency and total counts as represented in table 1. The above mentioned species were previously isolated from cardamom and other species by several researchers with different incidences (Chourasia, 1995;

Elshafie et al., 2002; Pitt and Hocking, 2009; Mezeal and Alwaan, 2015).

Natural occurrence of Aflatoxins and ochratoxin A in cardamom samples From eighty samples were tested to contaminate with aflatoxin or ochratoxin A, 64 samples (80%) contaminated with aflatoxin or ochratoxin A (Table 2). Fifty-four samples (67.5%) contaminated with aflatoxins, while 38 samples (41.3%) only appeared contaminate with ochratoxin A. Twenty-nine samples (36.3%) showed co-occurrence of aflatoxins and ochratoxin A. The total aflatoxins and ochratoxin A in the investigated samples ranged from 42.7 to 164.7 ppb and from 30 to 78 ppb, respectively (Table 2). In cardamom samples collected from India, 18 out of 25 samples (72%) 9 samples (36%) were positive in terms of AFs (Average amount 158 ppb) and OTA (68 ppb) detection, while 9 samples showed co occurrence of AFs and OTA (33). Prelle et al. (2014) studied the co- occurrence of aflatoxin and ochratoxin A in spices commercialized in Italy. His results indicated that 57.1% of black pepper, 34.2% of turmeric,

Fig. 1. Phylogenetic tree based on the internal transcribed spacer (ITS) region of rRNA showing closest relatives of fungal species isolated from Cardamom. The tree was constructed by neighbour-joining algorithm using maximum composite likelihood model. Bootstrap percentages from 100 replicates are shown (lower 70% not shown). The tree was rooted with Tilletia horrida [AY560653] as the out-group.


36% of green cardamom, 24% of fennel and 60% of mace samples were contaminated with aflatoxins as well as ochratoxin A. Also, he reported that in all the spices, aflatoxins contamination was higher then ochratoxin A except in turmeric. 51.4% of turmeric was ochratoxin A contaminated whereas only 34.2% were aflatoxins contaminated. For instance, the maximum tolerable limit for (AFs) allowed in spices in EU member state has been set at 10 μg/kg for total AFs (Commission Regulation (EC) 2006). Legal limits for ochratoxin A is 3 μg/kg for all products derived from cereals (including processed cereal products and cereal grains intended for direct human consumption) set by the European Commission (European Commission. Commission Regulation (EC) No 123/2005). Several researchers studied the natural occurrence of mycotoxins in spices (Aziz et al., 1998; Martins et al., 2001; Thirumala-Devi, et al., 2001; ; Taniwaki et al., 2003; Fazekas et al., 2005; Zinedine et al., 2006; Romagnoli et al., 2007Bokhari,

2007; Hashem and Alamri, S. 2010; Hammami et al., 2014; Gherbawy et al., 2015).

Aflatoxins and ochratoxin A potentials of isolated fungi The collected isolates of fungi that belonged to Aspergillus flavus (76 isolates) and A. parasiticus (7 isolates) were screened for their abilities to produce AFs, while isolates of Aspergillus niger (72 isolates), A. ochraceus (9 isolates), Penicillim citrinum (11 isolates) and P. verrucosum (9 isolates) were screened for OTA production (Table 3). From 76 isolates of A. flavus only 58 isolates were AFs producers, and their production ranged from 5.4 – 35.5 µg/L, while from one isolate out of 7 isolates of A. parasiticus was AFs producer (3.2 µg/L). The sclerotial and nonsclerotial isolates of A.flavus from Alyssiearpus vaginalis and Aerva lanata produced AFB1 and occasionally AFG1 in liquid medium (Abeywickrama and Bean, 1991). Isolates of A. flavus isolated from different stages of developing cardamom produced aflatoxin B1 ranging from 100

Table 1 . Total isolates (TI, calculated per 1280 seeds), number of cases of isolation (NCI out of 80 samples), occurrence remarks (OR), percentage frequency (F%) and relative importance values (RIV) of various fungal genera and species isolated from cardamom samples on potato dextrose agar (PDA) at 28℃.

Fungal genera & species ATC C% NCI&OR F% RIV

Alernaria alternata 20 0 .71 9R 11 .25 11 .96Aspergillus 1666 58 .74 79H 98 .75 157 .49A. candidus 2 0 .07 1R 1 .25 1 .32A. chevalieri 32 1 .1 9R 11 .25 12 .35A. flavus 850 29 .97 76H 95 124 .97A. niger 730 25 .74 72H 90 115 .74A. ochraceus 15 0 .53 9R 11 .25 11 .78A. parasiticus 11 0 .39 7R 8 .75 9 .14A. repens 5 0 .18 2R 2 .5 2 .68A. terreus 21 0 .74 8R 10 10 .74Chaetomium globosum 36 1 .27 5R 6 .25 7 .52Cladosporium 100 3 .5 25M 31 .25 32 .59C. cladosporioides 38 1 .34 11L 13 .75 15 .09C. herbarum 62 2 .19 16L 20 22 .19Curvularia lunata 28 0 .99 6R 7 .5 8 .49Fusarium oxysporum 157 5 .53 16L 20 25 .53Mucor 139 4 .9 32M 40 44 .9M. heimalis 96 3 .39 29M 36 .25 39 .64M. racemosus 43 1 .52 20M 25 26 .52Penicillium 627 22 .12 65H 81 .25 103 .37P. chrysogenum 533 18 .76 52H 65 83 .76P. citrinum 33 1 .16 11L 13 .75 14 .91P. verrucosum 62 2 .19 9R 11 .25 13 .44Phoma herbarum 6 0 .21 13L 16 .25 16 .46Rhizopus 53 1 .87 8LR 10 11 .87R. oryzae 18 0 .63 5R 6 .25 6 .88R. stolonifer 35 1 .23 8R 10 11 .23Syncephalastrum racemosum 4 1 .09 3R 3 .75 4 .84

Total 2836 100

Occurrence remarks: High (H) = 40-80 cases (out of 80), Moderate (M) = 39-20 cases, Low (L) = 19-10 cases and Rare (R) = 1-9 cases.


Table 2 . Natural occurrence of total Aflatoxins (AFs) and Ochratoxin A (OTA) in 80 samples of cardamom.

Cardamom samples

AFs (μg/kg)Main ± SD

OTA (μg/kg)Main ± SD

Cardamom samples

AFs (μg/kg)Main ± SD

OTA (μg/kg)Main ± SD

1 74 .3±17 .7 ND 41 142 .0±2 .0 53 .2±2 .52 96 .7±2 .1 ND 42 162 .7±3 .1 ND3 ND ND 43 ND 47±3 .54 60 .3±4 .0 ND 44 118 .0±2 .0 63±2 .55 ND ND 45 132 .3±2 .5 74±2 .56 ND 35 .7±2 .5 46 144 .3±4 .7 59±5 .57 ND ND 47 92 .7±2 .5 62±3 .18 126 .0±1 .0 54 .3±2 .5 48 95 .5±2 .5 ND9 131 .0±1 .0 62 .0±2 .6 49 118 .0±2 .6 ND10 151 .0±1 .0 43 .7±1 .5 50 118 .0±2 .6 ND11 121 .0±1 .0 ND 51 ND 78±2 .212 149 .0±2 .1 ND 52 115 .5±2 .5 68±2 .513 ND ND 53 121 .7±1 .5 77 .0±2 .014 133±4 .0 68 .0±2 .0 54 ND 56 .6±2 .115 161±6 .3 66 .0±2 .0 55 97 .7±1 .5 66±4 .216 130 .6±1 .5 72 .7±1 .5 56 113 .7±1 .5 ND17 ND 302 .0±2 .0 57 122 .3±1 .5 ND18 123 .6±1 .5 ND 58 80 .7±4 .7 77 .0±2 .019 153 .3±2 .1 53 .3±3 .1 59 76 .0±1 .0 65±4 .520 138 .0±2 .1 62 .0±3 .0 60 ND 66 .0±2 .021 ND ND 61 ND ND22 130 .0±2 .0 74 .7±1 .5 62 ND ND23 139 .7±2 .1 52 .0±2 .0 63 ND ND24 126 .3±1 .5 42 .7±2 .5 64 ND ND25 162 .3±2 .5 64 .7±1 .5 65 64 .3±4 .7 ND26 ND ND 66 42 .7±2 .5 70 .7±2 .127 ND ND 67 ND 55 .0±1 .428 96 .3±2 .5 ND 68 57 .0±2 .0 57 .3±1 .529 124 .7±3 .1 ND 69 66 .3±2 .5 ND30 138 .3±0 .6 ND 70 70 .3±1 .5 ND31 164 .7±1 .5 ND 71 ND ND32 ND ND 72 ND ND33 115 .0±2 .0 ND 73 58 .3±2 .5 63 .7±1 .534 135 .7±1 .2 60 .3±3 .5 74 ND 53 .7±2 .535 129 .0±1 .0 64 .0±2 .0 75 ND ND36 ND ND 76 ND ND37 118 .3±2 .1 50 .7±2 .1 77 68 .7±13 .3 ND38 88 .0±1 .0 52 .3±2 .1 78 65 .3±1 .5 ND39 63 .0±54 .6 ND 79 ND 64 .0±2 .640 113 .0±0 .1 ND 80 44 .0±4 .0 ND

Total 59 (73 .8%) 33 (41 .3%)

Table 3 . Aflatoxins and Ochratoxin A potentials of fungal species isolated from cardamom

Fungal species Mycotoxins produced

No . of tested isolates

No . of positive isolates

Range (μg/L)Main ± SD

Aspergillus flavus AFs 76 58 5 .4±2 .5 to 35 .5±5 .6A. parasiticus AFs 7 4 3 .2±4 .2 A. niger OTA 72 32 2 .5±1 .5 to 8 . 5±2 .2A. ochraceus OTA 9 5 4 .5±3 .2 to 14 .5±4 .5Penicillim citrinum OTA 11 5 1 .3± 2 .4 to 2 . 5±2 .6 P. verrucosum OTA 9 6 3 .8±2 .4 to 17 .5±2 .2


to 3000 ng mL_1 medium (Banerjeea et al., 19993). Recently Jeswal

and Kumar (2015) analyzed 20 and 10 isolates of Aspergillus flavus and A. parasiticus isolated from cardamom for AFs and OTA productions. Their results indicated that nine isolates of A. flavus were aflaoxigenic, while none of A. parasiticus isolates showed the same potentials.

Thirty two isolates out of 72 (44.4%) and 5 isolates out of 9 (55.6%) of Aspergillus niger and A. ochraceous were OTA producers and their production ranged from 2.5 to 8.5 µg/L and

4.5‒14.5 µg/L, respectively. From Penicillium citrinum and P. verrucosum 5 isolates out of 11 (45.5%) and 6 out of 9 isolates (66.7%) were ochratoxigenic and their production ranges were 1.3‒2.5 and 3.8‒17.5 µg/L, respectively. Aspergillus niger (11.59%), and A. ochraceus (1.83%) were potential producers for OTA among the mycobiota isolated from raisins samples in Saudi Arabia (Gashgari et al., 2011). From Cardamom samples collected from India, the percentages of OTA producers among Aspergillus niger, A. ochraceous and P. verrucosum were 40%, 20% and

Table 4 . Average total counts (ATC) of Aspergillus flavus and A. niger in 80 cardamom samples and their molecular detection of with specific PCR primers.

Cardamom samples

A . flavus ATC

FLA1 / FLA2

A . nigerATC ITS1 / NIG Cardamom

samplesA . flavus

ATC FLA1 / FLA2

A . nigerATC ITS1 / NIG

1 15 + 8 + 21 23 + 18 +2 10 + 11 + 22 14 + 12 +3 0 - 12 + 23 9 + 8 +4 15 + 15 + 24 18 + 10 +5 10 + 0 - 25 14 + 12 +6 13 + 9 + 26 10 + 3 -7 3 - 13 + 27 0 - 11 +8 12 + 11 + 28 17 + 9 +9 18 + 10 + 29 11 + 11 +10 9 + 6 + 30 0 - 10 +11 16 + 9 + 31 6 + 21 +12 10 + 10 + 32 10 + 11 +13 13 + 10 + 33 13 + 13 +14 19 + 12 + 34 7 + 0 -15 12 + 0 - 35 11 + 10 +16 8 + 0 - 36 15 + 9 +17 14 + 10 + 37 15 + 13 +18 9 + 6 + 38 11 + 12 +19 14 + 8 + 39 17 + 10 +20 12 + 11 + 40 7 + 0 -41 16 + 8 + 61 6 + 13 +42 11 + 10 + 62 10 + 11 +43 5 - 7 + 63 17 + 8 +44 8 + 10 + 64 11 + 9 +45 6 + 0 - 65 10 + 17 +46 4 - 9 + 66 8 + 0 -47 12 + 3 - 67 12 + 5 -48 11 + 11 + 68 14 + 19 +49 9 + 8 + 69 10 + 11 +50 12 + 6 + 70 21 + 10 +51 10 + 9 + 71 5 - 21 +52 13 + 10 + 72 3 - 11 +53 11 + 4 - 73 10 + 8 +54 6 + 12 + 74 7 + 17 +55 10 + 10 + 75 13 + 0 -56 9 + 7 + 76 10 + 9 +57 13 + 7 + 77 11 + 13 +58 9 + 2 - 78 7 + 12 +59 0 - 0 - 79 8 + 10 +60 11 + 11 + 80 11 + 8 +


33.33%, respectively (Jeswal and Kumar, 2015), while their OTA potentials ranged from 2.4 – 9.8, 1.5 – 6.9 and 3.0 – 13.8 μg/L.

Molecular detection of mycotoxigenic fungi in cardamom samples All collected samples of cardamom (80 samples) were subjected to enrichment technique to isolate total genomic DNA of contaminated fungal species. The collected DNA samples were amplified using specific primer pairs according to the fungal species targeted for detection.

Detection of Aspergillus flavus DNA samples collected from cardamom samples were amplified by FLA1 and FLA2 primers for detecting the presence of Aspergillus flavus in the tested samples. Although Aspergillus flavus appeared in 76 samples but 71 samples only showed amplicons with specific primers (Table 4). On the other hand, Aspergillus flavus free samples (4 samples) did not show any PCR products. Also, 8 samples with average total counts of A. flavus less than 6 did not show any amplicons (Table 4).

FLA1 and FLA2 primer were designed by González-Salgado et al. (2005a) for detecting A. flavus in wheat flour. Those primers used based on the existing variability in the ITS region that appeared sufficient to discriminate among closely related species and provided a higher sensitivity than single copy genes. The PCR amplification product was clearly observed for wheat flour contaminated by 102 spores after 16 h of incubation (González-Salgado et al., 2005a).

Detection of Aspergillus niger Primer pairs ITS1 and NIG were used to detect the presence of Aspergillus niger in the DNA samples isolated from cardamom enrichment samples. Sixty-six samples showed PCR products indicated the contamination with Aspergillus niger while this species appeared in 71 samples of cardamom. Nine samples free from A. niger did not showed any PCR products with the specific primers. Although this species appeared in 71 samples, five samples did not show PCR products

Fig. 2. Agarose gel electrophoresis of PCR products of DNA fragments specific for Aspergillus flavus using FLA1 and FLA2 primers. Lane 1: Positive control; Lanes 2-11: DNA from cardamom samples numbers 1, 9, 11, 14, 17, 21, 24 , 37, 39 and 70, receptively. lanes 12-14 were cardamom samples numbers 2, 27 and 57 (free A. flavus cardamom samples). M: DNA marker.

Fig. 3. Agarose gel electrophoresis of PCR products of DNA fragments specific for Aspergillus niger. Lane 1: Positive control; Lanes 2-10: DNA from cardamom samples numbers 6, 8, 9, 18, 22, 26, 28, 36, 42 and 44, respectively. M: DNA marker


which could be attributed to the low-level count of this species in those samples (Table 4).

In conclusion, the studied cardamom samples show high contamination with aflatoxigenic and ochratoxigenic fungi. Also, these samples were naturally contaminated with aflatoxins and ochratoxin A. From the isolated fungi Aspergillus flavus, A. niger, A. ochraceus Penicillim citrinum and P. verrucosum showed different mycotoxin potentials. The molecular techniques were able to detect A. flavus and A. niger in cardamom samples without isolation of these species. Furthermore, such products should pass through strict quality control inspection before being channeled to consumers.

Acknowledgements This work was supported by a grant (Contract No. 3465 -435-1) sponsored by Taif University, Saudi Arabia.

ReferencesAbeywickrama, K. and Bean, G.A. (1991). Toxigenic Aspergillus flavus

and aflatoxins in Sri Lankan medicinal plant material. Mycopathol., 113,

187‒190.

Alhussaini, M.S. (2012). Mycobiota and mycotoxins of nuts and some dried

fruits from Saudi Arabia. J. Amer. Sci., 8, 525‒534.

Ali-Shtayeh, M.S. and Al-Sheikh, B.S.A. (1988). Isolation of keratinophilic

fungi from the floor dust of Arab kindergarten schools in the West Bank

of Jordan. Mycopath., 106, 5‒11.

Aziz, N.H., Youssef, Y.A., El-Fouly, M.Z., and Moussa, L.A. (1998).

Contamination of some common medicinal plant samples and spices by

fungi and their mycotoxins. Bot. Bull. – Acad. Sinic., 39, 279‒285.

Banerjeea, A., Mathewsa, R.P., Prakasha, H.S., and Shettya, H.S. (1993).

Mycobiota and toxigenic Aspergillus flavus associated with developing

cardamom and pepper. Mycol Res., 97, 1403‒1406.

Ben Fredj, S.M., Chebil, S., and Mlik, A. (2009). Isolation and characterization

of ochratoxin A and aflatoxin B1 producing fungi infecting grapevines

cultivated in Tunisia. Afr. J. Microbiol. Res., 3, 523‒527.

Bokhari, F.M. (2007). Spices mycobiota and mycotoxins available in Saudi

Arabia and their abilities to inhibit growth of some toxigenic fungi.

Mycobiol. 35, 47‒53.

Chempakam, B. and Sindhu, S. (2008). Small Cardamom. In “Chemistry of

Spices” ed by V.A. Parthasarathy, B. Chempakam and T.J. Zachariah.

CAB International, pp 41‒58.

Chourasia, H.K. (1995). Mycobiota and mycotoxins in herbal drugs of

Indian pharmaceutical industries. Mycol. Res., 99, 697‒703.

Commission Regulation (EC) 2006. Commission Regulation No.1881/2006

of 19 December 2006. Official Journal of European Communities L

364/5, 20/12/2006.

E1-Kady, I.A., E1-Maraghy, S.S.M., and Mostafa, M.E. (1992). Contribution

of the mesophilic fungi of different spices in Egypt. Mycopathol., 120,

93‒101.

Elshafie, A.E., Al-Rashdi, T.A., Al-Bahry, S.N., and Bakheit, C.S. (2002).

Fungi and aflatoxins associated with spices in the Sultanate of Oman.

Mycopathol., 155, 155‒160.

European Commission. Commission Regulation (EC) No 123/2005 of 26

January 2005 amending Regulation (EC) No 466/2001 as regards

ochratoxin A. Official Journal of the European Union No. L25, 3‒5.

Fazekas, B., Tar, A., and Kovács, M. (2005). Aflatoxin and ochratoxin A

content of spices in Hungary. Food Addit. Contam., 22, 856‒863.

Gardes, M. and Bruns, T.D. (1993). ITS primers with enhanced specificity

for basidiomycetes-Application to the identification of mycorrhizae and

rusts. Mol. Ecol., 2, 113‒118.

Gashgari, R.M., Shebany, Y.M., and Gherbawy, Y.A. (2011). Molecular

Characterization of ochratoxigenic fungi associated with raisins.

Foodborn Path. dis., 8, 1221‒1227.

Gherbawy, Y.A., Shebany, Y.M., Hussein, M.A., and Maghraby, T.A.

(2015). Molecular detection of mycobiota and aflatoxins contamination

of chilli. Arch. Biol. Sci. Belg., 67, 223‒234, 2015.

González-Salgado, A., González-Jaén, M.T., Vázquez, C., and Patiño, B.

(2005). Highly sensitive PCR-based detection method specific for

Aspergillus flavus in wheat flour. Food Addit. Cont., 25, 758–764.

González-Salgado, A., Patiño, B., Vázquez, C., and González-Jaén, M.T.

(2005). Discrimination of Aspergillus niger and other Aspergillus species

belonging to section Nigri by PCR assays. FEMS Microbiol., 245,

353‒361.

Hammami, W., Fiori, S., and Thani, R.A. (2014). Fungal and aflatoxin

contamination of marketed spices. Food Cont., 37, 177‒181.

Hashem, M. and Alamri, S. (2010). Contamination of common spices in

Saudi Arabia markets with potential mycotoxin-producing fungi. Saudi J.

Biol. Sci., 17, 167–175.

Hocking, A.D. (1981). Improved media for enumeration of fungi from

foods. CSIRO Food Res Q., 41, 7–11.

Hocking, A.D. and Pitt, J.I. (1988). Two new species of xerophilic fungi

and a further record of Eurotium halophilicum. Mycol., 80, 82–88.

Hussain, A., Sohail, M., and Shafqatullah. (2012). Aflatoxin contamination

of spices sold in different markets of Peshawar. J. Chem. Soc. Pak., 34,

1052‒1055.

Jeswal, P. and Kumar, D. (2015). Assessment of co-occurrence of Aflatoxin

and Ochratoxin A in medicinal herbs and spices from Bihar state (India).

Curr. Res. Microbiol. Biotec., 3, 586‒592.

Jukes, T.H. and Cantor, C.R. (1969). Evolution of protein molecules. In:

Munro HN, editor. Mammalian protein metabolism. New York:

Academic Press, 3, 21‒32.

Martins, M.L., Martins, H.M., and Bernardo, F. (2001). Aflatoxins in spices

marketed in Portugal. Food Addit. Contam., 18, 315–319.

Mezeal, I.A. and Alwaan, N.M. (2015). Discovery of fungi supplementary

with some spices collected from Iraqi markets. Food Sci. Qual. Manag.,

36, 31‒35.

Moorthy, K., Prasanna, I., Thajuddin, N., Arjunan, S., Gnanendra, T.S., and

Zahir Hussain, M.I. (2010). Occurrence of mycopopulation in spices and

herbal drugs. Inter. J. Biotec., 1, 6‒14.

Neergaard, P. (1973). Seed Pathology. Vol. 1, John Villey and Sons, NY.

Pitt, J.I. and Hocking, A.D. (2009). Fungi and food spoilage (Third ed.).

New York: Springer Science. Business Media .

Prelle, A., Spadaro, D., Garibaldi, A., and Gullino, M.L. (2014). Co-


occurrence of aflatoxin and ochratoxin A in spices commercialized in

Italy. Food Cont., 39,192‒197.

Ramesh, C. and Jayagoudar, S. (2013). Mycoflora of Some Spices from

Dharwad, India. Res. J. Agric. Forest. Sci., 1, 13‒22.

Romagnoli, B., Menna, V., Gruppioni, N., and Bergamini, C. (2007).

Aflatoxins in spices, aromatic herbs, herb-teas and medicinal plants

marketed in Italy. Food Cont., 18, 697‒701.

Sumanth, G.T., Waghmare, B.M., and Shinde, S.R. (2010). Incidence of

mycoflora from the seeds of Indian main Spices. Afr. J. Agric. Res., 5,

3122‒3125.

Taniwaki, M.H., Pitt, J.I., Teixeira, A.A., and Lamanaka, B.T. (2003). The

source of ocratoxin A in Brazilian coffee and its formation in relation to

processing methods. Inter. J. Food Microbiol., 82, 73–179.

Thirumala-Devi, K., Mayo, M.A., Reddy, G., Emmanuel, K.E., Larondelle,

Y., and Reddy, D.V.R. (2001). Occurrence of ochratoxin A in black

pepper, coriander, ginger and turmeric in India. Food Addit. Contam.,

18, 830‒835.

Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., and Higgins,

D.G. (1997). The Clustal X windows interface: Flexible strategies for

multiple sequence alignment aided by quality analysis tools. Nuc Acid

Res., 25, 4876‒4882.

Van De Peer, Y. and De Wachter, R. (1994). Treecon for Windows: a

software package for the construction and drawing of evolutionary trees

for the Microsoft Windows environment. Comp. Appl. Biosci., 10,

569‒570.

VICAM inc. (1999). Aflatest Instruction Manual. Watertown, MA,

USA:VICAM.

Watanabe, T. (2002). Pictorial atlas of soil and seed fungi morphologies of

cultured fungi and key to species. 2 ed. CRC Press, Londom, UK. 486.

White, T.J., Burns, T., Lee, S., and Taylor, J.W. (1990). Amplification and

direct sequencing of fungal ribosomal RNA genes for phylogenetics. In:

Innis, M.A., Gelgard, D.H., Sninsky, J.J., White, T.J. (Eds.), PCR

Protocols: A Guide to Methods and Applications. Academic Press, New

York, pp. 315–322.

Zinedine, A., Brera, C., Elakhdari, S., Catano, C., Debegnach, F., Angelini,

S., De Santis, B., Faid, M., Benlemlih, M., Minardi, V., and Miraglia, M.

(2006). Natural occurrence of mycotoxins in cereals and spices

commercialized in Morocco. Food Cont., 17, 868–874.

Mycobiota, Total Aflatoxins and Ochratoxin A of Cardamom Pods

Documents

Transcript of Mycobiota, Total Aflatoxins and Ochratoxin A of Cardamom Pods