Abstract - The purpose of this study was to compare the effects

of growth factors and 810-nm-wavelength light on the

differentiation of normal human neural progenitor cells in

vitro. Although growth factors are routinely used to study

neural stem and progenitor cells in vitro, to date, light has not

been used as a replacement for growth factors. This study

demonstrates that NHNPCs are not only capable of being

sustained by light in the absence of growth factors, but that

they are able to differentiate normally as assessed by neurite

formation. The NHNPCs had an up-regulation in the

expression of endogenous FGF-2, BDNF and NGF in response

to the light. Suramin, a nonselective P2 receptor antagonist,

significantly decreased neurite outgrowth and P2Y2 and

P2Y11 receptors were found to be expressed by the NHNPCs

by immunolabeling. Based on these findings,

the mechanism by which light supports NHNPC

differentiation, is hypothesized to be due to increases in ATP

acting via P2Y receptors.

Index Terms—Light-stimulated neurite outgrowth, ATP,

growth factors, neuritogenesis, receptor immunolabeling

I. INTRODUCTION

Based on numerous in vitro, in vivo and clinical studies

using red and near-infrared coherent and non-coherent light,

light therapy (LT), which is also known as low level light

therapy (LLLT), biostimulation or photobiomodulation, can

alter cellular functions and clinical conditions [1]. However,

controversy still exists concerning the effectiveness of light

as a therapy. Part of the reason for this controversy is due to

an incomplete understanding of the biochemical

Manuscript received October , 2007. This research was supported in

part by the U.S. Department of Defense, USUHS under Grant CO70WH.

J. J. Anders, T. B. Romanczyk, H. Moges, and Xingjia Wu and are

with the Department of Anatomy, Physiology and Genetics, Uniformed

Services University of the Health Sciences, Bethesda, MD 20814 USA

(phone:301-295-3203; fax: 301-295-1715; e-mail: janders@usuhs.mil).

I. K. Ilev and R. W. Waynant are with the Center for Devices and

Radiological Health, U.S. Food and Drug Administration, Silver Spring,

MD 20993 USA.

L. Longo is with the Institute of Laser Medicine, University of Siena,

Siena, Italy.

mechanisms underlying the observed changes in cellular

function [2].

It is now generally accepted that mitochondria are the

initial site for the effects of light on modulation of the

function of cells and tissues [3], [2]. Specifically, Karu

hypothesized that the primary photoacceptors are the mixed

valence copper centers within cytochrome c oxidase of the

mitochondrial electron transport chain [4-7]. Recent reports

have supported Karu’s hypothesis and presented data

suggesting that cytochrome c oxidase is the chromophore

for LT irradiation with near-infrared wavelengths[8-12].

The absorption of photons by the cytochrome c oxidase,

results in the acceleration of the electron transfer reactions

[13] leading to increased production of adenosine

triphosphate (ATP) [14, 15]. Other mechanisms besides

cytochrome c oxidase mediated increase in ATP production

have been proposed for the observed effects of LT (see

[16], [2] for summaries of proposed mechanisms and

downstream signaling events). However, a direct correlation

between LT, the role of mitochondria, downstream cellular

signaling and a measurable biological outcome has not been

demonstrated.

Most in vitro studies of neural progenitor cells utilize

mitogens to regulate their proliferation and differentiation

[18]-[17] , in particular, fibroblast growth factor-2 (FGF-2)

and epidermal growth factor (EGF). To our knowledge, no

one has used light on human neural progenitor cells to

influence cellular differentiation. Wollman et.al. [18], [19]

demonstrated that low power laser irradiation enhanced

neuronal migration and induced neurite outgrowth in rat

fetal brain cells and cortical explants. Other groups

investigated the biostimulatory effects of low-power lasers

on cultured cells including fibroblasts, endothelial cells,

macrophages, melanocytes, and lymphocytes and found that

certain parameters stimulate cellular proliferation [20]-[29]

and mobility [21].

The purpose of this study was to compare the effects of

growth factors and 810-nm-wavelength light on the

differentiation of normal human neural progenitor cells

(NHNPCs) in vitro. Although growth factors are routinely

used to study neural stem and progenitor cells in vitro, to

date, light has not been used as a replacement for growth

factors. The present study demonstrates that NHNPCs are

not only capable of being sustained by light in the absence

Light Supports Neurite Outgrowth of Human

Neural Progenitor Cells In Vitro: The Role of

P2Y Receptors

Juanita J. Anders1, Tara B. Romanczyk

1, Ilko K.Ilev

2, Senior Member, IEEE, Helina Moges

1,

Leonardo Longo3, Xingjia Wu

1, and Ronald W. Waynant

2, Life Fellow, IEEE

of growth factors, but that they are able to differentiate

normally as assessed by neurite formation. Neurite

formation is a primary morphological event in neuronal

differentiation [22]. The mechanism by which light supports

NHNPC differentiation, specifically neurite outgrowth, is

hypothesized to be due to increases in ATP acting via P2Y

receptors.

II. MATERIALS AND METHODS

A. Cell Culture Preparation

NHNPCs were obtained from Cambrex BioScience

(Walkersville, Maryland) and thawed in a 37°C water bath

for 1-2 minutes, resuspended in warm (37°C) neural

progenitor basal media with gentamycin sulphate (30 µg/ml)

and 15ng Amphotericin B (NPBM), and incubated (24 hr,

37°C, 5% CO2). The cells were centrifuged (1000 rpm, 5

min). The supernatant was removed and the pellet was

resuspended in either NPBM (for control and light-treated

slides) or NPMM (for factor slides). To prepare NPMM,

human recombinant (hr) epidermal growth factor (EGF), hr

fibroblastic growth factor 2 (FGF-2), and neural survival

factor-1 (NSF-1) were added to NPBM according to

manufacturer. The cells were plated on polyethyleneimine

(PEI) or laminin coated-chamber slides at a seeding density

of ~25,000 cells/cm2. All cell culture products were

purchased from Cambrex (Walkersville, MD).

B. Light Treatment

NHNPCs were separated into three groups: Control Group

(no light, no factors), Factors Group (factors only, no light),

and Light Treated Group (light only, no factors). Light-

treated NHNPCs were exposed to a continuous-wave 810-

nm-wavelength, 150-mW-power diode laser (at a power

density of 50 mW/cm2, an exposure time of 4 s, and a

radiation dose of 0.2 J/cm2

or 100 mW/cm2, 2 s, and 0.2

J/cm2). The light treatment parameters used in this study

were based on a series of preliminary experiments. For the

preliminary experiments, NHNPCs were plated on slides

and treated with light once a day for three days and grown

for a total of seven days in three separate experiments using

the following laser parameters: 1) wavelengths: 458.6, 477,

488.7, 515, 646, 660, 780, 807, 810, and 975 nm; 2) doses

(810 nm light, at 50 mW/cm2): 0.005, 0.01, 0.02, 0.05, 0.1,

0.2, 0.5, 1, 2, 4, and 6 J/cm2; and 3) power density (810 nm

light): 1, 3, 10, 30, 50, and 100 mW/cm2. For each of the

three experiments, the diameter of the laser(s) spot size was

10 mm corresponding to an area of 0.785 cm2. A minimum

of two slides containing NHNPCs per experimental group

was used. Each experiment also had Control and Factors

slides. A surface area analysis was used to evaluate the

growth of the NHNPCs for selection of the optimal laser

parameters for this study.

C. Immunostaining

NHNPCs were fixed in 4% paraformaldehyde (Sigma) in

phosphate buffered saline (PBS) (10 min., room

temperature) at four days after the last day of light

treatment. The cultures were rinsed in PBS and incubated in

the primary polyclonal antibody for doublecortin (DCX)

(1:3000, Chemicon, Temecula, CA)(1 hr, 4°C) or overnight

at 4°C for the primary antibodies: nestin monoclonal (1:100,

Chemicon, Temecula, CA); musashi polyclonal (1:200,

Chemicon, Temecula, CA); glial fibrillary acidic protein

(GFAP) polyclonal (1:300, DAKO, Carpinteria, CA); and

anti-β-tubulin isotype III (TUJ1) monoclonal (1:75, Sigma,

St. Louis, MO). DCX is a phosphoprotein that is widely

expressed in the central nervous system (CNS) and is

present in migrating and differentiating neurons. Nestin is a

Class VI intermediate filament widely used as a

predominant marker for stem / progenitor cells, in the

mammalian CNS. Musashi is selectively expressed in

neural progenitor cells, including neural stem cells. TUJ1 is

transiently expressed in neuronal- and/or glial precursor

cells. In adult tissues, the distribution of beta III is almost

exclusively neuron-specific. GFAP is a class III

intermediate filament protein that is specifically expressed

in astrocytes in the CNS. For the detection of primary

antibodies, fluorescein (FITC)-, or cyanine 3 (CY3) -

conjugated secondary antibodies (Jackson Immunoresearch

Laboratories, West Grove, PA) were used. Slides were

cover-slipped using vectashield mounting medium with 4,6-

diamino-2-phenylindole (DAPI) (Vector Laboratories,

Burlingame, CA). No primary antibody was added for

negative control slides. Slides were photographed using a

Nikon (Tokyo, Japan) Labophot fluorescent microscope,

and images were captured using a Sony (Tokyo, Japan)

DKC 5000 Catseye digital still camera.

D. Reverse Transcription Polymerase Chain Reaction

NHNPCs were placed into four groups: Control (RNA

extraction at 7 days in vitro (DIV)), Factors (RNA

extraction at 7 days in vitro (DIV)), Light Treated (RNA

extraction at 3 days in vitro (DIV)), and Light Treated

(RNA extraction at 7 days in vitro (DIV)). The light treated

NHNPCs were exposed to an 810 nm, 150 mW diode laser

at a power density of 50 mW/cm2, 4 s, 0.2 J/cm

2 for three

days. Total cellular RNA was extracted and reverse

transcribed using First-Strand Synthesis beads (Marsha

Pharmacia, Piscataway, NJ) as per the protocol of the

manufacturers (Nitrogen, Carlsbad, CA and Amersham

Pharmacia). Briefly, cells were lysed by the addition of

TRIzol. RNA was extracted using the chloroform/

isopropanol method and purified with 75% ethanol prior to

being resuspended. RNA was transferred to tubes

containing First-Strand Synthesis beads (Amersham

Pharmacia) and Random Hexamers (Invitrogen) and

incubated (1 hr, 37°C). Resultant cDNA was amplified

using the following primers: FGF-2 (5'- GCC ACA TCT

AAT CTC ATT TCA CA -3'; 5'- CTG GGT AAC AGC

AGA TGC AA -3'), nerve growth factor (NGF) (5'-

CCAAGGGAGCAGCTTTCTATCCTGG -3'; 5'-

GGCAGTGTCAAGGGAATGCTGAAGT -3'), EGF (5'-

CTAATCACCTACTCAATGCCTGG -3'; 5'-

TGATTCTCCCAGTACTCTTACTTGG -3’), brain derived

neurotrophic factor (BDNF)

(5’AGCCTCCTCTTCTCTTTCTGCTGGA -3'; 5'-

CTTTTGTCTATGCCCCTGCAGCCTT -3') , and beta-

actin (β-actin) (5'- GTG GCA TCC ACG AAA CTA CCT

T -3'; 5'- GGA CTC GTC ATA CTC CTG CTT G -3'). PCR

products were run on 2% agarose gel and quantified as

previously described [23]. Briefly, pixel density for each

band was measured using MultiGauge (Fuji Photo Film Co.,

Ltd., Valhalla, New York) and calculated based on the ratio

between the intensity value of the experimental gene versus

the endogenous control, β-actin. All data are presented as

the ratio of gene of interest to β-actin + SEM.

E. Suramin Sodium Salt Treatment

For dose-effect analysis of suramin sodium salt (Sigma,

St. Louis, MO), a nonselective P2 receptor antagonist, on

NHNPCs, the cells were randomly placed into one of three

groups: Control, Factor or Light. Each group was further

divided into four subgroups according to treatment with

suramin: no suramin, 10 uM suramin, 50 uM suramin, and

100 uM suramin. For co-treatment of neurospheres with

light, cells were exposed to an 810 nm light at 15 minutes

and 24 hours after addition of the antagonist. After 48 hours

of growth, neurospheres were fixed in 4%

paraformaldehyde (10 min) and stored in PBS (4ºC).

F. Quantification of Neurite Outgrowth

The effects of different treatments on neurite outgrowth

were analyzed using Neuron J in Image J

(http://rsb.info.nih.gov/ij/). For DCX immunolabeled

NHNPCs, a minimum of five random neurospheres was

selected each from a separate optical field (10x objective).

Neurospheres were examined using a Nikon Labophot

fluorescent microscope, and images were captured using a

Sony DKC 5000 Catseye digital still camera. All neurites

were measured and data was expressed as the mean of the

neurite length ± SEM. For analyzing the effect of suramin

sodium salt on neurite outgrowth, slides were also analyzed

using Neuron J in Image J. Each group consisted of two

slides and for each slide a minimum of ten random

neurospheres was selected each from a separate optical

field. Phase contrast images were taken using a Zeiss

Axiocam HRC camera (Germany) connected to a Zeiss

Axiovert 200 microscope (Germany). Neurite

measurements for each group were expressed as the average

of the sum of the neurite lengths for each neurosphere

examined.

F. P2Y Receptor Immunolabeling

For P2Y2 receptor immunofluorescence labeling, live

NHNPCs were incubated in primary antibody (rabbit

polyclonal anti-P2Y2, 1:200, Alomone Labs, Jerusalem,

Israel) (37ºC, 5% CO2, 1 hr). Cells were washed in NPBM

containing 1% donkey serum (DS) (Jackson

Immunoresearch Laboratories) and 0.1% bovine serum

albumin (BSA, Sigma). Cells were incubated with Cy3

conjugated donkey anti-rabbit IgG (1:800, Jackson

Immunoresearch Laboratories) in NPBM/1%DS/0.1%BSA.

Slides were washed once in PBS, fixed for 15 min in 4%

paraformaldehyde, washed in PBS (3 x 5 minutes), and

coverslipped using vectashield with DAPI (Vector

Laboratories). For P2Y11 receptor immunofluorescence

labeling, cells were fixed in 4% paraformaldehyde (10 min)

and washed in PBS containing 0.2% Triton-X 100 (Sigma)

followed by overnight incubation in primary antibody

(rabbit polyclonal anti-P2Y11 antibody, 1:200, Alomone

Labs) at 4ºC. After four washes with PBS containing

0.1%BSA and 0.1%Triton-X 100, cells were incubated in

Cy3 conjugated donkey anti-rabbit IgG (1:800) in PBS/

2%Triton-X 100 and washed in PBS. Slides were then

coverslipped using vectashield with DAPI. Images of P2Y2

and P2Y11 immunolabeled cells were acquired using an

inverted Leica TCS SP confocal microscope with a 63x oil

objective lens.

G. Statistics

The data were

analyzed using the statistical software

program GraphPad Prism version 3.02 for Windows

(GraphPad Software, San Diego, CA, www.graphpad.com).

Statistical comparisons were performed using one-way

analysis of variance (ANOVA) with a level of 0.05,

followed by a Tukey multiple comparison test.

III. RESULTS

A. Characterization of NHNPCs

The NHNPCs expressed the progenitor markers nestin

(Fig. 1A) and musashi (Fig. 1B), demonstrating the

presence of progenitor cells within the neurosphere. To

determine if light would drive NHNPCs into specific

cellular phenotypes that differed from those of NHNPCs

grown in the presence of growth factors,

immunocytochemistry for neuronal (TUJ1) and glial

(GFAP) markers was performed. Under normal conditions,

NHNPCs typically co-express GFAP and TUJ1. NHNPCs,

grown either in the presence of growth factors (Fig. 1C) or

exposed to 810 nm light in the absence of growth factors

(Fig. 1D) labeled for both the neuronal and glial markers.

This similar co-expression of the neuronal and glial labeled

proteins in the Factors and the Light groups (Fig. 1C, D)

indicates that the 810 nm light did not change the

phenotypic morphology of the NHNPCs.

JSTQE

4

Fig. 1. NHNPCs were plated and grown under either normal

conditions (A-C) (in the presence of growth factors: FGF-2

and EGF), or were treated with 810 nm light and in the

absence of factors (D) for 7 days. They were fixed and

processed for single label immunocyto-chemistry using

musashi (A) and nestin (B), or double-label

immunocytochemistry using TUJ1 and GFAP and

counterstained with DAPI (blue) to visualize nuclei.

NHNPCs have labeled (green) processes with musashi (A)

and nestin (B), confirming the presence of stem/ progenitor

cells within the neurospheres. Factor treated NHNPCs (C)

and 810 nm light treated NHNPCs (D) labeled with TUJ1

(red) and GFAP (green). Bar = 100 µm (A, B); 200 µm (C,

D).

B. Endogenous Production of Growth Factors by NHNPCs

To evaluate the mechanism by which light sustained and

differentiated NHNPCs in vitro, the effect of light on

NHNPCs expression of growth factors was determined.

Gene expression for FGF-2, EGF, BDNF, NGF and β-actin

were determined (Fig. 2A). Semi-quantitative measurement

of the bands for FGF-2, EGF, BDNF, and NGF was done

(Fig 2B). Both Light Treated groups had significantly

greater expression of FGF-2 compared to the Factors

(p<0.05, p<0.01 respectively) and Control (p<0.01) groups.

No significant difference in EGF expression was detected

(p=0.1692). The Control group had significantly less

expression of BDNF compared to the Factors and both

Light Treated groups (p<0.05). Both Light Treated groups

had significantly greater expression of NGF compared to

the Factors and Control (p<0.001) groups. Also, the Light

Treated (7DIV) group had significantly greater expression

of NGF than the Light Treated (3DIV) group (p<0.001).

Fig. 2. NHNPCs were placed into four groups: Control,

Factors, Light treated (3DIV) and Light treated (7 DIV).

A, Gene expression for FGF-2, EGF, BDNF, NGF and β-

actin. B, Semi-quantitative measurement for FGF-2, EGF,

BDNF, and NGF. One-way ANOVA was performed for

each growth factor. FGF: Both light groups had

significantly greater expression compared to Factors

(p<0.05, p<0.01 respectively) and Control (p<0.01). EGF:

No significant difference detected (p=0.1692). BDNF: The

Control group had significantly less expression than

Factors, Light 3D, Light 7D (p<0.05). NGF: Both light

groups had significantly greater expression compared to

Factors and Control (p<0.001). Light 7DIV had

significantly greater expression compared to Light 3DIV

(p<0.001).

C. Growth Factors and Light Increase Neurite Outgrowth

of NHNPCs

To determine if light influenced neurite outgrowth of the

NHNPCs, immunocytochemistry for the neuronal migration

marker, DCX, was performed (Fig. 3A-E). Neurite

outgrowth was assessed and plotted for each group (Fig.

3F). The negative control slide (Fig. 3A) did not contain

any DCX labeling. The Control group (Fig. 3B, F) had

shorter neurite length than the Factors group (Fig. 3C, F)

and Light Treated groups (Fig. 3D, E, F). The 50 mW/cm2

group (Fig. 3D) had many labeled neurites. Statistical

analysis between the groups using one-way ANOVA

JSTQE

5

revealed a significant difference (p<0.0001). The Factors

and Light Treated (50 mW/cm2) groups had significantly

longer neurites compared to Control and Light Treated (100

mW/cm2) groups (p<0.001). There was no significant

difference between the Factors and Light Treated (50

mW/cm2) groups. These results support the hypothesis that

light is capable of inducing neurite outgrowth in NHNPCs

in the absence of growth factors.

Fig. 3. NHNPCs were placed into four groups: Control,

Factors, 50 mw/cm2 and 100 mw/cm

2. The Light Treated

slides were treated with 810 nm light for three days. All

groups of cells were grown for a total of 7 days, fixed,

processed for DCX (red) immunocytochemistry, and

counterstained with DAPI (blue) to visualize nuclei. The

negative control slide (A) did not contain any label for

DCX. The Control group (B) had shorter neural extensions

than the Factors (C) and Light-treated groups (D-E). The

50 mW/cm2 group (D) revealed many labeled neural

extensions. The 100 mW/ cm2 group (E) had fewer neurites

than the 50 mW/cm2 group (D). This was confirmed by

measurements taken in each group (F). Overall one-way

ANOVA was statistically significant (p<0.0001). Factors

and 50 mW/cm2 had significantly longer neurite outgrowth

as compared to Control and 100 mW/cm2 (p<0.001).

Factors and 50 mW/cm2 were comparable to one another.

Bar = 200 µm.

D. The Role of P2Y Receptors in NHNPCs Neurite

Extension

To determine if purinergic receptors are involved in

NHNPCs neurite extension, the effect of a non-specific P2

receptor antagonist (suramin) was examined and the data

are shown in Fig. 4. Using various concentrations of

suramin, a dose dependent inhibition of light enhanced

neurite outgrowth was observed (Fig. 4D, E, F and I). In the

Light Treated group (Fig. 4I), neurospheres that were

treated with 50 uM (p<0.05) and 100 uM (p<0.01) suramin

had a significantly decreased summed neurite length as

compared to cells that did not receive suramin. There was

no significant difference in summed neurite length of

neurospheres due to suramin treatment in Control (Fig. 4G)

and Factors (Fig. 4H) groups.

E. Expression of P2Y Receptors in NHNPCs

Immunostaining of NHNPCs with P2Y2 and P2Y11

showed that both the receptors are expressed in these cells.

The P2Y2 staining was abundant and located within the

cytoplasm (Fig 5A and C). As shown in Figure 5B and 5D,

the P2Y11 labeling was seen as punctate staining within the

plasma membrane.

IV. DISCUSSION

The purpose of this study was to compare the effects of

growth factors and light on the differentiation of NHNPCs

in vitro. The present study demonstrates that NHNPCs

treated with light can differentiate normally, extend

neurites, and up-regulate the expression of endogenous

FGF-2, BDNF and NGF.

A. ATP Production

The primary photoacceptors have been hypothesized to

be the mixed valence copper centers within cytochrome c

oxidase of the mitochondrial electron transport chain [4-7].

Recent reports suggested that cytochrome c oxidase is the

chromophore for LT irradiation with near-infrared

wavelengths [8-12] and supported Karu’s hypothesis.

Absorption of photons by cytochrome c oxidase, results in

the acceleration of the electron transfer reactions [13] and

increased production of ATP [14]-[16].

Modulation of ATP production has been hypothesized by

many researchers to be responsible for the beneficial effects

of light on cells and tissues. Light therapy (wavelength 810

nm) of ischemic mammalian heart was reported to cause a

six fold increase in ATP production by cardiomyocytes in

the ischemic zone as compared to the non-treated heart [24,

25]. Also, ATP was significantly increased in laser-treated

rat cerebral cortex regions compared to non-treated regions

[24]. Of direct relevance to this study is a recent publication

that reported a significant increase in ATP treated NHNPCs

compared to non-treated controls [26]. The NHNPCs

JSTQE

6

Fig.4. NHNP cells were grown under three conditions: Control group that received no light or growth factors (A); Factors

group that received only growth factors (B); and Light group that received LT but no growth factors (C). Addition of suramin to

cells inhibited light enhanced neurite outgrowth in a dose dependent manner (D, E and F are cells in light group that received

10uM, 50uM and 100uM suramin respectively). In the Light Treated group (I), neuroshperes that were treated with 50uM

(p<0.05) and 100uM (p<0.01) suramin had a significantly decreased summed neurite length as compared to cells that did not

receive suramin. There was no significant difference in summed neurite length of neurospheres due to suramin treatment in

Control (G) and Factors (H) groups. (Bar = 100 um)

were treated with laser parameters (Ga-As laser; 808 nm, 50

mW/cm2, 0.05 J/cm

2) that were similar to those used in this

report (laser diode, 810 nm, 50 mW/cm2, 4 s, 0.2 J/cm

2 or

100mW/cm2, 2 s, 0.2 J/cm2). The possibility that light

treated NHNPCs have other mechanisms activated in

response to light besides cytochrome c oxidase mediated

increase in ATP production cannot be ruled out. However,

the mechanism by which light supports NHNPC

differentiation, specifically neurite outgrowth and up-

regulation of growth factor expression can be explained by

increases in ATP acting via P2Y receptors.

B. Extracellular ATP and P2Y Receptors

ATP is a potent signaling molecule that causes a wide

range of physiological effects [27]. These effects range

from neurotransmission, chemosensory signaling, secretion,

vasodilation, and more complex effects such as immune

responses, pain modulation, fertilization and embryonic

development [27]. ATP is abundantly present in the CNS

and research suggests a role for extracellular ATP in the

development and maintenance of the nervous system and its

response to injury or diseases [28, 29].

ATP acts through the P2 receptors [30]. In 1978,

Burnstock provided the basis for distinguishing between

adenosine receptors (P1) and ATP receptors (P2) [31]. P2

receptors were classified into P2X (ionotrophic) receptors

that belong to a superfamily of transmitter gated ion

channels [32] and P2Y (metabotropic) receptors that are

members of the G-protein-coupled superfamily [33]. To

date, eight P2Y receptors (P2Y1,-2,-4,-6,and -11 to -14)

have been identified [34]. Both P2Y and P2X receptors are

present in the CNS but the effect of the individual P2Y

receptor subtypes on neuronal function and

JSTQE

7

Fig. 5. Expression of P2Y receptors in NHNP cells. Fluorescence images of NHNP cells immunolabeled with

Anti-P2Y2 receptor (A,C) and anti-P2Y11receptor (B, D). (Bars; A, B = 10um; C,D = 5um).

their interaction with signal transduction pathways in the

CNS still needs to be determined [35].

C. P2Y Receptors and Neuritogenesis

In 1999, Rathbone proposed that purines may interact with

neurons or neuronal precursors, eliciting neuritogenesis,

maintenance of existing neurites, and enhanced survival

[36]. It was initially reported that ATP and GTP could

potentiate the NGF-induced neurite outgrowth in PC12 cells

and that ATP alone enhanced cell survival but wasn’t

capable of inducing neuritogenesis [37]. However, it has

recently been reported that extracellular ATP stimulated

neurite outgrowth independent of other neurotrophic factors

[37]. Using various purinergic and signaling cascade

agonists and antagonists, the authors suggested that ATP

stimulated neurite outgrowth via the P2Y11 receptor and

that this effect was mediated by activation of mitogen-

activated protein kinase (MAPK). Purinergic receptors can

act through numerous signaling cascades. Extracellular

signal regulated kinase (ERK) is a key member of the

MAPK family and is a crucial mediator of trophic effects

including neuronal plasticity.

In this study, suramin significantly inhibited light-

enhanced neurite outgrowth, and expression of two of the

P2Y receptors, P2Y2 and P2Y11, was confirmed indicating

the involvement of P2Y receptors in light induced

enhancement of neurite outgrowth. The expression profile

of other P2Y receptors in NHNPCs and the role of each

receptor in light induced enhancement of neurite outgrowth

will be addressed in future experiments by examining the

effect of their respective agonists and antagonists.

D. Light Treatment and Growth Factor Expression

In this study, a significant increase in gene expression of

FGF2 and NGF was found in the NHNPCs that were treated

with light. The mechanism for this effect is not known. Of

interest are reports that nucleotides and nucleosides can

induce astrocytes to synthesize NGF, NT-3 and FGF [38].

Based on these observations it has been suggested that

purines and pyrimidines may modulate the function of glia

and neurons by inducing synthesis of these factors [38].

The significant increase in FGF2 and NGF may also play a

role in the observed neuritogenesis. There are numerous

reports of ATP acting synergistically with growth factors.

The intracellular pathways that would allow for an

interaction of P2Y receptors and growth factor receptor

mediated signaling cascades are known [39]. Further

studies are needed to determine if an increase in

JSTQE

8

ATP caused by light results in an increase in growth factor

expression.

V. CONCLUSION

The data presented here establish the neuritogenic potential

of light on NHNPCs in a growth factor and serum-free

environment. Based on these findings we propose that the

light caused an increase in ATP that acted through P2Y

receptors and downstream signaling pathways leading to

neurite outgrowth. Further experiments are underway to

identify the involved signaling pathways. Increasing

evidence suggests that extracellular ATP may be an

important neurotrophic agent in CNS development,

neuronal survival, and repair. Light therapy via the

generation of ATP can have profound effects on CNS

development and neuronal survival after injury and disease.

ACKNOWLEDGMENT

The authors would like to thank Dr. Kimberly Byrnes for

her informative discussions, and editorial comments

regarding this manuscript. We would also like to thank the

following people who assisted in this research project: Rolf

Graning, Rose Eisenbeiss and Dr. Albert Amat. The

opinions or assertions contained herein are the private ones

of the authors and are not to be construed as official or

reflecting the views of the DoD, USUHS or FDA.

REFERENCES

[1] J. Tuner, "The Laser Therapy Handbook," Grangesberg:

Priman Books, 2004, p. 589.

[2] T. N. D.-R. Michael R. Hamblin, Cellular Chromophores and

Signaling in Low Level Light Therapy vol. 6428. San Jose,

California: SPIE- The Interantional Society for Optical

Engineering, 2007.

[3] J. Streeter, L. D. Taboada, and U. Oron, "Mechanisms of action

of light therapy for stroke and acute myocardial infarction,"

Mitochondrion, vol. 4, pp. 569-576, 2004.

[4] T. I. Karu and S. F. Kolyakov, "Exact action spectra for cellular

responses relevant to phototherapy," Photomed Laser Surg,

vol. 23, pp. 355-61, Aug 2005.

[5] T. I. Karu, L. V. Pyatibrat, S. F. Kolyakov, and N. I.

Afanasyeva, "Absorption measurements of a cell monolayer

relevant to phototherapy: reduction of cytochrome c oxidase

under near IR radiation," J Photochem Photobiol B, vol. 81,

pp. 98-106, Nov 1 2005.

[6] T. I. Karu, L. V. Pyatibrat, and N. I. Afanasyeva, "Cellular

effects of low power laser therapy can be mediated by nitric

oxide," Lasers Surg Med, vol. 36, pp. 307-14, Apr 2005.

[7] V. M. Manteifel and T. I. Karu, "[Structure of mitochondria

and activity of their respiratory chain in subsequent generations

of yeast cells exposed to He-Ne laser light]," Izv Akad Nauk Ser

Biol, pp. 672-83, Nov-Dec 2005.

[8] J. T. Eells, M. M. Henry, P. Summerfelt, M. T. Wong-Riley, E.

V. Buchmann, M. Kane, N. T. Whelan, and H. T. Whelan,

"Therapeutic photobiomodulation for methanol-induced retinal

toxicity," Proc Natl Acad Sci U S A, vol. 100, pp. 3439-44,

Mar 18 2003.

[9] J. T. Eells, M. T. Wong-Riley, J. VerHoeve, M. Henry, E. V.

Buchman, M. P. Kane, L. J. Gould, R. Das, M. Jett, B. D.

Hodgson, D. Margolis, and H. T. Whelan, "Mitochondrial

signal transduction in accelerated wound and retinal healing by

near-infrared light therapy," Mitochondrion, vol. 4, pp. 559-67,

Sep 2004.

[10] H. L. Liang, H. T. Whelan, J. T. Eells, H. Meng, E. Buchmann,

A. Lerch-Gaggl, and M. Wong-Riley, "Photobiomodulation

partially rescues visual cortical neurons from cyanide-induced

apoptosis," Neuroscience, vol. 139, pp. 639-49, May 12 2006.

[11] M. T. Wong-Riley, X. Bai, E. Buchmann, and H. T. Whelan,

"Light-emitting diode treatment reverses the effect of TTX on

cytochrome oxidase in neurons," Neuroreport, vol. 12, pp.

3033-7, Oct 8 2001.

[12] M. T. Wong-Riley, H. L. Liang, J. T. Eells, B. Chance, M. M.

Henry, E. Buchmann, M. Kane, and H. T. Whelan,

"Photobiomodulation directly benefits primary neurons

functionally inactivated by toxins: role of cytochrome c

oxidase," J Biol Chem, vol. 280, pp. 4761-71, Feb 11 2005.

[13] W. Yu, J. O. Naim, M. McGowan, K. Ippolito, and R. J.

Lanzafame, "Photomodulation of oxidative metabolism and

electron chain enzymes in rat liver mitochondria," Photochem

Photobiol, vol. 66, pp. 866-71, Dec 1997.

[14] S. Passarella, A. Ostuni, A. Atlante, and E. Quagliariello,

"Increase in the ADP/ATP exchange in rat liver mitochondria

irradiated in vitro by helium-neon laser," Biochem Biophys Res

Commun, vol. 156, pp. 978-86, 1988.

[15] S. Passarella, "He-Ne laser irradiation of isolated

mitochondria," J Photochem Photobiol B, vol. 3, pp. 642-3,

Aug 1989.

[16] D. T. N. Hamblin michael R, Mechanisms of Low Level Light

Therapy vol. 6140. San Jose, CA: SPIE- the international

society for optical engineering, 2006.

[17] A. Gritti, E. A. Parati, L. Cova, P. Frolichsthal, R. Galli, E.

Wanke, L. Faravelli, D. J. Morassutti, F. Roisen, D. D. Nickel,

and A. L. Vescovi, "Multipotential stem cells from the adult

mouse brain proliferate and self-renew in response to basic

fibroblast growth factor," J Neurosci, vol. 16, pp. 1091-100,

Feb 1 1996.

[18] Y. Wollman, S. Rochkind, and R. Simantov, "Low power laser

irradiation enhances migration and neurite sprouting of

cultured rat embryonal brain cells," Neurol Res, vol. 18, pp.

467-70, Oct 1996.

[19] Y. Wollman and S. Rochkind, "In vitro cellular processes

sprouting in cortex microexplants of adult rat brains induced

by low power laser irradiation," Neurol Res, vol. 20, pp. 470-2,

Jul 1998.

[20] P. Moore, T. D. Ridgway, R. G. Higbee, E. W. Howard, and M.

D. Lucroy, "Effect of wavelength on low-intensity laser

irradiation-stimulated cell proliferation in vitro," Lasers Surg

Med, vol. 36, pp. 8-12, Jan 2005.

[21] A. F. Haas, R. R. Isseroff, R. G. Wheeland, P. A. Rood, and P.

J. Graves, "Low-energy helium-neon laser irradiation increases

the motility of cultured human keratinocytes," J Invest

Dermatol, vol. 94, pp. 822-6, Jun 1990.

[22] N. Yamamoto, A. Tamada, and F. Murakami, "Wiring of the

brain by a range of guidance cues," Prog Neurobiol, vol. 68,

pp. 393-407, Dec 2002.

[23] Y. Ming, E. Bergman, E. Edstrom, and B. Ulfhake,

"Reciprocal changes in the expression of neurotrophin mRNAs

in target tissues and peripheral nerves of aged rats," Neurosci

Lett, vol. 273, pp. 187-90, Oct 8 1999.

[24] N. Mochizuki-Oda, Y. Kataoka, Y. Cui, H. Yamada, M. Heya,

and K. Awazu, "Effects of near-infra-red laser irradiation on

adenosine triphosphate and adenosine diphosphate contents of

rat brain tissue," Neurosci Lett, vol. 323, pp. 207-10, May 3

2002.

[25] U. Oron, T. Yaakobi, A. Oron, D. Mordechovitz, R. Shofti, G.

Hayam, U. Dror, L. Gepstein, T. Wolf, C. Haudenschild, and S.

B. Haim, "Low-energy laser irradiation reduces formation of

scar tissue after myocardial infarction in rats and dogs,"

Circulation, vol. 103, pp. 296-301, Jan 16 2001.

[26] U. Oron, S. Ilic, L. De Taboada, and J. Streeter, "Ga-As (808

nm) laser irradiation enhances ATP production in human

neuronal cells in culture," Photomed Laser Surg, vol. 25, pp.

180-2, Jun 2007.

JSTQE

9

[27] C. A. Volonte, S. Cavaliere, F., D'Ambrosi, N., Vacca, F.,

Bernardi, G., "Extracellular ATP and Neurodegeneration," CNS

and Neurological Disorders - Drug Targets, vol. 6, p. 10,

2003.

[28] H. Franke and P. Illes, "Involvement of P2 receptors in the

growth and survival of neurons in the CNS," Pharmacol Ther,

vol. 109, pp. 297-324, Mar 2006.

[29] H. Franke, U. Krugel, and P. Illes, "P2 receptors and neuronal

injury," Pflugers Arch, vol. 452, pp. 622-44, Aug 2006.

[30] B. B. Fredholm, M. P. Abbracchio, G. Burnstock, J. W. Daly,

T. K. Harden, K. A. Jacobson, P. Leff, and M. Williams,

"Nomenclature and classification of purinoceptors,"

Pharmacol Rev, vol. 46, pp. 143-56, Jun 1994.

[31] G. Burnstock, "Cell Membrane Receptors for Drugs and

Hormones: A multidisciplinary Approach

" in A basis for distinguishing two types of purinergic receptor.

New York: Raven Press, 1978, pp. 107-118.

[32] B. P. Bean, "Pharmacology and electrophysiology of ATP-

activated ion channels," Trends Pharmacol Sci, vol. 13, pp. 87-

90, Mar 1992.

[33] E. A. Barnard, G. Burnstock, and T. E. Webb, "G protein-

coupled receptors for ATP and other nucleotides: a new

receptor family," Trends Pharmacol Sci, vol. 15, pp. 67-70,

Mar 1994.

[34] G. Burnstock and G. E. Knight, "Cellular distribution and

functions of P2 receptor subtypes in different systems," Int Rev

Cytol, vol. 240, pp. 31-304, 2004.

[35] D. B. Arthur, K. Akassoglou, and P. A. Insel, "P2Y2 receptor

activates nerve growth factor/TrkA signaling to enhance

neuronal differentiation," Proc Natl Acad Sci U S A, vol. 102,

pp. 19138-43, Dec 27 2005.

[36] M. P. Rathbone, P. J. Middlemiss, J. W. Gysbers, C. Andrew,

M. A. Herman, J. K. Reed, R. Ciccarelli, P. Di Iorio, and F.

Caciagli, "Trophic effects of purines in neurons and glial cells,"

Prog Neurobiol, vol. 59, pp. 663-90, Dec 1999.

[37] S. Lakshmi and P. G. Joshi, "Activation of

Src/kinase/phospholipase C/mitogen-activated protein kinase

and induction of neurite expression by ATP, independent of

nerve growth factor," Neuroscience, vol. 141, pp. 179-89, Aug

11 2006.

[38] J. T. Neary, M. P. Rathbone, F. Cattabeni, M. P. Abbracchio,

and G. Burnstock, "Trophic actions of extracellular nucleotides

and nucleosides on glial and neuronal cells," Trends Neurosci,

vol. 19, pp. 13-8, Jan 1996.

[39] S. K. Mishra, N. Braun, V. Shukla, M. Fullgrabe, C.

Schomerus, H. W. Korf, C. Gachet, Y. Ikehara, J. Sevigny, S.

C. Robson, and H. Zimmermann, "Extracellular nucleotide

signaling in adult neural stem cells: synergism with growth

factor-mediated cellular proliferation," Development, vol. 133,

pp. 675-84, Feb 2006.

Juanita Anders received a B.SC. degree

in Biology from Wilkes University, Wilkes

Barre, PA in 1969, a M.Sc. degree in

Zoology from Pennsylvania State

Univerity, State College PA in 1972 and a

Ph.D. degree in Anatomy from the

University of Maryland Medical School,

Baltimore, Maryland in 1977. She is a

Professor of Anatomy, Physiology and

Genetics at Uniformed Services University

of the Health Sciences. She also has a

secondary appointment as Professor of

Neuroscience at USUHS. While at the

National Institutes of Health in the Laboratory of Neuropathology and

Neuroanatomical Sciences, NINDS, she specialized in glial/ neuronal

interaction in normal and injured nervous tissue. Since joining USUHS,

her research interests have expanded to the use of light as a non-invasive

therapy for deep tissue injuries and the interaction of light with pluripotent

cells. Her research on the use of light applied non-invasively for repair of

spinal cord injury has received international attention. Dr. Anders serves

on the Executive Councils and Scientific Advisory Boards of several laser

societies. She is the past president of the North American Association of

Laser Therapy and a founding member of the International Academy of

Laser Medicine and Surgery. She serves on the Editorial Boards of

Photomedicine and Laser Surgery and Lasers in Surgery and Medicine and

as a reviewer for several other journals. She has published over 50 peer

reviewed articles.

Tara Romanczyk received a B.S. degree in

biology from West Chester University, West

Chester, PA in 1997. From 1998 to 2000, she

was a pre-doctoral IRTA at the National

Institute of Mental Health where her research

focused on schizophrenia. She received her

Ph.D. degree in Neuroscience from the

Uniformed Services University of the Health

Sciences, Bethesda, MD in 2007. Her

research interests include neurogenesis,

neuro-degenerative diseases and stroke, and photobiomodulation.

Ilko Ilev has over 20 years of experience in

the United States, Europe and Japan in the

field of quantum physics and laser

technologies, fiber optics, laser medicine,

non-invasive optical diagnostics and

biosensing, and ultrahigh-resolution optical

imaging. He received M.S. and Ph.D. degrees

in Laser Physics from Sofia University and

Technical University of Sofia, Bulgaria, in

1983 and 1992, respectively. He has worked in the Opto-electronics

Division at the Strathclyde University,

Glasgow, UK, in 1995, and in the Laser Technology Laboratory at the

Institute of Physical and Chemical Research (RIKEN), Tokyo, Japan, from

1995 to 1997. From 1998 to 2001 he was an American Academy of

Science/National Research Council (NRC) Research Associate in U.S.

Food and Drug Administration. Since May 2001 he has been with the

Center for Devices and Radiological Health at U.S. FDA where he is the

Leader of the Optical Therapeutics and Medical Nanophotonics

Laboratory. Dr. Ilev has produced more than 280 papers in peer-reviewed

journals and presentations at major national and international conferences

and meetings. His current research interests include development of novel

and simple minimally invasive biophotonics techniques including smart

tissue-activated fiber-optic structures and nanobiosensors for studying

single cell and intracellular chemical analytes, mechanisms of light-tissue

interactions at sub-cellular level and ultrahigh-resolution bioimaging

beyond the diffraction limit in the subwavelength nanoscale range.

Leonardo Longo received an M.D. degree

from the University of Florence, Florence,

Italy in 1981. He is an Associate Professor

of Laser Medicine and Surgery at the

University of Siena, Siena Italy and an

Associate Professor of Laser Aesthetic

Medicine and Surgery at the University of

S. Marino, S. Marino Republic. Among

numerous other positions, he is Chief of the

Institute for Laser Medicine of Florence

(I.L.M.), and Director of Laser Medicine

and Surgery Service of "Istituto Prosperius - Sezione Ricerca Medica" and

Private Hospital "Villa Cherubini" in Florence, a founding member and

President of the International Academy for Laser Medicine and Surgery,

and is the current President of the International Society of Laser Medicine

and Surgery. Prof. Longo is an expert in both high powered and low

powered lasers. He is highly pro-active in the field and has received

numerous honors for his work. He is President and organizer of the annual

Laser Florence International Congress and Courses.

JSTQE

10

Dr. Ronald W. Waynant is a Senior Optical

Engineer at the Food and Drug

Administration, Rockville, MD. He was an

Adjunct Professor of Electrical Engineering

at Catholic University of America,

Washington DC and taught a graduate level

laser course for fourteen years there. He

currently serves on the Advisory Board to the

Catholic University Department of Electrical

Engineering. He is now an Adjunct

Associate Professor at the Uniformed

Services University for the Health Sciences

in Bethesda. Most recently, he has been

working on laser therapy mechanisms and various sources for and uses of

laser therapy. He is also interested in laser medicine, infrared fiber optics,

and laser generated x-rays for medical imaging. He has edited five books

in the electro-optics and laser medical areas and four special issues of

IEEE LEOS Journal of Special Topics in Quantum Electronics. He has

organized seven conferences for the Engineering Conferences

International organization on lasers, laser medicine and laser therapy. He

has also served on IEEE LEOS Board of Governors for fifteen years. His

research work in the past fifteen years has been funded by agencies such

as AFOSR, ONR, DARPA, and NSF. He is an Elected Fellow of the

American Institute of Medical and Biological Engineers (1996), Elected

Fellow of the Institute of Electrical and Electronic Engineers (1987),

Elected Fellow of the Optical Society of America (1988), Elected Fellow

of American Society for Laser Surgery and Medicine, Elected Fellow of

Washington Academy of Science. He has published more than 110 journal

papers and has given more than 120 presentations. He also has 10 patents.

He has just retired as Editor-in Chief of the IEEE Circuits and Devices

Magazine after twenty years.

Xingjia Wu received a B.S. degree in Biochemical Engineering from

Shanghai University, Shanghai, P. R. China. From 1999 to 2002, she was

a Research Assistant at the Institute of Biochemistry and Cell biology, the

Chinese Academy of Sciences, Shanghai, China. Since 2002, she has been

a Research Associate at Uniformed Services University of the Health

Science, Bethesda, MD. Her research is focusing on repair of acute and

chronic spinal cord injury with light therapy and cell transplantation.

Helina Moges received a B.S. degree in Biology from University of

Maryland, College Park, MD in 2004. She has been working as a

Laboratory Technician at the Uniformed Services University of the Health

Sciences since 2003. She plans to pursue a career in medicine in the

future.