Lack of Fas/CD95 Surface Expression in Highly ProliferativeLeukemic Cell Lines Correlates with Loss of CtBP/BARSand Redirection of the Protein toward GiantLysosomal Structures1

Inmaculada Monleon, Marıa Iturralde,Marıa Jose Martınez-Lorenzo, Luis Monteagudo,Pilar Lasierra, Luis Larrad, Andres Pineiro,Javier Naval, Marıa Angeles Alava, andAlberto Anel2

Departamento de Bioquımica y Biologıa Molecular y Celular, Facultadde Ciencias [I. M., M. I., A. P., J. N., M. A. A., A. A.]; Servicio deInmunologıa, Hospital Clınico Universitario [M. J. M-L., L. L., P. L.]; andDepartamento de Anatomıa, Embriologıa y Genetica, Facultad deVeterinaria [L. M.], Universidad de Zaragoza, Zaragoza E-50009, Spain

AbstractFas/CD95 is a type-I membrane glycoprotein, whichinduces apoptotic cell death when ligated by itsphysiological ligand. We generated previouslyhyperproliferative sublines derived from the human T-cell leukemia Jurkat, Jurkat-ws and Jurkat-hp, whichlost Fas/CD95 surface expression. We have nowobserved that the total amount of Fas protein is similarin the sublines and in the parental cells, indicating thatin the sublines Fas remains in an intracellularcompartment. We have found that the protein isdirected toward lysosomes in the sublines, where it isdegraded. This defect in the secretory pathwaycorrelates with loss of polyunsaturated fatty acids fromcellular lipids, and with the lack of expression ofendophilin-I and CtBP/BARS, enzymes that regulatevesicle fission by catalyzing the acylation of arachidonateinto lysophosphatidic acid. In addition, great multillamerbodies, which contained acid phosphatase activity,absent in the parental Jurkat cells, were observed bytransmission electron microscopy in the sublines.

IntroductionFas (CD95/Apo-1) is a type-I membrane glycoprotein, whichinduces apoptotic cell death when ligated by its physiolog-ical ligand in sensitive cells (1). Fas-induced apoptosis takes

place through the activation of the caspase cascade (2). TheFas/Fas ligand system is of great importance in the functionand regulation of the immune system. It is one of the effectormechanisms used by T cells in the elimination of viral infec-tions or tumoral development, its main function being thedown-modulation of the cellular immune response throughan autocrine/paracrine mechanism (3). Defects in this mech-anism are associated with systemic lymphoproliferative andautoimmune diseases (4, 5).

Loss of Fas surface expression in tumoral or infected cellswould make them more reluctant to control by the immunesystem. On the other hand, loss of proapoptotic mechanismsor overexpression of apoptosis inhibitors lie in the molecularetiology of cancer (6). In previous studies, we generatedhyperproliferative sublines derived from the human T-cellleukemia Jurkat by culture of the parental cells in serum-freemedium (Jurkat-ws) or in exhausted medium (Jurkat-hp), andselection of the resistant cells. These selected cells demon-strated a much higher proliferative rate and saturation den-sity than parental cells. Interestingly, these hyperproliferativesublines lost Fas surface expression and caspase-3 intracel-lular expression, and were resistant to Fas- and doxorubicin-induced apoptosis (7). The resistance to doxorubicin shouldbe rather attributed to loss of effector caspase expressionthan to loss of surface Fas expression (8). On the other hand,the hyperproliferative phenotype of these sublines correlatedrather with tyrosine phosphorylation of the p85 regulatorysubunit of phosphatidylinositol 3�-kinase (9).

In the present work, we have additionally analyzed thedefect in Fas expression in these sublines. The Jurkat-derived sublines lack the surface expression not only of Fasbut also of other functionally relevant surface proteins suchas CD3, CD2, and CD59 (7). Using immunoblot analysis, wehave observed that the total amount of Fas and CD3 proteinsis similar in the sublines and in the parental cells, indicatingthat the defect lies rather in the secretory pathway. Instead,we have found that, in the sublines, Fas is directed towardlysosomes where it is degraded, because inhibition of lyso-somal hydrolases increases the level of Fas protein in thesublines but not in the parental cells. This defect in thesecretory pathway correlates with loss of polyunsaturatedfatty acids from cellular lipids and with the complete lack ofexpression of endophilin-I and CtBP/BARS, enzymes thatregulate vesicle fission by catalyzing the acylation of arachi-donate into lysophosphatidic acid (10–13).

Results and DiscussionCell Surface Fas Expression Is Lost in HyperproliferativeJurkat Sublines but Accumulates in Their Cytoplasm. Wehave observed previously by flow cytometry analysis that the

Received 3/19/02; revised 5/30/02; accepted 6/30/02.The costs of publication of this article were defrayed in part by thepayment of page charges. This article must therefore be hereby markedadvertisement in accordance with 18 U.S.C. Section 1734 solely to indi-cate this fact.1 Supported by Grant P24/2000 from Diputacion General de Aragon/Fondo Social Europeo, Grant SAF2001-1774 from Direccion General deInvestigacion (Spain), and Grant 99/1250 from Fondo de InvestigacionesSanitarias (Spain). I. M. was supported by a Fellowship from DiputacionGeneral de Aragon.2 To whom requests for reprints should be addressed, at Departamentode Bioquımica y Biologıa Molecular y Celular, Facultad de Ciencias,Universidad de Zaragoza, Campus Pza. San Francisco, ZaragozaE-50009, Spain. Phone: 34-976-761279; Fax: 34-976-762123; E-mail:anel@posta.unizar.es.

315Vol. 13, 315–324, July 2002 Cell Growth & Differentiation

expression of several surface proteins (Fas/CD95, CD3,CD2, and CD59) was lost in Jurkat-ws and Jurkat-hp cells ascompared with the parental Jurkat cells(see Ref. 7 and Fig.1). However, the defect is not general to all of the surfacereceptors, because the expression level of the interleukin 2receptor (CD25) is similar to that of the parental Jurkat cells,as shown in Fig. 1.

We have next analyzed the expression of Fas and of CD3by immunoblot in these cells and results are shown in Fig. 2a.The anti-Fas antibody used detects a Mr 46,000 band aftercell protein separation by SDS-PAGE in nonreducing condi-tions, as described previously (14). Despite the lack of ex-pression of the protein on the surface of the sublines, theamount of the protein was rather the same in parental Jurkatcells and in the sublines (Fig. 2a, top panel). The same resultwas obtained for CD3-� expression using the mAb UCHT1,which detects a band at Mr 20,000 in all three of the cell lines,as shown in the bottom panel of Fig. 2a.

Next, we analyzed the cellular distribution of Fas usingconfocal microscopy. In Jurkat parental cells, Fas wasmostly localized in the plasma membrane or in cytoplasmiccompartments close to it (Fig. 2b). However, in Jurkat-wscells, the labeling pattern was completely different, not lo-calized in the plasma membrane, but rather following a cy-toplasmic and punctate distribution, with net accumulationof labeling in discrete intracellular regions (Fig. 2c). A similarstaining was obtained in Jurkat-hp cells (data not shown).The staining pattern in single cells was also analyzed in

successive focal planes, separated 1 �m. In the case ofJurkat cells, the staining followed the same pattern in all ofthe planes, indicating that the labeling was truly localized inthe plasma membrane. However, in the sublines, the stainingwas absent in the first and last focal planes, being concen-trated in the central part of the cell, additionally indicating adiscrete cytoplasmic localization (data not shown).

Fas Colocalizes with Lamp-1 in the Sublines but not inParental Jurkat Cells. The punctate, cytoplasmic Fasstaining pattern observed in the sublines was reminiscent ofthe cellular organization of lysosomes or late endosomes(15). To test this hypothesis, we localized by confocal mi-croscopy the distribution of Fas and of the lysosomal markerlamp-1 in Jurkat and in the sublines, and analyzed theircolocalization. As shown in the top panels of Fig. 3, Fas

Fig. 1. Surface expression of Fas/CD95, CD3, and CD25 in parentalJurkat cells, and in the hyperproliferative sublines Jurkat-hp and Jurkat-ws. Jurkat (top panels), Jurkat-hp (middle panels), or Jurkat-ws cells(bottom panels) were stained at 4°C with FITC-labeled anti-Fas mAbSM1/23, anti-CD3 mAb OKT3, or anti-CD25 mAb 3G10, and the surfaceexpression of the proteins analyzed by flow cytometry (black histograms).White histograms correspond to the staining of the same cells with anirrelevant mouse IgG coupled to the same fluorophore. Diagrams shownare representative of at least three different experiments performed foreach experimental condition.

Fig. 2. Expression of Fas/CD95 and CD3 in parental Jurkat cells and inthe hyperproliferative sublines Jurkat-ws and Jurkat-hp. a, proteins fromJurkat, Jurkat-ws, or Jurkat-hp cells (2 � 106 per lane) were extracted,separated by SDS-PAGE in nonreducing (top panel) or reducing condi-tions (bottom panel), transferred, and immunoblotted with the polyclonalanti-Fas antibody C20 (top panel) or with the anti-CD3� mAb UCHT1(bottom panel). The positions of molecular weight markers are indicatedon the left. b and c, Fas/CD95 was located by confocal microscopy byusing the SM1/23 mouse mAb and FITC-conjugated antimouse antibody.b, Jurkat cells; c, Jurkat-ws cells. Magnification, �2000.

316 Fas/CD95 Aberrant Expression in Leukemic Cell Lines

localized mainly at the plasma membrane of Jurkat cells(green fluorescence), whereas lamp-1 localized in cytoplas-mic bright spots (red fluorescence). When superimposed,almost no colocalization (yellow fluorescence) was observedbetween both markers. However, the staining patterns of Fasand of lamp-1 were very similar in Jurkat-ws and Jurkat-hpcells, and the colocalization of Fas with lamp-1 was com-plete (lower panels of Fig. 3). Some zones positive for lamp-1could also be observed that were negative for Fas staining,suggesting the presence of lysosomes devoid of Fas.

Inhibition of Lysosomal Hydrolases by Monensin In-creases the Level of Fas Protein in the Sublines but not inParental Jurkat Cells. The presence of Fas in lysosomeswould suggest that in the hyperproliferative sublines, once

the protein has arrived to the TGN3, it is channeled towardlysosomes for degradation. To test this hypothesis wetreated the parental Jurkat cells or the derived sublines withmonensin, which prevents lysosome acidification, thus inhib-iting the hydrolase activity of lysosomal lipid and proteindegrading enzymes (16). As shown in the bottom panels ofFig. 4, a and b, monensin treatment resulted in some reduc-tion in the amount of Fas in Jurkat cells, as analyzed by

3 The abbreviations used are: TGN, trans-Golgi network; MLB, multillame-lar body; RT-PCR, reverse transcription-PCR; TEM, transmission elec-tronic microscopy; mAb, monoclonal antibody.

Fig. 3. Colocalization of Fas/CD95 with the lysosomal marker lamp-1 inJurkat parental cells, and in the hyperproliferative sublines Jurkat-ws andJurkat-hp. Fas was located by confocal microscopy by using the SM1/23mouse mAb and FITC-conjugated antimouse antibody (green fluores-cence, left panels). Lamp-1 was located using a polyclonal rabbit antibodyand Cy3-conjugated antirabbit antibody (red fluorescence, middle pan-els). Fas staining images were superimposed with lamp-1 staining ones,as indicated, to show overlapping signals as yellow fluorescence (rightpanels). Magnification, �2000.

Fig. 4. Effect of the inhibition of lysosomal hydrolases by monensin or ofthe proteasome by lacatacystin on the amount of Fas protein in Jurkatcells and in the sublines. a and b, 2 � 106 Jurkat, Jurkat-ws (a), orJurkat-hp (b) cells were incubated for the times indicated in the absence(C) or presence of 10 �g/ml of monensin. c, 2 � 106 Jurkat, Jurkat-ws, orJurkat-hp cells were incubated for the times indicated in the absence (C)or presence of 2 �M of lactacystin. Proteins were extracted with a buffercontaining 1% Triton X-100, separated by SDS-PAGE, transferred, andimmunoblotted with the polyclonal anti-Fas antibody C20. Equivalentprotein loading in each lane was controlled by reblotting of the samemembrane with antitubulin antibody (top panels in a and b). The positionsof molecular weight markers are indicated on the left. The experimentsshown are representative of at least three different experiments for eachexperimental condition.

317Cell Growth & Differentiation

immunoblot, whereas the amount of Fas in Jurkat-ws orJurkat-hp cells progressively increased with the time of mon-ensin exposure. The same membranes were immunoblottedwith antitubulin antibody as a loading control, demonstratingthat the variations in the amount of Fas protein were specificfor this protein (see top panels of Fig. 4, a and b). Theseexperiments were repeated at least three times for eachexperimental condition, obtaining the same qualitative re-sults. As an additional control, we observed that the protea-some inhibitor lactacystin did not affect the level of Fasprotein in the parental Jurkat cells nor in the sublines(Fig. 4c).

This result suggests that, as a result of a defect in thesecretory pathway, Fas is channeled in the sublines from theTGN to lysosomal structures where it is degraded. However,because the steady-state amount of Fas protein in the sub-lines is similar to that of the parental cells, lysosomal degra-dation should be compensated by a high biosynthetic rate inthe sublines. This would not be surprising, given their highproliferation rate and saturation density. This also indicatesthat the mechanism by which Fas is not expressed at the cellsurface in these sublines is in fact a futile cycle betweenactive biosynthesis and active degradation.

Fas Lysosomal Localization in the Sublines Is Not Be-cause of Increased Endocytosis. Protein sorting from theTGN toward the plasma membrane or other cellular localiza-tions is governed by interaction of protein cytoplasmic tailswith specific adaptors (17). The aberrant lysosomal localiza-tion of Fas in the sublines could be because of a mutation inthe Fas cytoplasmic domain that normally leads the proteintoward the plasma membrane, following the constitutive se-cretory pathway, conferring the possibility of interaction withadaptors that leads the protein toward lysosomes instead.However, this possibility is not very plausible, because othercell surface proteins, such as CD3, are also expressed at thesame level in the sublines, being absent from the plasma

membrane. Hence, the cause for the aberrant lysosomallocalization of cell surface proteins in the sublines should beattributed to a more general defect.

One possibility could be that the endocytosis rate of cellsurface proteins in the sublines would be much higher thanin the parental cells. In this case, the protein would arrive tothe plasma membrane and would immediately be endocy-tosed, with the steady-state level of cell surface expressionbeing negligible. Endocytic compartments finally fuse withlysosomes in agreement with the lysosomal localization ofFas in the sublines shown in Fig. 3. In fact, such a mechanismis used by adenovirus to down-modulate death receptorexpression in infected cells. The adenovirus protein RID in-teracts with Fas and also with DR4, a death receptor forAPO2 ligand/tumor necrosis factor-related apoptosis-induc-ing ligand, inducing its internalization and lysosomal degra-dation, making the infected cells less susceptible to immunecontrol (18, 19). To test this hypothesis, we used the actin-disrupting agent latrunculin A, which has been shown toinhibit receptor-mediated endocytosis (20). The inhibition ofreceptor internalization by latrunculin A results in the in-crease of cell surface expression of the transferrin receptor,for example (20). Hence, if our hypothesis was correct, wewould see some Fas cell surface expression in the sublinestreated with latrunculin A. However, as shown in the toppanels of Fig. 5, latrunculin A treatment did not restore Fassurface expression in Jurkat-ws nor in Jurkat-hp cells.

Loss of Arachidonic Acid in Cellular Lipids of the Sub-lines. Arachidonic Acid Supplementation Does Not Re-store Fas Surface Expression. Lipids are essential regula-tors of membrane traffic, both at the level of the secretorypathway and of the endocytic pathway, although a clearunderstanding of their specific role is far from sight. Phos-phoinositides are the best studied lipids, and their role in therecruitment of protein adaptors, and effectors in the secre-tory and endocytic pathways is clear (21, 22). Recently, the

Fig. 5. Effect of endocytosis inhibition bylatrunculin A and of arachidonic acid supple-mentation on Fas/CD95 surface expressionin Jurkat cells and in the sublines. Jurkat(left panels), Jurkat-ws (middle panels), orJurkat-hp cells (right panels) were left un-treated, were incubated for 1 h with 40 �g/mlof latrunculin A (�Latr, top panels), or weresupplemented with 10 �M arachidonic acidbound to serum proteins for 48 h (�20:4,bottom panels). After the incubations, cellswere stained at 4°C with FITC-labeled anti-Fas mAb SM1/23 and Fas/CD95 surface ex-pression analyzed by flow cytometry. Dia-grams shown are representative of at leastthree different experiments performed foreach experimental condition.

318 Fas/CD95 Aberrant Expression in Leukemic Cell Lines

role of ordered lipid rafts in these processes, apart from theirrole in signal transduction, is beginning to be considered(23). However, the role of other important lipid parameters,such as their specific fatty acid composition, has to be stud-ied still in more detail. Related to that, an interesting obser-vation has been made by two different groups (12, 13).Schmidt et al. (12) found that the protein endophilin-I, whichbinds to dynamin, was essential for the formation of synap-tic-like microvesicles from the plasma membrane. This wasassociated with the lysophosphatidic acid arachidonyl trans-ferase activity of endophilin-I. Weigert et al. (13) demon-strated that a protein termed CtBP/BARS, characterized asan essential protein to maintain Golgi structure (24), inducedGolgi vesiculation through the same lysophosphatidic acidarachidonyl transferase activity. Lysophosphatidic acid is alipid with an inverted cone shape, whereas phosphatidicacid, the product of arachidonyl esterification, has a coneshape (10, 11). Hence, the enzymatic activity of endophilin-Ior CtBP/BARS, acting on the neck of a membrane budding,results in a change in the intrinsic curvature of the cytosolicmonolayer because of a change in lipid composition, leadingfinally to vesicle fission (23).

Taking into account that one of the most prominent effectsof culture in serum-free medium would be a change in thefatty acid composition of cellular lipids, we analyzed the fattyacid composition of Jurkat-ws cells compared with the pa-rental Jurkat cells. The prolonged culture in serum- andessential fatty acid-free medium resulted in the completeloss of arachidonic and other polyunsaturated fatty acids,and a concomitant increase in the content of monounsat-urated fatty acids (Table 1). Hence, the most obvious effectof the described changes in fatty acid composition was amarked decrease in the ratio of polyunsaturated:monounsat-

urated fatty acids, from 0.37 in Jurkat to 0 in Jurkat-ws cells(see Table 1). The observed increase in the proportion ofmonounsaturated fatty acids (4-fold for 16:1n-7, 42% for18:1n-9, 2-fold increase for 18:1n-7) and especially in n-7fatty acids is a predictable result of essential fatty aciddeficiency (25). Strikingly, the fatty acid composition ofJurkat-hp cells, which are cultured in medium with serum,was very similar to that of Jurkat-ws cells. A marked reduc-tion in the proportion of polyunsaturated and an enrichmentin monounsaturated fatty acids was also observed with re-spect to parental cells, with a reduction of the polyunsatu-rated:monounsaturated fatty acid ratio of 9-fold. Arachidonicacid content was also markedly reduced in Jurkat-hp cellscompared with parental cells, from 7.1% to 1%. This markeddifference in fatty acid composition could be related to theobserved defect in the secretory pathway, because the gen-eration of constitutive secretory vesicles from the TGN couldbe impaired if CtBP/BARS activity is decreased because ofsubstrate depletion. To test this hypothesis, we supple-mented the culture medium of the cells with arachidonic acid(20:4 n-6) bound to BSA during 48 h and analyzed the levelof Fas expression by flow cytometry. We also confirmed bylipid analysis that supplemented arachidonic acid was incor-porated at a similar rate in the three cell lines (data notshown). However, the enrichment in this polyunsaturatedfatty acid did not restore Fas expression in the sublines, asshown in the bottom panels of Fig. 5.

Loss of Endophilin I and CtBP/BARS Expression in theSublines. The fact that Fas surface expression was notrestored by arachidonic acid supplementation could alsobe because of the absence of endophilin I and/or CtBP/BARS expression in the sublines. Hence, we analyzed theexpression of mRNA for these proteins in the sublines andin Jurkat parental cells by RT-PCR using specific primersbased on the sequences described (12, 13). As shown inFig. 6, whereas parental Jurkat cells expressed detectableamounts of both endophilin-I and CtBP/BARS mRNA, nei-ther Jurkat-ws nor Jurkat-hp cells expressed mRNA forthese two proteins.

The absence of these essential regulators of vesicle gen-eration from the TGN would be sufficient to account for the

Table 1 Fatty acid composition of Jurkat and derivedhyperproliferative sublines

Data are expressed as percentage (by weight) of the total cellular fattyacids and are the mean � SD of results obtained in three differentexperiments with samples analyzed in duplicate.

Fatty acid Jurkat Jurkat-ws Jurkat-hp

14:0 2.0 � 0.1 3.2 � 0.5 3.5 � 0.114:1 1.1 � 0.1 0.4 � 0.1 n.d.a

16:0DMA 1.7 � 0.2 0.7 � 0.1 n.d.16:0 27.2 � 0.1 17.1 � 0.4 25.1 � 0.616:1(n-9) 3.0 � 0.1 0.7 � 0.1 n.d.16:1(n-7) 2.8 � 0.1 12.9 � 0.8 11.6 � 0.718:0 15.9 � 1.6 8.2 � 0.7 10.0 � 0.518:1(n-9) 21.6 � 0.1 30.7 � 2.0 33.2 � 0.918:1(n-7) 8.2 � 0.1 19.4 � 1.5 13.8 � 0.718:2(n-6) 2.3 � 0.5 n.d. 1.4 � 0.120:1(n-9) 1.1 � 0.1 1.2 � 0.1 n.d.20:1(n-7) n.d. 1.6 � 0.1 n.d.20:4(n-6) 7.1 � 0.7 n.d. 1.0 � 0.122:4(n-6) n.d. n.d. n.d.22:5(n-6) n.d. n.d. n.d.22:6(n-3) 4.7 � 0.2 n.d. n.d.�g FA/106 cells 7.8 � 0.2 3.2 � 0.3 6.6 � 0.7Ratio polyunsaturates:

monounsaturates0.37 0.00 0.04

a n.d., not detected, DMA, dimethyl acetal from alkenyl side chains ofplasmalogens.

Fig. 6. Expression of mRNA for endophilin-I and CtBP/BARS in Jurkatcells or in the sublines. Total RNA (1 �g) was obtained from Jurkat,Jurkat-ws, or Jurkat-hp cells, reversed transcribed, and the resultingcDNA subjected to PCR. Endophilin-I and CtBP/BARS fragments of 716bp or 239 bp, respectively, were amplified and separated in agarose gels,as indicated. The same protocol was used to amplify a �-actin fragmentfrom the same samples, used as a loading control in the bottom panel. Theexperiment shown is representative of five different experiments.

319Cell Growth & Differentiation

observed defect in the secretory pathway in these sublinescompared with the parental cells. Indeed, the defect is gen-eral enough to justify that a similar situation is observed forother membrane proteins, such as the TCR/CD3 complex,and to account for the lack of surface expression of manyother functionally relevant receptors, such as CD2, CD59 (7),CD4, CD43, and CD37 (data not shown). However, not all ofthe membrane proteins can be absent from the surface ofthose cells, because they have an active metabolism andneed to incorporate nutrients at a high rate. For example, theinterleukin 2 receptor (CD25) is expressed at the same levelin the sublines and in the parental cells, as shown in Fig. 1.

This result suggests that different pathways of constitutivesecretion of membrane proteins should exist.

Great Multillamer Bodies with Lysosomal Features ArePresent in the Sublines but not in Jurkat Parental Cells.Although the secretory pathway is greatly impaired in thesublines, the formation of lysosomes seems to proceed nor-mally (see Fig. 3). Both the constitutive secretion vesiclesand the lysosomes form from buddings that emerge from theTGN. We have performed TEM studies on the parental cellsand, comparatively, in the sublines to detect possible differ-ences in lysosome formation. As shown in Fig. 7A, most ofthe volume of Jurkat cells is occupied by the nucleus (n),

Fig. 7. TEM of Jurkat and of the hyperprolif-erative sublines. Jurkat (A and B), Jurkat-hp (Cand D), and Jurkat-ws cells (E and F) wereembedded in a low-viscosity epoxy resin,using the Spurr protocol and ultrathin sec-tions observed in a transmission electronicmicroscope.

320 Fas/CD95 Aberrant Expression in Leukemic Cell Lines

because the cytoplasm:nucleus ratio is small. Some typicalstructures can be observed in the cytoplasm of Jurkat cells,such as mitochondria (m), with sizes between 2 and 0.9 �m,depending on the cut angle, and round multivesicular bodies(Fig. 7A, marked with arrows), with a size not exceeding 0.6�m. In addition, smaller, electron-dense round structureswith sizes corresponding with that described for mature ly-sosomes (between 100 and 240 nm) could be observed (Fig.7A, marked with arrowheads). A higher magnification ofthese compartments shows their nonmultivesicular ultra-structure (Fig. 7B). Jurkat-hp and Jurkat-ws cells had a sim-ilar cytoplasm:nucleus ratio as Jurkat cells (Fig. 7, C and E,respectively). The most striking feature of these cells was thepresence of big multilamellar cytoplasmic structures, markedwith arrowheads in Figs. 7, C and E, and with sizes between1 and 2 �m, occasionally containing an electron-dense in-clusion. Higher magnification of these compartments showtheir big size and ultrastructure characterized by the accu-mulation of membranous material in its interior (Figs. 7, Dand F for Jurkat-hp and Jurkat-ws cells, respectively).

We then performed acid phosphatase cytochemistry toshow the localization of this specific lysosomal enzyme.As shown in Fig. 8, the enzyme was only localized in thesmall structures observed previously in Jurkat cells(Fig. 8A), and in the giant MLBs observed in Jurkat-hp(Fig. 8B) and Jurkat-ws cells (Fig. 8C). The enzyme waslocalized in discrete regions of the MLBs, associated withinternal membranes.

Secretory vesicles form from TGN buddings, which do nothave a clathrin coat, whereas lysosomal vesicles do (26).During clathrin-mediated endocytosis, the large molecularweight GTPase dynamin assembles as a ring around theneck of the invaginated coated pit and seems to be impli-cated in the final fission step directly or indirectly by recruit-ment of other proteins (27). Endophilin-I is one of the dy-namin binding partners (12, 27, 28), and given its describedfunction in fission through modification of lipid compositionat the budding neck (12), it is conceivable that both dynaminand endophilin-I are implicated in fission (27). On the otherhand, CtBP/BARS has been shown to mediate vesicle fissionfrom the Golgi by the same enzymatic activity described forendophilin-I (13). However, in that study, clathrin and/or dy-namin are not implicated in the fission process, which seemsmore related with constitutive secretory vesicle generation(13). Hence, the lysophosphatidic acid arachidonyl transfer-ase activity seems to be implicated in vesicle fission pro-cesses both dependent and independent of clathrin anddynamin. In our system, loss of endophilin-I and CtBP/BARSexpression correlates with the impairment of constitutivesecretion, indicating that this clathrin- and dynamin-inde-pendent process could be dependent on the expression ofthose enzymes. On the other hand, our TEM data indicatethat the generation of lysosomes is also affected in thesublines. In these cells in which normal vesicle fission fromthe TGN is probably impaired, and with a high proliferativeand biosynthetic rate, the driving force for lysosomal bud-ding and fission could be the condensation of great amountsof cargo. The big size (�1 �m) of the MLBs observed by TEMonly in the sublines as compared with the smaller lysosomal

size in hematopoietic cells (100–200 nm) would be in agree-ment with this hypothesis. On the other hand, the origin ofsimilar MLBs has been assigned in other cell types to auto-phagy (29), and this would be another plausible explanationfor the formation of big MLBs in the sublines. In these cells,as a consequence of the defect in the secretory pathway, thefinal TGN structures could collapse in an autophagic-likeprocess because of concentration of undelivered cargo andmembranes.

Fig. 8. Acid phosphatase cytochemistry of Jurkat and of the hyperpro-liferative sublines. Jurkat (A), Jurkat-hp (B), and Jurkat-ws cells (C) weresubjected to the acid phosphatase cytochemistry protocol described in“Materials and Methods,” and afterward samples were treated in the sameway as indicated in the legend of Fig. 7.

321Cell Growth & Differentiation

This study defines a striking new mechanism of down-regulation of cell surface receptors in sublines derived fromthe Jurkat T-cell leukemia. Additional work is needed tocharacterize whether reconstitution of endophilin-I and/orCtBP/BARS expression would result in receptor surface ex-pression or if other steps in the secretory pathway could bealso affected. Whether this mechanism is shared by othertumoral cells awaits characterization. The down-modulationof death receptors from tumoral cells would increase theirindependence from regulatory homeostatic mechanismsand/or immune control. However, this cannot be directlyassociated with the hyperproliferative potential of the sub-lines studied, which should rather be attributed to the loss ofexecutor caspase expression and with the tyrosine phospho-rylation of the p85 subunit of phosphatidylinositol-3� kinase,as described previously (7, 9).

Materials and MethodsMaterials. Monensin, butylated hydroxytoluene, arachi-donic, and N-heptadecanoic acids, as well as the antitubulinmAb B512 and the secondary antirabbit antibody coupled toalkaline phosphatase used for immunoblot were from Sigma(Madrid, Spain). Lactacystin was from Calbiochem (Bad So-den, Germany). Latrunculin A was from Molecular ProbesEurope (Leiden, the Netherlands). The rabbit polyclonal anti-Fas antibody C-20 from Santa Cruz Biotechnology (SantaCruz, CA) was used for immunoblot studies, whereas forconfocal microscopy and flow cytometry determinations ofFas surface expression, we used the mouse mAb SM1/23(Bender Medsystems, Vienna, Austria), unconjugated orFITC-labeled, respectively. The anti-CD3-� mAb OKT3 andthe anti-CD25 mAb 3G10, both conjugated with FITC andused for flow cytometry determinations, were respectivelyfrom Coulter and Caltag, Barcelona, Spain. The anti-CD3-�

mAb UCHT1, purified from the supernatant of the corre-sponding hybridoma, a kind gift of Dr. Marisa Toribio, Centrode Biologıa Molecular, Madrid, Spain, was used for immu-noblot. The rabbit anti-lamp1 antibody used for confocalmicroscopy was kindly provided by Dr. Jean Pierre Gorvel,Centre d’Immunologie de Marseille-Luminy, Luminy, France.Secondary antimouse antibody labeled with FITC and anti-rabbit antibody labeled with Cy3 were from Caltag. DNAprimers for RT-PCR analysis of endophilin-I and CtBP/BARSexpression were obtained from Genotek (Barcelona, Spain).

Cells and Cell Culture. The human T-cell leukemia Jur-kat, clone E6.1 (American Type Culture Collection, Rockville,MD) was cultured in RPMI 1640 supplemented with 10%FCS, 2 mM L-glutamine, 100 units/ml penicillin, and 100�g/ml streptomycin (hereafter, complete medium).

The Jurkat-hp subline was generated by prolonging cul-tures in exhausted culture medium, allowing it to reach un-usually high cell densities. Viable cells were separated fromdead cells by Ficoll-Hypaque density centrifugation, and theprocedure was repeated for several passages. Jurkat-hpcells exhibit a shorter doubling time and a 6-fold greatersaturation density than parental Jurkat cells, and are culturedin the same complete culture medium (7). The Jurkat-wssubline was generated by prolonged culture (�8 months) ina serum-free medium, as described previously (7). Jurkat-ws

cells showed a shorter doubling time and a 3-fold greatersaturation density than parental Jurkat cells. Cells were freeof Mycoplasma, as routinely tested by RT-PCR.

Immunoblotting. Detection of Fas in cell lysates (2 � 106

cells per lane) was performed by immunoblot using the rabbitpolyclonal anti-Fas antibody C-20 and a secondary antirabbit antibody coupled to alkaline phosphatase. Immuno-reactivity was detected by incubation with bromo-4-chloro-3-indolylphosphate and nitroblue tetrazolium. In someexperiments, cells were incubated previously during 3 or 7 hwith 10 �g/ml of the lysosomotropic agent monensin (16), orwith 2 �M of the specific proteasome inhibitor lactacystin(30). At the end of the incubations, cells were washed, cel-lular proteins extracted with a lysis buffer containing 1%Triton X-100, proteins separated by SDS-PAGE, transferredto nitrocellulose membranes, and immunoblotted as indi-cated. Protein loading was controlled by reblotting of thesame membrane with antitubulin antibody.

Confocal Microscopy. Cells were collected from the cul-tures, washed with PBS, and fixed in a solution of 4%paraformaldehyde in PBS. Cell suspensions were thenplaced onto round coverglasses treated previously with L-polylysine, which were sequentially incubated with 1/200dilutions of the primary anti-Fas or anti-lamp-1 antibodies inPBS with a 5% goat serum and 0.1% saponin, and 1/200dilutions of the secondary antibodies in PBS with 0.1% sap-onin. After several washings, coverglasses were mountedonto glass slides using Mowiol (Calbiochem, Madrid, Spain).Preparations were observed in a Zeiss 310 confocal micro-scope, analyzed using the LSM 3.95 software, and finallyprocessed using the Adobe PhotoShop 5.0 software. Singlecells were observed in 10 successive focal planes, separated1 �m, and adjusted from the bottom to the top of the cell. Thepictures showing single cells correspond to the central partof the cell, normally the fifth/sixth focal plane. No labelingwas observed when using the secondary antibodies alone.

Analysis of Protein Surface Expression by Flow Cytom-etry. Cells (5 � 105) were collected from the cultures, re-suspended in 50 �l of ice-cold PBS containing 0.2% BSA,and treated with 5 �g/ml of the FITC-labeled anti-Fas mAbSM1/23 for 1 h at 4°C. Cells were washed twice in cold bufferand fixed with 1% paraformaldehyde in PBS (pH 7.4). Thesamples were analyzed on an EPICS XL-MCL cytometer(Coulter). In some experiments, cells were incubated previ-ously for 1 h with 40 �g/ml of the actin-disrupting agentlatrunculyn A (20) or were supplemented with arachidonicacid for 48 h, as indicated below.

Arachidonic Acid Supplementation and Lipid Analysis.In some experiments, cells were cultured for 48 h in thepresence of arachidonic acid (10 �M) before the analysis ofFas surface expression. Arachidonic acid was added boundto carrier proteins of the fetal serum used as culture supple-ment (31) and did not inhibit cell proliferation at the concen-trations used. For lipid analysis, control or supplementedcells were collected, washed twice by resuspension in ice-cold PBS, and cell lipids extracted by vigorous shaking inchloroform/methanol (2/1, v/v) as described previously (31).Aliquots of the antioxidant butylated hydroxytoluene (1 �g/106 cells) and of the internal standard N-heptadecanoic acid

322 Fas/CD95 Aberrant Expression in Leukemic Cell Lines

(2 �g/106 cells) were then added. Fatty acid methyl estersfrom total cell lipids were prepared by treatment with 5%H2SO4 in anhydrous methanol under nitrogen atmosphere at80°C for 1.5 h. Fatty acid methyl esters were analyzed bygas-liquid chromatography in a Shimadzu GC-14A chro-matograph, equipped with a SP-2330 capillary column (30m � 0.25 mm; Supelco, Barcelona, Spain), a flame ionizationdetector, and a computerized integrator. Fatty acids wereidentified by comparison with the appropriate commer-cial standards and quantified by comparison with the N-heptadecanoic integration area.

RT-PCR Analysis of Endophilin-I and CtBP/BARS Ex-pression. Total RNA was obtained from Jurkat and sublinescells using a Quickprep total RNA purification kit (Sigma)according to the manufacturer’s instructions. Total RNA (1�g) was reversed-transcribed with Superscript II Rnase H-reverse transcriptase using random hexameric primers (Firststrand cDNA synthesis kit; Life Technologies, Inc.). The re-sulting cDNA was subjected to PCR. Primers used to amplify�-actin have been described previously (32). Primers usedto amplify human endophilin I and CtBP/BARS cDNA werethe following: (a) endophilin I (716 bp cDNA fragment; 5�)TCATCCAGCCCCACCAAGTG and (3�) ATATTTGTTC-CCCTT CCCTGTG; and (b) CtBP/BARS (239 bp cDNAfragment; 5�) GGGAGAGAGCATGTGTGTGGT and (3�)GACAGCTAAGCAAACAGATCCT. RT-PCR reactions wereperformed using a thermal program of 95°C for 5 min; 30cycles of 95°C for 1 min, 56°C for 1 min, and 72°C for 1min; and then 72°C for 10 min. A total of 10% of the finalPCR products were loaded onto a 2% agarose gel.

Transmission Electron Microscopy. Cell pellets (50 �

106 cells) were washed, fixed with 2% paraformaldehydeplus 2.5% glutaraldehyde in PBS, osmified, dehydrated, andembedded in a low-viscosity epoxy resin using the Spurrprotocol (33). Ultrathin sections (60 nm) were cut using aLeica Ultracut unit and collected onto Formvar-coated goldgrids. Grids were contrasted with 2% uranyl acetate for 20min and Reynolds solution for 3 min, and observed in a JeolJEM 1010 transmission electronic microscope at 80 kV. Acidphosphatase cytochemistry was performed using themethod of Hand and Oliver (34). Cells were fixed for 10 minin suspension with 1% paraformaldehyde/1% glutaralde-hyde/0.05% CaCl2/0.1 M sodium cacodylate (pH 7.4), pel-leted, embedded in agar, and stored overnight in cacodylatebuffer containing 7% sucrose. Blocks were washed with 5%sucrose/20 mM sodium acetate (pH 5.0) and incubated for1 h at 37°C in 0.1% cytidine 5�-monophosphate/3.6 mM leadnitrate/5% sucrose/20 mM sodium acetate (pH 5.0). Theywere treated briefly with 1% ammonium sulfate, and post-fixed and processed as indicated above.

AcknowledgmentsWe thank Dr. Marta Taules, Servicios Cientıfico-Tecnicos, Universidad deBarcelona, for TEM, Dr. Jean Pierre Gorvel, Centre d’Immunologie deMarseille-Luminy, Francia, for anti-lamp-1 antibodies, and Dr. MarisaToribio, Centro de Biologıa Molecular, Universidad Autonoma de Madrid,for UCHT1 mAb.

References1. Nagata, S., and Golstein, P. The Fas death factor. Science (Wash. DC),267: 1449–1456, 1995.

2. Rathmell, J. C., and Thompson, C. B. The central effectors of cell deathin the immune system. Annu. Rev. Immunol., 17: 781–828, 1999.

3. Lenardo, M., Chan, F. K. M., Hornung, F., MacFarland, H., Siegel, R.,Wang, J., and Zheng, L. Mature T lymphocyte apoptosis: immune regu-lation in a dynamic and unpredictable antigenic environment. Annu. Rev.Immunol., 17: 221–253, 1999.

4. Rieux-Laucat, F., Le Deist, F., Hivroz, C., Roberts, I. A. G., Debatin,K. M., Fischer, A., and de Villartay, J. P. Mutations in Fas associated withhuman lymphoproliferative syndrome and autoimmunity. Science (Wash.DC), 268: 1347–1350, 1995.

5. Watanabe-Fukunaga, R., Brannan, C. I., Copeland, N. G., Jenkins,N. A., and Nagata, S. Lymphoproliferation disorder explained by defectsin Fas antigen that mediates apoptosis. Nature (Lond.), 356: 314–317,1992.

6. Thompson, C. B. Apoptosis in the pathogenesis and treatment ofdisease. Science (Wash. DC), 267: 1456–1462, 1995.

7. Martınez-Lorenzo, M. J., Gamen, S., Etxeberria, J., Lasierra, P., Larrad,L., Pineiro, A., Anel, A., Naval, J., and Alava, M. A. Resistance to apoptosiscorrelates with a highly proliferative phenotype and loss of Fas and CPP32(caspase-3) expression in human leukemias. Int. J. Cancer, 75: 473–481,1998.

8. Gamen, S., Anel, A., Lasierra, P., Alava, M. A., Martinez-Lorenzo, M. J.,Pineiro, A., and Naval, J. Doxorubicin-induced apoptosis in human T-cellleukemia is mediated by caspase-3 activation in a Fas-independent way.FEBS Lett., 417: 360–364, 1997.

9. Martınez-Lorenzo, M. J., Anel, A., Monleon, I., Sierra, J. J., Pineiro, A.,Naval, J., and Alava, M. A. Tyrosine phosphorylation of the p85 subunit ofphosphatidylinositol 3-kinase correlates with high proliferation rates insublines derived from the Jurkat leukemia. Int. J. Biochem. Cell Biol., 32:435–445, 2000.

10. Barr, F. A., and Shorter, J. Membrane traffic: do cones mark sites offission? Curr. Biol., 10: R141–R144, 2000.

11. Scales, S. J., and Scheller, R. H. Lipid membranes shape up. Nature(Lond.), 401: 123–124, 1999.

12. Schmidt, A., Wolde, M., Thiele, C., Fest, W., Kratzin, H., Podtelejni-kov, A. V., Witke, W., Huttner, W. B., and Soling, H. D. Endophilin Imediates synaptic vesicle formation by transfer of arachidonate to lyso-phosphatidic acid. Nature (Lond.), 401: 133–140, 1999.

13. Weigert, R., Silletta, M. G., Spano, S., Turacchio, G., Cericola, C.,Colanzi, A., Senatore, S., Mancini, R., Polishchuk, E. V., Salmona, M.,Facchiano, F., Burger, K. N. J., Mironov, A., Luini, A., and Corda, D.CtBP/BARS induces fission of Golgi membranes by acylating lysophos-phatidic acid. Nature (Lond.), 402: 429–433, 1999.

14. Ruiz-Ruiz, C., Robledo, G., Font, J., Izquierdo, M., and Lopez-Rivas,A. Protein kinase C inhibits CD95 (Fas/APO-1)-mediated apoptosis by atleast two different mechanisms in Jurkat T cells. J. Immunol., 163: 4737–4746, 1999.

15. Meresse, S., Gorvel, J. P., and Chavrier, P. The rab7 GTPase resideson a vesicular compartment connected to lysosomes. J. Cell Sci., 108:3349–3358, 1995.

16. Gamen, S., Anel, A., Pineiro, A., and Naval, J. Caspases are the mainexecutoniers of Fas-mediated apoptosis, irrespective of the ceramide-signaling pathway. Cell Death Differ., 5: 241–249, 1998.

17. Rohn, W. M., Rouille, Y., Waguri, S., and Hoflack, B. Bi-directionaltrafficking between the TGN and the endosomal/lysosomal system. J. CellSci., 113: 2093–2101, 2000.

18. Tollefson, A. E., Hermiston, T. W., Liechtenstein, D. L., Colle, C. F.,Tripp, R. A., Dimitrov, T., Toth, K., Wells, C. E., Doherty, P. C., and Wold,W. S. M. Forced degradation of Fas inhibits apoptosis in adenovirus-infected cells. Nature (Lond.), 392: 726–730, 1998.

19. Tollefson, A. E., Toth, K., Doronin, K., Kuppuswamy, M., Doronina,O. A., Lichtenstein, D. L., Hermiston, T. W., Smith, C. A., and Wold,W. S. M. Inhibition of TRAIL-induced apoptosis and forced internalization

323Cell Growth & Differentiation

of TRAIL receptor 1 by adenovirus proteins. J. Virol., 75: 8875–8887,2001.

20. Lamaze, C., Fujimoto, L. M., Yin, H. L., and Schmid, S. L. The actincytoskeleton is required for receptor-mediated endocytosis in mammaliancells. J. Biol. Chem., 272: 20332–20335, 1997.

21. Martin, T. F. J. PI(4, 5)P2 regulation of surface membrane traffic. Curr.Opin. Cell Biol., 13: 493–499, 2001.

22. Roth, M. G. Lipid regulators of membrane traffic through the Golgicomplex. Trends Cell Biol., 9: 174–179, 1999.

23. Huttner, W. B., and Zimmerberg, J. Implications of lipid microdomainsfor membrane curvature, budding and fission. Curr. Opin. Cell Biol., 13:478–484, 2001.

24. Spano, S., Silletta, M. G., Colanzi, A., Alberti, S., Fiucci, G., Valente,C., Fusella, A., Salmona, M., Mironov, A., Luini, A., and Corda, D. Molec-ular cloning and functional characterization of brefeldin A-ADP-ribosy-lated substrate. A novel protein involved in the maintenance of the Golgistructure. J. Biol. Chem., 274: 17705–17710, 1999.

25. Cook, H. W. Fatty acid desaturation and chain elongation in euca-ryotes. In: D. E. Vance and J. E. Vance (eds.), Biochemistry of Lipids,Lipoproteins and Membranes, pp. 141–154. Amsterdam: Elsevier, 1991.

26. von Figura, K. Molecular recognition and targeting of lysosomal pro-teins. Curr. Opin. Cell Biol., 3: 642–646, 1991.

27. Hill, E., van der Kaay, J., Downes, C. P., and Smythe, E. The role ofdynamin and its binding partners in coated pit invagination and scission.J. Cell Biol., 152: 309–323, 2001.

28. Ringstad, N., Nemoto, Y., and De Camilli, P. The SH3p4/SH3p8/SH3p13 protein family: binding partners for synaptojanin and dynamin viaa Grb2-like SH3 domain. Proc. Natl. Acad. Sci. USA, 94: 8569–8574,1997.

29. Hariri, M., Millane, G., Guimond, M. P., Guay, G., Dennis, J. W., andNabi, I. R. Biogenesis of multilamellar bodies via autophagy. Mol. Biol.Cell., 11: 255–268, 2000.

30. Fentenay, G., and Schreiber, S. L. Lactacystin, proteasome functionand cell fate. J. Biol. Chem., 273: 8545–8548, 1998.

31. Anel, A., Naval, J., Desportes, P., Gonzalez, B., Uriel, J., and Pineiro,A. Increased cytotoxicity of polyunsaturated fatty acids on human tumoralB and T-cell lines compared with normal lymphocytes. Leukemia (Balti-more), 6: 680–688, 1992.

32. Raff, T., van der Giet, M., Endemann, D., Wiederholt, T., and Paul, M.Design and testing of �-actin primers for RT-PCR that do not co-amplifyprocessed pseudogenes. Biotechniques, 23: 456–460, 1997.

33. Spurr, A. R. A low-viscosity epoxy resin embedding medium forelectron microscopy. J. Ultrastruct. Res., 37: 146–156, 1969.

34. Hand, A. R., and Oliver, C. Effects of secretory stimulation on theGolgi apparatus and GERL of rat parotid acinar cells. J. Histochem.Cytochem., 32: 403–412, 1984.

324 Fas/CD95 Aberrant Expression in Leukemic Cell Lines