indian journal of animal nutrition

INDIAN JOURNAL OF ANIMAL NUTRITION(A quarterly publication)

EDITORIAL BOARD

Ashish Tyagi, University of Louisville, Louisville, United

States

Luisa Biondi, University of Catania, Catania, Italy

Dragan Sefer, Belgrade University Serbia, Serbia

Nurcan Cetinkaya, Turkey

Seyed Hadi Ebrahimi, Ferdowsi University of Mashhad,

Iran

Vinod Kumar Sidhu, DUVAS, Mathura, Uttar Pradesh

V.B. Chaturvedi, ICAR-IVRI, Izatnagar, Uttar Pradesh,

India

P.K. Nayak, ICAR-CARI, Bhubaneswar, Odisha

P.M. Chatterjee, West Bengal University of Animal and

Fishery Sciences, West Bengal

Goutam Mondal, ICAR-NDRI, Karnal, Haryana

K.C. Das, ICAR- CIFA, Mumbai, Maharashtra

Parimal Sardar, ICAR-CIFE, Mumbai, Maharashtra

A. Sahoo, Avikanagar, Rajasthan

B.N. Saikia, Assam

R.K. Swain, Bhubaneswar, Odisha

S.K. Mahanta, IGFRI, Jhansi, Uttar Pradesh

A.S. Mishra, ICAR, New Delhi

N.S. Maan, Hisar, Haryana

PUBLICATION MANAGEMENT

COMMITTEE

Asit Das, Karnal, Haryana - Chairman

A.K. Tyagi, Karnal, Haryana

T.K. Walli, Karnal, Haryana

R.C. Chopra, Karnal, Haryana

Bhupinder Singh, Karnal, Haryana

Veena Mani, Karnal, Haryana

S.V. Rama Rao, Hyderabad, Telangana

S.K. Verma, Hyderabad, Telangana

Raman Malik, Karnal, Haryana

Sachin Kumar, Karnal, Haryana

P. Vashan, Namakkal, Tamil Nadu

IJAN is supplied free of cost to members of ANSI

Life Membership of Animal Nutrition Society of

India

Membership

A person interested in the activities of the Society who

pays a lumpsum fee of Rs. 4000/- could become Life

Member of the Society. For students the life membership

fee is Rs. 2500/- subject to production of a proof from

his guide. A Life Member will have all the rights and

privileges of an Ordinary Member. The Life Membership

Fee of Foreign Members for SAARC countries is US $

100/- and NON SAARC countries is US $ 100/-

S. Category Amount

No. (Annual)

1 Government and Public Institution Rs. 6000/-

2 Agents fees including postage Rs. 7500/-

(1 year)

3 Benefactor members Rs. 25000/-

(for 10 years)

4 Sustaining members Rs. 25000/-

(for 10 years)

5 For SAARC countries USD 100/-

(postage extra)

6 For other countries USD 100/-

(postage extra)

All application forms and other communication may be

sent to the Secretary, Animal Nutrition Society of India,

Department of Animal Nutrition, Guru Angad Dev

Veterinary and Animal Sciences University, Ludhiana –

141004, Punjab. Bank drafts should be drawn in favour

of ‘Animal Nutrition Society of India’ payable at Karnal.

Email: [email protected]

The articles should be sent to Chief Editor using on line

facility (http://epubs.icar.org.in/ejournal index.php/

IJAN/about/submissions#online Submissions).

Chief Editor welcomes books for reviews; news items

etc.

Change of Address: May be communicated to The

Secretary as well as The Chief Editor.

CHIEF EDITOR

Asit Das, NDRI, Karnal, Haryana

EDITORS

P. Vasan Sachin Kumar Muneendra Kumar

Namakkal, Tamil Nadu Karnal, Haryana Mathura, Uttar Pradesh

Sustaining Member

New Life Members of ANSI

586. Vinus Rana

Chirya, Charhki Dadri, Haryana

M: 9728230866

e-mail: [email protected]

587. Anup Kumar Singh

NDRI, Karnal, Haryana India


588. Ingle Vinayak Shivagi Rao

NDRI, Karnal, Haryana India


589. Surej Joseph Bunglavan

CVAS, Pookode, Wayanad, India


590. Yora Reena

NDRI, Karnal, Haryana, India


SM1. Fermenta Biotech LimitedA-1501, Thane One, DIL Complex, Ghodbunder Road, Majiwada, Thane (West) 400 610, Maharashtra, India

Mobile: +91 98 92659914 | Email: [email protected] | Web: www.fermentabiotech.com

ACKNOWLEDGEMENTAnimal Nutrition Society of India puts on record its sincere thanks to Indian

Council of Agricultural Research, New Delhi for grant of financial support for

publication of IJAN

591. Rohit Gupta

KVK, Nurmahal, Jalandhar, Punjab, India


592. Chandrasekar Seenivasan

Tamil Nadu, India


593. Sarat Chandra Amaravadhi

PVNR Telangana Vet. Uni. Hyderabad, India


594. B. Balamuralikrishnan

Tanjore, Tamil Nadu, India


Ruminants

1. Spatial and Temporal Distribution of Microbes and Enzyme Activity in the Rumen of

Buffaloes

Payal Agarwal, Anju Kala, D.N. Kamra, Neeta Agarwal and L.C. Chaudhary

2. Rhythmic Alterations in Physiological Response, Growth Performance and Blood

Metabolites in Growing Hariana Cattle Fed on Ration Included with Different Levels

of Corn Silage

Ashwani Kumar Verma, Muneendra Kumar, Vinod Kumar, Raju Kushwaha,

Shalini Vaswani1, Avinash Kumar and Yajuvendra Singh

3. Effect of Supplementing Wet Distillers’ Grains with Solubles to Maize Silage Based

Diet on Performance of Growing Nellore Jodipi Ram Lambs

K. Naveena, A. Ravi, B. Devasena and S. Shakila

4. Effect of Feeding Solid-State Fermentation Biomass on Nutrients intake, Digestibility

and Microbial Protein Synthesis in Lactating Buffaloes

Kishan P. Patel, Shrikant B. Katole, P.R. Pandya, Srushti Patel and D. Srinivas Murty

5. Effect of Feeding Calf Starter Diets Containing Shrimp Waste Meal on Nutrient

Utilization in Murrah Buffalo Calves

K.V.N. Aruna, D. Srinivas Kumar, E. Raghava Rao and S. Jagadeeswara Rao

6. Effect of Solid- State Fermentation Biomass Supplementation to Mixed Substrate

on Digestibility and Methane Mitigation in vitro

Kishan P. Patel, Shrikant B. Katole, P.R. Pandya, K.K. Sorathia and Srushti Patel

7. Effect of Supplementing Conjugated Linoleic Acid Producing Bifidobacterial Strains

on In vitro Rumen Fermentation Attributes

Neeru Jaglan, Sachin Kumar, Prasanta Kumar Choudhury, Bhawna Tyagi,

P.S. Banakar, Nitin Tyagi and Amrish Kumar Tyagi

Non-Ruminants

8. Augmenting Feeding Value of Rice Gluten Meal through Dietary Addition of Enzymes

in Broilers

O.P. Dinani, Pramod Kumar Tyagi, A.B. Mandal, Praveen Kumar Tyagi and

Narayan Dutta

9. Effect of Feeding Graded Levels of Guava Leaf Meal on Performance and Economics

of Broiler Chicks

M.I. Daing, A.K. Pathak, R.K. Sharma and M.A. Zargar

10. Effect of Feed Restriction and Garlic Supplementation on Growth Performance,

Nutrient Utilization and Meat Quality in Female Broiler

Vishavdeep Singh, Udeybir Singh and A.P.S. Sethi

INDIAN JOURNAL OF ANIMAL NUTRITION

(www.indianjournals.com; www.ansi.org.in; http://epubs.icar.org.in/ejournal/index.php/IJAN)

June, 2020 Vol. 37 #2

CONTENTS

87

95

106

115

121

127

132

138

143

152

11. Effect of Eugenia jambolana and Psidium guajava Leaf Meal Mixture

Supplementation on Antioxidant Indices and Immune Responses in Broiler Chicks

M.A. Zargar, A.K. Pathak, R.K. Sharma and M.I. Daing

12. Effect of Replacement of Maize by Animal Fat on Growth and Nutrient Utilization of

Growing Large White Yorkshire Pigs

N. Elanchezhian and K. Ally

13. Effect of Feeding Different Levels of Rice Distillers Dried Grains with Soluble

(RDDGS) on Performance of Broiler

Niharika Singh, Meenu Dubey, Raina Doneria, M.K. Gendley, O.P. Dinani and

R.C. Ramteke

14. Effect of Organic Copper, Zinc and Manganese Supplementation on Growth, Immunity

and Hatchability of Egg in Japanese Quail (Coturnix coturnix japonica)

A.K. Satapathy, S.K. Das, K. Sethy, R. K Swain, S.K. Mishra, K. Behera and

S. Pati

15. Effect of Feeding Probiotics and Milk Powder Supplemented Creep Ration on the

Growth Performance and Efficiency of Feed Utilization in Pre-weaning Piglets

Monica Tissopi, J.P. Bordoloi, Jakir Hussain, H. F. Ahmed and Rajib Kro

Short communication

16. Effect of Graded Levels of Broken Rice on Egg Quality of White Pekin Ducks During

Second Year of Laying

P. K. Naik, B. K. Swain, S. K. Sahoo, D. Kumar and S. K. Mishra

158

167

172

179

185

191

87

Indian Journal of

Animal Nutrition

Spatial and Temporal Distribution of Microbes and Enzyme Activity

in the Rumen of Buffaloes

Payal Agarwal, Anju Kala*, D.N. Kamra, Neeta Agarwal and L.C. Chaudhary

Animal Nutrition Division, ICAR-Indian Veterinary Research Institute,

Izatnagar-243 122, UP, India

ABSTRACT

Information about abundance of rumen microbes is a prerequisite to assess the fermentation in rumen

during any dietary intervention. However, conventional techniques are not able to enumerate majority of

microbes as majority of rumen microbes are uncultivable. Real time PCR (qPCR) has successfully been used for

quantification of various rumen microbes like rumen cellulolytic bacteria, protozoa, fungi, methanogens etc. In

this experiment, the whole rumen content (WRC) was squeezed to particulate matter (PM) and squeezed rumen

liquor (SL), whereas, the fourth fraction, strained rumen liquor (SRL) of rumen content was obtained by filtering

through a probe with double layer of muslin cloth. The population of total bacteria, fungi, Ruminococcus albus,

R. flavefaciens, Fibrobacter succinogenes, total methanogens, Butyrivibrio fibrisolvens and protozoa were

estimated in different fractions of rumen content at 0, 4 and 8 h post-feeding by real time PCR using specific

primers. The numbers of these microbes were significantly (P<0.001) higher in WRC and PM as compared to

SRL and RL. The activities of carboxymethylcellulase (CMCase), avicelase, amylase, xylanase, β-glucosidase

and urease were significantly (P<0.05) higher in WRC and PM as compared to SRL and RL. The activities of

CMCase and urease were higher (P<0.05) at 4 and 8 h post feeding, whereas, rest of the enzymes were not

affected. There was no effect of time of sampling on the population of rumen microbes explored in this

experiment. It appeared that WRC or PM fraction provided true picture of microbial and enzyme profiles

responsible for fibre degradation in the rumen. The increase in enzyme activity at a particular time of sampling

was not associated with population size of the specific microbes or specific activity of enzymes.

Key words: Buffalo, Enzymes, Microbes, Rumen content fractions, Real time PCR

Corresponding author; Email: [email protected]

INTRODUCTION

Rumen microbes have a mutualistic relationship

with their hosts, and symbiotic and/or antagonistic

relationship among themselves (Kamra, 2005). The

rumen microbes, predominantly bacteria, fungi and

protozoa, secrete an array of fibrolytic enzymes (Chen

et al., 2008) including micro-crystalline cellulase,

caboxymethylcellulase, xylanase etc. and this complex

pool of enzymes are responsible for degradation of

plant based fibrous feeds. The major culturable fibre

degrading bacteria are represented by F. succinogenes,

R. flavefaciens, R. albus and B. fibrisolvens based

on conventional cultivation techniques and their

contribution to fibre degradation is much larger than the

other microbes (Wanapat and Cherdthong, 2009; Dai et

al., 2015). B. fibrisolvens and Prevotella ruminicola

are other major fibre degrading bacteria which

contribute to carbohydrate and fibre utilization (Flint et

Indian J. Anim. Nutr. 2020. 37 (2): 87-94

doi: 10.5958/2231-6744.2020.00016.X

al., 2008). For fibre degradation, the microbial

population attached to feed particles is the most

important as about 80-90% of carboxymethyl cellulase,

avicelase and xylanase are from the microbes attached

with the feed particles or particulate matter (Agarwal

et al., 2000). But the microbes identified so far as the

main fibre degrading microbes are the cultivable

microbes, whereas, there are other numerous bacteria

which are functional but uncultivable under laboratory

condititon (Kobayashi, 2006). Real time PCR has

successfully been used for quantification of various

rumen microbes like rumen cellulolytic bacteria,

protozoa, fungi, methanogens etc (Tajima et al., 2001;

Koike and Kobayashi, 2001).

The present study has been undertaken to

establish the distribution of various microbes by using

real-time PCR and the major microbes and fibre

degrading enzymes secreted by these microbes in the


88

rumen and their changing pattern with the type of sample

and feeding time. Some in vitro studies reported change

in rumen microbial count for all major microbes after 24

h of incubation in Rusitec (Lengowski et al., 2016),

whereas, there are also reports of no effect of period of

sampling on rumen microbes and enzyme activity (Li et

al., 2009; Kala et al., 2017, 2020).Most of the studies

looking into rumen microbes attached to different

rumen content fractions have used high throughput

sequencing. de Mulder et al. (2017) has reported high

abundance of celllulolytic and the associated secondary

bacteria in solid phase. Bowen et al. (2018) also

reported high abundance of methanogens on Holstein

Friesian (HF) cattle grazing on white clover vs.

perennial ryegrass, whereas de Mulder et al. (2017)

reported similar abundance in solid and liquid fraction of

rumen. The change in pattern of rumen microbes and

enzymes produced by them affect the extent of fibre

degradation in rumen. The studies available have

explored the temporal variation in microbes using in vitro

methods, and availability of studies using in vivo

models is very meagre. This study explores the shift in

population of rumen microbes and the enzymes produced

by them at different periods and fractions.

MATERIALS AND METHODS

The experiment was carried out on three fistulated

male buffaloes fed control diet of wheat straw and

concentrate mixture (wheat bran 37%, maize 41%,

de-oiled soybean meal 19%, mineral mixture 2% and

common salt 1%) in equal proportion to meet nutrient

requirements for maintenance (ICAR, 2013). The whole

rumen content for enzyme estimation and microbial

enumeration was collected at 0 (just before feeding), 4

and 8 h post-feeding on two consecutive days, after 21

days of feeding. The samples were transported to the

laboratory in an ice bucket and processed immediately.

The rumen content was separated into four fractions

i.e. the whole rumen content (WRC), and it was

squeezed to have particulate material (PM, the solid

fraction) and the squeezed liquid (SL) portion. The fourth

fraction was SRL (strained rumen liquor) obtained by

filtering through two layers of muslin cloth.

For enzyme extraction, either 5 g particulate

material, whole rumen content, SL or SRL were mixed

Table 1. PCR primers for real time PCR

Primer Name Primer Sequence Amplicon Annealing Reference

(bp) temp(°C)

Bacteria F-5’CGGCAACGAGCGCAACCC-3’ 130 60 Denman et al.,

R-5’CCATTGTAGCACGTGTGTAGCC-3’ 2006

Fungi F-GAGGAAGTAAAAGTCGTAACAAGGTTTC 110 60

R-CAAATTCACAAAGGGTAGGATGATT

Methanogen F 5’-TTCGGTGGATCDCARAGRGC-3’R 140 60

R-5’-GBARGTCGWAWCCGTAGAATC C-3

Ruminococcus F5’CGAACGGAGATAATTTGAGTTTACTTAGG3’ 132 60

flavefaciens R-5’CGGTCTCTGTATGTTATGAGGTATTA-3’

Fibrobacter F-5’GTTCGGAATTACTGGGCGTAAA-3’ 121 60

succinogenes R-5’CGCCTGCCCCTGAACTATC-3’

Ruminococcus F-5’CCCTAAACAGTCTTAGTTCG-3’ 175 60 Koike and

albus R-5’CCTCCTTGCGGTTAGAACA-3’ Kobayashi, 2001

Protozoa F-316f, 5'-GCTTTCGWTGGTAGTGTATT-3' 223 55 Sylvester et al.,

R-539r, 5'-CTTGCCCTCYAATCGTWCT-3' 2004

Butyrivibrio F-5’TCTGGAAACGGATGGTA-3’ 284 60 Chen and

fibrisolvens R-5’CCTTTAAGACAGGAGTTTACAA-3’ Weimer, 2001

Agarwal et al.


89

with phosphate buffer (0.1M, pH 6.8), lysozyme (0.4%)

solution and carbon tetrachloride and incubated at 39°C

for 3 h and the clear supernatant obtained after

centrifugation was used as a source of microbial

enzymes (Hirstov et al., 1999).

For measuring the activities of carboxymethyl

cellulase and xylanase, the reaction mixture contained

1 ml phosphate buffer (0.1 M pH 6.8); 0.5 ml enzyme

and 0.5 ml of either carboxymethylcellulose (1.0%) or

xylan (0.25%). The reaction mixture for α-amylase

contained 0.5 ml buffer, 0.25 ml starch (1%) and 0.25

ml enzyme. The reaction mixtures were incubated for

60, 15 and 30 min, respectively, at 39°C and the

reducing sugars released were estimated (Miller, 1959).

β-glucosidase activities were estimated using

p-nitrophenyl- α-glucopyranoside and p-nitrophenyl-

α-glucopyranoside as substrate, respectively (Shewale

and Sadana, 1978). Urease activity was measured by

incubating the enzyme sample (0.25 ml) with urea (0.25

ml of 0.1 M) for 15 min and released ammonia nitrogen

was estimated (Weatherburn, 1967). Protease activity

was measured using azocasein (Sigma, St. Louis, USA)

as a substrate (Brock et al., 1982) and the enzyme unit

was expressed as µg protein hydrolysed/min/ml.

Total genomic DNA was extracted as per

procedure described by Yu and Morrison (2004) which

included bead beating of samples mixed with lysis

buffer followed by purification of DNA by using a kit

(A9281, Wizard SV Gel and PCR clean up system).

The quality and quantity of the DNA was checked by

electrophoresis (0.8% agarose) and nanodrop qPCR

was standardized for absolute quantification of

microbial cell per gram of rumen content/rumen

liquor. For preparation of standard curve, the purified

PCR product using specific primer was cloned in

pGEMT easy vector (Promega) and transformed in

Escherichia coli by using Transform AidTM Bacterial

Transformation Kit (Fermentas). The plasmid with

insert was extracted and copy number was calculated

(Ritalahti et al., 2006). The plasmid was serially diluted

to make standard curve and the copy number of

unknown sample was calculated. The amplification

reactions were performed in a total volume of 20 µl,

containing 2 ng of template DNA, 10 µl of 2X Kappa

SYBR master mix, 0.6 µl of each primer (10 µM) and

nuclease free water. The cycling conditions consisted

of initial denaturation step at 95°C for 3 min, followed

by 40 cycles of 95°C for 10 sec and specific annealing

temperature for 15 sec. The specific primers used for

qPCR with their annealing temperature and product size

are given in Table 1.

RESULTS AND DISCUSSION

The results of microbial profile including total

bacteria, Ruminococcus flavefaciens, R. albus,

methanogens, protozoa and Fibrobacter succinogenes

in the rumen of buffalo (Table 2) studied with real time

PCR indicated that the number of rumen microbes was

higher (P<0.05) in WRC and PM as compared to those

in SRL and SL. However, there was no difference in

the temporal distribution (at 0, 4 and 8 h post-feeding)

of microbial population. This clearly indicated that

majority of the rumen microbes, especially fibre

degraders are attached with particulate material/solid

portion of rumen content. Relative microbial diversity

was studied to see how the rumen microbial profile

changes in other fractions with respect to whole rumen

content. It was calculated by taking the absolute count

of microbes in whole rumen content as 1, and microbial

count for other sample type was expressed in relation

to whole rumen content (Table 3). The relative count

Fig. 1. Relative microbial diversity of major rumen

microbes in various fractions of rumen

content of buffaloes

Rumen Liquor

Squeezed liquid

Particulate Material

Whole rumen Content

Microbes and Enzyme Activity in the Rumen of Buffaloes


90

also exhibited similar trend as absolute count of microbes

(Fig. 1). It clearly indicated that microbial count in PM

is generally similar, sometimes even numerically higher

than WRC. The relative count in other two fractions,

namely SL and SRL were observed to have similar

microbial count.

The information on microbial diversity of buffalo

rumen available till date is primarily based on

conventional techniques of microbial cultivation and the

information available is scanty as compared to other

domesticated (cattle, sheep and goat) and wild

ruminants (Kamra and Pathak,1996). This scanty

knowledge has limited our understanding of the

environment and requirements of target microbes in

buffalo rumen as majority of the rumen bacteria are

uncultivable under lab condititon. However, real time

quantification of bacteria in the rumen has made it

possible to quantify the absolute number of some of these

Table 2. Distribution of microbes (Log10

) in different fractions of rumen contents at different hrs of

post-feeding

Primers Time(h) WRC PM SL SRL Mean SEM P value

T F T*F

Bacteria 0 11.41 11.50 10.64 10.57 11.03 0.067 0.970 <0.001 0.806

4 11.64 11.28 10.39 10.83 11.03

8 11.38 11.48 10.33 10.79 11.00

Mean 11.4a 11.42a 10.45b 10.73b

F. succinogenes 0 10.59 10.66 9.18 9.40 9.96 0.071 0.188 <0.001 0.785

4 10.82 10.32 8.96 8.93 9.76

8 10.42 10.40 8.66 9.07 9.64

Mean 10.6a 10.46a 8.93b 9.13 b

R. albus 0 7.78 7.85 7.07 6.96 7.41 0.047 0.165 <0.001 0.190

4 7.92 7.52 6.49 7.07ab 7.25

8 7.69 7.76 6.41 6.93 7.20

Mean 7.80a 7.71a 6.66b 6.99b

R. flavefaciens 0 8.47 8.72 7.52 7.24 7.99 0.060 0.928 <0.000 0.618

4 8.77 8.48 7.17 7.42 7.96

8 8.57 8.73 7.23 7.55 8.02

Mean 8.60a 8.64a 7.31b 7.40b

B. fibrisolvens 0 9.48 9.58 8.44 8.21 8.93 0.086 0.662 <0.001 0.548

4 9.69 9.42 7.64 8.20 8.74

8 9.40 9.56 7.73 8.53 8.80

Mean 9.52a 9.52a 7.93b 8.31b

Methanogens 0 8.60 8.75 7.75 7.94 8.26 0.068 0.247 <0.001 0.795

4 8.95 8.56 7.55 7.81 8.22

8 8.53 8.59 7.18 7.70 8.00

Mean 8.69a 8.63a 7.49b 7.82b

Protozoa 0 9.85 9.82 9.32 9.62 9.65 0.105 0.054 0.034 0.946

4 10.14 9.60 8.94 9.34 9.50

8 9.45 9.01 8.44 9.22 9.03

Mean 9.81a 9.48ab 8.90b 9.39ab

*WRC, whole rumen content; PM, particulate matter; SL, squeezed liquid; SRL, strained rumen liquor; T, time; F, fraction

Agarwal et al.


91

Table 3. Relative count of microbes in different fractions of rumen contents at different periods after

feeding

Fraction WRC PM SL SRL Mean SEM P value

Bacteria 1a 1.01a 0.93b 0.93 b 0.97 0.010 <0.001

R. albus 1 a 1.01a 0.91b 0.90 b 0.95 0.015 <0.001

R. flavefaciens 1 a 1.03a 0.89b 0.86 b 0.94 0.021 <0.001

Methanogens 1 a 1.02a 0.90b 0.92 b 0.96 0.015 <0.001

Protozoa 1 a 1.00a 0.95b 0.98 b 0.98 0.008 0.026

F.succinogenes 1 a 1.01a 0.87b 0.89 b 0.94 0.017 <0.001

*WRC, whole rumen content; PM, particulate matter; SL, squeezed liquid; SRL, strained rumen liquor; T, time; F, fraction

Fig. 2. Temporal variation in major fibrolytic enzymes in buffalo rumen

rumen bacteria (Malmuthuge et al., 2012). In

corroboration with this study, Li, et al (2009) reported

no effect of sampling time (at three time points: 3h

×

RC

PM

SL

SRL

CMCase

×

RC

PM

SL

SRL

Xylanase

before feeding, 3h after feeding and 9h after feeding)

or location in rumen from where samples were collected

(cranial dorsal, cranial ventral, central rumen, caudal



92

dorsal and caudal ventral locations) on rumen microbe

population of Holstein cows. Similarly, Kala et al., (2017,

2020) had reported no change in rumen microbial

profile and rumen enzyme activity at 0 and 4h post

feeding in buffaloes fed various levels of TDN.

Lengowski et al. (2016) has reported no change during

initial periods after adding silage as substrate in Rusitec,

but a decrease was observed for all major microbes

after 24 h of incubation. In our study it was observed

that, the number of these bacteria drastically reduced

Table 4. Enzyme activities (µmol/ml/min/100g RC/RL) in different fractions of rumen contents at

different post-feeding periods

Enzyme Time RC PM SL SRL Mean SEM P value

(Hr) T F T*F

CMCase 0 55.93 79.63 10.68 11.88 39.53 b 1.94 0.032 <0.001 0.552

4 79.59 94.93 19.07 15.54 52.28a

8 70.04 71.00 9.35 9.35 39.93ab

Mean 68.52a 81.85 a 13.03b 12.26b

MCCase 0 37.72 40.56 12.59 10.33 25.30 0.66 0.342 <0.001 0.129

4 44.30 46.02 7.53 9.04 26.72

8 42.54 49.65 9.62 9.33 27.78

Mean 41.52a 45.41 a 9.91b 9.57b

Amylase 0 75.41 79.93 18.14 20.42 48.47 5.88 0.977 <0.011 1.000

4 80.15 80.45 24.59 20.61 51.45

8 73.41a 85.12a 23.45b 21.14b 50.78

Mean 76.32 81.83 22.06 20.72

Xylanase 0 24.44 27.65 5.47 3.57 15.28 0.82 0.232 0.003 0.699

4 17.96 20.72 4.14 4.54 11.84

8 24.89 25.69 3.90 3.93 14.60

Mean 22.43a 24.68 a 4.50b 4.01b

β-glucosidase 0 11.35 10.50 2.87 1.89 6.65 1.01 0.942 0.018 1.000

4 9.76 9.15 2.79 2.94 6.16

8 11.00 11.25 3.07 2.76 7.02

Mean 10.70a 10.30 a 2.91b 2.53b

Urease 0 5.94 6.80 1.07 0.71 3.63 b 0.21 0.001 <0.001 0.023

4 5.43 5.86 1.97 2.49 3.93 b

8 9.38 10.76 2.00 1.68 5.95a

Mean 6.91 a 7.80 a 1.68b 1.63b

Protease 0 51.34 62.67 10.88 17.25 35.53 4.25 0.945 0.002 0.998

4 61.33 62.00 15.63 10.63 37.40

8 51.33 57.67 15.63 10.88 33.87

Mean 54.67a 60.78a 14.04b 12.92b

CMCase, amylase and xylanase: nmol glucose or xylose ml-1 min-1; α-glucosidase, β-glucosidase and acetyl esterase, nmol p-nitrophenol ml-

1 min-1.; protease, µg of protein hydrolysed ml-1 min-1

when liquid portion of rumen is used for analysis. Thus,

the whole rumen content or particulate matter seems to

be better representative for microbial profiling study.

However, the time of sampling was not found to be a

factor affecting microbial population.

The polymeric carbohydrate-based crop residues

are degraded by a combined activity of a microbiome

consisting primarily of bacteria accompanied with

protozoa, fungi, archaea and bacteriophages (Klieve and

Bauchop, 1988; Kamra, 2005). In order to have better

Agarwal et al.


93

access to the fibre, the microbes excreting these

hydrolytic enzymes must get attached with the substrate.

This is even observed in the present experiment that the

microbes and enzymes excreted by these microbes were

in close association with the particulate material of the

partially degraded feed ingredients in the rumen. The

enzyme activity also followed similar trend as microbial

profile and observed higher activity associated with

WRC and PM (Table 4). Activity of CMCase and

urease was higher at 4 h and at 8 h post-feeding, whereas

no temporal changes in activities of other enzymes were

observed. Higher activity of CMCase reflects increased

fibre utilization at 4 h post-feeding. Results further

indicated that the rumen content and particulate

material had higher population of rumen microbes and

higher quantity of enzymes (Fig. 2), than the liquid

portion from the squeezed and strained rumen liquor.

From the results it appears that when enzyme and

microbial profiles are to be studied in the rumen

content, the whole rumen content should be sampled as

majority of the enzymes and microbes are attached with

the partially degraded feed particles. The present study

revealed that temporal changes appear to have little or

no effect on activity of enzymes in rumen.

CONCLUSIONS

The study clearly revealed that the whole rumen

content or particulate material seems to be containing

majority of rumen microbes and thus the hydrolytic

enzymes produced by these microbes. The time

of sampling does not appear to affect the microbial

number or enzyme activity. Thus, for rumen

fermentation studies whole rumen content should be the

preferred sample. Due to the lack of existing

information and unclutivablity of majority of rumen

microbes’ culture independent techniques seem to be

better approach. These primer based approaches likes

real time PCR are better than cultivation based

methods but, high throughput techniques involving

metagenomics and metatranscriptomics are the holistic

approach as they sequence all the DNA/RNA present

in a sample. Nonetheless, qPCR provides great deal of

information about the microbial profile of rumen

microbes.

ACKNOWLEDGEMENT

This work was supported by ICAR National

Professorial Chair (Project No.F.No.27 (17)/2011-HRD.

24/12/2012). We are also thankful to director IVRI for

his support in conducting the experimental work.

REFERENCES

Agarwal, N., Agarwal, I., Kamra, D.N. and Chaudhary, L.C.

2000. Diurnal variations in the activities of hydrolytic

enzymes in different fractions of rumen contents of

Murrah buffalo. J. Appl. Anim. Res. 18: 73-80.

Bowen, J.M., McCabe, M.S., Lister, S.J., Cormican, P. and

Dewhurst, R.J.2018. Evaluation of microbial

communities associated with the liquid and solid

phases of the rumen of cattle offered a diet of

perennial ryegrass or white clover. Front. Microbiol. 9:

2389.

Brock, F.M., Frosberg, C.W. and Buchanan-Smith, J.G. 1982.

Proteolytic activity of rumen microorganisms and

effect of proteinase inhibitors. Appl. Environ.

Microbiol. 44: 561-569.

Chen, X.L., Wang, J.K., Wu, Y.M. and Liu, J.X. 2008. Effects

of chemical treatments of rice straw on rumen

fermentation characteristics, fibrolytic enzyme

activities and populations of liquid- and solid-

associated ruminal microbes in vitro. Anim. Feed Sci.

Technol. 141: 1-14.

Dai, X., Tian, Y., Li, J., Su, X. and Wang, W. 2015.

Metatranscriptomic analyses of plant cell wall

polysaccharide degradation by microorganisms in the

cow rumen. Appl. Environ. Microbiol. 81: 1376-1386.

de Mulder, T., Goossens, K., Peiren, N., Vandaele, L., Haegeman,

A., de Tender, C., Tom Ruttink, T., de Wiele, T.V. and

De Campeneere s. 2017. Exploring the methanogen and

bacterial communities of rumen environments: solid

adherent, fluid and epimural. FEMS Microbiol.

Ecol. 93: 251.

Flint, H.J., Bayer, E.A., Rincon, M.T., Lamed, R. and White,

B.A. 2008. Polysaccharide utilization by gut bacteria:

potential for new insights from genomic analysis. Nat.

Rev. Microbiol. 6: 121-131.

Hristov, A.N., McAllister, T.A. and Cheng, K.J. 1999. Effect of

diet, digesta processing, freezing and extraction

procedure on carboxy-methyl cellulase, xylanase and

amylase activities of rumen contents. Can. J. Anim.

Sci. 79: 73-81.



94

Indian Council of Agricultural Research. 2013. Nutrients

Requirement for Livestock and Poultry, ICAR, New

Delhi.

Kala, A., Kamra, D.N., Agarwal, N. and Chaudhary, L.C. 2020.

Effect of a blend of commercial Ajwain (Trachyspermum

ammi) oil and nitrate on the fermentation and microbial

profile of buffalo rumen. Anim. Nutr. Feed Technol. 20:

141-153.

Kala, A., Kamra, D.N., Agarwal, N. and Chaudhary, L.C. 2017a.

Effect of a blend of essential oils on buffalo rumen

microbial and enzyme profiles and in vitro feed

fermentation. Anim Nutr Feed Technol. 189-200.

Kala, A., Kamra, D.N., Kumar, A., Agarwal, N., Chaudhary,

L.C. and Joshi, C.G. 2017b. Impact of levels of Total

digestible nutrients on microbiome, enzyme profile and

degradation of feeds in buffalo rumen. PLoS ONE. 12:

e0172051.

Kamra, D.N. 2005. Rumen microbial ecosystem. Curr. Sci.

89:124-135.

Kamra, D.N. and Pathak, N.N. 1996. Nutritional

Microbiology of Farm Animals, 1-224. Vikas

Publishing House, New Delhi.

Klieve, A.V. and Bauchop, T. 1988. Morphological diversity

of ruminal bacteriophages from sheep and cattle. Appl.

Environ. Microbiol. 54: 1637-1641.

Kobayashi, Y. 2006. Inclusion of novel bacteria in rumen

microbiology: need for basic and applied science. Anim.

Sci. J. 77: 375-385.

Koike, S. and Kobayashi, Y. 2001. Development and use of

competitive PCR assays for the rumen cellulolytic

bacteria: Fibrobacter succinogenes, Ruminococcus

albus and Ruminococcus flavefaciens. FEMS

Microbiol. Lett. 204: 361-366.

Lengowski, M.B., Zuber, K.H.R., Witzig, M., Möhring, J.,

Boguhn, J. and Rodehutscord, M. 2016. Changes in

rumen microbial community composition during

adaption to an in vitro system and the impact of

different forages. PLoS ONE. 11: e0150115.

Li, M., Penner, G.B., Hernandez-Sanabria, E., Oba, M. and Guan,

L.L. 2009. Effects of sampling location and time, and

host animal on assessment of bacterial diversity and

fermentation parameters in the bovine rumen J. Appl.

Microbiol. 107: 1924-1934.

Malmuthuge, N., Li, M., Chen, Y., Fries, P., Griebel, P.J.,

Baurhoo, G.B., Zhao, X. and Guan, L.L. 2012. Distinct

commensal bacteria associated with ingesta and

mucosal epithelium in the gastrointestinal tracts of

calves and chickens. FEMS Microbiol. Ecol. 79:

337-347.

Miller, G.L. 1959. Use of dinitrosalisylic acid reagent for

determination of reducing sugar. Analyt. Chem. 31:

26-428.

Ritalahti, K.M., Amos, B.K., Sung, Y., Wu, Q. and Koenigsber,

S.S. 2006. Quantitative PCR targeting 16S rRNA and

reductive dehalogenase Genes simultaneously

monitors multiple Dehalococcoides strains. Appl.

Environ. Microbiol. 72: 2765-2774.

Shewale, J.G. and Sadana, J.C. 1978. Cellulase and

β-glucosidase by a basidomycete species. Can. J.

Microbiol. 24: 1204-1216.

Tajima, K., Nagamine, T., Matsui, H., Nakamura, M. and

Aminov, R.I. 2001. Phylogenetic analysis of archaeal

16S rRNA libraries from the rumen suggests the

existence of a novel group of archaea not associated

with known methanogens. FEMS Microbiol. Lett. 200:

67-72.

Wanapat, M., and Cherdthong, A. 2009. Use of real-time PCR

technique in studying rumen cellulolytic bacteria

population as affected by level of roughage in swamp

buffalo. Curr. Microbiol. 8: 294-299.

Weatherburn, M.W. 1967. Phenol hypochlorite reaction for

determination of ammonia. Analyt. Chem. 39: 971-974.

Yu, Z. and Morrison, M. 2004. Improved extraction of

PCR-quality community DNA from digesta and fecal

samples. Bio Techniques. 36: 808-812.

Agarwal et al.


Received on 06-07-2020 and accepted on 06-08-2020

95

Indian Journal of

Animal Nutrition

Rhythmic Alterations in Physiological Response, Growth Performance

and Blood Metabolites in Growing Hariana Cattle Fed on Ration

Included with Different Levels of Corn Silage

Ashwani Kumar Verma1, Muneendra Kumar1*, Vinod Kumar1, Raju Kushwaha1,

Shalini Vaswani1, Avinash Kumar1 and Yajuvendra Singh2

Department of Animal Nutrition, College of Veterinary Science and Animal Husbandry,

DUVASU, Mathura 281 001, India

ABSTRACT

This study was conducted to determine the effect of green fodder replacement with corn silage on the

physiological response, growth performance, and blood metabolites in summer exposed growing Hariana

cattle. Eighteen growing Hariana cattle were randomly allocated into three groups (n=6) on body weight

(130±3.0 kg) and age (14±1.5 months) basis. Experimental heifers either received a basal total mixed ration

(TMR) devoid of corn silage (S0%

) or were fed on TMR of which 50% (S50%

) and 100% (S100%

) green fodder were

replaced with corn silage. Mean THI and RH values indicated that experimental heifers were in moderate heat

stress. Replacement of green fodder with corn silage did not alter the physiological response of heifers during

90 d experimental periods. As the level of inclusion of corn silage increased, dry matter intake (DMI) and cost

of feeding also increased (P<0.05) while average daily gain (ADG) was similar among all groups. Hematological

attributes and plasma metabolites showed non-significant effect of green fodder replacement with corn silage.

Although the green fodder replacement with corn silage increased cost of feeding but can be used as a best

alternative during summer period by maintain the performance of dairy animals.

Key words: Blood metabolites, Corn silage, Green fodder, Hariana heifer, Haematology

*Corresponding author; Email: [email protected]; 1Department of Animal Nutrition, College of Veterinary Science and Animal

Husbandry, DUVASU, Mathura 281 001; 2Yajuvendra Singh; Department of Livestock Production Management, College of Veterinary

Science and Animal Husbandry, DUVASU, Mathura 281001, India; Email: [email protected]

INTRODUCTION

The feed itself accounts for 60 to 65% of the

total cost of production in dairy cattle and the main

determinant of production system profitability.

Shrinkage of irrigated lands for fodder production,

higher labour cost, and small landholdings further

increases the cost of rearing of dairy animals. Out of

the available dry matter, most of it is available in the

form of agricultural by-products and dried grass which

is of inferior quality. It is imperative to arrange

sufficient good quality feed and fodder for efficient

utilization of the genetic potential of the various

livestock species and sustainable improvement in

productivity. The only way to meet the increasing

fodder needs of livestock is to look for alternative

options of fodder. Among these, silage is one of them.

Availability of nutritious fodder throughout the year can

be maintained by converting green fodder into silage.


doi: 10.5958/2231-6744.2020.00017.1

Silage is green succulent roughage preserved more

or less in its original condition, with a minimum

deterioration and minimum loss with respect of various

nutritive constituents of fodders. Well-fermented silage

is readily consumed by animals and may improve their

health and production characteristics (Varadyova et al.,

2010). Recent findings on silage production indicate that

it could replace the conventional fodder without any

ill-effect on intake, efficiency, digestibility, and

performance of dairy animals (Chaudhary et al., 2014).

In a well-managed system, where losses are low, the

silage dry matter content and digestibility will be similar

or slightly lower and crude protein content might be

similar to parent fodder (Kaiser and Piltz, 2004).

Preference for cereal green fodder including maize,

sorghum, pearl millet, etc. for ensiling is due to more

sugar content than protein, as sugar is utilized in

the fermentation process to make lactic acid by


96

microorganisms (Nazli et al., 2019).

A major factor which affects the physiological

response, feed intake, and performance of animal

during summer stress is dietary composition. Therefore,

a corollary to this concept exists in utilization of diets,

suggesting that when different diets are fed to cattle,

the analysis of physiological response, feed intake,

performance measures, and blood metabolites should

be able to differentiate between the efficiencies of

the utilization of diet. Considering these facts, the

present study was designed to investigate the effect

of replacement of green fodder with corn silage on

physiological response, feed intake, growth performance,

and blood metabolites in growing Hariana cattle during

summer season.


The experiment was conducted in the

Instructional Livestock Farm Complex (ILFC) of

Veterinary University, Mathura (India). Mathura is

situated at elevation 191 m above mean sea level,

latitude and longitude position being 27° 303 N and 77°

413 E, respectively. The climate of Mathura is

semi-arid, and temperature goes up to 45°C during the

summer months.

To prepare the best quality silage, maize fodder

was used in this study. Fodder harvest was performed

at a height of 5 cm above the ground when the moisture

content of maize fodder was in the range of 70-75%.

Silage was prepared in bunker silo having a dimension

of 20 m×10 m. The whole fodder was chopped into 2-3

cm pieces by using tractor operated forage chopper

(Ensiladeria JF4Max, NB Maquinas Ltd., Brazil).

Chopped material was filled in the silo and compressed

with a tractor fitted with a labeler. For adequate

compaction and perfect anaerobic condition, the chopped

fodders were covered with two layers of polythene

sheets (0.2 mm thickness) followed by a layer of sand

and tires. After 60 d of ensiling, the silo was opened

from one end and silage samples were collected in a zip

lock polythene pack from the core area of the opened

portion of the filled bunker silo. Collected silage samples

were used for evaluation of nutrients content, and

physical and chemical characteristics (Table 1). Silage

samples were analyzed for moisture content (by using

Table 1. Nutrient composition and characteristics

of corn silage

Attribute Amount, g/kg DM or

as mentioned

Nutrient composition

DM 270

OM 958

CP 83

EE 31

CF 359

Ash 42

AIA 28

NFE 485

NDF 461

ADF 285

ADL 27

Total CHO 844

NFC 383

Ca 1.5

P 1.9

Physical characteristics

Temperature, ºC 32

Aroma Slightly acidic and

fruity smell

Colour Brownish yellow

Structure/texture Loose and soft,

non- viscous/firm

Moldiness or sliminess Absent

Chemical characteristics

pH value 4.37

Lactic acid (g/100g DM) 7.35

BC, ml of acid 8.94

NH3-N (g/100 g DM) 0.13

Acetic acid, g/kg DM 24.39

Propionic, g/kg DM 3.60

Butyric, g/kg DM 0.92

Valeric acid, g/kg DM 0.18

Isovaleric acid, g/kg DM 0.36

TVFAs, mM/100 g DM 29.45

WSC, g/kg DM 168.0

Flieg index 84.20

Verma et al.


97

toluene distillation method, Method 925.04), crude

protein (CP; Method 4.2.08), ether extract (EE; Method

920.85), total ash (Method 923.05), and acid insoluble

ash (AIA; Method 923.03) contents by following

protocol of AOAC (2005). Neutral detergent fibre

(NDF), acid detergent fibre (ADF) and acid detergent

lignin (ADL) were determined as per the method of

Van Soest et al. (1991). The total carbohydrate (total

CHO) and non-fiber carbohydrate (NFC) content were

determined by using the equation of Sniffen et al. (1992)

and Detmann and Valadares Filho (2010), respectively.

Ca and P content were determined by titration method

(Talpatra et al., 1940) and spectrophotometric method

(AOAC, 2005), respectively.

Physical characteristics were evaluated by

following guidelines of Horiguchi and Takahashi (2007).

The temperatures of the core, lateral and apical parts

of the working face of silage were measured

by mercury in glass clinical thermometer (Qingdao

Dacon Trading Co. Ltd., Shandong, China). The pH in

the silage extract before stabilizing with 5%

meta-phosphoric acid was measured by using a pH

meter (Systronics pH System-361, India). The

estimation of lactic acid in silage samples was done as

per the modified method of Barnett (1951). Buffering

capacity (BC) was determined by the hydrochloric

acid-sodium hydroxide method of Playne and McDonald

(1966). NH3–N content was measured in the extract

by phenol-hypochlorite assay (Weatherburn, 1967).

Volatile fatty acid (VFA) content was determined with

gas chromatography-mass spectroscopy (GC-MS;

5975C VL MSD with Triple-Axis Detector, Agilent

Technologies India Pvt. Ltd, with 30 m×320 µm×0.25

µm capillary column, condition: column temperature

130 °C, injection temperature 220 °C) fitted with flame

ionization detector (FID). The concentration of WSC in

silage sample was determined by method according

to McDonald and Henderson (1964). To assess the

quality of silage after ensiling for 60 days, Flieg index

by means of the pH values and DM content was

calculated (Kilic, 1986).

Animal care procedures were approved (approval

number, 121/IAEC/18) and conducted under the

established standard of the Institutional Animal Ethics

Committee (IAEC), constituted as per the article

number 13 of the Committee for the Purpose of Control

and Supervision of Experiments on Animals (CPCSEA)

rules laid down by the Government of India. A total 18

growing Hariana heifers were selected from the cattle

herd maintained at LFC, DUVASU, Mathura. All

heifers were housed in a well-ventilated shed having

the proper arrangement for individual feeding and

watering without having access to the other animal’s

diet. Deworming of all the experimental animals

were done before the start of the experiment by oral

administration of Fentas bolus (Intas Pharmaceuticals

Pvt. Ltd., India) at the dose level of 10 mg/kg body

weight. Animals were let loose every fortnightly for

exercise. Selected heifers were randomly assigned into

three groups (n=6) on body weight (130±3.0 kg) and

age basis (14±1.5 months). Heifers were either fed on

basal TMR that consisted of compounded concentrate:

available green fodder: wheat straw in proportion of

40: 40: 20 (S0%

) or TMR of which 50% green fodder

(DM basis) was replaced with corn silage (S50%

) and

TMR of which 100% green fodder (DM basis) was

replaced with corn silage (S100%

). Ingredients and

nutrients composition of TMR fed to animals in

different groups are presented in Table 2. TMR was

prepared daily by hand mixing and offered at 0900 h in

all tests. The calves were fed the TMR in such an amount

that at least 5% refusals were left daily per animals.

Fresh drinking water was offered ad libitum twice daily

at 0800 h and 1700 h.

The experimental calves were monitored daily for

DMI and fortnightly for growth performance. The

samples of TMR offered and ort left were dried in a hot

air oven at 60°C till a constant weight was attained and

ground in a Wiley mill to pass a 1-mm sieve. Processed

samples were pooled animal wise and stored at the dry

place. Samples of TMR offered and ort left were

analyzed for nutrient composition by following

methodology as mentioned in silage preparation and

quality evaluation section.

Replacement of green fodder with maize silage


98

Peripheral blood samples were collected in

heparinized vacuutainer tubes (BD Franklin, USA) by

venipuncture of jugular vein at 0, 30, 60 and 90 days of

experiment. A fraction of blood samples were used

for analysis of red blood cells (RBCs) count, white

blood cells (WBCs) count, haemoglobin (Hb)

concentration, packed cell volume (PCV) or haematocrit

(HIT) value, mean corpuscular volume (MCV), mean

cell haemoglobin (MCH), and mean corpuscular

hemoglobin concentration (MCHC) by using automatic

analyzer (Celltac alpha CM, Nihon, Kohden, Pvt. Ltd,

Surat, India). The remaining amount of blood samples

were centrifuged at 3000 rpm for 30 min to separate

the plasma from packed blood cells. Plasma samples

were stored at –20°C until further analysis of aspartate

aminotransferase (AST), alanine aminotransferase

(ALT), alanine phosphatase (ALP) activity, and plasma

Ca and P content by using automated biochemical

analyzer (BS-120 Chemistry Analyzer, Shenzhen

Mindray Biochemical Electronics Co. Ltd.).

Microclimatic data, viz., dry bulb temperature

(Cdb) and wet bulb temperature (Cwb) in degree

Celsius, were recorded at 0700 and 1400 h with dry and

wet bulb hygrometer (Zeal, UK) every day during

experimental period and THI was calculated by using

the following equation (McDowell et al., 1976).

THI = (0.72 × Cdb + Cwb) + 40.6

Daily relative humidity (RH) was calculated by

Table 2. Ingredients and nutrients composition of TMR fed during feeding trial (g/kg DM basis or as

mentioned)

Attribute Group

S0%

S50%

S100%

Ingredients composition

Berseem fodder 400 200 0

Corn silage 0 200 400

Wheat straw 200 200 200

Mustard oil cake, solvent extract 128 128 128

Ground barley grain 104 104 104

Gram chuni 80 80 80

Wheat bran 80 80 80

Micronutrient mixtureβ 8 8 8

Nutrients composition

DM 598.9 622.7 646.5

CP 167.4 147.0 126.6

EE 31.7 30.4 29.2

Ash 88.7 78.8 68.9

NDF 467.6 475.9 484.2

ADF 252.6 259.4 266.2

ADL 44.2 44.0 43.7

Total CHO 712.2 743.8 775.3

NFC 244.6 267.9 291.1

Ca 11.1 11.3 11.5

P 4.4 7.4 10.3

ME, Mcal/kg DM 2.24 2.25 2.26

βMicronutrient mixture consisted (kg-1) of 700,000 IU of vitamin A, 70,000 IU of vitamin D3, 250 mg of vitamin E, 190 g of Ca, 90 g of P,

50 g of Na, 19 g of Mg, 1.2 g of Cu, 9.6 g of Zn, 1.5 g of Fe, 6.0 g of Mn, 325 mg of I, 150 mg of Co, 10 mg of Se.

Verma et al.


99

the difference of dry bulb temperature and wet bulb

temperature.

Respiration rate (RR) of the animals was recorded

by observing flank movement and one inward and

outward movement was counted as one respiration and

recorded/minute. To record the pulse rate (PR),

coccygeal artery was palpated and recorded/

minute. Immediately after recording pulse rate, rectal

temperature (RT) was recorded using mercury in glass

clinical thermometer (Qingdao Dacon Trading Co. Ltd.,

Shandong, China), inserted 7 cm in the rectum for at

least 2 min and the rectal mucosa was in contact with

the bulb of the thermometer.

Data of the study were subjected to analysis of

variance using the General Linear Model (GLM)

procedure of the Statistical Software Package (SPSS

for windows, V21.0; Inc., Chicago, IL, USA). The

effect of green fodder replacement with corn silage on

performance, feed efficiency measures and blood

metabolites were tested using the following model:

Yijk = µ + Ti + Tj + (T × D)ij + eijk

Where; Yijk is dependent variable, µ is overall

mean of the population, Ti is mean effect of the

treatment, Dj is mean effect of day of sampling (j=0,

30, 60 and 90 days of dietary treatment), (T×D)ij is

effect of the interaction between treatment and period

and eijk is unexplained residual element assumed to be

independent and normally distributed. Individual animals

were used as the experimental unit for all data. The

pair-wise comparison of means was carried out using

“Tukey’s honest significant difference (HSD) test”.

Significance was determined at P<0.05 and the values

are presented in the tables. Error bars in figures depict

standard error. The data were also analyzed for

correlation coefficient (r) and coefficient of variation

(CV). Cost of feeding of silage as the replacement of

green fodder was calculated at the end of 90 d study

period.


In the present study, corn silage was well

preserved as indicated by their high lactic acid content

and low pH value, NH3-N content and butyric acid

content. Ensilaged maize fodder retained their physical

characteristics and silage smells slightly acidic and fruity,

appeared brownish-yellow with loose and soft and

non-viscous texture. Core silage temperature in the

bunker was 32°C which was slightly higher than

ambient temperature. Flieg points calculated by means

of the pH values and DM content also denoted a very

good quality of prepared corn silage. The DM content

and values of other nutritive constituents were within

ranges reported previously by NRC (2001) for typical

corn silage. The corn silage prepared in the present study

had a DM concentration of 270 g/kg fresh silage which

was near the optimum stage of maturity at harvest as

reported by Phipps et al. (2000), Keady et al. (2002b)

and Keady et al. (2007). Fisher and Lessard (1987)

reported that the DM, CP and ADF contents were 32.5,

8.0 and 27.0% for corn silage which was in accordance

with the findings of the present study. The pH of silage

is one of the simplest and quickest ways of evaluating

its quality, as silage properly fermented will have a much

lower pH as acids such as formic acid (Wang et al.,

2009), acetic acid (Queiroz et al., 2013) and propionic

acid (Mills and Kung, 2002) can quickly decrease pH at

the beginning of ensiling. Kung and Stoke (2001) also

reported pH values in the range from 3.7- 4.2 for maize

silage. Similar results were obtained by Church (1991),

Etman et al., (1994), McDonald et al., (1995), and

Sheperd and Kung (1996). Above cited studies reported

that pH values for maize silage ranged from 4.2-4.5.

Fig. 1. Mean THI and RH recorded during

experimental period

TH

I

Fortnight

RH

(%

)

THI

RH (%)



100

Lactic acid is the most abundant acid, around 75% of

the total acids contained in silage. In high quality corn

silage, it ranged between 4-7% (Seglar, 2003). The

lactic acid content of the silage of the present study

was within the optimum range. Langston et al. (1958)

stated that high quality silage is characterized by low

NH3-N concentration. The NH

3-N and VFAs content

of the corn silage in the present study felled within the

range observed by Sheperd and Kung (1996). In the

present study, prepared corn silage had a Flieg index

of 84.20, characterized by a typical very good

fermentation quality (Moselhy et al., 2015). Mafakher

et al. (2010) studied the chemical composition and quality

characteristics of corn, sunflower, and corn-sunflower

mixture silages and found highest Flieg index (103.01)

and the best pH value (3.66) for corn silage compared

to other silages.

The present study was conducted between the

months of May to July. As the days of experimental

period proceeded, THI and RH also increased (Figure

1). Mean THI and RH values during 90 days of

the experimental period were 80.48 and 79.52 %,

respectively. Thus, the heifers were in moderate heat

stress. Researchers stated 25 °C ambient temperature

as the upper critical temperature and 72 as the upper

critical THI (Bernabucci et al., 2002; NRC, 2005).

As the level of inclusion of corn silage increased

numerical values of RR, PR, and RT also increased but

Table 3. Feed intake, growth performance, and blood metabolites of animals fed TMR containing

different levels of corn silage

Attribute Groups SEM P value r¥ CVβββββ

S0%

S50%

S100%

Physiological response, feed intake and growth performance

Respiration rate, min-1 15.79 16.17 16.34 0.643 0.692 0.218 0.114

Pulse rate, min-1 59.88 60.52 60.98 0.941 0.502 0.029 0.059

Rectal temperature, ºF 100.15 100.78 101.12 0.227 0.994 0.284 0.026

DMI, kg/d 4.33a 4.93ab 5.16b 0.16 0.032 0.217 0.298

ADG, g/d 618.52 620.74 633.33 19.50 0.950 0.048 0.344

Hematological parameters

RBCs count, 106/µl 8.52 8.95 8.20 0.49 0.424 0.157 0.068

WBCs count, 103/µl 13.95 13.97 14.67 1.03 0.912 0.098 0.029

Hb, g/100 ml 9.90 10.22 9.64 0.38 0.576 -0.106 0.029

PCV, % 32.44 33.80 32.12 1.37 0.686 -0.038 0.027

MCV, fl 38.32 36.37 39.48 1.08 0.424 0.157 0.041

MCH, pg 11.50 10.96 11.88 0.33 0.184 0.249 0.070

MCHC, g/100 ml 30.03 30.15 30.10 0.21 0.768 0.031 0.002

Blood biochemical parameters

ALT (IU/L) 6.01 5.73 6.12 0.23 0.247 0.060 0.033

AST (IU/l) 25.62 25.73 26.05 0.79 0.896 0.094 0.009

De Rittis Index 4.31 4.56 4.32 0.20 1.000 0.028 0.013

ALP (IU/l) 27.54 26.44 28.49 1.23 0.150 0.128 0.037

Ca (mg/100 ml) 10.17 9.38 10.09 0.35 0.672 -0.031 0.044

P l (mg/100 ml) 5.53 5.40 5.80 0.23 0.762 0.113 0.036

De Rittis Index calculated as ratio of AST and ALT, SEM, standard error of mean; a,bmean with different superscript in a row differs

significantly (P<0.05), ¥greater (r>0) or lower (r<0) than zero value of Pearson square correlation coefficient showed positive or negative

correlation whereas, zero (r=0) value showed no correlation between treatment and attributes, βcoefficient of variation.

Verma et al.


101

statistical analysis showed non-significant impact

of rreplacement (Table 3). Physiological variables

showed weak positive correlation with treatment.

No information is available regarding the effect of

replacement of green fodder with corn silage on

physiological response of dairy animals. Numerically

lower RR, PR, and RT in cows receiving TMR with

higher green fodder proportion than those receiving TMR

with higher corn silage proportion indicated cooling

effect of green fodder (Singh, 1997). Roughage diets,

which are lower in ME density and NDF content;

appear to contribute less to metabolic heat load.

Different proportions of green fodder in the ration can

alter fibre quality, quantity, dietary vitamin A levels,

dietary β-carotene levels and some dietary intake of

minerals. These factors have several marked effects

on digestion and physiological response of dairy animals

(Van Soest, 1994).

Statistical analysis of data revealed that the

replacement of green fodder with corn silage affected

daily DMI significantly (P<0.05) and intake was reported

highest in S100%

group (Table 3; Figure 2). Although the

DMI increased with an increased level of inclusion of

corn silage but ADG was similar among all three groups.

Green fodder replacement with corn silage showed a

positive correlation with DMI and ADG.

It is perhaps predictable that the substitution of

green fodder by maize silage would cause a positive

effect on voluntary forage intake without altering cattle

Fortnight

SO% S5O% S10O%

Fig. 2. Effect of green fodder replacement with

corn silage on DMI

Table 4. Cost economics of replacing green fodder with corn silage

Attributes Group

S0%

S50%

S100%

DMI, kg/d 4.33 4.93 5.16

ADG, g/d 618.52 620.74 633.33

Parts of concentrate mixture in TMR, g/kg DM 400 400 400

Parts of berseem fodder in TMR, g/kg DM 400 200 0

Parts of corn silage in TMR, g/kg DM 0 200 400

Parts of wheat straw in TMR, g/kg DM 200 200 200

Cost of concentrate mixture, INR/kg DM 23.19 23.19 23.19

Cost of berseem fodder, INR/kg DM 16.67 16.67 -

Cost of corn silage, INR/kg DM - 18.52 18.52

Cost of wheat straw, INR/kg DM 7.22 7.22 7.22

Cost of TMR, INR/kg DM 17.39 17.76 18.13

Total cost of TMR intake, INR/animal/d 75.24 87.56 93.50

Cost of gain, INR/kg gain/d 118.49 135.54 140.18

Cost difference, INR/d - 12.32 18.26

DMI difference, kg/d - 0.600 0.830

ADG difference, g/d - 11.00 32.00

INR, Indian rupees.



102

performance due to their high palatability. There are

several examples in the literature where maize silage

inclusion has stimulated voluntary forage intake

(Hameleers, 1998; Mulligan et al., 1999), although this

is generally accompanied by little or no effect on the

performance of dairy animals. Keady et al. (2007)

offered grass silage either as the sole forage or in

addition to maize silage in continental cross beef steers

and found that the inclusion of corn silage in the diet

increased DM intake. The corn silage intake was higher

than cattle fed with fresh Napier grass (Siddque et al.,

2015) and Napier grass silage (Bureenok et al., 2012).

Juniper et al. (2005) replaced different levels of grass

silage with corn silage in the basal diet of Simmental ×

Holstein-Friesian steers and found that the forage DM

intake increased linearly with the increased level of

inclusion of maize silage. The linear intake response to

forage substitution observed in the current experiment

has also been reported previously with dairy cows

(O’Mara et al., 1998; O’Kiely and Moloney, 2000;

Phipps et al., 2000). El-Ayouty et al. (2000) also found

that up to 100 % of maize silage can be fed to rabbits

without affecting the growth performance. Fazaeli et

al. (2006) observed non-significant effect of inclusion

of different levels of corn and sorghum silage on body

weight gain of yearling male calves. Thus, the results

suggest that corn silage has the potential to replace green

fodder in the diets fed to growing cattle. Low feed

intake and similar gain in the heifers of green fodder fed

group might be due to better metabolizability of ration

than corn silage fed groups.

In the present study, hematological attributes

showed non-significant effect of the replacement of

green fodder with corn silage (Table 3). Effect of green

fodder replacement with corn silage showed a weak

positive correlation with RBCs count, WBCs count,

MCV, MCH, and MCHC and weak negative

correlation with Hb content and PCV value. CV for

haematological attributes in different groups ranged

between 0.2-7.0%. Information pertaining to the

variability of hematological parameters in animals fed

on varying levels of corn silage is scanty. The

hematological attributes reported in the present study

were within the range reported earlier (Singh, 2016;

Singh, 2019) in growing indigenous cattle. Amuda

and Okunlola (2018) also found that PCV and Hb

concentrations in the blood did not differ among West

African Dwarf Sheep fed on different levels of ensiled

maize stover. However, there were significant (P<0.05)

differences in RBC and WBC concentration between

the dietary treatments such that it was highest in the

diet with more ensiled maize stover.

No significant differences in the ALT, AST, De

Rittis index, ALP, and plasma Ca and P were observed

among S0%

, S50%

and S100%

groups. Data on AST,

ALT and ALP concentrations were within normal

physiological limits and corroborate to those reported

by Sharma et al. (2014) and Singh et al. (2016) in

healthy indigenous heifers. Plasma ALT, AST, De Rittis

index, ALP, and P concentration showed weak positive

correlation and plasma Ca levels showed a weak

negative correlation with treatment. CV for blood

biochemical attributes in different groups ranged

between 0.9-4.4 %. Chen et al. (2015) also observed

no difference in serum concentrations of ALT and AST

among treatments having different proportion of for-

age. Little and Manston (1972) compared corn silage

and alfalfa hay as forages for dairy cattle and found

slightly higher P and slightly lower Ca in the blood of the

corn silage fed cows, but were within physiological

range.

Cost of feeding increased with the increased level

of inclusion of corn silage (Table 4). Cost difference

denoted that 12.32 and 18.26 INR/d required more in

S50%

and S100%

groups, respectively than S0%

group while

heifers were gaining at the similar rate. Higher cost

economics for replacement of green fodder with corn

silage was due to less metabolizability of corn silage

than green fodder.

Cost economics for replacement of green fodder

with corn silage was due to less efficiency of corn

silage utilization than green fodder. Bose et al. (2014)

observed lower total feed cost in more efficient calves

than less efficient calves over the course of the 52 day

Verma et al.


103

feeding period in Murrah buffalo calves.

CONCLUSION

Results of the present study demonstrate that

prepared corn silage was well preserved and of very

good quality. Replacement of green fodder with corn

silage increased feed intake and cost of feeding while

growth performance was similar. Replacement of green

fodder with corn silage did not exert any effect on

physiological response, hematological attributes, and

blood metabolites. Corn silage can be used as an

alternative to high quality green fodder during scarcity

period without affecting performance of dairy animals.

REFERENCES

Amuda, A.J. and Okunlola, D.O. 2018. Haematological

parameters and serum biochemistry of West African

dwarf sheep fed ensiled maize stover and concentrate

supplements. J. Agric. Vet. Sci. 11: 57-63.

AOAC. 2005. Official Methods of Analysis, 18th edn.

Association of Official Analytical Chemists.

Washington DC.

Barnett, A.J.G. 1951. The colorimetric determination of lactic

acid in silage. Biochem. J. 49: 527-529.

Bernabucci, U., Ronchi, B., Lacetera, N. and Nardone, A. 2002.

Markers of oxidative status in plasma and erythrocytes

of transition dairy cows during hot season. J. Dairy

Sci. 85: 2173-2179.

Bose, B.K.S., Kundu, S.S., Tho, N.T.B., Sharma, V.K. and

Sontakke, U.B. 2014. Residual feed intake as a feed

efficiency selection tool and its relationship with

feed intake, performance and nutrient utilization in

Murrah buffalo calves. Trop. Anim. Health Prod. 46:

615-662.

Bureenok, S., Yuangklang, C., Vasupen, K., Schonewille, J.T.

and Kawamoto, Y. 2012. The effects of additives in

Napier grass silages on chemical composition, feed

intake, nutrient digestibility and rumen fermentation.

Asian Australas. J. Anim. Sci. 25: 1248-1254.

Chaudhary, D.P., Jat, S.L., Kumar, R., Kumar, A. and Kumar, B.

2014. Fodder quality of maize. In: Chaudhary D.P,

Kumar S, Singh S (eds.), Its preservation in maize

nutrition, dynamics and novel uses, Springer, India.

pp: 153-160.

Chen, G.J., Song, S.D., Wang, B.X., Zhang, Z.F., Peng, Z.L.,

Guo, C.H., Zhong, J.C. and Wang, Y. 2015. Effects of

forage: concentrate ratio on growth performance,

ruminal fermentation and blood metabolites in

housing-feeding Yaks. Asian Australas. J. Anim. Sci.

28: 1736-1741.

Church, D.C. 1991. Livestock Feeds and Feeding, 3rd ed.

Prentice Hall INC. Engle wood Cliffs, New Jersey, USA.

Detmann, E. and Filho, S.C.V. 2010. On the estimation of

non-fibrous carbohydrates in feeds and diets. Arq.

Bras. Med. Vet. Zootec. 62: 980-984.

El-Ayouty, S.A., Abdel-khalek, A.E., Ghanay, E.L., A.I.A. and

Shatifa, M.A. 2000. Effects of diets containing silage

on growth performance digestibility and carcass traits

of growing rabbits. Egyptian J. Nutr. Feeds. 3: 43-56.

Etman, K.E.I., Khafagi, E.A., Malik, A., Hathout, W.A. and

El-Sayes, M.F. 1994. Conservation of green summer

forage as silage and its utilization in feeding growing

lambs. In Proceedings of the 8th Conference, Egyptian

Society of Animal Production, pp: 175.

Fazaeli, H., Golmohhammadi, H.A., Al-Moddarres, A.,

Mosharraf, S. and Shoaei, A.A. 2006. Comparing the

performance of sorghum silage with maize silage in

feedlot calves. Pakistan J. Biol. Sci. 9: 2450-2455.

Fisher, L.J. and Lessard. 1987. Intake and digestibility of corn,

rye and sorghum-sudan grass silages by lactating

cows. Can. J. Anim. Sci. 67: 1027-1032.

Hameleers, A. 1998. The effects of the inclusion of maize

silage, fermented whole crop wheat or urea-treated

whole crop wheat in a diet based on high-quality grass

silage on the performance of dairy cows. Grass

Forage Sci. 53: 157-163.

Horiguchi, K. and Takahashi, T. 2007. Fermentation quality

and nutritive value of green soybean stover silage.

Grassl. Sci. 53: 27-31.

Juniper, D.T., Browne, E.M., Fisher, A.V., Bryant, M.J., Nute,

G.R. and Beever, D.E. 2005. Intake, growth and meat

quality of steers given diets based on varying

proportions of maize silage and grass silage. Anim.

Sci. J. 81:159-170.

Kaiser, A.G. and Piltz, J.W. 2004. Feed testing assessing silage

quality in successful silage. Dairy Australia and New

South Wales Department of Primary Industries, pp:

312-333.

Keady, T.W.J., Lively, F.O., Kilpatrick, D.J. and Moss, B.W.

2007. Effects of replacing grass silage with either maize

or whole-crop wheat silages on the performance and

meat quality of beef cattle offered two levels of

concentrates. J. Anim. Sci. 1: 613-623.

Keady, T.W.J., Mayne, C.S. and Kilpatrick, D.J. 2002b. The

effect of maturity of maize silage at harvest on the

performance of lactating dairy cows offered two

contrasting grass silages. In Proc. Br. Soc. Anim. Sci.



104

pp:16.

Kilic, A. 1986. Silo Feed, Instruction, Education and

Application Proposals, pp:327.

Kung, J.L. and Stokes, M. 2001. Analyzing silages for

fermentation end products. (Available:http://

www.ag.udel.edu/anfs/faculty/kung/articles/

analyzing/silages/for/formentati.htm; Accessed 21

November 2012).

Langston, C.W., Irvin, H., Gordon, C.H., Bouma, C., Wismani,

H.G., Melin, C.G. and Moore, L.A. 1958. Microbiology

and chemistry of grass silage. Tech. Bull. 1187.

Little, W., Manston, R. 1972. The effect of feeding maize and

lucerne silages on blood composition in dairy cows. J.

Agric. Sci. 78: 809.

Mafakher, E., Meskarbashee, M., Hassibi, P. and Mashayekhi,

M.R. 2010. Study of chemical composition and quality

characteristics of corn, sunflower and corn-sunflower

mixture silages. Asian J. Anim. Vet. Adv. 5: 175-179.

McDonald, P. and Henderson, A.R. 1964. Determination of

water-soluble carbohydrates in grass. J. Sci. Food

Agric. 15: 395-398.

McDonald, P., Edwards, R.A., Greenhalgh, J.F.D. and

Morgan, C.A. 1995. Animal Nutrition, 5th ed.

Copyright Licensing LTD, London.

McDowell, R.E., Hooven, N.W. and Camoens, J.K. 1976.

Effect of climate on performance of Holsteins in first

lactation. J. Dairy Sci. 59: 965-973.

Mills, J.A. and Kung, J.L. 2002. The effect of delayed ensiling

and application of a propionic acid-based additive on

the fermentation of barley silage. J. Dairy Sci. 85:

1969-1975.

Moselhy, M.A., Borba, J.P. and Borba, A.E.S. 2015. Improving

the nutritive value, in vitro digestibility and aerobic

stability of Hedychium gardnerianum silage through

application of additives at ensiling time. Anim. Feed

Sci. Technol. 206: 8-18.

Mulligan, F.J., O’Mara, F.P., Rath, M., Caffery, P.J., Callan, J.

and Flynn, B. 1999. Factors affecting the feeding value

of maize and grass silage in late lactation dairy cows.

In Proc. Br. Soc. Anim. Sci. pp: 79.

Nazli, M.H., Halim, R.A., Abdullah, A.M., Hussin, G. and

Samsudin, A.A. 2019. Potential of four corn varieties at

different harvest stages for silage production in

Malaysia. Asian-Australas. J. Anim. Sci. 32: 224-232.

NRC. 2001. Nutrient Requirements of Dairy Cattle. 7th Rev

ed. National Research Council. National Academy

press, Washington DC.

NRC. 2005. Mineral Tolerance of Animals. National Research

Council. National Academy, Washington DC.

O’Kiely, P. and Moloney, A.P. 2000. Nutritive value of maize

and grass silage for beef cattle when offered alone or

in mixtures. In Proc. Agric. Res. Forum. pp: 99-100.

O’Mara, F.P., Fitzgerald, S., Murphy, J.J. and Rath, M. 1998.

The effect on milk production of replacing grass silage

with maize silage in the diet of dairy cows. Livest. Prod.

Sci. 55: 79-87.

Phipps, R.H., Sutton, J.D., Beever, D.E. and Jones, A.K. 2000.

The effect of crop maturity on the nutritional value of

maize silage for lactating dairy cattle, food intake and

milk production. J. Anim. Sci. 71: 401-409.

Playne, M.J. and McDonald, P. 1966. The buffering

constituents of herbage and of ensilage. J. Sci. Food

Agric. 17: 264-268.

Queiroz, O.C., Arriola, K.G., Daniel, J.L. and Adesogan, A.T.

2013. Effects of 8 chemical and bacterial additives on

the quality of corn silage. J. Dairy Sci. 96: 5836-5843.

Seglar, B. 2003. Fermentation analysis and silage quality

testing. In Proceedings of the Minnesota Dairy Health

Conference. College of Veterinary Medicine,

University of Minnesota, USA, pp: 119-136.

Sharma, V.C., Mahesh, M.S., Mohini, M., Datt, C. and

Nampoothiria, V.M. 2014. Nutrient utilisation and

methane emissions in Sahiwal calves differing in

residual feed intake. Arch. Anim. Nutr. 68: 345-357.

Sheperd, A.C. and Kung, L. 1996. An enzyme additive for corn

silage: Effect on silage composition and animal

performance. J. Dairy Sci. 79: 1760.

Siddque, M.A.B., Sarker, N.R., Hamid, M.A., Amin, M.N. and

Sultana, M. 2015. Growth performance, feed

conversion ratio and economics of production of

native and crossbred (local× Holstein Friesian) bulls

for fattening under different improved feeding. J. Agric.

Sci. Technol. A5: 770-780.

Singh, A., Kumar, M., Kumar, V., Roy, D., Kushwaha,

R., Vaswani, S. and Kumar, A. 2019. Effect of nickel

supplementation on liver and kidney function test and

protein metabolism in growing cattle. Proc. Nat. Acad.

Sci. India Sec. B Biol. Sci. doi.org/10.1007/s40011-

019-01087-9.

Singh, P. 1997. Feeding Management Studies on Green

Forage Proportions in the Ration of Lactating

Crossbred Cows. MVSc thesis submitted to National

Dairy Research Institute (NDRI), Karnal, India.

Singh, S. 2016. Effect of Feeding Biomethanated Spent Wash

on Growth and Nutrient Utilization in Growing

Cattle. MVSc thesis submitted to U. P. Pandit Deen

Dayal Upadhyaya Pashu Chikitsa Vigyan

Vishwavidyalaya Evam Go-Anusandhan Sansthan

Verma et al.


105

(DUVASU), Mathura (Uttar Pradesh), India.

Singh, S., Kumar, M., Kumar, V., Roy, D., Kushwaha, R., Vaswani,

S., Singh, Y. and Singh, S.K. 2016. Evaluation of

molasses based biomethanated distillery spent wash

as an alternative feed for growing cattle. Indian J. Anim.

Nutr. 33: 388-393.

Sniffen, C.J., O’Connor, J.D., Van Soest, P.J., Fox, D.G. and

Russell, J.B. 1992. A net carbohydrate and protein

system for evaluating cattle diets, carbohydrate and

protein availability. J. Anim. Sci. 70: 3562-3577.

Talapatra, S.K., Roy, S.C. and Sen, K.C. 1940. The analysis of

mineral constituents in biological materials. Estimation

of phosphorus, chlorine, calcium, manganese, sodium

and potassium in foodstuffs. Indian J. Vet. Sci. Anim.

Husb.10: 243.

Van Soest, P.J. 1994. Nutritional Ecology of the Ruminant,

2nd edn. Comstock Publishing Associates/Cornell

University Press, Ithaca, New York, USA, pp: 476.

Van Soest, P.J., Robertson, J.B. and Lewis, B.A. 1991.

Methods for dietary fiber, neutral detergent fiber, and

nonstarch polysaccharides in relation to animal

nutrition. J. Dairy Sci. 74: 3583-3597.

Varadyova, Z., Kisidayova, S., Laukova, A. and Jalc, D. 2010.

Influence of inoculated maize silage and sunflower oil

on the in vitro fermentation, ciliate population and fatty

acid outputs in the rumen fluid collected from sheep.

Czech J. Anim. Sci. 55: 105-115.

Wang, J., Wang, J.Q., Zhou, H. and Feng, T. 2009. Effects of

addition of previously fermented juice prepared from

alfalfa on fermentation quality and protein

degradation of alfalfa silage. Anim. Feed Sci. Technol.

151: 280-290.

Weatherburn, M.W. 1967. Phenol Hipochlorite Reaction for

Determination of Ammonia. Anal. Chem. 39: 971-974.




106

Indian Journal of

Animal Nutrition

Effect of Supplementing Wet Distillers’ Grains with Solubles to Maize

Silage Based Diet on Performance of Growing Nellore Jodipi Ram Lambs

K. Naveena, A. Ravi1*, B. Devasena2 and S. Shakila3

Department of Animal Nutrition, College of Veterinary Science,

Sri Venkateswara Veterinary University, Tirupati-517 502, Andhra Pradesh, India

ABSTRACT

The objective of the study was to evaluate performance of ram lambs supplemented with distillers grains

with solubles (DGS) under intensive system. In a completely randomized design, 24 growing Nellore Jodipi ram

lambs were divided into 4 equal groups of six each. Corn silage was fed ad libitum to all the rams, basal diet was

supplemented with DDGS at 1.0% BW in control group (T1), whereas WDGS was supplemented at 1.0, 1.5 and

2.0 % BW in groups T2, T

3 and T

4, respectively.The average daily gain (g) of 105.4, 69.1, 81.6, and 89.5 was

recorded recorded in T1 to T

4 fed lambs respectively, was higher (P<0.05) in T

1 than in T

2. The DMI from silage

and total DMI were not significantly different among treatments. The DMI (g/d) from dry DGS was 153.0 in T1

and 46.6, 74.4 and 99.8, in T2 to T

4 from wet DGS, respectively and was higher (P<0.05) in T

1 than in T

2. The feed

efficiency was inferior (P<0.05) in T2 as compared to other treatments. The digestibility of nutrients except CP

and EE was not significantly different among treatments. The N retained as per cent of intake and the molar

proportion of acetate, and acetate to propionate ratio was higher (P<0.05) in T1 than in other treatments. There

was no significant difference among treatments with respect to serum concentration of protein, mineral profile

of serum except for a higher (P<0.05) phosphorus in T1 fed lambs. The carcass traits, chemical composition and

mineral profile of longissimus dorsi muscle were also not significantly different among dietary treatments.

Returns over feed cost was higher (P<0.01) in T1 and T

4, than in T

2 and T

3 fed lambs. It was concluded that

supplementation of wet DGS to maize silage-based diet at 2.0% of body weight resulted in performance

comparable with dry DGS supplementation at 1 % of body weight.

Key words: Maize silage, Ram lambs, Supplementation, Wet Distillers grains with soluble

1Corresponding author; Email: [email protected], NTR CVSc., Gannavaram, AP; 2Department of Animal Nutrition, CVSc., Tirupati, AP3Department of Poultry Science, CVSc., Tirupati, AP

INTRODUCTION

The cereal processing industries in India are

on constant rise producing various beverage-based

by-products at higher amounts (Lakshmi et al., 2017).

Among these by-products, distillers grains with solubles

(DGS) is a by-product of ethanol industry made

primarily of unfermented grain residue containing

protein, fibre, and fat at higher amounts (Reddy et al.,

2017). The DGS is majorly used as a protein source, but

can also be used to provide energy due to presence of

degradable fibre in large amounts (NDF - 38-40%).

Farmers, especially those in third-world countries,

feed sheep with DGS in two forms i.e., wet DGS

(WDGS) and dry DGS (DDGS) depending on the

availability (Iram et al., 2020). Though wet DGS has

four to five days of shelf life, the chemical composition

of the dry and wet DGS is similar on dry matter basis.


doi: 10.5958/2231-6744.2020.00018.3

However, poor amino acid digestibility due to Maillard

reaction can be observed in dry DGS than in wet DGS

due to extreme hot conditions during drying of wet DGS

(De Almeida, 2013). Feeding of wet DGS would be

economic as the cost incurred in drying the product

can be bypassed and loss of protein quality due to heat

treatment can be minimized (Schingoethe et al., 2009).

Addition of DGS to replace soybean meal to the ration

has been beneficial in finishing lamb diets (Kawecka et

al., 2018). In view of availability of wet DGS to

farmers in the vicinity of distillery plants, this study was

taken up to study the effect of supplementing wet DGS

to corn silage based on performance of lambs under

intensive system of rearing.


All experimental protocols were approved by the

Institutional Committee for Animal Use and Ethics of


107

the College of Veterinary Science, Tirupati. Corn silage

was purchased from M/S Fertile Green Inc, Nellore,

WDGS was procured weekly once from a local vendor

and DDGS was purchased from Prorich Agro Foods,

Haryana.

In a completely randomized design and under

intensive system, 24 Nellore Jodipi ram lambs (3-4

months old, 12.8 ± 2.4 kg BW) were randomly allotted

to four treatment groups of six animals each. Corn

silage was fed ad libitum to all the rams, basal diet was

supplemented with DDGS at 1.0% BW in control group

(T1), whereas WDGS was supplemented at 1.0, 1.5 and

2.0 % BW in groups T2, T

3 and T

4, respectively.

Animals were housed in a pucca shed individually in

pens of 2.1 x 1.2 x 1 m dimensions having facilities for

individual feeding and watering. The ram lambs were

fed weighed quantity of DGS at 9:00 AM daily and corn

silage ad libitum twice daily at 12:00 PM and 4:30 PM.

The leftover corn silage if any, was recorded. The body

weight of lambs was recorded at weekly intervals. The

growth trial lasted for 90 days and was preceded by a 7

days adaptation period during which time the animals

were weighed, tagged for identification, treated for

ecto- and endoparasites and adapted to corn silage. After

completion of growth trial, the lambs were shifted to

metabolism cages for metabolism trial with 14 day

preliminary and 7 day collection periods that was

followed by slaughter by “Halal” method (Gerrard,1964)

and whole cuts were taken as per ISI (1963) to study

the effect of treatments on carcass traits.

Representative samples of feed offered and feed

residues were collected and weighed. Silage samples

and WDGS samples were taken at 3 days interval, DM

was estimated immediately and dried samples were

pooled. During metabolism trial, a 24-hour collection of

faeces was recorded everyday morning at 9:00 AM for

seven days. Daily faeces was pooled for 24 hours in

separate containers and the faeces was weighed, mixed

thoroughly and representative sample (2%) was taken

separately for each animal and stored in a deep freezer

at –20º C. At the end of the trial faecal samples were

thawed to room temperature and fresh samples were

taken for nitrogen estimation. For further analysis, faeces

was dried at 60ºC and ground to pass through 1 mm

screen of a Willey mill and were preserved in air tight

bottles. A 24-hour collection of urine was recorded

everyday morning at 8:00 AM for seven days and

representative sample (1/10th of total volume voided)

was taken separately for each animal and stored in a

deep freezer at –20º C. At the end of the trial urine

samples were thawed to room temperature and sampled

for nitrogen estimation.

Rumen contents were collected at the time of

slaughter and filtered through four layers of muslin cloth

and approximately 100 ml of filtrate was collected, a

few drops of concentrated sulphuric acid was added

and stored at -20º C for further analysis (Spanghero et

al., 2019). Blood was collected from each animal under

aseptic conditions from jugular vein at the end of growth

trial and kept in slant position for 1 h and samples were

centrifuged at 3000 rpm for 5 min, serum was collected

in Eppendorf tubes and kept at -20ºC for further

estimation of serum protein and minerals.About 100g of

meat sample (Longissimus dorsi) was collected at the

time of slaughter and stored at -20º C for further

analysis.

Proximate composition (AOAC, 2005) and cell

wall constituents (Van Soest et al., 1991) were

estimated in the dried and pooled samples of corn

silage, leftover silage, WDGS, DDGS and faeces. Urine

was analyzed for nitrogen (AOAC, 2005). The per cent

moisture, crude protein and crude fat (AOAC, 2005)

was estimated. Serum protein was estimated using a

commercial kit (Erba Total Protein Estimation) and

minerals in serum and meat samples were estimated

using atomic absorption spectrophotometer (GBC AAS

Avanta PM Model).

Three samples per silage bale were taken, 100 ml

of distilled water was added to 10 g of sample and

triturated for 3-5 minutes with the help of mortar and

pestle and filtered using Whatman filer paper No.1

(Hasanah et al., 2017) for pH estimation.

Naveena et al.


108

Samples of WDGS for pH estimation were drawn

at weekly intervals, 20 ml of distilled water was added

to 5 g of sample, kept for 30 minutes and filtered using

Whatman filer paper. No.1, pH of the silage extract,

WDGS extract and rumen liquor was estimated using

EUTECK 501 pH meter. Silage extract was collected

by incubating 10 g of fresh silage with 100 ml of distilled

water for 24 hours followed by filtration (Hasanah et

al., 2017) and samples were kept at -200C till

estimation of lactic acid.

NH3-N in rumen liquor was estimated (AOAC,

2005). TVFA and molar proportions of acetic, propionic

acid and butyric acids was estimated using ACME 6000

gas chromatography. Samples were prepared for GC

analysis (Soren and Rao, 2015) and stock standards were

purchased from Sigma. Working standard solutions of

acetic, propionic and butyric acid were prepared having

concentration of 10 m Mol/ml separately and mixed

standard was prepared from individual working

standard solutions to contain acetic, propionic and

butyric acids in 65:21:14 ratio. The operating conditions

followed during analysis included, inlet temperature at

200º C, detector temperature at 220º C and oven

program with initial temperature at 100º C for 3 min,

ramp rate at 10º C/min till final temperature at 180º C.

Calculation:

Concentration of analyte in sample (mM/ml) =

area of analyte × concentration of analyte in standard

factordilution ml

mM×

area of analyte in standard

10 g of fresh silage sample was triturated

(Hasanah et al., 2017) for 3-5 minutes using 100 ml of

distilled water and filtered using Whatman filter paper

No. 1 and the extract was used for estimation of

ammonia nitrogen (AOAC, 2005).

Statistical analysis

Data obtained were subjected to one-way

analysis of variance (version 23.0; SPSS, 2015) and the

treatment means were ranked using Duncan’s multiple

range test with a significance at P<0.05 (Duncan,1955).

All the statistical procedures followed were in

accordance with Snedecor and Cochran (1994).


The chemical composition of corn silage, DDGS

and WDGS is presented in Table 1. There was a wide

variation in the chemical composition of silage and

WDGS during the study. Many factors influence the

variation in composition of corn silage starting from seed

sowing till end of fermentation including type of soil,

Table 1. Chemical composition of feedstuffs (% DM basis) #

Composittion Corn silage (n=10) Dry DGS Wet DGS (n=9)

Dry matter 31.4±2.07 (27.7-33.8) 90.2 31.1±3.45 (26.7-35.6)

On % DM basis

Crude protein 7.2±1.92 (4.4-9.5) 37.6 32±11.55 (17.0-44.9)

Ether extract 2.6±1.07 (1.6-5.4) 1.0 4.4±0.47 (3.6-5.2)

Crude fibre 30.0±5.06 (23.0-38.7) 13.2 3.7±0.59 (2.8-4.9)

Total ash 5.4±0.40 (4.7-6.0) 9.4 7.8±2.87 (4.8-13.2)

Nitrogen free extract 54.8±3.90(48.2-60.0) 38.8 53.5±11.56 (36.5-71.3)

Neutral detergent fibre 46.8±2.64(43.4-52.3) 38.8 53.8±2.22(51.3-57.9)

Acid detergent fibre 31.1±3.45(24.9-35.1) 18.3 23.8±2.36(20.5-27.2)

pH 3.4±0.35 (2.3-3.8) - 3.5±0.53(2.9-4.2)

NH3 - N (% of total N) 10±5.04 (3.3-18.2) - -

Lactic acid 3.1±0.46 (2.5-3.8) - -

#Values in parenthesis indicate range

Feeding value of wet distillers grains with solubles


109

irrigation and harvesting practices (Bal, 2006). The most

influencing factor is dry matter content at harvest time

because nutrient contents like starch, water soluble

carbohydrates (WSC) and NDF depends on dry matter

content of fodder (Khan et al., 2009) and the content of

WSC decides the quality of silage by maintaining pH of

silage. The nutrient composition of WDGS is not

constant and it would fluctuate frequently depending on

many factors like type and quality of grain and

conditions of processing such as milling, fermentation,

temperatures adopted during drying and the quantity of

solubles that are blended into WDGS (Reddy et al.,

2017). The average value (% total N) for NH3-N (Table

1) of corn silage was indicative of good quality but there

was wide variation, 4.16±0.68 at the time of opening

the silage bale, 10.09±1.44 when 50% of silage in a bale

was used up and 15.8±1.9 at the time of complete

usage of silage in a bale. High temperature provokes

the microbial activity which results in higher NH3–N

due to proteolysis (Muck and Dickerson, 1988). As

the experiment was conducted during summer (March-

June), high temperature during storage and time of

sampling might be the reasons for obtaining higher val-

ues for NH3 - N.

The weight gain (kg) of ram lambs (Table 2) was

9.27, 6.57, 7.18, and 8.50 in T1, T

2, T

3 and T

4,

Table 2. Effect of dietary treatments on body weight gain and feed efficiency of ram lambs

Parameter Dietary treatments* SEM P value

T1

T2

T3

T4

Initial weight (kg) 12.92 12.87 12.77 12.8 1.00 0.99

Final weight (kg) 22.19 19.43 19.95 21.3 1.44 0.545

Weight gain (kg) 9.27a 6.57b 7.18ab 8.50ab 0.71 0.018

ADG (g) 105.4a 69.1b 81.6ab 89.5ab 8.24 0.008

DMI silage (g) 478 447 416 472 50.67 0.84

DMI DGS (g) 153.0a 46.6b 74.4ab 99.8ab 17.52 0.00

Total DMI (g) 631.1 493.8 490.9 572.4 60.00 0.296

FCR 5.65 7.07 5.85 6.39 0.59 0.351

ADG, average daily gain, DMI, average daily dry matter intake; DGS, distillers grain with solubles; FCR, feed conversion ratio; *Corn silage

was fed ad libitum to all the rams, basal diet was supplemented with DDGS at 1.0% BW in control group (T1), whereas WDGS was

supplemented at 1.0, 1.5 and 2.0 % BW in groups T2, T

3 and T

4, respectively; a,bMean values within a row with unlike superscript letters

were significantly different for each dietary treatment

Table 3. Effect of dietary treatments on nutrient digestibility (%) of ram lambs


T1

T2

T3

T4

Dry matter 70.48 70.98 69.7 71.75 2.13 0.937

Organic matter 71.35 72 71.22 73.02 2.05 0.938

Crude protein 59.74ab 56.73ab 54.00a 67.92b 3.67 0.022

Ether extract 71.78a 81.34ab 79.30ab 86.37b 3.74 0.026

Crude fibre 63.43 59.78 61.78 61.25 3.23 0.906

NFE 77.56 79.03 78.43 77.66 1.83 0.948

NDF 73.24 70.75 71.49 72.51 2.55 0.925

ADF 78.69 73.01 70.85 72.2 2.82 0.218

NFE, nitrogen free extract, NDF, neutral detergent fibre; ADF, acid detergent fibre; a,b Mean values within a row with unlike superscript letters

were significantly different for each dietary treatment; *Corn silage was fed ad libitum to all the rams, basal diet was supplemented with

DDGS at 1.0% BW in control group (T1), whereas WDGS was supplemented at 1.0, 1.5 and 2.0 % BW in groups T

2, T

3 and T

4, respectively.

Naveena et al.


110

respectively; leading to an average daily of gain of 105,

69, 81 and 89 g which was significantly (P<0.05) higher

in T1 than in T

2, and the FCR was inferior in T

2

compared to other treatments but the differences were

not significant. The nutrient digestibility due to wet DGS

supplementation was not significantly improved except

for higher (P<0.05) CP and EE digestibility in T4 (Table

3).

The nitrogen intake (g/d) and retention (either as

g/d or as % of intake) were higher (P<0.05) in T1 and

T4 compared to other treatments. The higher N

retention might be due to the higher (P<0.05) dry

matter intake and CP digestibility in T1 and T

4 groups

(Table 4). The higher CP digestibility in group T4 than

other groups might be due to the higher amount of

available protein from wet DGS. De Almeida (2013)

and Schingoethe et al. (2009) stated that Maillard

reaction was one of the reasons for lower availability of

protein in dried DGS. The DMI from silage and the

total DMI were higher in T1 and T

4 fed lambs The DMI

from DGS was also higher (P<0.05) in T1 and least in

T2. The better growth performance of ram lambs in T

1

and T4 might also be explained by the higher plane of

nutrition (Table 5). In both these treatment groups, the

CP and DCP content (% DM) were higher (P<0.05)

than in T2 and T

3. The plane of nutrition of ram lambs in

T1 and T

4 compared favourably with the requirements

set by ICAR (2013) feeding standards, which suggested

a DMI of 3.8- 4.2% of live weight with a CP and TDN

content of 13-14 % and 57-58%, respectively. The DMI

(% BW) and TDN (% DM) values were comparable

across treatments with the ICAR (2013) feeding

standards. There was a deficit of protein intake in T2,

T3 and T

4 by 24.1, 15.6 and 0.46%, respectively while

Table 4. Effect of dietary treatments on nitrogen balance of ram lambs


T1

T2

T3

T4

N intake (g/d) 20.52a 14.27b 13.26b 19.68a 2.01 0.003

N voide in faeces (g/d) 7.23 5.93 5.54 6.66 0.6 0.198

N voided in urine (g/d) 3.85 3.67 3.05 5.54 0.77 0.11

Total N voided (g/d) 11.08 9.61 8.59 12.2 1.62 0.003

N retained (g/d) 13.29a 8.34b 7.71b 13.02a 1.07 0.061

N retained (% intake) 46.27a 32.76b 34.66b 38.04ab 3.49 0.012

N retained (% absorbed) 66.43 58.11 67.23 50.92 4.72 0.069

a,b Mean values within a row with unlike superscript letters were significantly different for each dietary treatment; *Corn silage was fed ad

libitum to all the rams, basal diet was supplemented with DDGS at 1.0% BW in control group (T1), whereas WDGS was supplemented at

1.0, 1.5 and 2.0 % BW in groups T2, T

3 and T

4, respectively.

Table 5. Effect of dietary treatments on plane of nutrition


T1

T2

T3

T4

Body weight (kg) 18.3 18 16.7 19 1.26 0.186

Total DMI (g) 797 645 554 713 60 0.296

DMI (% BW) 4.41 3.66 3.76 3.76 0.26 0.093

DCP (% DM) 9.46b 7.75c 7.51c 11.85a 1.00 0.00

TDN (% DM) 68 70.35 69.01 71.42 2.03 0.693

DMI, average daily dry matter intake; DCP, digestible crude protein, TDN, total digestible nutrients; *Corn silage was fed ad libitum to all

the rams, basal diet was supplemented with DDGS at 1.0% BW in control group (T1), whereas WDGS was supplemented at 1.0, 1.5 and 2.0

% BW in groups T2, T

3 and T

4, respectively.



111

in T1 fed lambs it was as per recommendations. Lower

protein content in T2 and T

3 diets might be the reason

for getting lower body weight gain in those two groups.

It was of interest to see if wet DGS supplementation

could promote optimum ruminal fermentation and

stimulate consumption of basal roughage i.e. corn

silage. Intake of the silage is related to three measures

of quality, namely dry matter and digestible organic

matter content, and ammonia nitrogen content as a

proportion of total nitrogen content. Other measures of

silage quality affecting its intake are nitrogen content,

butyric acid content and pH (McDonald et al., 2001).

In the present study also, the NH3-N content as a

proportion of total nitrogen increased from the time of

opening a silage bale to the end of use probably

affecting the voluntary DM intake from silage. Further,

CF content of silage ranged from 23.0 to 38.7% with a

mean value of 30.0% (Table 1) and the higher CF

content might also have failed to stimulate the voluntary

intake of silage. The leftover silage contained 34.3%

crude fibre.

The rumen fermentation pattern (Table 6)

revealed optimum rumen pH across treatments and a

slightly higher NH3-N in T

2 to T

4 diets due to wet DGS

Table 6. Rumen fermentation pattern of the ram lambs fed experimental diets


T1

T2

T3

T4

Rumen Ph 6.58 6.48 6.38 6.38 0.11 0.58

NH3 - N (mg/100 ml) 5.8 5.92 6.1 6.17 0.21 0.603

TVFA (mMol/dl) 21.83 18.9 20.48 19.54 1.16 0.327

Molar proportion

Acetic acid 0.42a 0.39ab 0.33b 0.37ab 0.02 0.034

Propionic acid 0.34 0.36 0.37 0.37 0.01 0.199

Butyric acid 0.25 0.25 0.29 0.26 0.02 0.317

Acetate :Propionate 1.25a 1.1ab 0.89b 0.99ab 0.1 0.033

a,bMean values within a row with unlike superscript letters were significantly different for each dietary treatment; *Corn silage was fed ad

libitum to all the rams, basal diet was supplemented with DDGS at 1.0% BW in control group (T1), whereas WDGS was supplemented at

1.0, 1.5 and 2.0 % BW in groups T2, T

3 and T

4, respectively.

Table 7. Serum protein (g/dl) and mineral profile (mg/dl) of the ram lambs


T1

T2

T3

T4

Protein (g/dl) 6.25 5.94 6.21 6.25 0.23 0.742

Ca 6.48 7.51 7.23 7.34 1.59 0.496

P 7.17a 6.60b 6.83ab 6.76ab 0.41 0.041

Na 331.68 317.75 322.12 323.83 18.02 0.081

K 20.21 20.11 19.42 22.23 2.17 0.457

Mg 2.76 2.95 2.76 2.94 1.1 0.299

Fe 0.22 0.26 0.25 0.27 0.18 0.36

Zn 0.12 0.13 0.11 0.12 0.82 0.324

Co 0.12 0.02 0.022 0.021 0.06 0.173

abMean values within a row with unlike superscript letters were significantly different for each dietary treatment; *Corn silage was fed ad

libitum to all the rams, basal diet was supplemented with DDGS at 1.0% BW in control group (T1), whereas WDGS was supplemented

at 1.0, 1.5 and 2.0 % BW in groups T2, T

3 and T

4, respectively.

Naveena et al.


112

Table 8. Carcass characteristics, chemical composition and mineral profile of longissiumus dorsi muscle


T1

T2

T3

T4

Pre-slaughter weight (kg) 22.43 19.33 17.90 21.23 1.79 0.30

Dressed weight (kg) 9.97 8.27 7.90 9.47 0.87 0.297

Dressing % 44.43 42.30 44.05 44.62 1.25 57.0

Neck & Shoulder 10.26 11.18 9.99 10.11 0.62 0.541

Brisket & Fore shank 31.98 26.79 31.71 28.27 1.66 0.053

Loin 13.09 12.44 13.56 13.28 0.68 0.721

Rack 10.94 14.38 11.96 14.95 1.35 0.101

Leg 33.73 35.21 32.79 33.40 0.72 0.10

Meat (kg) 6.35 5.03 4.91 6.16 0.62 0.23

Bone (kg) 3.54 2.95 2.99 3.35 0.3 0.456

M:B ratio 1.58 1.69 1.62 1.54 0.05 0.197

L. dorsi muscle composition

Dry matter (%) 27.51 28.30 25.76 28.59 1.06 0.24

Crude protein (%, DM) 23.92 25.01 24.04 25.56 0.97 0.603

Ether extract (%, DM) 1.83 2.02 2.06 2.19 0.21 0.125

Mineral profile of L. dorsi muscle (mg/100 g)

Na 69.84 71.72 72.61 69.18 95.27 0.852

K 335.77 331.25 336.31 330.99 81.83 0.997

Ca 7.51 8.30 7.81 7.03 2.73 0.761

Mg 21.78 23.96 21.93 22.83 3.36 0.264

Fe 1.42 1.54 1.43 1.41 2.34 0.412

Cu 0.32 0.45 0.52 0.53 0.56 0.227

Zn 8.64 9.48 9.59 9.69 1.26 0.23

Mn 0.24 0.22 0.23 0.22 0.31 0.483

Co 0.21 0.20 21 0.22 0.05 0.591

*Corn silage was fed ad libitum to all the rams, basal diet was supplemented with DDGS at 1.0% BW in control group (T1), whereas WDGS

was supplemented at 1.0, 1.5 and 2.0 % BW in groups T2, T

3 and T

4, respectively.

supplementation. Further, TVFA concentration and

molar proportions of propionic acid and butyric acid in

rumen liquor was comparable among treatment groups

whereas the acetic acid concentration was higher

(P<0.05) in T1 than in other treatments. Higher value

for acetate was noticed in dry DGS fed group than that

of wet DGS fed groups which might be due to lower

NDF content in dry DGS (Avila Stango et al., 2013).

The serum protein and mineral profile (Table 7)

did not differ significantly among treatments, except for

a higher (P<0.05) serum phosphorus in ram lambs fed

on T1. The higher phosphorus content of the dry dried

distillers grain with solubles (Reddy, 2017) might have

led to a higher serum phosphorus concentration in ram

lambs fed on T1 since the DMI from dry DDGS was

higher than the DMI from wet WDGS in other

treatments.

There was no significant difference among

treatments with respect to carcass characteristics (Table

8), chemical composition and mineral profile of

Longissimus dorsi muscle and were comparable with

those available in literature. Kasap et al. (2018) reported

values of 75.61% moisture, 2.13% EE and 20.91% CP

in the longissimus thoracis et lumborum muscle of lambs



113

Table 9. Cost economics of ram lamb production per animal


T1

T2

T3

T4

Animal cost (`) 3247.92 3016.67 3091.67 3200 42.68 0.193

Silage cost (`) 1025.62 999.08 990.63 1037.26 59.89 0.295

DGS cost (`) 340.37a 144.00b 190.02b 309.78a 38.93 0.000

Total feed cost (`) 1365.99a 1088.05b 1009.26b 1347.04a 152.21 0.051

Feed cost (`)/kg gain 146.25 163.08 169.27 158.21 13.22 0.159

Returns (by sale of 5481.21 4549.42 4643.17 5200.25 350.9 0.299

meat & offal `)

Net Profit/Loss (`) 772.88a 578.58b 651.50b 775.25a 138.16 0.052

(e-(a+d))

a,b Mean values within a row with unlike superscript letters were significantly different for each dietary treatment.

Cost of silage: ` 6.8/kg, Cost of dry DGS: ` 23/kg, Cost of wet DGS: ` 10/kg; *Corn silage was fed ad libitum to all the rams, basal diet was

supplemented with DDGS at 1.0% BW in control group (T1), whereas WDGS was supplemented at 1.0, 1.5 and 2.0 % BW in groups T

2, T

3

and T4, respectively.

reared in outdoor conditions. Kawecka et al. (2018)

reported values of 22.94, 2.87 and 19.57 of DM, EE

and CP, respectively with diets containing 45% dry DGS.

Radzik-Rant et al. (2018) reported 26.09 % DM and

4.62 % EE content in the muscle of lambs fed with wet

brewers grains. Higher intake of dry DGS in T1 and

wet DGS in T4 fed lambs resulted in higher (P<0.01)

cost of DGS supplementation in these treatments

leading to higher (P<0.05) total feed cost compared to

T2 and T

3 fed lambs. However, no significant

differences were found in total returns. Net profit was

higher (P<0.05) in T1 and T

4 than in T

2 and T

3 fed lambs

(Table 9).

CONCLUSIONS

It was concluded that supplementation of wet

DGS at 2.0 % of body weight resulted in ram lamb

performance comparable with dry DGS

supplementation at 1.0% of body weight.

REFERENCES

AOAC. 2005. Official Methods of Analysis.18th rev. ed.

Association of Official Analytical Chemists, Arlington,

Washington DC, USA.

Avila Stagno, J., Chaves, A.V., He, M. L. and McAllister, T.A.

2013. Increasing concentrations of wheat dry

distillers’ grains with solubles in iso-nitrogenous

finishing diets reduce lamb performance. Small Rumin.

Res. 114: 10-19.

Bal, M.A. 2006. Effects of hybrid type, stage of maturity, and

fermentation length on whole plant corn silage quality.

Turk. J. Vet. Anim. Sci. 30: 331-336.

De Almeida, F.N. 2013. Effects of the Maillard reactions on

chemical composition and amino acid digestibility of

feed ingredients and on pig growth performance.

Doctoral dissertation, University of Illinois at Urbana-

Champaign.

Duncan David, B. 1955. Multiple range and multiple F tests.

Biometrics.11: 1-42.

Gerrard, F. 1964. Meat Technology. Leonard Hill, London.

Hasanah, U., Permana, I.G. and Despa 2017. Introduction of

complete ration silage to substitute the conventional

ration at traditional dairy farms in Lembang. Pak. J.

Nutr. 16: 577-587.

ICAR, 2013. Nutrient Requirements of Sheep, Goat and

Rabbit. ICAR, New Delhi.

Iram, A., Cekmeceliogly, D. and Demirci, A. 2020. A Distilers’

dried grains with solubles (DDGS) and its potential as

fermentation feedstock. Appl. Microbiol. Biotechnol.

104: 6115-6128.

ISI, 1963. Indian Standards Specifications for Mutton and

Goat Flesh, Fresh, Chilled and Frozen. Bureau of

Indian Standards Institution, New Delhi, India.

Kasap, A., Kaiæ, A., Širiæ, I., Antunoviæ, Z. and Mioè, B.

2018. Proximate and mineral composition of M

longissimus thoracis et lumborum of suckling lambs

from three Croatian indigenous breeds reared in

outdoor conditions. Ital. J. Anim. Sci. 172: 274-278.

Kawecka, A., Sosin-Bzducha, E., Pucha³a, M. and Sikora, J.

2018. Effect of maize DDGS addition on carcass and

Naveena et al.


114

meat quality of lambs of native sheep breed. J. Appl.

Anim. Res. 46: 301-305.

Khan, N. A., Cone, J. W. and Hendriks, W. H. 2009. Stability of

fatty acids in grass and maize silages after exposure to

air during the feed out period. Anim. Feed Sci. Technol.

154: 183-192.

Lakshmi, R. K., Kumari, K., Reddy, P. (2017). Corn Germ Meal

(CGM) - Potential Feed Ingredient for Livestock and

Poultry in India - A Review. Int. J. Livest. Res. 7: 39-50.

McDonald, P., Edwards, R.A., Greenhalgh, D.F.J., Morgan,

A.C., Sinclair, L.A. and Wilkinson, R.G. 2001. Silage. In:

Animal Nutrition. (6 th ed). Pearson Education

(Singapore) Pte. Ltd. Indian Branch, New Delhi.

Muck, R.E. and Dickerson, J.T. 1988. Storage temperature

effects on proteolysis in alfalfa silage. Trans. ASAE.

31: 1005-1009.

Radzik-Rant, A., Rant, W., Niznikowski, R., Swiatek, M.,

Szymañska, Z., Slêzak, M. and Niemiec, T. 2018. The

effect of the addition of wet brewers grain to the diet of

lambs on body weight gain, slaughter value and meat

quality. Arch. Anim. Breed. 61: 245-251.

Reddy, P., Lakshmi, R., Raju, J., Kishore, K. and Kumar, C.

2017. CNCPS Fractionations and in-vitro nutrient

digestibility of corn dried distiller grains with Solubles

from various ethanol plants in Andhra Pradesh. Int. J.

Livest. Res. 7: 164-171.

Reddy, V.V. 2017. Effect of Supplementation of Distillers

Dried Grain with Solubles (DDGS) with Straw Based

Diet on Performance and Nutrient Utilization in

Native Sheep. Thesis submitted to Sri Venkateswara

Veterinary University. Tirupati. http://

krishikosh.egranth.ac.in/handle/1/5810085084

Schingoethe, D.J., Kalscheur, K.F., Hippen, A.R. and Garcia,

A.D. 2009. Invited review: The use of distillers’

products in dairy cattle diets. J. Dairy Sci. 92: 5802-

5813.

Snedecor, G.W. and Cochran, W.G. 1994. Statistical Methods.

8th ed Affiliated East West Press, New Delhi 13: 1467-

1473.

Soren, N.M. and Rao, S.B.N. 2015. Quantification of individual

volatile fatty acids by gas chromatography. In: Recent

Techniques in Feed and Fodder Evaluation for

Assessing Feed Quality and Safety, ICAR-NIANP,

Bengaluru, India, 2: 99-102.

Spanghero, M., Chiaravalli, M., Colombini, S., Fabro, C., Froldi,

F., Mason, F., Moschini, M., Sarnataro, C., Schiavon,

S. and Tagliapietra, F. 2019. Rumen inoculum collected

from cows at slaughter or from a continuous fermenter

and preserved in warm, refrigerated, chilled or

freeze-dried environments for in vitro tests. Animal. 9:

815.


Methods for dietary fibre, neutral detergent fiber and

nonstarch polysaccharides in relation to animal





115

Indian Journal of

Animal Nutrition

Effect of Feeding Solid-State Fermentation Biomass on Nutrients intake,

Digestibility and Microbial Protein Synthesis in Lactating Buffaloes

Kishan P. Patel, Shrikant B. Katole*, P.R. Pandya, Srushti Patel1 and D. Srinivas Murty1

Animal Nutrition Research Department, College of Veterinary Science and Animal Husbandry,

Anand Agricultural University, Anand-388 110, Gujarat, India

ABSTRACT

Increasing livestock population with limited availability of feed resources requires a paradigm shift in

implementing newer arena of nutritional research which would enable efficient utilization of available

low-quality feed resources. The objective of the present study was to evaluate the effect of feeding of solid

state fermentation (SSF) biomass on nutrients intake and digestibility of lactating buffaloes. Two treatments i.e.

basal diet (T1) and o basal diet supplemented with SSF at 4% of DM (T

2). Twenty lactating buffaloes (2nd -3rd

week post-calving) were selected and randomly assigned to one of the either treatment for a duration of 139

days. Towards the end of feeding trial provision was made for individual fecal collection from buffaloes to

measure nutrients digestibility. The SSF supplementation had not resulted in any significant improvement in

dry matter (DM) and crude protein (CP) intake, but intake of digestible crude protein (DCP) and total digestible

nutrients (TDN) was significantly (P<0.05) improved in SSF supplemental group. Digestibility of fibre fractions

had also shown significant (P<0.01) improvement due to SSF supplementation. Numerically increased microbial

protein synthesis was also observed in SSF supplemental group but mean value showed non-significant effect.

Supplementing SSF biomass as crude fermented product with fibrolytic enzymes has resulted in improvement

in digestibility of nutrients without affecting DMI of lactating buffaloes which signifies that SSF biomass helps

in effective utilization of feeds and potentiation of energy availability for productive performance.

Key Words: Buffalo, Digestibility, Microbial protein, Nutrient intake, SSF

*Corresponding author; Email: [email protected]; 1 Department of Microbiology, Gujarat Vidhyapeeth, Sadra, Gandhinagar, Gujarat

INTRODUCTION

Agricultural by-products and cereals crops

residues usually form the major part of ration of

lactating ruminants which are low in nutrients and less

digestible too due to presence of lignocellulose bonds,

high levels of silica and anti-nutritional factors. This not

only reduces the production potential but also affects

the profitability of farmers. In such conditions use of

feed additives appears to be an attractive solution.

Ruminants are equipped with huge array of

microorganisms which can utilize such feeds but

suitable manipulation of ruminant ecosystem can

further improve feed digestibility and economic returns.

Use of enzymes, probiotics, prebiotics and nutraceuticals

(Patel et al., 2018) are found to be effective in such

conditions.

A biotechnological tool i.e. SSF appears to be an

attractive and suitable technique for enrichment of

microbial protein, efficient digestion and utilization of

lignocellulosic agricultural fibrous feeds and fodder


doi: 10.5958/2231-6744.2020.00019.5

residues. SSF is a cultivation technique where microbes

and fungi (Doelle et al., 1992) are grown on a moist

solid substrate under controlled conditions which are

devoid of free water which eventually can produce a

variety of enzymes (Pandey et al., 1999) and can be

fed directly as crude fermentable mass to animals.

Positive effects of supplementation of fibrolytic enzymes

like cellulase, xylanase, pectinase, laccase etc. was also

documented by several authors (Beauchemin et al.,

2003; Miachieo and Thakur, 2007; Arif et al., 2019).

We had hypothesized that supplementation of SSF

biomass would improve intake and digestibility of

nutrients. Accordingly, the current study was aimed to

examine the effect of SSF biomass supplementation

digestibility and intake of nutrients of lactating

buffaloes.


An experiment of 139 days was carried out

(excluding adaptation of 30 d) on 20 lactating buffaloes


116

of private dairy farms of livestock farmers of Sojitra

village of Anand District, Anand, Gujarat (India).

Animal care and procedures were conducted under the

established standard of the Institutional Animal Ethics

Committee (IAEC). Lactating buffaloes (2nd to 3rd week

post calving) were selected on basis of their parity (2nd

to 4th parity) and milk yield and were randomly divided

into two groups of 10 buffaloes each as either control

group or SSF supplemental group. All the lactating

buffaloes were fed upon as per farmer’s schedule.

Ration of experimental buffaloes that included

commercial concentrate mixture of Amul dairy like Amul

buffalo special concentrate mixture (Dan), Amulnutri

power and Amul crushed maize (bhardo) and cotton

seed cake and maize cake along with ad libitum cereal

straw (paddy/maize/wheat) and green fodder (jowar

forage) (10 kg/d) as a basal ration in control group of

animals. Buffaloes of treatment (T2) group were

supplemented with SSF biomass at 4% of DM intake

by mixing it with concentrates at the time of milking

during evening.

SSF biomass used in the present study was

prepared on jowar hay which was used as substrate

for inoculation of microorganisms in fermentation

process. Fermentation process was carried out at

Department of Microbiology, Gujarat Vidhyapeeth,

Sadra, Gandhinagar, Gujarat (India). Jowar hay was

inoculated with various group of fungi i.e. Aspergillus

spp., Trichoderma spp., Fusarium spp., Pleurotus

spp. and Phanerochaete spp. Enzymes were produced

due to fermentation activity during SSF biomass

preparation, and activity of various enzymes i.e. carboxy

methyl cellulase (CMCase) (170 U/g), filter paperase

(FPase) (60 U/g), xylanase (468 U/g), laccase (270 U/

g), manganese peroxidase (MnP) (488 U/g) and lignin

peroxidase (LiP) (298 U/g) was also assessed using

enzymatic assay technique.

Daily intake of feeds of each buffalo was

recorded by weighing feeds offered to buffaloes and

analyzing nutrients present in feeds at regular intervals.

After 100 days of experimental feeding, a digestibility

trial of seven days collection period was conducted to

measure digestibility of nutrients. A proper record of

total amount of feed offered, refusal and faeces voided

by each buffalo was maintained during the trial period.

Representative samples of offered feeds, refusal (if any)

and 1/300th part of faeces voided were taken in tray

and kept in a hot air oven at 100±2°C for 24 h to

estimate the DM content of samples.

Oven dried samples of individual animals were

further pooled for seven days of collection and wre then

grinded to pass through 2.0 mm sieve and stored in air

tight bottles at room temperature for further analysis.

Composite samples of feeds offered, refusal feeds and

faeces were analyzed for DM, CP, OM as per AOAC

(1995). Neutral detergent fibre (NDF), acid detergent

fibre (ADF), acid detergent lignin, hemicellulose and

cellulose were analyzed as per Van Soest et al. (1991).

Urine samples (50 ml) was collected from individual

buffalo which was preserved with sufficient quantity of

1.87 mol/l H2SO

4 to maintain pH<3.0 which was

further analyzed for purine derivatives (allantoin, uric

acid and creatinine) using spectrophotometric method

(Hawk et al., 1976). Purines absorbed and microbial

protein was calculated from the daily urinary purine

derivatives excreted IAEA (1997).

Statistical Analysis

The experimental data generated were subjected

to analysis of variance using the General Linear Model

(GLM) procedure of the Statistical Software Package

(SPSS for windows, V21.0; Inc., Chicago, IL, USA)

and analyzed as per the methods of Snedecor and

Cochran (1994).


The proximate composition and fibre fractions of

feeds offered to lactating buffaloes are presented in

Table 1 along with composition of SSF biomass.

Supplementation of SSF biomass in the diet of lactating

buffaloes had not resulted in any significant increase in

daily intake of DM and CP (Table 2). Other authors had

also reported that supplementation of several enzymes

had not resulted in any effect on DM and CP intake in

cows (Herrick et al., 2012; El-Bordeny et al., 2015;

Daniel et al., 2016). Supplementation of enzymes like

cellulase and xylanase (Shekhar et al., 2010) and

Solid state fermentation biomass for lactating buffaloes


117

commercial fibrolytic enzymes (Morsy et al., 2016) did

not cause any significant change of DM and CP intake

in buffaloes.

Intake of DCP and TDN were significantly

(P<0.05) higher in SSF supplemented groups as

compared to control. Similar, to present the findings

Gaafar et al. (2010) reported that supplementation of

cellulase and xylanase as enzyme in the diet of lactating

buffaloes caused significant increase in DCP and TDN

intake. Similar response was also observed by Silva et

al. (2016) on supplementing xylanase. However,

several authors had also reported non-significant effect

of enzymes supplementation on DCP and TDN intake

(Miachieo and Thakur,2007; Bassiouni et al., 2010;

Shekhar et al., 2010). The difference in responses of

supplementation between the studies might be due to

different methods of preparation, application,

concentration, activities and nature of enzymes. An

enzymatic effect also depends on the type of feeds

and their processing. Proteins are also subjected

to proteolysis by several enzymes which might be

responsible for inconsistent results on protein intake

Ravindran (2013).

Data pertaining to digestibility of nutrients are

presented in Table 3. Digestibility of DM, OM, CP, CF,

EE and NFE was higher (P<0.05) in SSF biomass

supplemented group as compared to control group.

Similar to the findings of present investigation several

authors have also reported a significant increase in

digestibility of proximate principles in buffaloes due to

supplementation of various enzyme preparations

containing cellulase and xylanase (Gaafar et al., 2010;

Azzaz et al., 2013; Morsy et al., 2016). Similar, results

were also observed on supplementing the enzymes to

buffaloes at increasing levels in ration (Abd ElT awab

et al., 2016; Azam et al., 2017; Arif et al., 2019).

Digestibility (%) of various fibre fractions were

found to be significantly increased (P<0.05) in

treatment group as compared to control group.

Similarly, several earlier researchers had reported that

supplementation of fibrolytic enzymes improved

digestibility of fibre fractions of feed. Supplementation

of commercial fibrolytic enzymes like Asperozyme,Tab

le 1

. P

roxim

ate

com

posi

tion

an

d F

iber

fra

ctio

ns

(% o

n D

M b

asi

s) o

f off

ered

fee

d a

nd

SS

F b

iom

ass

Ing

red

ien

tsP

rox

ima

te c

om

po

siti

on

(%

on

DM

ba

sis)

Fib

er f

ract

ion

s (%

on

DM

basi

s)

CP

EE

CF

NF

EO

MA

shS

ilic

aC

aP

ND

FN

DS

AD

FH

em

i-C

ell

u-

Lig

nin

Sil

ica

cell

u-

lose

lose

SS

F9.5

52.9

131.8

942.6

386.9

813.0

03.7

70.7

30.1

863.3

039.6

537.1

926.1

029.2

17.6

50.8

8

Gre

en j

ow

ar

12.0

01.9

628.5

437.5

280.0

219.9

87.5

31.2

80.3

770.2

540.2

338.3

931.8

634.3

64.8

90.9

8

Baj

ra s

traw

10.7

41.7

327.7

648.7

588.9

711

.03

4.3

21.5

70.5

368.7

241.1

237.7

430.9

834.5

84.1

40.6

5

Wh

eat

stra

w3.1

51.9

236.2

947.4

288.7

811

.22

6.6

21.0

10.2

878.4

230.2

346.4

731.9

541.3

15.8

10.9

7

Am

ul

Conce

ntr

ate

18.5

58.3

711

.15

50.4

188.4

811

.52

3.1

31.3

71.6

935.1

378.5

216.2

818.8

512.8

33.7

90.2

2

Mix

ture

(D

an)

Am

ul

Nu

tri

Po

wer

23.0

54.3

012.8

553.2

993.4

86.5

21.4

61.0

70.9

832.7

381.5

418.0

014.7

313.9

53.7

10.6

7

Cru

shed

mai

ze8.3

02.6

51.5

785.5

298.0

52.1

10.2

30.5

60.2

614.7

387.1

53.5

711

.16

3.4

50.2

30.2

3

(bh

ard

o)

Co

tto

n s

eed

cak

e23.1

410.1

420.3

941.0

194.6

95.3

10.3

30.8

10.9

647.5

462.1

027.6

019.9

420.7

07.2

20.1

1

Mai

ze c

ake

14.4

911

.09

4.7

968.3

498.7

35.2

10.3

20.7

70.5

142.5

765.3

98.9

233.6

59.0

20.6

40.2

1

Patel et al.


118

Tomoko (TOM), Vet-zyme (VET) etc. having cellulase,

xylanse, xylose, pectinase, protease and amylase

activity with different types of feeds and their ratios

between roughage and concentrates has shown a

significant increase in digestibility’s of fibre fractions in

Table 2. Cumulative DM, CP, DCP and TDN intake (kg/day) of buffaloes

Buffalo Treatments

No. DMI CPI DCPI TDNI

T1

T2

T1

T2

T1

T2

T1

T2

1 16.76 16.76 2.52 2.52 1.44 1.56 9.66 10.40

2 14.68 16.54 2.13 2.50 1.23 1.66 7.97 10.26

3 14.59 16.77 2.11 2.51 1.12 1.54 7.07 9.63

4 15.05 16.62 2.16 2.49 1.42 1.52 7.89 9.54

5 15.19 16.63 1.93 2.49 1.32 1.50 8.72 10.07

6 14.86 15.53 2.13 2.21 1.11 1.46 8.03 9.87

7 14.82 15.04 2.12 1.92 1.20 1.23 8.16 8.83

8 16.71 15.15 2.51 1.93 1.44 1.20 9.41 8.57

9 15.24 15.12 1.93 1.93 1.16 1.25 8.14 8.74

10 16.62 16.72 2.50 2.51 1.23 1.51 8.16 9.77

Average 15.45±0.28 16.09±0.24 2.20±0.07 2.30±0.08 1.27b±0.04 1.44a ±0.05 8.32b±0.24 9.57a±0.20

SEM1 0.26 0.07 0.04 0.22

CD2 (0.05)3 NS NS 0.13 0.66

CV4 % 5.25 11.10 10.56 7.88

abMeans with different superscripts in a row for a parameter differ significantly; 1Standard Error of Mean, 2Critical Difference, 3Level of

significance, 4Co-efficient of variation

Table 3. Apparent digestibility (%) of nutrients

Nutrient T1

T2

SEM1 CD2(0.05)3 CV4 %

Dry Matter 58.18b 64.73a 0.99 2.96 5.14

Organic Matter 62.14b 67.60a 0.95 2.83 4.65

Crude Protein 57.81b 62.90a 1.39 4.13 7.28

Crude Fiber 48.31b 57.28a 1.11 3.29 6.65

Ether Extract 65.07b 72.51a 1.22 3.63 5.62

Nitrogen Free Extract 58.31b 63.30a 1.21 3.60 6.31

Neutral Detergent Fiber 48.43b 55.36a 1.20 3.58 7.35

Acid Detergent Fiber 39.09b 45.84a 1.34 3.98 9.99

Hemi-cellulose 60.06b 65.05a 1.13 3.37 5.74

Cellulose 52.27b 59.24a 1.56 4.65 8.88

Intestinal Flow of 168.71 180.10 10.79 NS 19.57

Microbial Nitrogen (g N/d)

abMeans with different superscripts in a row for a parameter differ significantly; 1Standard Error of Mean, 2Critical Difference, 3Level of

significance, 4Co-efficient of variation

buffaloes (Shekhar et al., 2010; Azzaz et al.,2013;

Rajamma et al., 2014; Morsy et al., 2016; Abd ElTawab

et al,. 2016; Azam et al., 2017; Arif et al., 2019).

Increase in digestibility of nutrients in the present study

was observed due to combined effect of several



119

enzymes like xylanase, carboxy methyl cellulase

(CMCase), and lignin degrading enzymes like laccase,

lignin peroxidase and manganese peroxidase which due

to their hydrolytic and oxidizing actions breaks the bonds

between fibre and renders them easy to digest.

Microbial protein was calculated on the basis of

spectrophotometric analysis of purine derivatives (uric

acid, allantion and creatinine) from urine samples of

individual buffaloes. Amount of urinary microbial

protein (g/d) on an average was found to be 168.71 g/d

in control group of buffaloes while for treatment group

of buffaloes it was 180.10 g/d. Statistically the amount

of microbial protein excreted from buffaloes of two

groups was found to be not differing significantly but

still there was a numerical increase in microbial protein

synthesis in SSF biomass supplemental group by 6.75%

as compared to control. Synthesis of protein by ruminal

microbes usually depends on type of feeds and its

quality and fibre degradation by ruminal microbes.

Increased overall digestibility of feeds (Table 3) might

be responsible for increased activity and growth of

microbes that ultimately increased intestinal flow of

microbial nitrogen (Table 3). In agreement with the

present study that several authors have reported that

yeast supplementation resulted a non-significant change

in microbial protein synthesis despite of numerical

improvement (Erasmus et al., 1992; Putnam et al., 1997;

Hriostav et al., 2010; Noziere et al., 2014; Robinson

and Erasmus, 2016).

CONCLUSIONS

It was observed that supplementation of SSF

biomass in the diets of lactating buffaloes had

significantly increased the intake DCP and TDN.

Further, improvement in digestibility of proximate

nutrients by 8.50% to 11.50 % and that of fibre

fractions by 8% to 14.5% is attributable to enzymatic

degradation of nutrients and fibre in feed under the

influence of enzymes and microbes present in SSF

biomass. This signifies that more energy was available

for enhancement of productive performance of

buffaloes under SSF biomass supplementation. Rumen

microbial protein synthesis was also found to be

increased numerically due to increased microbial

activity in SSF supplemental group.

REFERENCES

Abd El Tawab, A.M., Khattab, M.S.A., El-Zaiat, H.M.,

Matloup, O.H. and Hassan, A.A. 2016. Effect of

cellulase and tannase enzymes supplemention on the

productive performance of lactating buffaloes fed

diets contain date palm fronds. Asian J. Anim. Sci. 10:

307-312.

AOAC. 1995. Official Methods of Analysis, 16th Edition. Assoc.

Off. Anal. Chem., Washington, D.C.

Arif, M., Al-Sagheer, A.A., Salem, A.Z.M., El-Hack, M.A.,

Swelum, A.A., Saeed, M. and Akhtar, M. 2019.

Influence of exogenous fibrolytic enzymes on milk

production efficiency and nutrient utilization in early

lactating buffaloes fed diets with two proportions of

oat silage to concentrate ratios. Livest. Sci. 219: 29-34.

Azam, B., Tahir, M.N., Shahzad, F., Ghaffar, A., Abbas, G. and

Gohar, M. 2017. Exogenous Fibrolytic Enzymes

Addition in Concentrate Ration of Lactating Nili

Ravi Buffaloes: Effects on Milk Production and Diet

Digestibility. Pak J. Zool. 49: 1359-1359.

Azzaz, H.H., Murad, H.A., Kholif, A.M., Morsy, T.A., Mansour,

A.M. and El-Sayed, H.M. 2013. Increasing nutrients

bioavailability by using fibrolytic enzymes in dairy

buffaloes feeding. Online J. Biol. Sci. 13: 234.

Bassiouni, M.I., Gaafar, H.M.A., Mohi, A.M.A., Metwally,

A.M. and Elshora, M.A.H. 2010. Evaluation of rations

supplemented with fibrolytic enzyme on dairy cow’s

performance 3. Productive performance of lactating

Friesian cows. Livest. Res. Rural. Dev. 22: 117.

Beauchemin, K.A., Colombatto, D., Morgavi, D.P. and Yang,

W.Z. 2003. Use of exogenous fibrolytic enzymes to

improve feed utilization by ruminants. J. Anim. Sci. 81:

E37-E47.

Daniel, J.L.P., Queiroz, O.C.M., Arriola, K.G., Staples, C.R.,

Romero, J.J., Shin, J.H., Paschoaloto, J.R., Nussio, L.G.

and Adesogan, A.T. 2016. Effects of maturity at ensiling

of bermuda grass and fibrolytic enzyme application on

the performance of early-lactation dairy cows. J. Dairy

Sci. 99: 9716-9723.

Doelle, H.W., Mitchell, D.A. and Rolz, C.E. 1992. Solid

Substrate Cultivation, Elsevier, London.

El-Bordeny, N.E., Abedo, A.A., El-sayed, H.M., Daoud, E.N.,

Soliman, H.S. and Mahmoud, A.E.M. 2015. Effect

of Exogenous Fibrolytic Enzyme Application on

Productive Response of Dairy Cows at Different

Lactation Stages. Asian J. Anim. Vet. Adv. 10: 226-236.

Patel et al.


120

Erasmus, L. J., Botha, P. M. and Kistner, A. 1992. Effect of

yeast culture supplement on production, rumen

fermentation, and duodenal nitrogen flow in dairy

cows. J. Dairy Sci. 75: 3056-3065.

Gaafar, H.M.A., Abdel-Raouf, E.M.and El-Reidy, K.F.A. 2010.

Effect of fibrolytic enzyme supplementation and fiber

content of total mixed ration on productive performance

of lactating buffaloes. Slovak J. Anim. Sci. 43:

147- 153.

Hawk, P.B., Oser, B.L. and Summerson, W.H. 1976. Practical

Physiological Chemistry (14th ed.) London, England:

McGraw Hill Publishing Company Limited.

Herrick, K.J., Hippen, A.R., Kalscheur, K.F., Anderson, J.L.,

Ranathunga, S.D., Patton, R.S. and Abdullah, M. 2012.

Lactation performance and digestibility of forages and

diets in dairy cows fed a hemicellulose extract. J. Dairy

Sci. 95: 3342-3353.

Hristov, A.N., Varga, G., Cassidy,T., Long,M., Heyler,

K., Karnati, S.K.R. and Yoon, I. 2010. Effect of

Saccharomyces cerevisiae fermentation product on

ruminal fermentation and nutrient utilization in dairy

cows. J. Dairy Sci. 93:682-692.

IAEA. 1997. Estimation of rumen microbial protein

production from purine derivatives in urine. IAEA-

TECDOC-945. IAEA, Vienna, pp. 22-24.

Miachieo, K. and Thakur, S.S. 2007. Effect of exogenous

fibrolytic enzymes on the productive performance of

lactating Sahiwal cows. Indian J. Anim. Sci. 24: 27-30.

Morsy, T. A., Kholif, A.E., Kholif, S.M., Kholif, A.M., Sun, X.

and Salem, A.Z. 2016. Effects of two enzyme feed

additives on digestion and milk production in

lactating Egyptian buffaloes. Ann. Anim. Sci. 16: 209-

222.

Noziere, P., Steinberg, W., Silberberg, M. and Morgavi, D.P.

2014. Amylase addition increases starch ruminal

digestionin first-lactation cows fed high and low starch

diets. J. Dairy Sci. 97: 2319-2328.

Pandey, A., Selvakumar, P., Soccol, C.R. and Nigam, P. 1999.

Solid state fermentation for the production of

industrial enzymes. Curr. Sci. 77: 149-162.

Patel, K., Sunidhi, and Katole, S. 2018. Nutraceuticals and

Ruminants Nutrition – A Review. Int. J. Livest. Res. 6:

76-85.

Putnam, D.E., Schwab, C.G., Socha, M.T., Whitehouse, N.L.,

Kierstead, N.A. and Garthwaite, B.D. 1997. Effect of

yeast culture in the diets of early lactation dairy cows

on ruminal fermentation and passage of nitrogen

fractions and amino acids to the small intestine. J. Dairy

Sci. 80: 374-384.

Rajamma, K., Kumar, D.S., Rao, E.R. and Nath, D.N. 2014.

Nutrient utilisation in buffalo bulls fed total mixed

rations supplemented with exogenous fibrolytic

enzymes. Indian J. Anim. Sci. 31: 213-217.

Ravindran, V. 2013. Feed enzymes: The science, practice, and

metabolic realities. J. App. Poult. Res. 22: 628-636.

Robinson, P.H. and Erasmus, L.J. 2016. Effects of two yeast

based direct fed microbials on performance of high

producing dairy cows. Anim. Feed Sci. Technol. 215:

58-72.

Shekhar, C., Thakur, S.S. and Shelke, S.K. 2010. Effect of

exogenous fibrolytic enzymes supplementation on milk

production and nutrient utilization in Murrah

buffaloes. Trop. Anim. Health Prod. 42: 1465-1470.

Silva, T.H., Takiya, C.S., Vendramini, T.H.A., de Jesus, E.F.,

Zanferari, F. and Rennó, F.P. 2016. Effects of dietary

fibrolytic enzymes on chewing time, ruminal

fermentation, and performance of mid-lactating dairy

cows. Anim. Feed Sci. Technol. 221: 35-43.


8th ed., Oxford and IBH Publishing Co. Pvt. Ltd., New

Delhi, India.


Methods of dietary fiber, neutral detergent fiber and

non-starch polysaccharides in relation to animal





121

Indian Journal of

Animal Nutrition

Effect of Feeding Calf Starter Diets Containing Shrimp Waste Meal

on Nutrient Utilization in Murrah Buffalo CalvesK.V.N. Aruna, D. Srinivas Kumar*, E. Raghava Rao, S. Jagadeeswara Rao

Department of Animal Nutrition, Sri Venkateswara Veterinary University,

NTR College of Veterinary Science, Gannavaram-521 102 Krishna Dist. (A.P.), India

ABSTRACT

A 120-day growth trial was conducted using 20 Murrah buffalo calves (Avg. BW 71.0 ± 1.6 kg) by

randomly allotting them to four groups of 5 animals each to study the effect of replacing the protein content of

soybean meal with shrimp waste meal at 0, 10, 20 and 30 % levels on nutrient utilization. Chemical composition

(% DMB) indicated that shrimp waste meal was rich source of crude protein. Amino acid composition revealed

that shrimp waste meal used in the present study is a rich source of serine. Fatty acid composition indicated

that shrimp waste meal is rich in saturated fatty acids and also possesses considerable quantities of mono- and

poly-unsaturated fatty acids which accounts for 34.86 % of total fatty acids. The digestibility of DM, OM, CP,

EE, CF, NFE, NDF, ADF, hemi-cellulose and cellulose increased (P<0.01) in Murrah buffalo calves irrespective

of the level of inclusion of shrimp waste meal in the diet. However, higher (P<0.01) digestibilities were observed

at 10 % replacement level (T2) as compared to the other groups. The DM, DCP and TDN intakes of buffalo

calves of all the groups were higher than the recommendations of ICAR (1998) indicating the adequacy and

palatability of calf starter diets. The % DCP and TDN content were significantly higher (P<0.01) in T2 as

compared to other treatments. It is concluded that replacement of the protein content of soybean meal with

shrimp waste meal at 10 % level in calf starter diets resulted in improved digestibility of gross nutrients in

buffalo calves.

Key words: Buffalo calves, Calf starter, Nutrient utilization, Shrimp waste meal

*Corresponding author; Email: [email protected]; Phone: 08676-253782 Ext. 226 (Off); Mobile: +91-9951384777

INTRODUCTION

Livestock production in developing countries needs

greater attention because of its role in food production,

livelihood support and environmental change. In India

dairy sector is growing at the rate of 4 % annually to

meet the needs of human population (Singh, 2011).

The growth in world’s population and other factors have

made our natural resources into scarce, limited

commodities. It has become the responsibility of

those who manage natural resources to maximize

productivity while minimizing the demand on restricted

resources. For this reason, search for other products

that can substitute conventional feed ingredients has

become the need of the hour.

By-products and recycling of nutrients have

become common in areas associated with production in

animal agriculture. In India, many of the organized farms

use about 7 % animal protein like fish meal in the calf

ration but due to high cost and variable quality of fish

meals, alternatives need to be explored (Saijpaul et al.,


doi: 10.5958/2231-6744.2020.00020.1

2008). One such by-products which could be more

efficiently utilized in coastal areas is the waste

generated from shrimp processing. The shrimp

processing industry has been rapidly growing with the

significant increase in cultured shrimp production in the

South-East Asian region. A huge amount of bio-waste

consisting of head shells and abdominal shells is

produced from the industry because shrimps are

normally sold as headless or peeled or both. One such

waste by-products of shrimp industry is shrimp waste

meal (SWM). It is a dried product consisting of heads,

shells and appendages, a potential protein source that

can replace conventional protein. Annual production of

shrimp in India is about 2,92,810 tons during 2013 (Aqua

culture Asia Pacific, 2014). There is a significant

amount of waste generated by shrimp industry because

of the large percentage of the shrimp heads,

exoskeleton and soluble components lost during various

processing operations. Shrimp heads comprise of

approximately 44 % of the whole raw shrimp (Meyers


122

and Rutledge, 1971). Shrimp processing waste

generated in India is around 1.25 to 1.5 lakh tons per

annum, channeling the waste as a protein alternative.

Shrimp wastes constitute 48-56% of the weight of shrimp.

The major components of the waste (DM basis) are

protein (35-40%), chitin (10-15%), minerals (10-15%)

and carotenoids (Ramya Devi et al., 2012). These

wastes, which are high in crude protein and extremely

perishable, can be efficiently utilized by ruminant

animals. Keeping in view the availability of this valuable

animal protein source, the present study was undertaken

to evaluate the optimum level of inclusion of shrimp

waste meal in starter diets of buffalo calves.


Shrimp shell waste was suspended (1:15 w/v) in

1 N NaOH solution at 100o C for 2 h. This treatment

was repeated several times. This removed the chitin

present in shrimp shell waste. These extracts were

combined and the pH was adjusted to 4.0 using

concentrated HCl to precipitate the protein. The

precipitated protein was recovered by centrifugation at

2000 rpm for 15 min followed by removal of the

supernatant by decantation. Protein cured was

readjusted to pH 7 using 1 N NaOH (to neutralize

sample) and then washed with distilled water several

times. The precipitate was collected by centrifugation

at 2000 rpm for 15 minutes and dried in a hot air oven

at 40o C until dried; 3 g of precipitate was collected

from 100 ml of the extract. The dried sample was ground

and used for laboratory evaluation. In case of bulk

preparation of the material, the sediment was collected

by allowing the extracts to settle in sedimentation

tanks for 2 days. Precipitated protein was sun dried and

used in experimental rations.

A calf starter with 23% CP was prepared by

using conventional feed ingredients and was used as

control (T1). In this, the protein supplied through

soybean meal was replaced at 10 (T2), 20 (T

3) and

30 (T4) percent level by incorporating SWM. The

ingredient composition of calf starters is furnished in

Table 1. All the calf starters were made iso-nitrogenous.

In an experiment based on completely

randomized design (CRD), 20 Murrah buffalo calves

(BW 71.0 ± 1.60 kg; 3 m of age) were randomly

divided into 4 equal groups with 5 caves in each group.

The animals were housed in well ventilated conventional

sheds. During the trial period, the buffalo calves were

offered chopped green fodder (Super Napier) ad

libitum and respective calf starter (T1 to T

4) diets to

meet the growth requirements (ICAR, 1998). The calves

were fed on respective experimental diets for 120 days.

During the middle of the trial period (after 90 d), a

digestion trial was conducted by following 7 days

collection period. Clean, fresh drinking water was made

available throughout the trial period. During the

digestion trial, the amount of feed offered and faces

voided were recorded. Daily representative samples of

feed and faeces were collected and pooled animal wise.

Shrimp waste meal in starter ration of buffalo calves

Table 1. Ingredient composition of calf starter

Ingredient Dietary treatments

T1

T2

T3

T4

Maize 35.0 35.0 35.0 35.0

DORB 23.0 23.5 24.0 24.7

Soybean meal 32.5 29.3 26.0 22.7

Sunflower cake 5.00 5.00 5.00 5.00

Shrimp waste meal 0.00 2.70 5.50 8.10

Molasses 2.00 2.00 2.00 2.00

Mineral mixture 2.00 2.00 2.00 2.00

Salt 0.50 0.50 0.50 0.50

Total 100 100 100 100


123

The feed and faecal samples were analyzed for

proximate constituents (AOAC, 2007) and fibre

fractions (Van Soest et al., 1991). Estimation of Ca and

P in feed was also done (Talapatra et al., 1940). Amino

acid composition of shrimp waste meal was quantified

using reverse phase HPLC while fatty acid

composition was determined by Gas chromatography

(AOAC 996.01).The data were analyzed statistically

(Snedecor and Cochran, 1994) and tested for

significance by Duncan’s multiple range test (Duncan,

1955) using SPSS 17.0 version.


The per cent DM, OM, CP, EE, CF, NFE, TA and

AIA of SWM were 94.25, 81.05, 55.00, 6.41, 2.50, 17.14,

18.95 and 3.20, respectively. The per cent calcium and

phosphorous content of SWM were 5.65 and 1.28,

respectively. The CP content (55.0%) of SWM in the

present study was in close agreement with the findings

of Rosenfeld et al. (1997) and Gernat (2001) who

reported the CP value of shrimp waste meal as 50.89

and 52.70 per cent, respectively. However, Cobos et al.

(2007), Mahata et al. (2008) and Ingweye et al. (2008)

reported lower CP content of 35.6, 24.03 and 48.3 %,

respectively as compared to the CP content reported in

the present study.

Amino acid composition of SWM is shown in

Table 2. The amino acid composition revealed that SWM

contains 12 amino acids, of which 7 are essential and 5

are non-essential amino acids. The present study

indicated that SWM is a good source of serine. Similar

findings were also reported by Lakshmi and Saravanan

(2012). The lysine, threonine and methionine contents

of SWM observed in the present study were lower

compared to the values reported earlier (Khempaka et

al., 2006; Fanimo et al., 2004).

Fatty acid composition of shrimp waste meal is

presented in Table 3. Fatty acid composition of SWM

revealed more concentration of saturated fatty acids

than unsaturated fatty acids. The SWM used in the

present study was rich in saturated fatty acids and also

possessed considerable quantities of mono and

polyunsaturated fatty acids which accounted for 34.86

% of total fatty acids, which is similar to the findings

observed by Kandra et al. (2012). Major fatty acids

observed in the present study were palmitic acid,

palmitoleic acid, margaric acid, stearic acid, oleic acid

and linoleic acid which were similar to the results

obtained by Sachindra et al. (2005) in various species

of shrimp available in India. In contrast, Bragagnolo and

Rodriguez-Amaya (2001) reported that the fatty acid

composition of penaeid shrimp from Brazilian water was

found to be rich in unsaturated fatty acids, indicating

that fatty acid composition varies with species of shrimp.

Individual fatty acid composition (g/100g sample) of

SWM indicated that the content of palmitic acid,

palmitoleic acid, margaric acid, stearic acid, oleic acid

and linoleic acid were 2.11, 0.16, 0.14, 1.01, 1.12 and

0.5 g, respectively while that of other fatty acids were

at less than 0.1g/100g sample.

The chemical composition of calf starters

containing SWM at varying levels is presented in

Table 2. Amino acid composition of shrimp waste

meal

Amino acid mg/100g of sample

Serine 332.36

Aspartic acid 192.37

Glutamic acid 55.01

Proline 43.76

Taurine 56.68

Threonine 35.9

Histidine 18.83

Phenyl alanine 32.9

Lysine 8.75

Valine 5.35

Methionine 14.08

Isoleucine 2.0

Table 3. Fatty acid composition of shrimp waste

meal

Fatty acid g/100 g sample

Saturated fatty acids 3.6

Monounsaturated fatty acids 1.32

Polyunsaturated fatty acids 0.66

Total trans-fatty acids 0.1

Aruna et al.


124

Table 4. All the calf starters were iso-nitrogenous.

Data pertaining to the effect of dietary inclusion

of SWM at varying levels in calf starter diets on

digestibility of proximate constituents and fibre fractions

are presented in Table 5. The digestibility of DM, OM,

CP, EE, CF, NFE NDF, ADF, hemi-cellulose and

cellulose increased significantly (P<0.01) in calves fed

diets containing SWM at 10 % level as compared to

those fed SWM at 0, 20 and 30 % levels (Table 5).

Further, the study indicated that digestibility of gross

nutrients and fibre fractions decreased significantly

(P<0.01) in calves when SWM was included at 20 and

30 % levels as compared to 10 % level. In contrast to

the findings of the present study, Cobos et al. (2002)

observed no effect (P>0.05) on digestibility of DM, CP

and ADF in lambs by feeding shrimp shell waste at 15

% level as compared to the control, while DM, CP and

EE digestibility decreased significantly (P<0.05) when

fed shrimp shell waste at 25 % level in the diet. On the

other hand, Cobos et al. (2002) reported that NDF

digestibility decreased significantly (P<0.05)

irrespective of the level of inclusion of shrimp shell waste

as compared to the control. Similarly, Fanimo et al.

(2006) observed decreased (P<0.05) digestibility of

DM, CP and CF in growing pigs fed diets replacing fish

meal with shrimp meal. Further, Ngoan et al. (2000)

also reported that nutrient digestibility of diets based on

shrimp by-product silages were lower than for similar

diets based on fish meal which might be attributed to

the high level of chitin in shrimp meal (Ngoan et al.,

2000).

A major concern with shrimp meal is the

chemical nature of the exoskeleton of the shrimp, which

is mainly composed of chitin and is considered to have

low digestibility (Austin et al., 1981). Due to this

low digestibility, chitin physically blocks the access of

digestive enzymes to lipids and proteins, thus affecting

the utilization of these nutrients (Karasov, 1990). In the

present study, SWM was obtained after extraction of

chitin. This might had resulted in increased digestibility

of gross nutrients in calves fed diets containing shrimp

waste meal as compared to those in control group.

Data pertaining to plane of nutrition of buffalo

calves (Table 5) revealed that the DMI (g/kg W0.75)

was not significantly different (P>0.05) among

different treatments. The average DMI of buffalo calves

fed diets containing SWM was higher than the values

recommended by ICAR (1998). This indicated that

Table 4. Chemical composition of calf starters containing varying levels of SWM

Nutrient CM-1 CM-2 CM-3 CM-4

Dry matter 91.84 91.69 91.95 92.20

Organic matter 89.02 88.82 88.03 87.68

Total ash 10.98 11.18 11.97 12.32

Crude protein 23.01 23.10 23.05 23.21

Ether extract 0.98 1.23 1.49 1.58

Crude fibre 10.75 10.15 9.75 9.68

Nitrogen free extract 54.28 54.34 53.74 53.21

Neutral detergent fibre 32.87 32.22 31.45 30.35

Acid detergent fibre 15.10 14.33 13.98 13.55

Hemi-cellulose 17.77 17.89 17.47 16.80

Cellulose 7.62 7.53 7.41 7.32

Acid detergent lignin 6.92 6.07 6.04 6.04

Silica 2.31 2.20 1.75 1.73

Calcium (%) 0.32 0.42 0.55 0.70

Phosphorus (%) 0.22 0.38 0.45 0.50



125

inclusion of SWM in calf starter diets had not affected

the palatability. The content of DCP (%) was

significantly higher (P<0.01) in T2 as compared to other

treatments. This may be attributed to higher CP

digestibility in T2 as compared to other treatments (Table

5). Similarly, the % DCP was significantly higher

(P<0.01) in T2 as compared to other treatments. The

numerically higher nutrient digestibility recorded

in buffalo calves fed calf starter diets containing

SWM at 10 % level as compared to those in other groups

(Table 5) might have resulted in higher TDN content

in that group.

CONCLUSION

Thus, it is concluded that shrimp waste meal

obtained from shrimp shell processing industry can

replace 10 % protein supplied through soybean meal in

calf starter diets of Murrah buffalo calves without any

adverse effect.

REFERENCES

AOAC, 2007. Official Methods of Analysis, 18th ed.

Association of official Analytical chemists,

Washington DC, USA.

AOAC, 2000a. Official methods of analysis. (996.01) Fat

(total, saturated, unsaturated, and monounsaturated)

in cereal products, 17th ed. Association of official

Analytical chemists, Washington DC, USA.

Aquaculture Asia Pacific, 2014 10(2) https://

www.shrimpnews.com

Austin, P.R., Brine, C.J., Castle, J.E. and Zikakis, J.P. 1981.

Chitin. New Facets Res. Sci. 212: 749-753.

Bragagnolo, L. and Rodriguez-Amaya, D.B. 2001. Total lipid

cholesterol and fatty acids of farmed fresh water prawn

(Macrobrachium rosenbergii) and wild marine shrimp

(Penaeus brasiliensis, Penaeus schimitti,

Table 5. Effect of inclusion of Shrimp waste meal in the calf starter on intake and digestibility of

nutrients in buffalo calves

Particulars Dietary treatments† SEM

T1

T2

T3

T4

Dry matter** 71.83a 76.39c 73.56b 72.25ab 0.44

Organic matter** 55.40a 63.16d 59.29c 57.45b 0.66

Crude protein** 62.64a 70.90c 66.08b 64.4b 0.73

Ether extract** 67.93a 72.92c 70.80b 68.79a 0.45

Crude fibre** 62.72a 71.30d 66.13c 64.62b 0.74

Nitrogen free extract** 65.60a 70.38c 67.25b 66.27a 0.43

Neutral detergent fibre** 64.49a 70.55d 68.12c 66.49b 0.52

Acid detergent fibre** 59.67a 64.49c 63.30b 60.20a 0.47

Hemi cellulose** 55.77a 61.36d 59.30c 57.59b 0.48

Cellulose** 46.70a 50.77c 48.43b 47.72b 0.35

Nutrient Intake (g/kg BW0.75)

Dry matter 89.53 81.91 86.41 89.83 2.39

Digestible crude protein 8.28 8.39 8.26 8.37 0.39

Total digestible nutrients 54.88 54.75 54.30 54.83 1.88

Plane of Nutrition

Digestible crude protein (%) 9.05a 10.25b 9.55a 9.32a 0.17

Total digestible nutrients* (%) 61.30a 67.24b 63.60a 62.40a 0.93

Digestible energy* (M Cal) 7.18a 8.02b 7.19a 7.23a 0.11

Metabolizable energy* (M Cal) 5.89b 6.58b 5.89a 5.93a 0.09

a,b,c,dValues in the rows bearing different superscripts differ significantly (*P<0.05) (**P<0.01); †Calves of the control (T1) group were fed a

standard calf starter, the protein supplied through soybean meal of T1 was replaced at 10 (T

2), 20 (T

3) and 30 (T

4) percent level by

incorporating SWM.

Aruna et al.


126

Xiphopenaeus kroyeri). J. Food Compos. Anal. 14:

359-369.

Cobos, M.A., Garcia, L.E., Gonzalez, S.S., Barcena, J.R.,

Hernandez, D.S. and Perez-Sato, M. 2002. The effect

of shrimp shell waste on ruminal bacteria and

performance of lambs. Anim. Feed Sci. Technol. 95:

179-187.

Cobos, M.A., Perez-Sato, M., Piloni-Martini, J., Gonzalez, S.S.

and Barcena, J.R. 2007. Evaluation of diets containing

shrimp shell waste and an inoculum of Streptococcus

milleri on rumen bacteria and performance of lambs.

Anim. Feed Sci. Technol. 132: 324-330.

Duncan, D.B. 1955. Multiple range and multiple F-tests.

Biometrics. 11: 1-42.

Fanimo, A.O., Oduguwa, B.O., Oduguwa, O.O., Ajasa, O.Y.

and Jegede, O. 2004. Feeding value of shrimp meal for

growing pigs. Arch. de Zoot. 53: 77-85.

Fanimo, A.O., Susenbeth, A. and Sudekum, K.H. 2006. Protein

utilization, lysine bioavailability and nutrient

digestibility of shrimp meal in growing pigs. Anim. Feed

Sci. Technol. 129: 196-209.

Gernat, A.G. 2001. The Effect of Using Different Levels of

Shrimp Meal in Laying Hen Diets. Poult. Sci. 80:

633-636.

ICAR, 1998. Nutrient Requirements of Livestock and

Poultry. New Delhi.

Ingweye, J.N., Okon, B.I., Ubua, J.A. and Essein, A.I. 2008.

Performance of broiler chickens fed fish and shrimp

wastes. Asian J. Anim. Sci. 2: 58-63.

Kandra, P., Challa, M.M. and Jyothi, H.K.P. 2012 Efficient use

of shrimp waste: present and future trends. Appl.

Microbiol Biotechnol. 93: 17-29.

Karasov, W.H. 1990. Digestion in Birds: Chemical and

physiological Determinants and Ecological Implica-

tions. Stud. Avian Biol. 13: 391-415.

Khempaka, S., Koh, K. and Karasawa, Y. 2006. Effect of

shrimp meal on growth performance and digestibility

in growing broilers. J. Poult. Sci. 43: 250-254.

Lakshmi, E.R. and Saravanan, J.K. 2012. Isolation and

analysis of proteins in shrimp waste. Indian J.

Innovation Dev. 1: 112-114.

Mahata, M.E., Dharma, A., Ryanto, H.I. and Rizal, Y. 2008.

Effect of Substituting shrimp waste hydrolysate of

Penaeus merguensis for fish meal in broiler

performance. Pak. J. Nutr. 7: 806-810.

Meyers, S.P. and Rutledge, J.E. 1971. Shrimp meal-A new look

at an old product. Feedstuffs. 43: 31-32.

Ngoan, L.D., An, L.V., Ogle, B. and Lindberg, J.E. 2000. Ensiling

techniques for shrimp byproducts and their nutritive

value for pigs. Asian-Australas. J. Anim. Sci. 13:

1278-1284.

Ramyadevi, D., Subathira, A. and Saravanan, S. 2012.

Potential Recovery of Protein from Shrimp Waste in

Aqueous two-phase system. Res. J. Chem. Sci. 2:

47-52.

Rosenfeld, D.J., Gernat, A.G., Marcano, J.D., Murillo, J.G.,

Lopez, G.H. and Flores, J.A. 1997. The effect of using

different levels of Shrimp Meal in broiler diets. Poult.

Sci. 76: 581-587.

Sachindra, N.M., Bhaskar, N. and Mahendrakar, N.S. 2005.

Carotenoids in different body components of Indian

shrimps. J. Sci. Food Agric. 85: 167-172.

Saijpaul, S., Sikka, S.S., Malhotra, P. and Singh, N. 2008. Growth

performance and feed efficiency of calves fed calf

starter containing leather meal. Indian J. Anim. Nutr.

25: 330-335.

Singh, R. 2011. India Dairy and Products Annual Report

2010. USDA Foreign Agricultural Service: Global

Agricultural Information Network. Retrieved June 2011,

from static.globaltrade.net/files/pdf/2011022623125

5627.pdf.

Snedecor, G.W. and Cochran, W.G. 1993. Statistical Methods

(9th edition) Iowa state university press, IOWA, USA.

SPSS. 2008. Statistical Packages for Social Sciences,

Version 17.0, SPSS Inc., Illinois, USA.

Talapatra, S.K., Roy, S.C. and Sen, K.C. 1940. Estimation of

phosphorus, chlorine, calcium, magnesium, sodium and

potassium in food stuffs. Indian J. Vet. Sci. Anim. Husb.

10: 243-258.


Methods for dietary fiber, neutral detergent fibre and


nutrition. J Dairy Sci. 74: 3583-3597.




127

Indian Journal of

Animal Nutrition

Effect of Solid-state Fermentation Biomass Supplementation to Mixed

Substrate on Digestibility and Methane Mitigation in vitro

Kishan P. Patel, Shrikant B. Katole*, P.R. Pandya, K.K. Sorathia and Srushti Patel1

Animal Nutrition Research Department, College of Veterinary Science and Animal Husbandry,

Anand Agricultural University, Anand-388 110, Gujarat, India

ABSTRACT

An experiment was conducted to assess the effect of supplementation of various levels of solid-state

fermentation (SSF) biomass on in vitro digestibility, total gas production and methane production. Eight

different types of substrates were prepared viz. SSF0 (control), and the basal substrates supplemented with

SSF biomass at 1%, 2%, 3%, 4%, 5%, 6% and 7% replacing mixed cereal straw was designated as SSF1, SSF2,

SSF3, SSF4, SSF5, SSF6 and SSF7, respectively. In vitro dry matter digestibility (IVDMD) and in vitro organic

matter digestibility (IVOMD) were 10.62 and 11.70% higher (P<0.01) in SSF4 treatment than that of SSF0

treatment. In vitro total gas production was increased numerically due to SSF biomass supplementation as

compared to control with maximum increment at 5% level, but statistically the change was not significant.

Methane production after 24 h of incubation was lowest (P<0.01) in SSF4 treatment, it reduced by 38.4% as

compared to control. Results revealed an improved digestibility, gas production and reduced methane

production at 4% level of SSF supplementation, and was found to be most suitable level for further in vivo

studies in dairy animal.

Key words: SSF, in vitro, Digestibility, Methane, Gas production

*Corresponding author; Email: [email protected]; 1 Department of Microbiology, Gujarat Vidhyapeeth, Sadra, Gandhinagar, Gujarat.

INTRODUCTION

Animal husbandry plays an important role in

rural economy of India as almost about 73% of rural

population of India possesses some form of livestock.

Moreover, the importance of livestock in India’s economy

can be gauged from the fact that 90 million farming

families rear over 90 million milch animals. According

to livestock census 2012, there is an increment of 4.51%

livestock population in India as compared to previous

one while for the state of Gujarat increment in livestock

population was even more up to 15.36%. As population

grows it leads to increased demand for feeds and

fodder leading to widening of the gap between demand

and supply. The deficit in the requirement and

availability of dry fodder, green fodder and concentrates

during 2015 was to the extent of 21 MT, 26 MT and

34 MT which will increase further to 23 MT, 40 MT

and 38 MT, respectively, by the year 2025 (NIANP,

2016). This scenario demands a paradigm shift for

implementing newer arena of nutritional research on the

way of developing proper feeding strategies to utilize

available feed resources for its optimum utilization.


doi: 10.5958/2231-6744.2020.00021.3

Ruminant animals have complex ecosystem of various

microorganisms which eventually utilize low quality

agricultural by-products (rich in cellulose, hemicellulose

and lignin) and convert them into quality food resources.

Utilization of such agricultural by-products can be

improved by appropriate use of feed additives like

prebiotics, probiotic, enzymes etc. and also through

appropriate application of biotechnological tools. Solid

state fermentation (SSF) technique is the one of the most

suitable and economical technique for enrichment of

microbial protein, efficient digestion and utilization of

lignocellulosic agricultural fibrous feeds and fodder

residues for enhancing their feed values. SSF is a

cultivation technique where microbes and fungi (Doelle

et al., 1992) are grown on a moist solid substrate under

controlled conditions which are devoid of actual free

water which eventually can produce a variety of

enzymes (Pandey et al., 1999) and can be fed directly

as crude fermentable mass to animals. Beneficial

effects of supplementing such fibrolytic enzymes

produced by microorganisms on overall productive

performance of lactating ruminants was also reported


128

by several authors (Miachieo and Thakur, 2007; Gallardo

et al., 2010; Lopuszanska-Rusek and Bilik, 2011; Ahmad

Para et al., 2019; Arif et al., 2019). It was

hypothesized that SSF would improve the fermentation

kinetics and digestibility of nutrients. Hence, this study

was planned to assess the effect of supplementation of

various levels of SSF biomass on in vitro digestibility,

total gas production and methane production.


The present study was conducted at Animal

Nutrition Research Department, College of Veterinary

Science and Animal Husbandry, Anand Agricultural

University, Anand, Gujarat. Ingredients for experi-

mental substrates were procured from farmers where

further in vivo trial will be carried out. Mixed cereal

straw (paddy straw, bajra straw and wheat straw),

green fodder (jowar CoFS-29) and Amul buffalo

special concentrate mixture (Dan), Amulnutri power and

Amul crushed maize (bhardo) and cotton seed cake

and maize cake were procured, which were then oven

dried at 70°C and finely grounded in Wiley mill using 1

mm sieve. Substrates were prepared for in vitro by

mixing the ingredients in ration as per the feeding

schedule followed by farmers i.e. by mixing green

fodder, mixed cereal straw, and concentrate at 4:5:4 (kg

on dry matter basis). The ingredients and substrates

were analyzed for proximate constituents (AOAC, 1995)

and fibre fractions (Van Soest et al., 1991).

SSF biomass was procured from Department of

Microbiology, Gujarat Vidhyapeeth, Sadra, Gandhinagar,

Gujarat, India. SSF biomass was prepared using

inoculations of various fungi species i.e. Aspergillus

spp., Trichoderma spp., Fusarium spp., Pleurotus

spp. and Phanerochaete spp. on jowar hay which was

used as solid substrate for SSF biomass preparation.

Activity of various microbial enzymes viz. carboxy

methyl cellulase (CMCase), filter paperase (FPase),

xylanase, laccase, manganese peroxidase (MnP) and

lignin peroxidase (LiP) were at the tune of 170, 60, 468,

270, 488, 298 Units/g of wet weight of SSF biomass,

respectively. The experimental substrate without any

supplementation of SSF biomass was designated as SSF0

(control), while mixed cereal straw of the SSF0 was

replaced with 1, 2, 3, 4, 5, 6 and 7% of SSF in groups

SSF1, SSF2, SSF3, SSF4, SSF5, SSF6 and SSF7,

respectively.

Rumen liquor for in vitro studies was collected

from two lactating buffaloes using stomach tube.

Buffaloes were fed individually with TMR prepared to

meet their nutrients requirements (ICAR, 2013) with

free access of water. Collected rumen liquor was

strained through four-layers of muslin cloth which was

termed as strained rumen liquor (SRL) and was mixed

in prepared artificial saliva (McDougall’s) in proper

proportions prior to incubation. Substrates (200 mg) with

various levels of SSF biomass was incubated with

artificial saliva mixed with SRL (40 ml) for 48 h in

quadruplet at 39±1°C in a shaker twin water bath (Menke

et al., 1979). After 48 h of incubation, total gas

production (TGP) was recorded after subtracting gas

production from blank. To determine in vitro methane

production, gas produced in 100 ml glass syringes after

24 h of incubation period was used. A gas sample was

directly injected into Gas Chromatograph (GC) from

each syringe and CH4 concentration was determined

against standard methane gas (10.4 ppmv and 101.9

ppmv). All samples were analysed using GC instrument,

fitted with a SS column (4 ft. long, 3.2 mm inside

diameter) packed with Porapack N (80 to 100 mesh),

equipped with a flame ionization detector (FID).

Column temperature was maintained at 50°C, and

nitrogen was used as a carrier gas, with flow rate of 30

ml/min. Calibration was completed using standards (10.4

ppmv and 101.9 ppmv) procured from Scott-Marrin Inc.,

USA. Peak areas were integrated using a Perkin Elmer

integrator. After completion of incubation, the content

of each syringe was filtered and dried in a pre-weighed

Gooch crucible. The IVDM was calculated by

subtracting residues remained after incubation from the

amount of substrate incubated and was expressed in

percentage.

Statistical analysis

Data obtained were subjected one way analysis

of variance as per the methods of Snedecor and Cochran

In vitro evaluation of solid state fermentation biomass


129

(1994).Treatment means were separated by using

Duncan’s multiple range tests. All analysis was

performed using a statistical package (SPSS 9.00

software).


The data on proximate composition and fibre

fractions of prepared substrate are presented in Table

1. The data on IVDMD and IVOMD are presented in

Table 2, while values of TGP and methane (ml)

produced per 100 g of digestible DM are presented in

Table 2. Perusals of the data revealed a significant

(P<0.05) improvement in digestibility of DM and OM in

4% SSF group as compared to control. In the present

study higher fermentation rates was observed due to

addition of SSF which might have improved digestibility.

Furthermore, addition of enzymes stimulated the

population of cellulolytic bacteria, increased fibre

digestion and flow of microbial protein from the rumen

(Azzaz et al., 2013). This improvement in digestibility

could be also due to synergetic effects of enzyme and

rumen microbes (Morgavi et al., 2000), better

attachment of rumen microbes and feed particles (Yang

et al., 1999). Similarly, significant improvement in

IVDMD (Faramarzi-Garmroodi et al., 2013; Rajamma

et al.,2015; Lopez et al., 2016; Vallejo et al., 2016;

Lunagariya et al., 2017) and IVOMD (Elghandour et

al. 2013; Dey et al., 2014; Lunagariya et al., 2017).

was also reported by earlier authors.

Total amount of gas produced under the

anaerobic microbial fermentation during in vitro

incubation study of 48 h was observed and presented

in Table 2. The values for the gas production were

found to be numerically increased due to SSF

supplementation but did not differ significantly.

Numerical increase in gas production with increasing

levels of SSF biomass in this study indicates better

nutrients availability for rumen microbes which further

increases their fermentation activity resulting in better

feed digestion Morgavi et al. (2000); Azzaz et al.

(2013).Methane contributes for major greenhouse gas

emissions thus its mitigation measures are also required

for better environment. Effect of SSF biomass

supplementation on levels of methane production was

estimated with gas chromatography. There is a

significant (P<0.05) decrease in methane production

(38.4%) in SSF4 group as compared to control.

Table 1. Proximate composition of substrate, jowar hay and SSF

Parameters (%) Substrate Jowar Hay SSF

Crude protein 11.27 6.74 9.55

Ether extract 3.93 2.78 2.91

Crude fibre 28.84 38.40 31.89

Nitrogen free extract 45.92 42.24 42.63

Organic matter 89.96 90.16 86.98

Ash 10.04 9.81 13.00

Silica 4.10 3.25 3.77

Ca 1.11 0.66 0.73

P 0.89 0.18 0.18

Neutral detergent fibre 64.17 72.94 63.30

Neutral detergent solubles 44.35 34.22 39.65

Acid detergent fibre 34.84 40.04 37.19

Hemi-cellulose 29.33 32.89 26.10

Cellulose 22.07 35.43 29.21

Lignin 12.29 5.03 7.65

Patel et al.


130

CONCLUSION

It was observed that SSF biomass at 4% levels

has shown most significant improvement in IVDMD

and IVOMD, and significant reduction in methane

emission in vitro. Therefore, SSF biomass at 4% level

of supplementation was found to be most suitable for

further in vivo studies in dairy animals.

REFERENCES

Ahmad Para, I., Singh, M., Punetha, M., Hussain Dar, A.,

Ahmad Naik, M., Salam Teli, A. and Gupta, D. 2019.

Milk production and feed efficiencies as affected

by dietary yeast (Saccharomyces cerevisiae)

supplementation during the transition period in Murrah

buffaloes. Biol. Rhythm Res. 50: 1-8.

AOAC. 1995. Official Methods of Analysis, 16th Edition. Assoc.

Off. Anal. Chem., Washington, D.C.

Arif, M., Al-Sagheer, A.A., Salem, A.Z.M., El-Hack, M.A.,

Swelum, A.A., Saeed, M. and Akhtar, M. 2019.

Influence of exogenous fibrolytic enzymes on milk

production efficiency and nutrient utilization in early

lactating buffaloes fed diets with two proportions of

oat silage to concentrate ratios. Livest. Sci. 219: 29-34.

Azzaz, H.H., Murad, H.A., Kholif, A.M., Morsy, T.A., Mansour,

A.M. and El-Sayed, H.M. 2013. Increasing nutrients

bioavailability by using fibrolytic enzymes in dairy

buffaloes feeding. J. Biol. Sci. 13: 234-241.

Dey, A., Paul, S.S., Pandey, P. and Rathore, R. 2014. Influence

of addition of fibrolytic bacterial culture on in vitro

degradability of wheat straw, methanogenesis and

fermentation metabolites in buffalo. Indian J. Anim.

Nutr. 31: 223-226.

Doelle, H.W., Mitchell, D.A. and Rolz, C.E. 1992. Solid

Substrate Cultivation, Elsevier, London.

Elghandour, M.M.Y., Salem, A.Z.M., Gonzalez-Ronquillo, M.,

Bórquez, J.L., Gado, H.M., Odongo, N.E. and Penuelas,

C.G. 2013. Effects of exogenous enzymes on in vitro

gas production kinetics and ruminal fermentation of

four fibrous feeds. Anim. Feed Sci. Technol. 179:

46-53.

Faramarzi-Garmroodi, A., Mesgaran, M.D., Parand, E. and

Vakili, A.R. 2013. In vitro Effect of Increasing Levels of

Natuzyme® on Fermentation Responses of Corn

Silage Based Diet. Ann. Res. Review Biol. 3: 1066-1073.

Gallardo, I., Bárcena, R., Pinos-Rodríguez, J.M., Cobos, M.,

Carreón, L. and Ortega, M.E. 2010. Influence of

exogenous fibrolytic enzymes on in vitro and in sacco

degradation of forages for ruminants. Ital. J. Anim.

Sci., 9: e8.

ICAR. 2013. Nutrients Requirements of Cattle and Buffalo.

Indian Council of Agricultural Research, New Delhi,

India.

Lopez, D., Vazquez-Armijo, J.F., Lopez-Villalobos, N.,

Lee-Rangel, H.A., Salem, A.Z.M., Borquez-Gastelum,

J.L. and Rojo-Rubio, R. 2016. In vitro gas production

Table 2. Average in vitro dry matter digestibility (IVDMD, %) and organic matter digestibility (IVOMD,

%), total gas production (TGP, ml) and methane (ml/ 100 g digestible DM) of substrates con-

taining different levels of SSF biomass

Substrates IVDMD IVOMD TGP Methane

SSF0 60.64c±0.54 60.47c±0.66 68.00±1.77 1.38 ab±0.08

SSF1 61.48c±1.81 60.89 c±1.82 66.25±4.98 0.91 c±0.20

SSF2 61.77 c±0.15c 61.20c±0.16 71.50±1.75 0.97 bc±0.16

SSF3 62.65 c±1.18 62.37c±1.27 73.75±3.14 1.08±0.14bc

SSF4 67.07a±1.62 67.55a±1.63 71.50±2.72 0.85 bc±0.07c

SSF5 65.92ab±0.90 65.78ab±1.07 78.00±2.04 1.63 a±0.005

SSF6 62.98bc±1.05 63.13bc±0.77 77.50±1.93 1.36 ab±0.16

SSF7 63.00bc±0.47 62.70bc±0.62 72.75±4.67 1.62 a±0.191SEM 1.10 1.33 3.12 0.142, 3 CD (0.05) 3.22 3.30 NS 0.344CV % 3.50 3.59 8.64 20.34

abcMeans with different superscripts in a column for a parameter differ significantly; 1SEM, standard error of mean; 2CD, critical difference;3level of significance, 4CV, co-efficient of variation; SSF0 was made by blending jowar hay mixed cereal straw, and concentrate at 4:5:4; while

mixed cereal straw of the SSF0 was replaced with 1, 2, 3, 4, 5, 6 and 7% of SSF in groups SSF1, SSF2, SSF3, SSF4, SSF5, SSF6 and SSF7,

respectively.

In vitro evaluation of solid state fermentation biomass


131

of foliage from three browse tree species treated with

different dose levels of exogenous fibrolytic

enzymes. J. Anim. Physiol. Anim. Nutr. 100: 920-928.

£opuszañska-Rusek, M. and Bilik, K. 2011. Influence of

pre-and postpartum supplementation of fibrolytic

enzymes and yeast culture, or both, on performance

and metabolic status of dairy cows. Ann. Anim. Sci, 11:

531-545.

Lunagariya, P.M., Gupta, R.S. and Parnerkar, S. 2017. In vitro

evaluation of total mixed ration supplemented with

exogenous fibrolytic enzymes for crossbred cows. Vet.

World. 10: 281-285.

Menke, K.H., Raab, L., Salewski, A., Steingass, H., Fritz,

D. and Schneider, W. 1979. The estimation of the

digestibility and metabolizable energy content of

ruminant feeding stuffs from the gas production when

they are incubated with rumen liquor in vitro. J. Agric.

Sci. 93: 217-222.

Miachieo, K. and Thakur, S. S. 2007. Effect of exogenous

fibrolytic enzymes on the productive performance of

lactating Sahiwal cows. Indian J. Anim. Nutr. 24:

27-30.

Morgavi, D.P., Beauchemin, K.A., Nsereko, V.L. and Rode,

L.M. 2000. Synergy between ruminal fibrolytic enzymes

and enzymes from Trichoderma longibrachiatum in

degrading fibre substrates. J. Dairy Sci. 83: 1310-1321.

NIANP. 2016. Steps taken to Bridge the Gap Between the

Demand and Availability of FodderThrough Sub-

Mission on Fodder and Feed Development (Standing

Committee on Agriculture, Lok Sabha, 34th Report).

New Delhi, India.

Pandey, A., Selvakumar, P., Soccol, C.R. and Nigam, P. 1999.

Solid state fermentation for the production of

industrial enzymes. Curr. Sci. 77: 149-162.

Rajamma, K., Kumar, D.S., Rao, E.R. and Nath, D.N. 2015. In

vitro evaluation of total mixed rations containing

different roughage-concentrate ratios supplemented

with or without fibrolytic enzymes. Anim. Sci. 9: 63-69.


8th ed., Oxford and IBH Publishing Co. Pvt. Ltd., New

Delhi, India.

Vallejo, L.H., Salem, A.Z.M., Kholif, A.E., Elghangour, M.M.Y.,

Fajardo, R.C., Rivero, N. and Mariezcurrena, M.D. 2016.

Influence of cellulase or xylanase on the in vitro

rumen gas production and fermentation of corn

stover. Indian J. Anim. Sci. 86: 70-74.

Van Soest, P. J., Robertson, J. B. and Lewis, B. A. 1991.

Methods of dietary fiber, neutral detergent fiber and



Yang, W.Z., Beauchemin, K.A. and Rode, L.M. 1999. Effects

of an enzyme feed additive on extent of digestion and

milk production of lactating dairy cows. J. Dairy Sci.

82: 391-403.

Patel et al.



132

Indian Journal of

Animal Nutrition

Effect of Supplementing Conjugated Linoleic Acid Producing

Bifidobacterial Strains on In vitro Rumen Fermentation Attributes

Neeru Jaglan, Sachin Kumar, Prasanta Kumar Choudhury, Bhawna Tyagi, P.S. Banakar,

Nitin Tyagi and Amrish Kumar Tyagi*

Animal Nutrition Division, ICAR-National Dairy Research Institute, Karnal-132 001, Haryana, India

ABSTRACT

The present study was undertaken to evaluate the effects of supplementation of four conjugated

linoleic acid (CLA) producing strains of Bifidobacteria isolated from rumen fluid samples of Murrah buffalo

(Bubalus bubalis) on ruminal fermentation attributes based on a basal diet having roughage: concentrate in a

ratio of 70:30. Results of the study showed that dosing Bifidobacterium strains (109 cells/ml) separately into in

vitro incubation tubes neither affect the total gas nor methane (CH4) production after 24 h of incubation.

Digestibility parameters showed no significant (P>0.05) changes with respect to in vitro dry matter digestibility

(IVDMD), in vitro organic matter digestibility (IVOMD), or total ammonia-N content of fermentation fluid.

However, volatile fatty acid (VFA) concentration was observed to be significantly increased (P<0.05) in the

treatment samples with bacterial strains NB-191 and NB-184. While analyzing CLA content of incubation

medium, a significant increase in the value was observed as compared to control tubes. Therefore, it can be

concluded that the addition of potential CLA producing Bifidobacterial isolates to mixed rumen culture

increased the CLA and VFA content without affecting digestibility and fermentation parameters.

Key words: Bifidobacteria; Conjugated linoleic acid; IVDMD; Murrah buffaloes; Rumen fermentation

*Corresponding author; Email: [email protected]

INTRODUCTION

In present time, manipulation of rumen microbial

ecosystem by supplementation of probiotics and

prebiotics to enhance feedstuff utilization and improve

production efficiency is a key area of research pursued

by both ruminant nutritionists and microbiologists

(Sharma et al., 2011; Chaturvedi et al., 2014). Most

researches using direct-fed microbials (DFM) have

generally indicated positive responses (Newbold et al.,

1990). The bacterial strains most commonly used as

DFM are Lactobacillus, Lactococcus, Enterococcus

and Bifidobacterium, which are categorized as lactic

acid bacteria (LAB) and are normal gut inhabitants in

most of the animals. LAB is reported to improve the

dry matter (DM) digestibility and decreased ruminal CH4

production (Cao et al., 2011). Among LAB,

Bifidobacteria have been confirmed to have specific

health benefits that can be mediated through

enhancement of vitamin synthesis and mineral

bioavailability (Jena et al., 2017; Teraguchi et al., 1984),

improvement of immune function (Schiffrin et al., 1997),

reduction of gastrointestinal disturbances (Hotta et al.,


doi: 10.5958/2231-6744.2020.00022.5

1987; Ballongue et al., 1993). Further, Bifidobacterium

may accelerate production of CLA having functional

properties like anti-carcinogenic, anti-obesity, antioxidant

and anti-inflammatory effects (Kim et al., 2016).

Ruminant products are reported to have highest

concentration of CLAs (Alfaia et al., 2017). Despite

having such beneficial effects, Bifidobacteria have not

been investigated as a feed additive in Murrah buffalos.

To the best of our knowledge, there are no published

reports documenting a response to in vivo and/or in

vitro supplementation of anaerobic Bifidobacterial

cultures on nutrient digestion by Murrah buffaloes.

Therefore, the study was undertaken to examine the

effects of Bifidobacteria supplementation on in vitro

rumen fermentation attributes in Murrah buffalo model.


In vitro trials were carried out as per the

procedure described by Menke and Steingass (1988) in

triplicates. Rumen fluid was obtained 2 h after morning

feeding from two fistulated buffalo bulls maintained

on a standard diet (70 parts roughage: 30 parts

concentrate) in a pre-warmed container. Ruminal feed


133

particles were allowed to settle to the bottom (5 min),

and finally the fluid content was strained through two

layers of nylon cloth (50 mm pore size). Particle-free

ruminal fluid was mixed with the buffer solution (Menke

and Steingass, 1988) in a proportion 1: 2 (v/v) at 39°C

anaerobically under a constant stream of O2 free CO

2.

To evaluate the effect of supplementing different

strains of Bifidobacteria, a substrtae was prepared

(Table 1) by mixing roughage and concentrate in the

ratio of 70: 30 to simulate a commonly fed total mixed

ration (TMR). The roughage portion consisted of fresh

berseem and the concentrate mixture consisted of

maize-33%, groundnut cake-18%, mustard cake

(expeller)-20%, cotton seed cake-5%, wheat bran-20%,

de-oiled rice bran-6%, bajra-5%, mineral mixture-2%

and common salt-1%. Proximate principles (AOAC,

2005) and fibre fractions (Van Soest et al., 1991) were

determined for individual ingredients and the substrate.

Four bacterial isolates namely NB-19, NB-81,

NB-179 and NB-184, isolated from Murrah buffalos

were used in the study. One millilitre of each bacterial

isolate (109cells/ml) was added in each glass syringe

except control (100 ml) (Fortuna Optima, Germany)

containing 200±5 mg of substrate with 30 ml of

buffered rumen liquor. Three blank syringes containing

only 30 ml of buffered rumen fluid were included to

correct gas production values for the gas released from

endogenous substrates. Syringes were closed using

clamps and petroleum jelly was applied on the plungers

of syringes to avoid friction and any leakage. Syringes

were incubated for 24 h at 39±0.5°C. The corrected

gas values (net gas) were used for calculation of

partitioning factor (PF) and microbial biomass

production (MBP). After 24 h incubation, fermentation

was arrested by chilling the syringes to 4°C, and the

quantities of fermentation products were determined in

each syringe. The in vitro gas production technique was

employed to estimate the parameters such as total

gas production, CH4 production, ammonia nitrogen

(NH3-N) concentration and individual VFA’s (Menke

et al., 1979; Menke and Steingass, 1988). Three trials

were run for each treatment and each treatment was

performed in triplicates. CH4 content in fermentation

gas was determined by gas chromatography (GC)

using Nucon-5765 gas chromatograph equipped with a

flame ionization detector (FID) and a stainless steel

column packed with Porapak-Q (length 6’;o.d.1/8" i.d.

2 mm; mesh range 80-100). After collection of gas

sample the contents of each syringe were centrifuged

at 3000 rpm for 15 min to get a clear supernatant and

pellets. To estimate ammonia nitrogen (NH3-N) an

aliquot of supernatant was acidified with equal volume

of 0.5 M HCl and the acidified supernatant (5 ml) was

mixed with 10 ml of NaOH (1 N) and immediately steam

distilled using KEL PLUS - N analyser (Pelican, India).

Boric acid (20% w/v) solution was used for ammonia

collection and titrated against N/100 sulphuric acid.

Another aliquot of supernatant (4 ml) was added to 25%

m-phosphoric acid (2 ml), kept overnight at 4°C and

centrifuged at 2000 rpm for 15 min and supernatant was

stored at -20°C VFA analysis (Erwin et al., 1961). The

pellets obtained after centrifugation were refluxed with

neutral detergent solution for an hour (Van Soest et al.,

1991) where loss in weight was considered as true dry

Table 1. Chemical composition of ingredients and substrates used in this study

Nutrients Berseem Concentrate Mixed substrate

Dry matter 14.34±0.70 88.12±0.22 51.23±0.60

Organic matter 90.22±0.41 90.24±0.48 90.21±0.21

Crude protein 16.78±0.66 18.21±0.95 17.49±0.34

Ether extract 1.01±0.36 3.47±0.22 2.07±0.12

Total 9.04±0.74 7.21±0.64 7.95±0.35

Neutral detergent fibre 54.69±1.21 23.96±0.87 45.25±0.52

Acid detergent fibre 28.78±1.35 10.64±0.45 23.22±0.10

Jaglan et al.


134

matter digestibility. Residue was further subjected to

ashing at 550°C for estimation of in vitro organic

matter digestibility (IVOMD). The PF and MBP were

calculated based on truly degraded organic matter

(TDOM) as described by Blummel et al. (1999) and

Blummel et al. (2005), respectively.

PF= mg TDOM/total gas production

TDOM was calculated by multiplying TOMD (%)

by mg OM content of substrate.

Microbial biomass production (MBP) was

calculated from TDOM using equation:

MBP (mg) = TDOM (mg) – (Net gas volume×2.20)

Where 2.20 is the stoichiometric factor

CLA content of the rumen fluid was estimated

by UV-spectrophotometric method. In brief, after

incubation, fermentation fluid (1 ml) was centrifuged at

18,000 rpm for 1 min, the pellet was discarded and the

supernatant was mixed with 2 ml of isopropanol by

vortexing and allowed to stand for 3 min. The fatty

acids were extracted following the addition of 1.5 ml

of hexane. The presence of CLA in the culture

supernatant was assayed spectrophotometrically by

dispensing 230 µl of the fat-soluble hexane layer into

a UV-transparent 96-well plate for determining

the absorbance at 233 nm using a 96 well plate

spectrophotometer.

The data were subjected to one-way analysis of

variance procedure of SPSS (2010), using the linear

model. The post-hoc comparison of means was done

for the significant difference by Tukey’s test.

Significant differences of treatments were considered

at P<0.05.


Results indicated that supplementation of

bacterial isolates had no effect on gas production as

compared to control (Table 2). The in vitro gas

production technique has been used widely to study feed

degradation (Rymer et al., 2005); it can provide

valuable information on the kinetics of feed digestion

in rumen and reflect the utilisation efficiency of

fermentation substrates (Metzler-Zebeli et al., 2012).

Previous studies also reported that LAB survive in

rumen, affects rumen microflora, and changed the in

vitro ruminal fermentation (Weinberg et al., 2004; Gollop

et al., 2005). Our results indicated that supplementation

of Bifidobacteria did not affect the total gas

production. This agrees with Jena et al. (2017) who

reported that Bifidobacteria did not produce gas on

Table 2. Effect of the Bifidobacterial isolates on rumen fermentation and CLA production

Parameter Bifidobacterium Strain

Control NB-191 NB-81 NB-179 NB-184

Net gas (ml) 32.23 a±0.179 33.02ab±0.423 33.08ab±0.318 33.97 b±0.241 33.03ab±0.453

CH4 (%) 33.01±0.353 33.71±0.147 33.58±0.543 34.39±0.659 34.43±0.723

CH4 (ml) 8.07±0.11 8.12±0.13 8.10±0.16 9.10±0.31 9.14±0.41

NH3-N (mg/100 ml) 13.08±0.68 13.67±0.87 14.08±0.38 13.63±0.29 14.99±0.26

IVDMD (%) 60.48±0.63 62.26±1.04 62.03±0.25 61.25±0.46 61.59±0.19

IVOMD (%) 61.86±0.92 63.34±0.87 63.45±0.41 61.70±0.45 62.80±0.16

Acetate (mmol/L) 41.11 a±0.46 49.45b±0.83 45.28ab±1.82 43.24 a±0.89 49.94 b±1.19

Propionate (mmol/L) 14.47±1.53 18.20±0.23 17.20±0.71 17.07±1.39 15.60±0.96

Butyrate (mmol/L) 8.4±0.95 11.37±0.12 9.70±1.01 9.40±0.62 10.93±0.18

PF 3.59±.06 3.59±.09 3.59±.04 3.39±.02 3.55±.03

MBP (mg/200mg DM) 43.35±1.97 44.15±2.76 44.42±1.01 38.94±.79 43.12±.46

CLA (µg/mL) 15.23±0.11a 18.09±0.62b 17.74±0.34b 18.84±1.00b 18.52±0.41b

IVDMD, in vitro dry matter digestibility; IVOMD, in vitro organic matter digestibility; P,- partitioning; MBP, microbial biomass produc-

tion; CLA, conjugated linoleic acid; a,b means bearing superscript differs significantly in a row (P<0.05).

Bifidobacteria increases CLA content in vitro


135

substrate fermentation

Approximately 6-15% of feed energy is lost in

the formation of methane (Johnson and Johnson, 1995).

Santoso et al. (2003) reported that CH4 production could

be affected by the nature of the carbohydrates being

fermented; cellulose and hemicellulose are important

fibre fractions that influence CH4 production. However,

we found that CH4 production was not affected with

the addition of Bifidobacterial strains which may be

because of differences between fermentation substrates

(single fermented cell wall substrates compared to total

mixed substrates).

The data revealed that incorporation of CLA

producing bacteria had no significant effect on IVDMD

and IVOMD (Table 2). IVDMD reflects the degree

of degradation of substrates by microorganisms in

fermentation systems. LAB do not possess the

enzymatic ability to hydrolyse cell-wall constituents

(Rooke and Hatfield, 2003), and the activity of

cellulolytic bacteria may not have been affected with

the addition of Bifidobacteria. Although Reich and Kung

(2010) reported that a combination of Lactobacillus

buchneri 40788 with Lactobacillus plantarum or

Pediococcus acidilactici tended to increase in

vitro neutral detergent fibre degradation (IVNDFD) in

treated compared to untreated silage. However, no

such results with supplementation of Bifidobacteria

have been reported till now. So, further study is

needed to investigate the effect of Bifidobacteria

supplementation on in vitro rumen fermentation.

NH3-N production was similar in all the isolates

and varied in a range of 13.67±0.87 to 14.99±0.26 mg/

100 ml indicating no adverse effect of bacterial isolates

on this fermentation parameter (Table 2). Optimum

ammonia levels vary from 50 mg/l (Satter and Slyter,

1974) to 190 mg/L. Deficiency of NH3-N restricts

microbial protein synthesis, while high concentrations

of NH3-N also inhibit microbial utilization of this

compound (Hristov et al., 2002). The acquisition and

assimilation strategies followed by members of

Bifidobacteria to retrieve nitrogen from the gut lumen

are still largely unknown (Ferrario et al., 2015). When

similar experiment was conducted with L. acidophilus

a significant increase in ammonia-N was reported (Chen

et al., 2017) which might be due difference in substrate

availability or /and different nitrogen assimilation

pathways between microbes. So, further research is

required to investigate the effect of Bifidobacteria on

protein metabolism in rumen.

PF and efficiency of MBP synthesis varied from

3.39 to 3.59, and 38.94 to 44.15 respectively; having no

significant difference from control diet (Table 2).

Normal physiological range for PF varies from 2.75 to

4.41 (Blummel et al., 1997) and PF values of the present

study lies within this normal range. Results of this

experiment were in agreement with the findings of Sarkar

et al. (2017) who reported 3.63 and 40.23 for PF and

MBP, respectively on similar type of substrate.

Data on individual VFA is presented in table 2. Acetate

concentration was higher in NB-191 and NB-184, and

lower in control and NB-179, however, its level was

similar between NB-81, NB-171 and control group.

Proportions of propionate and butyrate did not differ

significantly between the control and treatment groups.

Kumar et al. (2013) reported that supplementation of

Saccharomyces cerevisiae or lactobacilli alone or in

combination of both cultures had no effect on total VFA

concentration. The values of VFAs in the present study

were lower than those reported by Kaur et al. (2017)

from similar type of substrate. In another in vitro study

performed by Zicarelli et al. (2011) having same

roughage to concentrate ratio a higher level of VFA

production was reported. The difference could be due

to different green fodder used and also due to the

variation in the ingredient composition of the of the

substrate (Table 1).

A significant increase was observed on CLA

production by supplementation of Bifidobacteria

isolates (Table 2). Hussain et al. (2016), reported strain

specific CLA producing ability of Butyrivibrio spp.

Similarly Jaglan et al. (2019) investigated the conjugated

linoleic acid production potential of bifidobacterial

isolates from ruminal fluid samples of Murrah buffaloes

and found that B. thermophilum and B. pseudolongum

produced cis9, trans11 CLA isomer. Results of this study

further testifies the CLA producing capability of

Jaglan et al.


136

Bifidobacterial isolates, which is reflected in the

results obtained. In covenant with the present findings

various workers have also reported increase in CLA

production with supplementation of different bacterial

isolates (Puniya et al., 2008; Shivani et al., 2016). The

conversion rate of linoleic acid to CLA is very high

at reasonably high concentration of linoleic acid, so

relatively high CLA concentration could be maintained

if this strain is stable at ruminal condition.

CONCLUSIONS

The results conclusively revealed that addition of

potential CLA producing Bifidobacterial isolates to

mixed rumen culture increased the VFA and CLA

content without affecting digestibility and fermentation

attributes. Such a development is particularly significant

because this study demonstrates that the introduction

of a microorganism with CLA producing potential into

the rumen may improve functional worth of ruminant

products. However, in vivo trials are necessary before

advocating these findings to feed industry.

REFERENCES

Alfaia, C.M., Alves, S.P., Pestana, J.M., Madeira, M.S., Moreira,

O., Santos-Silva, J. and Prates, J.A.2017. Distinct fatty

acid composition of some edible by-products from

bovines fed high or low silage diets. Food Sci. Technol.

Int. 23: 209-221.

AOAC, 2005. Official Methods of Analysis. 18th edn.


Washington, DC.

Ballongue, J., Grill, J.P. and Baratte-Euloge.1993. Effects of

Bifidobacterium fermented milks on human intestinal

flora. Lait. 73: 249-256.

Blummel, M., Givens, DI. and Moss, AR.2005. Comparison of

methane produced by straw fed sheep in open-circuit

respiration with methane predicted by fermentation

characteristics measured by an in vitro gas procedure.

Anim. Feed Sci. Technol. 123: 379-390.

Blummel, M., Makkar, H.P.S. and Becker, K.1997. In vitro gas

production: a technique revisited. J. Anim. Physiol.

Anim. Nutr. 77: 24-34.

Blummel, M., Mgomezulu, R., Chen, X.B., Makkar, H.P.S.,

Becker, K. and Orskov, E.R.1999. The modification of

an in vitro gas production test to detect roughage

related differences in in vivo microbial protein

synthesis as estimated by the excretion of purine

derivatives. J. Agric. Sci. 133: 335-340.

Cao, Y., Cai, Y., Takahashi, T., Yoshida, N., Tohno, M., Uegaki,

R. and Terada, F.2011. Effect of lactic acid bacteria

inoculant and beet pulp addition on fermentation

characteristics and in vitro ruminal digestion of

vegetable residue silage. J. Dairy. Sci. 94: 3902-3912.

Chaturvedi, I., Dutta, T.K., Singh, P.K., Sharma, A. and Kumar,

M. 2014. Effect of herbal feed additives on IVDMD,

methane and total gas production via in-vitro study. J.

Agroecol. Nat. Resour. Manag. 1: 108-112.

Chen, L., Ren, A., Zhou, C. and Tan, Z. 2017. Effects of

Lactobacillus acidophilus supplementation for

improving in vitro rumen fermentation characteristics

of cereal straws. Ital. J. Anim. Sci. 16: 52-60.

Erwin, E.S., Macro, G.A. and Emery, E.M. 1961. Volatile fatty

acid analysis of blood and rumen fluid by gas

chromatograph. J. Dairy. Sci. 44: 1768-1771.

Ferrario, C., Duranti, S., Milani, C., Mancabelli, L., Lugli, G.A.,

Turroni, F., Mangifesta, M., Viappiani, A., Ossiprandi,

M.C., van Sinderen, D. and Ventura, M. 2015.

Exploring amino acid auxotrophy in Bifidobacterium

bifidum PRL2010. Front. Microbiol. 6: 1331.

Gollop, N., Zakin, V. and Weinberg, Z.G. 2005a. Antibacterial

activity of lactic acid bacteria included in inoculants

for silage and in silages treated with these inoculants. J.

Appl. Microbiol. 98: 662-666.

Hotta, M., Sato, Y., Iwata, S., Yamashita, N., Sunakawa, K.,

Oikawa, T., Tanaka, R., Watanabe, K., Takayama, H.,

Yajima, M., Sekiguchi, S., Arai, S., Sakurai, T. and Mutai,

M. 1987. Clinical effects of Bifidobacterium

preparations on paediatric intractable diarrhea. Keio. J.

Med. 36: 298-314.

Hristov, A.N. and McAllister, T.A. 2002. Effect of inoculants

on whole-crop barley silage fermentation and dry

matter disappearance in situ. J. Anim. Sci. 80: 510-516.

Hussain, S.A., Srivastava, A., Tyagi, A., Shandilya, U.K.,

Kumar, A., Kumar, S., Panwar, S. and Tyagi, A.K., 2016.

Characterization of CLA-producing Butyrivibrio spp.

reveals strain-specific variations. 3 Biotech. 6: 90.

Jaglan, N., Kumar, S., Choudhury, P.K., Tyagi, B. and Tyagi,

A.K., 2019. Isolation, characterization and conjugated

linoleic acid production potential of bifidobacterial

isolates from ruminal fluid samples of Murrah

buffaloes. Anaerobe. 56: 40-45.

Jena, R., Choudhury, P. K., Puniya, A.K. and Tomar, S.K. 2017.

Isolation and species delineation of genus

Bifidobacterium using PCR-RFLP of partial hsp60 gene

fragment. Lwt-Food. Sci. Technol. 80: 286-293.

Johnson, K.A. and Johnson, D.E. 1995. Methane emissions

from cattle. J. Anim. Sci. 73: 2483-2492.

Bifidobacteria increases CLA content in vitro


137

Kaur, J., & Thakur, S. S. (2017). In vitro methane production

potential, nutrient digestibility and fermentation

pattern of total mixed rations containing incremental

levels of novel feedstuff Phalaris minor seeds in

buffalo inoculum. Int. J. Curr. Microbiol. Appl. Sci. 6:

96-103.

Kim, J. H., Kim, Y., Kim, Y.J. and Park, Y. 2016. Conjugated

linoleic acid: potential health benefits as a functional

food ingredient. Ann. Rev. Food. Sci. Technol. 7: 221-

244.

Kumar, S., Dagar, S.S., Sirohi, S.K., Upadhyay, R.C. and Puniya,

A.K. 2013. Microbial profiles in vitro gas production

and dry matter digestibility based on various ratios of

roughage to concentrate. Ann. Microbiol. 63: 541-545.

Menke, K.H. and Steingass, H. 1988. Estimation of the

energetic feed value obtained from chemical analysis

and gas production using rumen fluid. Anim. Res. Dev.

28: 7-55.

Menke, K.H., Raab, L., Salewski, A., Steingass, H., Fritz, D.

and Schneider, W. 1979. The estimation of the

digestibility and metabolizable energy content of

ruminant feeding stuffs from the gas production when

they are incubated with rumen liquor in vitro. J. Agric.

Sci. 93: 217-222.

Metzler Zebeli, B.U., Scherr, C., Sallaku, E., Drochner, W. and

Zebeli, Q. 2012. Evaluation of associative effects of

total mixed ration for dairy cattle using in vitro gas

production and different rumen inocula. J.

Sci. Food Agric. 92: 2479-2485.

Newbold, C.J., Williams, P.E.V., McKain, N., Walker, A. and

Wallace, R.J. 1990. The effects of yeast culture on yeast

numbers and fermentation in the rumen of sheep. Proc.

Nutr. Soc. 49: 47.

Puniya, A. K., Chaitanya, S., Tyagi, A. K., De, S. and Singh, K.

2008. Conjugated linoleic acid producing potential of

lactobacilli isolated from the rumen of cattle. J. Ind.

Microbiol. Biotechnol. 35: 1223-1228.

Reich, L J and Kung Jr. L. 2010. Effects of combining

Lactobacillus buchneri 40788 with various lactic acid

bacteria on the fermentation and aerobic stability of

corn silage. Anim. Feed Sci. Technol. 159: 105-109.

Rooke, J.A. and Hatfield, R.D. 2003. Biochemistry of Ensiling.

Silage Science and Technology. p. 95-139. (Eds) Buxton

D R, Muck R E and Harrison J H. American Society of

Agronomy, Madison.

Rymer, C., Huntington, J.A., Williams, B.A. and Givens, D.I.

2005. In vitro cumulative gas production techniques:

History, methodological considerations and

challenges. Anim. Feed Sci. Technol. 123: 9-30.

Santoso, B., Kume, S., Nonaka, K., Kimura, K., Mizukoshi, H.,

Gamo, Y. and Takahashi, J. 2003. Methane emission

nutrient digestibility energy metabolism and blood

metabolites in dairy cows fed silages with and without

galacto-oligosaccharides supplementation. Asian-

Australas. J. Anim. Sci. 16: 534-540.

Sarkar, S., Mohini, M., Mondal, G., Pandita, S., Nampoothiri,

V.M., Gautam, M. 2017. Effect of supplementing Aegle

marmelos leaves on in vitro rumen fermentation and

methanogenesis of diets varying in roughage to

concentrate ratio. Indian. J. Anim. Res. DOI :10.18805/

ijar. b-3331

Satter, L. D. and Slyter, L.L. 1974. Effect of ammonia

concentration on rumen microbial protein production

in vitro. Br. J. Nutr. 32: 199-208.

Schiffrin, E.J., Brassart, D., Servin, A.L., Rochat, F. and Donnet-

Hughes, A. 1997. Immune modulation of blood

leukocytes in humans by lactic acid bacteria: criteria

for strain selection. Am. J. Clin. Nutr. 66: 515S-520S.

Sharma, A., Chaudhary, P.P., Sirohi, S.K. and Saxena, J. 2011.

Structure modeling and inhibitor prediction of NADP

oxidoreductase enzyme from Methanobrevibacter

smithii. Bioinformation. 6: 15.

Shivani, S., Srivastava, A.K., Shandilya, U.K., Kale, V. and

Tyagi, A. K. 2016. Dietary supplementation of

Butyrivibrio fibrisolvens alters fatty acids of milk and

rumen fluid in lactating goats. J. Sci. Food Agric. 96:

1716-1722.

Teraguchi, S., Ono, J., Kiyosawa, I., Fukuwatari, Y., Araki, K.

and Okonogi, S. 1984. Vitamin production by

Bifidobacteria originated from human intestine. J.

Japanese. Soc. Nutr. Food Sci. 37: 157-164.

Van Soest, P.J., Robertson, J.B., Lewis, B.A. 1991. Methods

for dietary fiber, neutral detergent fiber, and nonstarch

polysaccharides in relation to animal nutrition. J. Dairy

Sci.74: 3583-3597.

Weinberg, Z.G., Chen, Y., Gamburg, M. 2004. The passage of

lactic acid bacteria from silage into rumen fluid, in vitro

studies. J. Dairy Sci.87: 3386-3397.

Zicarelli, F., Calabro, S., Cutrignelli, M. I., Infascelli, F., Tudisco,

R., Bovera, F., & Piccolo, V. 2011. In vitro fermentation

characteristics of diets with different forage/

concentrate ratios: comparison of rumen and faecal

inocula. J. Sci. Food Agric. 91: 1213-1221.

Jaglan et al.



138

Indian Journal of

Animal Nutrition

Augmenting Feeding Value of Rice Gluten Meal through Dietary Addition

of Enzymes in Broilers

O.P.Dinani*, Pramod Kumar Tyagi, A.B. Mandal, Praveen Kumar Tyagi

and Narayan Dutta1

Avian Nutrition and Feed Technology Division,

ICAR-Central Avian Research Institute, Izatnagar-243122, India

ABSTRACT

A biological experiment of 42 days duration was undertaken to study the growth performance of broilers.

A total of 384, day-old chickswere divided into 12 dietary treatments following 3×4 factorial design having 4

replicates per treatment with 8 birds in each. Twelve experimental diets were prepared by incorporating control,

two different levels (15 and 17.5%)of rice gluten meal (RGM), and three different types of enzymes namely

xylanase (X), protease (P) and multienzymes (M). Data pertaining to the growth performance of birds revealed

no significant (P>0.05) difference in RGM levels (15 and 17.5%), but FCR was significantly (P<0.05) poor in

17.5% RGM level. Either of the three supplementations (X, P and M) significantly (P<0.05) improved the growth

performanceof the birds, best response being observed with protease supplementation. Thus,it may be

concluded thatprotease supplementation may increase the effective and safe inclusion level of alternate

protein source RGM from 15 to 17.5% for economic broiler production.

Key words:Broiler, Enzymes,Growth, Protein, Protease, Rice glutenmeal

*Corresponding author; Email: [email protected]; 1Division of Animal Nutrition, ICAR-Indian Veterinary Research Institute, Izatnagar

243122, India.

INTRODUCTION

The search of alternative feed ingredients in

poultry nutrition is a continuous process in the pursuit of

economical poultry production. India is the second

largest producers of rice in the world after China,

producing approximately 109.7 MT rice in 2016-17

(Agriculture Statistics, 2018). Now-a-days, certain

newer rice by-products are available in appreciable

quantities from rice processing industries and at cheaper

rate such as rice gluten meal (RGM), which can be

utilized in feeding poultry.The RGM is a by-product of

wet-milling of rice obtained after starch extraction

and syrup preparation. It is a relatively newer feedstuff

having brownish colour and coarse powdery texture.

Commercial traders categorise RGM as a high crude

protein and energy ingredient which is priced lower than

soybean meal.

Initial research finding showed that RGM can be

included up to 10% level in broiler chicken ration

without affecting feed efficiency and dressing

percentage (Sheraziet al., 1995).Metwally and Farahat

(2015) found that broiler fed RGM with different


doi: 10.5958/2231-6744.2020.00023.7

inclusion rates up to 12.5% had the same growth

performance.Overall, very little research data is

available on feeding value of RGM in poultry and no

data is available regarding augmenting its feeding value

through dietary addition of enzymes in broilers. Hence,

this study was conducted for substrate specific

selection of enzyme for RGM and its effect on the

growth performance of broilers.


Experimental layout for feeding different level of

RGM with or without enzymes is presented in Table 1.

In an experiment based on factorial design 384, day-old

chicks (CARIBRO-Vishal) were randomly divided into

48 replicates of eight birds each. There were twelve

different treatments with 4 replicates for each

treatment. Dietary treatments were according to 3×4

factorial arrangements; 0, 15 and 17.5% of RGM,

supplemented with either no enzyme, or protease,

xylanase or multienzymes supplementation. Mixing

ratio 50 g per 100 kg feed for protease, 10 g per 100 kg

feed for xylanase and 25 g per 100 kg feed for

multienzymes were used as per manufacturer


139

instructions.

Data pertaining to chemical composition of dietary

ingredients (%) analysedas per (AOAC, 2000) on as is

basis is presented in Table 2. Ingredients and nutrient

composition (%) of pre-starter (0-14 days), starter

(14-28 days)and finisher (28-42 days) diets with or

without enzymes for different level of RGM are

presented in Table 3. All the rations were formulated to

meet the nutrient requirements of the birds as per ICAR

(2013) standard. In vitro pepsin-pancreatin digestibilities

(IVPPD) of RGM and soybean meal were measured

according to the method of Gopalkrishnan and Jamuna

(2000). The IVPPD of RGM was found to be 81.92%

and that of soybean meal was 88.15%.No detectable

amount of aflatoxin B1 and ochratoxin were found in

RGM as estimated by thin layer chromatography

(AOAC, 2000).

The three commercial enzyme preparations i.e.

protease, xylanase and multienzymes were used as per

manufacturer instructions after assessing their activity

as per standard methods (Kamra and Agarwal,

2003).Activity of protease and xylanase were 600,000±

849 and 150,000 ± 683 units/g, respectively.

Multienzymes activity were estimated for cellulase

15,000±275, xylanase 18, 500±328, β-glucanase 12,500

±128, amylase 1500±46, pectinase 150±16, protease

Table 1. Experimental layout for feeding different level of RGM with or without enzymes

Treatment Rice gluten No. of replicates Birds/ Total Enzymes

meal (%) replication

T1

0.0 4 8 32 -

T2

0.0 4 8 32 Xylanase

T3

0.0 4 8 32 Protease

T4

0.0 4 8 32 Multienzymes

T5

15 4 8 32 -

T6

15 4 8 32 Xylanase

T7

15 4 8 32 Protease

T8

15 4 8 32 Multienzymes

T9

17.5 4 8 32 -

T10

17.5 4 8 32 Xylanase

T11

17.5 4 8 32 Protease

T12

17.5 4 8 32 Multienzymes

Table 2. Chemical composition of dietary ingredients (%) on as is basis

Ingredients Moisture DM CP EE CF TA NFE Ca P GE *ME

(kcal/kg) (kcal/kg)

Maize 8.6 91.3 9 3.9 1.8 1.4 83.8 0.03 0.29 4447 3350

SBM 9.1 90.9 44.5 0.9 6.2 3.1 45.2 0.32 0.68 4097 2400

DORB 10.1 91.8 14 1.6 15.9 5.8 62.6 0.3 1.54 3854 2000

RGM 7.6 92.3 49.9 5.7 7.4 3.3 33.5 0.84 0.98 4742 3031

Soybean oil - - - - - - - - - 8900 8450

Lime stone 1.4 98.6 - - - - - 33.89 - - -

powder

DCP 7.2 92.7 - - - - - 22.92 16.04 - -

SBM, soyabean meal; DORB, de-oiled rice bran; RGM, rice gluten meal, DCP, di-calcium phosphate; DM, dry matter;CP, crude protein; EE,

ether extract; CF, crude fibre; TA, total ash; NFE, nitrogen-free extract; GE, gross energy; ME, metabolizable energy*calculated value

Dinani et al.


140

5000±136, lipase 15± 3.8 and β-mannanase 400±31.

The research work was carried out at the

Division of Avian Nutrition and Feed Technology, ICAR-

Central Avian Research Institute (CARI), Izatnagar,

India as per the guidelines and approval of Institute

Animal Ethical Committee (IAEC) and Committee for

the Purpose of Control and Supervision of Experiments

on Animals (CPCSEA).Theinitial body weight, final body

weight, overall body weight gain, feed intake (g/bird)

andfeed conversion ratio were recorded.

Data analyzed for mean, standard errors and

analysis of variance as per method of Snedecor and

Cochran (1989) and comparison of means were done

using Tukey’s test (1949) using software of Statistical

Package for Social Sciences (SPSS) 16.0 version.


Data pertaining to the growth performance of

birdsare presented in Table 4. Perusals of data revealed

no significant (P>0.05) difference in RGM levels (15

and 17.5%)on body weight gain and feed intake, but

FCR was significantly (P<0.05) poorer when RGM was

included at 17.5%. Supplementation of either of the three

enzymes (X, P and M) significantly (P<0.05) improved

the body weight gain and FCR of the birds,

best response being observed with protease

supplementation. Incorporation of RGM up to 15% did

not cause any significant change in body weight gain

and feed intake. Thus, it is evident that RGM can be

incorporated safely up to 15% in the broiler ration.

However, some notable studies (Wani, 2017) reported

decrease in body weight gain and poor FCR when RGM

was included at 20% inclusion level.Thus, it seems that

RGM may not be incorporated in broiler ration at a level

higher than 15%. Major drawbacks that hindered the

incorporation of RGM in broiler ration included poor

energy and protein digestibility of RGM, factors

associated with the level and type of crude fibre present

in it along with poor feed intake (Metwally and Farahat,

2015; Malik etal.,2017). Some of these drawbacks,

particularly associated with non-starch polysaccharide,

poor energy and protein digestibility can be overcome

by supplementation of exogenous enzymes (Giannenaset

al., 2017; Wani, 2017). Results of the present

experiment suggest that all the three enzyme

preparations were effective in improving body weight

gain and FCR. In general, this is inagreement with

earlier study(Wani, 2017) which indicate that enzyme

supplementation improved the utilization of RGM in

Table 3. Ingredient and nutrient composition of experimental diets

Diets Pre-starter Starter diets Finisher diets

Ingredients T1

RGM- RGM- T1

RGM- RGM- T1

RGM- RGM-

15 17.5 15 17.5 15 17.5

Maize 54.42 59.40 60.00 55.63 60.70 61.62 62.00 67.07 67.97

SBM 38.40 20.70 17.80 37.10 19.20 16.20 31.30 13.40 10.40

RGM 0.00 15.00 17.50 0.00 15.00 17.50 0.00 15.00 17.50

Oil 3.00 0.70 0.40 3.50 1.20 0.80 3.22 0.90 0.50

LSP 1.40 1.30 1.30 1.35 1.32 1.32 1.20 1.14 1.14

DCP 1.82 1.95 1.95 1.55 1.70 1.70 1.45 1.60 1.60

Constant* 0.765 0.765 0.765 0.765 0.765 0.765 0.765 0.765 0.765

Total 100.00 100.00 100.00 100.00 100.0 100.0 100.0 100.0 100.00

Nutrient composition

CP 21.99 22.06 22.07 21.52 21.52 21.52 19.50 19.50 19.50

ME ** 2998 3001 3001 3050 3050 3050 3100 3100 3100

SBM, soyabean meal; DORB, de-oiled rice bran; RGM, rice gluten meal, DCP, di-calcium phosphate; LSP, lime stone powder; CP, crude

protein; ME, metabolizable energy; **calculated value; *Constant 0.765included salt 0.4%, trace mineral premix 0.1%, vitamin premix

0.15%, vitamin B complex 0.015%, choline chloride 0.05% and toxin binder 0.05%.(ICAR,2013)

Enzyme supplementation of rice gluten meal diet in broilers


141

broilers. Enzyme supplementations leads to increase

feeding value of the dietary raw materials, reduction in

the variation of nutrient quality of the diet, increased

nutrient digestibility, reduction in water content of the

excreta, reduced viscosity of intestinal contents and

accelerated rate of passage of digesta through the

gastrointestinal tract (Lazaro et al., 2004). However,

the best response was obtained when the ration was

supplemented with proteasesfindings corroborate well

with those available in literature (Wani, 2017).

Our results are in agreement with many previous

reports (Metwally andFarahat, 2015; Kumar et al.,2016;

Maliket al., 2017; Wani, 2017). However, Sheraziet al.

(1995) reported decrease in body weight gain (BWG)

on incorporation of rice protein meal up to 10% level.

Metwally and Farahat (2015) reported that 12.5% RGM

level did not affect the FCR in broiler chicken. Kumar

et al. (2016) reported no significant (P>0.05)

difference in the dry matter (DM) intake, average daily

gain, (ADG) and feed efficiency by replacing 75% of

ground nut cake with RGM in the concentrate mixture

of growing calves. Contrary to our results, Wani (2017)

reported significant (P<0.05) decrease in the feed

intake when RGM was included in the diet 17.5% level,

Table 4. Effect of feeding different level of RGM with or without enzymes on growth performance

Treatments Initial body Final body Weight gain Feed FCR

weight (g) weight (g) (g) consumption (g)

T1

44 1747ab 1704ab 3068 1.80

T2

42 1788abc 1744abc 3074 1.76

T3

43 1785abc 1741abc 3076 1.76

T4

41 1880d 1836d 3047 1.66

T5

44 1775abc 1731abc 3074 1.77

T6

45 1778abc 1735abc 3065 1.77

T7

44 1837cd 1793cd 3065 1.71

T8

42 1810bcd 1766bcd 3095 1.75

T9

44 1723a 1680a 3065 1.82

T10

41 1803bc 1759bc 3084 1.75

T11

44 1828cd 1784cd 3089 1.73

T12

42 1782abc 1739abc 3068 1.76

Pooled SEM 0.10 8.14 8.15 4.02 0.01

Levels of RGM

0 44 1800 1757 3066 1.75a

15 43 1800 1757 3074 1.75a

17.5 44 1785 1741 3077 1.78b

Effect of enzymes

- 42 1748a 1705a 3069 1.80b

X 44 1790b 1746b 3074 1.76a

P 43 1816b 1773b 3077 1.73a

M 44 1824b 1780b 3070 1.72a

Significance

RGM NS NS NS NS P<0.05

Enzyme NS P<0.01 P<0.01 NS P<0.01

RGM x enzyme NS P<0.05 P<0.05 NS NS

a,b, c,dValues bearing different superscript in a column differ significantly

Dinani et al.


142

but BWG and FCR between the control and various

treatment groups did not differed significantly (P>0.05)

up to 17.5% inclusion level of RGM.

Our results are in disagreement with Wani (2017)

and Giannenaset al. (2017) with respect to response of

enzymes supplementation. Wani (2017) reportedthat

enzyme supplementation had shown significantly

(P<0.01) decreased feed intake with no significant

(P>0.05) effect on BWG and FCR. Giannenaset al.

(2017) reported that broilers which were fed the corn

gluten meal up to 20.10% level supplemented with

protease in the diet showed significantly (P>0.05) lower

feed intake and weight gain.

CONCLUSIONS

Supplementation of protease enzymes at 50 g per

100 kg feed improved body weight gain and FCR in

broilers fed RGM diet. Thus, it may be concluded that

protease supplementation may increase the effective and

safe inclusion level of alternate protein source RGM

from 15 to 17.5% for commercial broiler production.

ACKNOWLEDGEMENT

ICAR- Central Avian Research Institute,

Izatnagar-243122, India for providing all necessary

inputs and facilities.

REFERENCES

Agricultural statistics.2018. Agricultural Statistics at a

Glance. Department of agriculture, cooperation and

farmers welfare. Government of India, New Delhi.

AOAC.2000. Association of Official Analytical

Chemists.Official Methods of Analysis. 17th

edn.,Washington, DC.

Giannenas, I., Bonos, E., Anestis, V., Filioussis, G.,

Papanastasiou, D.K., Bartzanas, T., apaioannou,

N.,Tzora, A. and Skoufos, I. 2017. Effects of protease

addition and replacement of soybean meal by

corngluten meal on the growth of broilers andon the

environmental performances of a broiler production

system in greece. PloSone. 12: 1-26.

Gopalkrishnan, M.V. and Jamuna, P. 2000. Optimum time

requirement for enzymatic hydrolysis of food proteins.

J. Food Sci. Technol. 37: 319-322.

ICAR. 2013. Nutrient Requirements of Animals-Poultry.

Indian Council of Agricultural Research, New Delhi,

India. 1: 13-16.

Kamra, D.N.and Agarwal, N.2003.Techniques in Rumen

Microbiology. IVRI (Deemed University), Izatnagar,

U.P., India.

Kumar, R., Thakur, S.S. and Mahesh, M.S. 2016. Rice gluten

meal as an alternative by product feed for growing

dairy calves. Trop. Anim.Health Prod.48: 619-624.

Lazaro, R., Latorre, M. A., Medel, P., Gracia, M. and Mateos, G.

G. 2004. Feeding regimen and enzyme supplementation

to rye based diets for broilers. Poult. Sci. 83: 152-160.

Malik, T.A., Thakur, S.S., Mahesh, M.S. and Yogi, R.K. 2017.

Replacing groundnut cake with glutenmeals of rice and

maize in diets for growing Sahiwal cattle. Asia-

Australas.J. Anim. Sci.30: 1410.

Metwally, A. and Farahat, M. 2015. Nutritive value and

feeding of rice gluten meal in broiler chickens. Res.

Opin. Anim. Vet. Sci. 5: 443-451.

Sherazi, T.H., Alam, M.Z., Gilani, A.H. and Nawaz, H. 1995.

Graded replacement of fish meal with rice protein meal

in broiler ration. Pak. J. Agric. Sci. 32: 2-3.

Snedecor, G.W. and Cochran, W.G. 1989. Statistical Methods,

7th edn. Oxford and IBH.Iowa State University Press,

Iowa, USA.

Tukey, J. 1949. Comparing Individual Means in the Analysis

of Variance. Biometrics.5: 99-114.

Wani, M.A. 2017.Evaluationof Feeding Value of Rice Gluten

Meal in Broiler Chicken. Ph.D. thesis submitted to

IVRI (Deemed University), Izatnagar, U.P., India.

Enzyme supplementation of rice gluten meal diet in broilers



143

Indian Journal of

Animal Nutrition

Effect of Feeding Graded Levels of Guava Leaf Meal on Performance

and Economics of Broiler Chicks

M.I. Daing, A.K. Pathak*, R.K. Sharma and M.A. Zargar

Division of Animal Nutrition, Faculty of Veterinary Sciences and Animal Husbandry,

SKUAST-Jammu, R.S. Pura, India

ABSTRACT

Present study was undertaken on 120-day-old unsexed broiler chicks to study the effect of dietary

guava leaf meal (GLM) on performance of broilers. They were randomly distributed into 4 dietary treatment

groups of 30 birds per group, each having 3 replicates (10 birds per replicate) in a completely randomized block

design (CRD). All the birds were fed standard starter and finisher ration to meet their nutrient requirements.

Diets of the birds in groups T1, T

2, T

3 and T

4 were supplemented with guava leaf meal at 0, 1, 2 and 4 % of diet.

Cumulative feed intake during 0-3, 0-6 and 4-6 weeks of broiler chicks were significantly (P<0.05) higher in T1

followed by T2, T

3 and lowest in T

4 groups. FCR of 0-3 weeks among groups was found to be statistically

non-significant (P<0.05), whereas, at 0-6 weeks better FCR was observed in T3 followed by T

4 and poor FCR

was recorded in T1 and T

2. Similarly, FCR during 4-6 weeks was significantly (P<0.05) better in T

3 followed by

T4, T

2, and lower FCR was recorded in T

1. GLM incorporation did not exert any adverse effect on carcass

characteristics, even though, significantly decreased abdominal fat content and improved lymphoid organ

weight was noted in gram and percent of live weight. GLM supplementation significantly (P<0.001) increased

net profit per bird and benefit: cost ratio in T2, T

3 and T

4 groups as compared to T

1 group. It may be concluded

that GLM supplementation at 2 % improved body weight gain, FCR, lymphoid organs weights and reduced

feed intake and abdominal fat content. Thus, supplementation of guava leaf meal at 2% in the broiler ration

could be a better alternative in terms of producing healthy low fat broiler meat.

Key words: Broilers, Carcass characteristics, Economics, Feed conversion ratio, Guava leaf meal

*Corresponding author; Email: [email protected], Assistant Professor (SS), Division of Animal Nutrition, Faculty of Veterinary

Sciences & AH, SKUAST-Jammu-181102, India

INTRODUCTION

The synthetic drugs as feed additives in broiler

diets are primarily included to improve efficiency of

broiler’s growth, prevent diseases and improve feed

utilization. This leads to improve production, and have

been used extensively in intensive broiler farming in

order to minimize diseases, and to improve growth and

feed utilization. But the prophylactic use of synthetic

drugs as feed additives/ growth promoters in broiler

production have been banned because of harmful

effects (microorganisms resistance against chemical

drugs and their residual effect on meat products) on

human health. In this context, condensed tannin

containing leaf meals (CTLM) could serve as suitable

alternatives to synthetic products.

One such CTLM source is Psidium guajava,

commonly known as guava, which is used as a

traditional medicine. Its primary traditional uses include


doi: 10.5958/2231-6744.2020.00024.9

the alleviation of diarrhoea and dehydration. Other uses

include treatment of gastroenteritis, dysentery, stomach

pain, diabetes mellitus, and wounds. In addition, it is

known for its anthelmintic (Pathak et al., 2013a; Pathak

et al., 2013b; Pathak et al., 2013c; Pathak et al., 2016)

antioxidant (Daing et al., 2017a; Daing et al., 2017b;

Pathak et al., 2017; Zargar et al., 2016; Zargar et al.,

2017), antibacterial (Daing et al., 2017a; Daing et al.,

2017b), anticoccidial (Zargar et al., 2016; Zargar et al.,

2017) and anti-inflammatory properties (Qian and

Nihorimbere, 2004; Cheng et al., 2009; Han et al.,

2011). Guava leaves have CTs with high antioxidant

activity, growth promoting and functional feed

properties besides playing important role in lowering

abdominal fat content and improve broiler performance.

Most of its biological activities have been accredited to

the presence of CT at lower level. Keeping all these

point in view, the present study was planned to assess


144

the effect of graded levels of dietary GLM on feed

intake, FCR, carcass characteristics and economics of

broiler chicks production.


The experimental was carried out in the Division

of Animal Nutrition, Faculty of Veterinary Sciences and

Animal Husbandry, R.S. Pura, SKUAST-Jammu. Fresh

guava (Psidium guajava) leaves were collected from

Faculty premises, R.S. Pura, Jammu. They were shed

dried to dry matter content of more than 90 percent and

stored in a cool, dark and dry place. Dried guava leaves

were milled in the laboratory hammer mill.

A total of 120 day-old unsexed and healthy

commercial broiler chicks of Cobb-K strains were

purchased from Kashmir Valley Poultry Breeding Farm

and Hatchery, Jammu. They were randomly distributed

into 4 dietary treatment (T1, T

2, T

3 and T

4) groups of 30

chicks per group, each having 3 replicates of 10 chicks

per replicate in an experiment based on CRD. Electric

bulbs and gas brooders were used as source of light and

heat. On arrival, chicks were given water and feed

ad libitum but with small amount of feed sprinkled on

papers inside brooding area for easier consumption and

recognition of feed by chicks up to ten days of age.

Temperatures were kept at 32°C for first 7 days and

monitored frequently for about 3 times/day i.e. in the

morning, during the day, and at night. Brooding house

and its environments was thoroughly cleaned, washed

with detergent, disinfected and fumigated by using

standard protocol. After 10 days, they were shifted in

12 deep litter pens. Rice husk was spread on the floor

to serve as litter material. All the birds were fed to meet

their nutrient requirements as per BIS (1992). Diets of

the birds in groups T1, T

2, T

3 and T

4 were supplemented

with guava leaf meal at 0, 1, 2 and 4 % of diet.

The parameters measured were feed intake, body

weight, body weight gain, FCR, carcass characteristics

and benefit: cost ratio of broiler birds. Average daily

feed intake per bird was calculated every morning by

subtracting the amount of feed left in feeding trough

from what was offered previous day and then dividing it

by the number of birds in the replicate. Chicks were

weighed at the start of the experiment and weekly

thereafter. Chicks in a pen were weighed individually

with a digital weighing scale and previous weight was

subtracted from the current weight to determine the

body weight gain per bird for the week. The FCR was

calculated by dividing the feed consumed by the live

weight gain.

Samples of GLM, feed offered, residue left

and faeces voided were analyzed for proximate

composition viz. dry matter (DM), organic matter (OM),

crude protein (CP), crude fibre (CF), ether extract (EE)

and nitrogen free extract (NFE) as per standard

protocol (AOAC, 1995). Samples were also subjected

to analysis of calcium (Ca) and phosphorus (P) as per

methods described by Talpatra et al. (1940) and AOAC

(2000), respectively. A representative sample of GLM

was analyzed for CT content as per butanol HCl method

(Makkar, 2000). The metabolizable energy (ME)

content (kcal/Kg) of GLM and experimental broiler

diets was calculated according to the formula of

Pauzenga (1985).

ME = 37 × % CP + 81 × % EE + 35.5 × % NFE

Carcass evaluation was done at the end of

experimental feeding trial of 42 days. Two birds from

each replicate were randomly selected for carcass

evaluation. The birds were starved overnight to empty

the crop and were put in slaughtering trough and the

head cut. The following measurements were taken for

the carcass analysis viz. live weight, slaughtered weight,

de-feathered weight, eviscerated weight, shank, head,

neck, heart, liver, lungs, empty gizzard, thymus, bursa,

spleen and empty intestine weights etc. All these were

calculated as such (in grams) and as percent of the live

weight of the bird. The economics of broiler chicks with

and without GLM supplemented diets was calculated at

the end of feeding trial of 6 weeks as per standard

protocol.

The data obtained were subjected to analysis

of variance and treatment means were ranked

using Duncan’s multiple range tests (Snedecor and

Cochran, 2004) using SPSS version 16.0 for windows.

Significance was declared at P<0.05 unless otherwise

stated.

Guava leaf meal in broiler ration


145


The ingredients and chemical composition of

experimental broiler (starter and finisher) diets have been

presented in Table 1. The CT content of GLM was 83.4

g/kg DM, which is confirmatory with the findings of

previous workers (Khan et al., 2019; Pathak et al., 2015;

Singh et al., 2015). Birds of T1 group were fed with

basal diet (Control: GLM 0 % of diet) while T2, T

3 and

T4 groups were fed by replacing crushed maize with

GLM @ 1, 2 and 4 percent of diet or 10, 20 and 40 g/kg

of diet, respectively. Dietary incorporation of GLM @

0, 1, 2 and 4 % by replacing maize slightly changed the

nutrient values of experimental diets of T1, T

2, T

3 and

T4. As the level of GLM in the diet increased the

concentration of CT increased and nutrient composition

very slightly decline in T2, T

3 and T

4 groups compared

to T1 group but they remained within the permissible

range (BIS, 1992).

Growth pattern (average body weights) of

experimental broiler chicks of various groups (T1, T

2,

T3 and T

4) at weekly interval is depicted in figure 1.

Average body weights among groups were statistically

Table 1. Ingredients and chemical composition of experimental broiler diets

Attributes Experimental diets

Broiler Starter Broiler finisher

T1

T2

T3

T4

T1

T2

T3

T4

Ingredient composition (g/kg)

Crushed Maize 500 490 480 460 540 530 520 500

Rice polish 45 45 45 45 80 80 80 80

Soybean meal 400 400 400 400 315 315 315 315

Soybean oil 15 15 15 15 25 25 25 25

DCP 15 15 15 15 15 15 15 15

LSP 10 10 10 10 10 10 10 10

Common salt 5 5 5 5 5 5 5 5*Premix 4.7 4.7 4.7 4.7 4.7 4.7 4.7 4.7

L-Lysine 3.6 3.6 3.6 3.6 3.3 3.3 3.3 3.3

DL-Methionine 1.7 1.7 1.7 1.7 1.6 1.6 1.6 1.6

GLM % of diet 0 1 2 4 0 1 2 4

Chemical composition (g/kg)

OM 929.7 929.2 924.8 920.7 924.8 921.7 924.0 919.7

CP 229.2 229.7 227.1 226.6 200.4 199.1 199.5 198.9

EE 44.4 42.3 44.3 44.0 60.2 60.0 59.3 58.4

CF 39.6 40.3 43.2 46.9 47.4 49.3 46.0 52.6

NFE 616.5 616.9 610.2 603.2 616.8 613.3 619.2 609.8

TA 70.3 70.8 75.2 79.3 75.2 78.3 76.0 80.3

AIA 26.2 23.7 25.2 27.7 25.3 24.9 25.8 27.0

Ca 15.1 15.8 16.4 17.6 15.6 15.2 16.5 18.4

P 6.9 6.7 6.0 5.8 6.3 6.4 5.9 5.6

ME (kcal/kg) 2803 2799 2795 2787 2907 2894 2882 2866

CT (g/kg) 0.0 0.80 1.62 3.23 0.0 0.83 1.65 3.30

*Per kg diet provide Manganese, 90 mg; zinc, 80 mg; iron, 90 mg; iodine, 2 mg; copper, 15 mg; selenium, 0.3 mg; vitamin A, 10,000 IU; vitamin

D3, 2500 IU; vitamin K

3, 1 mg; vitamin E, 8 mg; vitamin B

1, 8 mg; vitamin B

2, 5 mg; vitamin B

6, 1.6 mg; vitamin B

12, 20.5 mcg; niacin, 12 mg;

folic acid, 0.8 mg and calcium pantothenate, 8 mg

Daing et al.


146

similar up to 3rd weeks of age. However, body weight

differed significantly (P<0.05) irrespective of groups

after 3rd weeks onwards. Furthermore, significantly

(P<0.05) higher mean body weight was obtained in T3

followed by T1 and T

2 and minimum body weight was

observed in T4, while, body weight of birds of groups T

1

and T2 did not differ significantly.

Cumulative feed intakes during 0-3, 0-6 and 4-6

weeks of broiler chicks were significantly (P<0.05)

higher in T1 followed by T

2, T

3 and lowest feed intake

was recorded in T4 groups (Table 2). Reduction in feed

intake may be due to the GLM used in this study that

contained high concentration (3.23-3.33 g/ kg diet) of

CT. The CT having astringent property, at higher level it

bind with glycol-proteins of the saliva and other

nutrients, such complex causes a sensation in the oral

cavity, which greatly reduced palatability and hence

tends to depress the feed intake in broiler birds. Similar

results have been reported before (Douglas et al., 1993;

Hassan et al., 2003). However, present results are

contradictory to the findings of Rahman et al. (2013)

who found that GLM up to 4.5% dietary level had no

detrimental effect on feed consumption.

Cumulative weight gains during 0-3, 0-6 and 4-6

weeks were found to be highest in T3 followed by T

1,

T2 and lowest in T

4 (Table 2). The present findings

showed that up to 2 % of GLM inclusion in the diets of

broiler chicks had no adverse effect on body weight

gain even though the feed intake was lower in this group,

indicating that CT containing GLM act as natural feed

additives and showed beneficial effects on body weight

gain. The present results are in agreement with the

findings of Rahman et al. (2013). They reported no

deleterious effect of guava leaf meal on body weight

gain up to 4.5 % level of dietary inclusion in broiler chicks.

Table 2. Effect of GLM supplementation on cumulative feed intake, body weight gain and FCR

Age Group SEM P Value

T1

T2

T3

T4

Feed intake

0-3 weeks 1084d 1068c 1016b 983a 3.70 0.001

4-6 weeks 2690d 2668c 2580b 2477a 7.70 0. 001

0-6 weeks 3774d 3736c 3596b 3460a 11.37 0.001

Body weight gain

0-3 weeks 685b 671ab 654ab 637a 5.94 0.025

4-6 weeks 1230a 1255a 1337 1206a 12.10 0.001

0-6 weeks 1916b 1926b 1991c 1844a 11.06 0.001

Feed conversion ratio (FCR)

0-3 weeks 1.59 1.61 1.57 1.56 0.01 0.627

4-6 weeks 2.21c 2.14bc 1.95a 2.08b 0.02 0.001

0-6 weeks 1.97c 1.95c 1.81a 1.88b 0.01 0.001

a,b,c,d Means with different superscripts within a row differ significantly (P<0.05)

2200210020001900180017001600150014001300120011001000900800700600500400300200100

0

Fig. 1. Growth pattern of broiler chicks fed with and

without GLM supplemented diets



147

However, El-Deek et al. (2009) reported that broiler

body weight gain at 8 weeks showed non-significant

difference at 2 or 4% levels of guava by-products, raw

or treated, in comparison with control.

The cumulative FCR of 0-3 weeks among groups

was found to be statistically non- significant (P<0.05),

whereas, FCR of 4-6 was found to be better in T3

followed by T4, T

2 and worse FCR was recorded in T

1,

while T2 has an intermediate value between T

1 and T

4.

Similarly, FCR at 0-6 weeks was better in T3 followed

Table 3. Effect on carcass characteristics of broiler chicks fed GLM supplemented diets

Parameters Groups SEM P Value

T1

T2

T3

T4

Live weight (g) 1724 1776 1890 1846 32.59 0.293

De-feathered weight (g) 1315 1372 1466 1426 26.68 0.210

% of live weight 76.29 77.25 77.53 77.27 0.24 0.280

Slaughter weight (g) 1645 1708 1820 1743 31.55 0.268

% of live weight 95.42b 96.19c 96.29c 94.44a 0.24 0.014

Eviscerated weight (g) 1146 1195 1345 1212 34.87 0.219

% of live weight 66.40 67.30 71.12 65.54 1.27 0.442

Carcass

Feather (g) 228.00 239.50 243.17 231.17 3.64 0.441

% of live weight 13.28 13.49 12.94 12.59 0.23 0.545

Head (g) 35.00 42.67 43.17 41.17 1.46 0.173

% of live weight 2.03 2.41 2.26 2.25 0.07 0.273

Neck (g) 52.17 55.00 54.17 52.00 1.58 0.897

% of live weight 3.03 3.09 2.88 2.84 0.09 0.756

Thigh (g) 83.67 90.33 91.67 82.17 2.59 0.500

% of live weight 4.84 5.08 4.84 4.44 0.11 0.196

Shank (g) 32.00 32.67 34.67 27.83 1.32 0.329

% of live weight 1.86 1.84 1.82 1.52 0.07 0.220

Breast (g) 430.67 450.33 479.67 456.67 12.07 0.580

% of live weight 24.94 25.36 25.33 24.69 0.35 0.904

Drumstick (g) 75.00 81.17 85.00 78.50 2.09 0.403

% of live weight 4.35 4.57 4.51 4.23 0.08 0.420

Wings (g) 48.67 51.17 55.33 51.00 1.53 0.505

% of live weight 2.82 2.89 2.94 2.75 0.07 0.815

Abdominal fat (g) 8.00c 5.50b 4.33a 5.50b 0.38 0.001

% of live weight 0.47c 0.31b 0.23a 0.30b 0.02 0.001

Organs

Gizzard (g) 31.50 34.50 34.33 35.67 1.57 0.832

% of live weight 1.83 1.94 1.81 1.91 0.07 0.910

Heart (g) 6.50 7.17 7.33 8.50 0.37 0.297

% of live weight 0.38 0.40 0.40 0.46 0.02 0.563

Liver (g) 28.50 29.33 29.67 30.00 0.93 0.956

% of live weight 1.65 1.65 1.57 1.63 0.05 0.941

Intestine (g) 48.33a 56.33b 62.83c 74.17d 2.69 0.001

% of live weight 2.82a 3.17b 3.32c 4.06d 0.14 0.008

a,b,cMeans with different superscripts within a row differ significantly (P<0.05)

Daing et al.


148

by T4 and worse FCR was obtained in T

1 and T

2,

however, differences between T1

and T2 were

statistically non-significant (Table 2). The results

indicate that there was no detrimental effect on mean

FCR after feeding up to 4 percent level of GLM. Present

results are similar to the findings of Rahman et al.

(2013). They observed that the broiler fed diet with 4.5

% guava leaf meal utilized their diet efficiently and

maintained FCR that was comparable to control. It is

clearly indicated that the broiler production was more

profitable and economical in GLM supplemented diets.

Data on carcass characteristics of experimental

broiler chicks are presented in the Tables 3 and 4.

Dietary supplementation of GLM at 0, 1, 2 and 4%

level did not exert any adverse effect on carcass

characteristics measurements of broiler chicks except

slaughter weight in percent of live weight.

The slaughter weight (% of live weight) was

significantly (P<0.05) higher in T2 and T

3 followed by

T1, while the least slaughter weight was observed in

T4. However, the slaughter weight between T

2 and T

3

was statistically similar. Other carcass characteristics

viz. feathers weight, head, neck, thigh, shank, breast,

drumstick, wings, gizzard, heart and liver weights in gram

as well as in percent of their live weights did not differ

significantly (P<0.05) among groups.

Dietary supplementation of CT containing GLM

significantly (P<0.05) reduced abdominal fat weight in

Table 4. Effect of GLM supplementation on lymphoid organs weight

Parameters Group SEM P Value

T1

T2

T3

T4

Live weight (g) 1914 1864 2147 1934 46.03 0.080

Thymus (g) 6.65a 7.56a 11.37c 9.68b 0.57 0.001

% live weight 0.35a 0.41b 0.53c 0.50c 0.02 0.001

Spleen (g) 5.67a 6.33ab 7.67b 7.33b 0.30 0.043

% live weight 0.29a 0.34ab 0.36b 0.38b 0.01 0.032

Bursa (g) 5.78 7.16 7.45 7.03 0.26 0.069

% live weight 0.30a 0.38b 0.35ab 0.36b 0.01 0.043

a,b,cMeans with different superscripts within a row differ significantly (P<0.05)

Table 5. Economics of broiler chickens fed CT containing guava leaf meal based diets

Parameters Group SEM P Value

T1

T2

T3

T4

Total body weight (kg) 1.96b 1.97b 2.04c 1.89a 0.09 0.001

Total feed intake (kg) 3.773c 3.736c 3.596b 3.460a 0.04 0.001

Feed cost (`) / kg diet 29.05 28.89 28.73 28.41 1.18 0.194

Total feed cost (`)/ bird 109.61d 107.93c 103.31b 98.30a 0.07 0.001

Cost of chicks (`) 15 15 15 15 - -

Bird selling rate (`) / kg 89 89 89 89 - -

Revenue ` / bird 174.44b 175.33b 181.56c 168.21a 1.05 0.001

Investment ` / bird 124.61c 122.93c 118.31b 113.30a 0.16 0.001

Net return/ profit (`) / bird 49.83a 52.40ab 63.25c 54.91b 0.05 0.001

% Profit from GLM 0.00a 5.16b 26.93d 10.19c 1.02 0.004

Benefit: cost ratio 1.40:1a 1.43:1ab 1.53:1c 1.48:1b 0.01 0.001

a,b,c,d Means with different superscripts within a row differ significantly (P<0.001)



149

treatment groups as compared to control group. The

lowest abdominal fat contents were obtained in T3

followed by T2and T

4, whereas, the highest abdominal

fat content was recorded in T1

group. Hafeni (2013)

also reported similar results related to fat content and

concluded that more than 5 g/kg of CT containing

A. karroo leaf meal should be supplemented in order

to achieve a significant reduction of fat deposition in

Cobb 500 broiler chickens. The reduction of fatness

has been associated with lower concentration of growth

hormone (GH) when the diets were sprayed with

polyethylene glycol. The GH increase nitrogen

retention and reduce fat deposition, with an increase in

fat turn over. The reason for the higher level in plasma

GH has been explained with a possible inactivation of

gut wall proteins by CT. The intestine weight in grams

and percent of live weight increased significantly

(P<0.05) as the GLM levels increased in the diets of

broiler chicks.

The intestine weights were significantly (P<0.05)

higher in T2, T

3 and T

4 groups than that of T

1 group. It

might be due to GLM supplemented diets takes more

time for digestion of feed as well as increase the length

of intestine compared to control group, therefore,

increase the weight of intestine in supplemented groups.

Comparable mean live weight and significantly (P<0.05)

higher lymphoid organs (thymus, bursa and spleen)

weights and their size were recorded in GLM

supplemented groups as compared to their counterpart

control group. Thus, the supplementation of GLM in

broiler diets significantly (P<0.05) increased lymphoid

organ weight and their size which might be due to

immune modulating properties of CT.

Data related to feed cost are presented in Table

5. At the end of feeding trial of 6 weeks, final body

weight (kg) was found to be highest in T3 group

followed by T1 and T

2 groups and the least final body

weight was recorded inT4 group, while final body

weights between T1

and T2 groups were statistically

similar. However, GLM supplementation significantly

(P<0.05) reduced total feed intake and total feed

cost per bird in T3 and T

4 groups as compared to

un-supplemented T1 group, while, total feed intake was

statistically non-significant between T1 and T

2 groups.

Although, feed cost (`) per kg diet among groups

did not differ significantly. As the level of GLM

supplementation increased the total feed intake and

total feed cost per bird decreased significantly (P<0.001).

The degree of reduction in the cost of total feed

consumed at the end of feeding trial of 6 weeks was

proportional to the amount of GLM in broiler diets. The

price of day-old chick was ` 15 per chick and the

selling rate of bird at the end of experiment of 6-weeks

was ` 89 per kg bird. Furthermore, revenue generated

in ` per bird as well as investment in ` per bird were

significantly (P<0.001) lower in GLM supplemented (T3

and T4) groups as compared to T

1 and T

2 groups, but

the revenue generated and investment were statistically

similar between T1 and T

2 groups. Dietary

supplementation of GLM significantly (P<0.001)

increased net return or profit per bird and benefit:

cost ratio in T2, T

3 and T

4 groups as compared to

un-supplemented T1 group. The net profit per bird and

benefit: cost ratio was found maximum in T3 followed

by T4, while, minimum net profit per bird and benefit:

cost ratio was recorded in T1 group, whereas T

2 has an

intermediate value between T1 and T

4 groups.

The net profit made in the present study ranged

from ` 49.83 to 63.25 per bird. As the level of GLM

increased percent profit increased significantly (P<0.004)

and the highest profit was obtained in T3 group which

clearly indicated that dietary supplementation of GLM

(2% of diet) improved productive performance and cost

effective partial replacer of costlier maize without any

deleterious effect on broiler production.

CONCLUSION

It may be concluded that dietary incorporation of

guava leaf meal (2 %) in broiler diet improved body

weight gain, FCR, lymphoid organs weights, and reduced

feed intake and abdominal fat content. Thus,

supplementation of guava leaf meal at 2% in the broiler

ration could be a better alternative in terms of

producing healthy low fat broiler meat.

Daing et al.


150

ACKNOWLEDGEMENT

First author is thankful to Hon’ble Vice

Chancellor and worthy Dean, FVSc & AH, SKUAST-

Jammu for providing necessary facilities to carry out

the MVSc research work.

REFERENCES

AOAC. 1995. Official Methods of Analysis (16th edn.).


Washington, DC.

AOAC. 2000. Official Methods of Analysis (16th edn.).


Washington, DC.

BIS. 1992. Bureau of Indian Standards. Requirements for

Chicken Feeds. IS 1374-1992. Manak Bhavan, 9,

Bhadursha Zafar Marg, New Delhi. pp. 1-3.

Cheng, F.C., Shen, S.C. and Wu, J.S.B. 2009. Effect of guava

(Psidium guajava L.) leaf extract on glucose uptake in

rat hepatocytes. J. Food Sci. 74: 132-138.

Daing, Mohd. Iqbal, Pathak, A.K., Bhat, Mohd. Altaf, and

Zargar and Mohd. Aqib 2017a. Antioxidant and

antibacterial potential of condensed tannins

containing tree leaves extract. Vet. Pract.18: 118-121.

Daing, Mohd. Iqbal, Pathak, A.K., Bhat, Mohd. Altaf, Sharma,

R. K. and Zargar, Mohd. Aqib 2017b. In vitro

antioxidant and antibacterial efficacy of condensed

tannins containing tree leaves extract of Jammu

Province. J. Anim. Res.7: 165-174.

Douglas, J.H., Gonzalez, N.J. and Beck, M.M. 1993.

Differential age response of turkeys to protein and

sorghum tannin levels. Poult. Sci. 72: 1944-1951.

El-Deek, A.A., Asar, M.A., Hamdy, S.M. and Abdalla, A.A.

2009. Utilization of guava by-products in broiler

finisher diets. Poultry Prod. Dept., Fac. of Agric.

Alexandria University, Alex. Egypt. Poult. Sci.29:

53-75.

Hafeni, S. 2013. Performance of broiler chickens fed pearl

millet as an energy source and Acacia karroo leaf

meal as an additive. M.Sc. Thesis, University of

Namibia.

Han, E.H., Hwang, Y.P., Choi, J.H., Yang, J. H. and Seo, J. K.

2011. Psidium guajava extract inhibits thymus and

activation-regulated chemokine (TARC/CCL17)

production in human keratinocytes by inducing heme

oxygenase-1 and blocking NF-κB and STAT1

activation. Environ. Toxicol. Pharmacol.32: 136-145.

Hassan, I.A., Elzuber, E.A. and Tinay, H.A. 2003. Growth and

apparent absorption of minerals in broiler chicks fed

diets with low or high tannins content. Trop. Anim.

Hlth. Prod. 35: 189-196.

Khan, Muzaffer, Pathak, A.K. and Singh, Surender 2019.

Nutrient metabolism, blood Indices and Immunity in

Haemonchus contortus infected goats fed condensed

tannins enriched densified complete feed blocks.

Anim. Nutr. Feed Technol. 19: 417-430.

Makkar, H.P.S. 2000. Quantification of tannins in tree foliage.

Joint FAO/IAEA working document, IAEA, Viena. Pp

1-26.

Pathak, A.K., Dutta, N., Banerjee, P.S. and Sharma, K. 2013b.

Effect of tannin extracts from tropical tree leaves on

larvae and adult Haemonchus contortus. Indian Vet.

J. 90: 32-34.

Pathak, A.K., Dutta, N., Banerjee, P.S., Pattanaik, A.K.

and Sharma, K. 2013a. Influence of dietary

supplementation of condensed tannins through leaf

meal mixture on nutrient intake, utilization and

performance of Haemonchus contortus infected sheep.

Asian-Australas. J. Anim. Sci.26: 1446-1458.

Pathak, A.K., Dutta, N., Pattanaik, A.K., Sharma, K., Banerjee,

P.S. and Goswami, T.K. 2017. Effect of condensed

tannins supplementation through Ficus infectoria and

Psidium guajava leaf meal mixture on erythrocytic

antioxidant status, immune response and gastro-

intestinal nematodes in lambs (Ovis aries). Vet.

Archiv.87: 139-156.

Pathak, A.K., Dutta, Narayan, Banerjee, P.S., Sharma, K. and

Pattanaik, A.K. 2013c. Efficacy of various condensed

tannins extracts from tanniferous tree leaves on egg

hatching inhibition of Haemonchus contortus. Vet.

Pract.14: 127-129.

Pathak, A.K., Dutta, Narayan., Banerjee, P.S., Goswami, T.K.

and Sharma, K. 2016. Effect of condensed tannins

supplementation through leaf meal mixture on

voluntary feed intake, immune response and worm

burden in Haemonchus contortus infected sheep. J.

Parasitic Dis.40: 100-105.

Pathak, A.K., Dutta, N., Pattanaik, A. K., Singh, A., Narang, A.


supplementation from tanniferous tree leaves on

methane production and efficiency of biomass

production in vitro. Anim. Nutr. Feed Technol. 15:

91-100.

Pauzenga, U. 1985. Feeding Parent Stock. Zootec. Int., pp.

22-24.

Qian, H., and Nihorimbere, V. 2004. Antioxidant power

ofphytochemicals from Psidium guajava. J. Zhejiang

Univ. Sci.5:676-683.

Rahman, Z., Siddique, M.N., Khatun, M.A., Kamruzzaman,



151

M. 2013. Effect of Guava (Psidium guajava) leaf meal

on production performances and antimicrobial

sensitivity in commercial broiler. J. Nat. Prod.6:

177-187.

Singh, S., Pathak, A.K., Sharma, R.K. and Khan, M. 2015.

Effect of tanniferous leaf meal based multi nutrient

blocks on feed intake, haematological profile, immune

response and body weight changes in Haemonchus

contortus infected goats. Vet. World 8: 572-579.


8th edn. East West Press Pvt. Ltd., New Delhi.

Talpatra, S.K., Ray, S.C. and Sen, K.C. 1940. Estimation of


potassium in foodstuffs. Indian J. Vet. Sci. Anim.

Husb.10: 243-258.

Daing et al.


Zargar Mohd. Aqib, Pathak, A.K. and Daing, Mohd. Iqbal

2017. Screening and evaluation of antioxidants and

anticoccidial properties of condensed tannins

containing tree leaves of Jammu province. Indian J.

Anim. Res.51: 1105-1112.

Zargar, Mohd. Aqib, Pathak, A.K., Sharma, R.K. and Daing,

Mohd. Iqbal 2016. Antioxidants and Anticoccidial

potential of aqueous extract from various tree leaves

containing condensed tannins. J. Anim. Res.6:

563-570.


152

Indian Journal of

Animal Nutrition

Effect of Feed Restriction and Garlic Supplementation on Growth

Performance, Nutrient Utilization and Meat Quality in Female Broiler

Vishavdeep Singh, Udeybir Singh* and A.P.S. Sethi

Department of Animal Nutrition,

Guru Angad Dev Veterinary and Animal Sciences University, Ludhiana-141 004, Punjab, India

ABSTRACT

An experiment was conducted to study the effects of feed restriction and garlic supplementation

on growth performance, nutrient utilization and meat quality in female broilers. In this study, 120, day-old

female broilers were randomly distributed into 5 treatment groups each having 4 replicates with 6 birds

in each replicate. Diets were formulated as per ICAR 2013 specifications and were fed in 3 phases. Treatment

T1 served as control. The other treatments comprised: T

2=T

1 with feed restriction (10-12 h) at 8-17 days of

age (DOA) with garlic supplementation, T3=T

1 with feed restriction at 8-17 DOA (10-12 h) without garlic

supplementation, T4=T

1 with feed restriction at 18-27 DOA (10-12 h) with garlic supplementation, T

5=T

1 with

feed restriction at 18-27 DOA (10-12 h) without garlic supplementation. Early feed restriction (8-17 DOA)

without garlic supplementation reduced (P<0.05) the average body weight gain at 2nd and 3rd weeks of age.

Garlic supplementation and late feed restriction (from 18-27 DOA) reduced (P<0.05) the average body weight

gain at 4th week of age. Significantly (P<0.05) reduced average feed intake was observed in birds subjected

to early feed restriction (8-17 DOA) with garlic (T2) and without garlic (T

3) at 2nd and 3rd week of age as

compared to control (T1). There was no significant effect on feed conversion ratio (FCR) of early and late feed

restriction with or without garlic supplementation expect at 5th week of age where FCR was observed to be

better (P<0.05) in T4 group of birds with late feed restriction and garlic supplementation as compared to control

(T1) and late feed restriction without garlic supplementation (T

5). Early and late feed restrictions with

garlic supplementation (T2 and T

4) resulted in significantly (P<0.05) higher crude protein and organic matter

metabolizability as compared to control (T1. Garlic supplementation with early and late feed restriction (T

2

and T4) improved meat quality, had significantly (P<0.05) better color and appearance, odour, texture, juiciness

as well as overall acceptability than the control (T1). It was concluded that early feed restriction without

garlic supplementation reduced the feed intake at 2nd and 3rd week of age and improved meat quality.

Key words: Female birds, Feed restriction, Garlic supplementation, Meat quality, Nutrient retention


INTRODUCTION

Poultry industry is one of the major industries

that are supporting the nutrient supply of the huge

population of the world. As we know feed contributes

about 70 percent cost of poultry production. But if

feed is offered ad-libitum, it is unfortunately

accompanied by certain ill-effects like high metabolic

rate, high mortality, and skeletal defects. Feed

restriction is a method of feeding in which the time or

duration or amount of feed is limited and had significant

effect on the subsequent ability of broilers to recover

from a growth defect. Male broilers have a greater ability

to exhibit compensatory growth following a period of

under nutrition than females (McMurtry et al., 1988,

Plavnik and Hurwitz 1991).


doi: 10.5958/2231-6744.2020.00025.0

At the present time, there is increasing pressure

to reduce or eliminate the use of antibiotics in poultry

feed and to look for alternative growth promoters

like garlic. The major active ingredients in garlic are

allicin, ajoene, dialkyl polysulphides, s-allylcysteine and

it also possesses at least 33 sulphur containing

compounds, several enzymes, amino acid and minerals.

Supplementation of garlic powder at 1.5% gave best

response in terms of growth performance (Singh et al.,

2015). Though both feed restriction and garlic

supplementation have a beneficial effect on broiler

performance but synergistic effect of feed restriction

without or with garlic supplementation in female birds is

still to be studied. So, this study was conducted to

assess the effect of feed restriction along with garlic


153

supplementation on performance of broilers.


The present investigation was carried out to study

the effect of feed restriction and garlic supplementation

in female broilers at the Department of Animal

Nutrition, GADVASU, Ludhiana, Punjab. One hundred

and twenty female, day-old meat type chicks (IBL-80)

were distributed randomly into 5 groups having total 24

birds per treatment with 4 replicates having 6 chicks in

each replicate representing different treatments which

were as follows: T1 - Control group fed ad libitum as

per ICAR specification i.e. starter diet (22% CP and

3000 kcal/kg ME), grower diet (21.5% CP and 3050

kcal/kg ME) and finisher diet (19.5% CP and 3100 kcal/

kg ME). The other treatments were T2=T

1 with feed

restriction at 8-17 DOA (10-12 h) with garlic

supplementation, T3=T

1 with feed restriction at

8-17 DOA (10-12 h) without garlic supplementation,

T4=T

1 with feed restriction at 18-27 DOA (10-12 h)

with garlic supplementation, and T5=T

1 with feed

restriction at 18-27 DOA (10-12 h) without garlic

supplementation. The percent ingredient composition of

rations fed the three phases that was kept were

formulated to meet nutrient requirements as per ICAR

(2013) specifications is presented in Table-1. The

feeders were removed for 10-12 hours during 8 PM. to

8 AM. (next day) to apply feed restriction.

A metabolic trial of three days collection period

was conducted at the end of experiment. Four birds of

comparable body weight were selected from each

treatment and were housed in battery brooders. There

were 2 replicates of each treatment having 2 birds in

each replicate. All the faecal collection trays and

feeding trays were cleaned properly to start the

metabolic evaluation. After adaptation period of five days

the measured quantity of feed for three consecutive days

was offered to each replicate both in the morning and

evening. The residual feed left was removed on 4th day

and weighed to record the actual consumption of feed

for each replicate. The excreta voided by each

replicate were collected daily in the morning and

weighed. A separate aliquot was collected in 25 ml of

10 % sulphuric acid to avoid nitrogen loss. Excreta Ta

ble

1:

Perc

en

t in

gre

die

nt

co

mp

osi

tio

n o

f ex

perim

en

tal

die

ts

Ing

red

ien

tsS

tart

er p

ha

seG

row

er p

ha

seF

inis

her p

ha

se

(kg

/10

0 k

g)

T1

T2

T3

T4

T5

T1

T2

T3

T4

T5

T1

T2

T3

T4

T5

Mai

ze54.8

554.3

554.8

554.3

554.8

557.0

57.0

57.0

57.0

57.0

57.0

57.0

57.0

57.0

57.0

Soybea

n M

eal

33.5

33.5

33.5

33.5

33.5

27.0

27.0

27.0

27.0

27.0

27.0

27.0

27.0

27.0

27.0

Gro

undnut E

xtr

acti

on

4.5

4.0

4.5

4.0

4.5

4.0

4.0

4.0

4.0

4.0

4.0

4.0

4.0

4.0

4.0

De-

oil

ed R

ice

Bra

n1.0

0.5

1.0

0.5

1.0

5.0

3.5

5.0

3.5

5.0

5.0

3.5

5.0

3.5

5.0

Gar

lic

-1.5

-1.5

--

1.5

-1.5

--

1.5

-1.5

-

Oil

2.5

2.5

2.5

2.5

2.5

3.5

3.5

3.5

3.5

3.5

3.5

3.5

3.5

3.5

3.5

Di-

calc

ium

Phosp

hat

e1.5

1.5

1.5

1.5

1.5

1.9

1.9

1.9

1.9

1.9

1.9

1.9

1.9

1.9

1.9

Lim

esto

ne

Po

wd

er1.5

1.5

1.5

1.5

1.5

1.0

1.0

1.0

1.0

1.0

1.0

1.0

1.0

1.0

1.0

Met

hio

nin

e (g

)150

150

150

150

150

100

100

100

100

100

100

100

100

100

100

Sal

t (g

)300

300

300

300

300

300

300

300

300

300

300

300

300

300

300

Addit

ives

*(g

)200

200

200

200

200

200

200

200

200

200

200

200

200

200

200

To

tal

(Kg

)100

100

100

100

100

100

100

100

100

100

100

100

100

100

100

*A

ddit

ives

incl

ude

vit

amin

A 8

,25,0

00 I

U, v

itam

in D

3 1

,20,0

00 I

U/,

vit

amin

K 1

00 m

g, r

ibofl

avin

500 m

g, t

hia

min

e 80 m

g, p

yri

doxin

e 160 m

g, v

it e

800 m

g, c

yan

oco

bal

amin

e 100 m

cg,

nia

cin 1

200 m

g, c

alci

um

pan

toth

enat

e 80 m

g, m

angan

ese

sulp

hat

e 25 g

, fer

rous

sulp

hat

e 10 g

, copper

sulp

hat

e 500m

g, z

inc

oxid

e 8g p

ota

ssiu

m iodid

e 100 m

g, c

occ

idio

stat

60 g

.

Singh et al.


154

restrictions with or without garlic supplementation (T2

and T3) reduced the feed intake at 2nd and 3rd week of

age. However, in late feed restrictions with or without

garlic supplementation (T4 and T

5) the average feed

intake remained unaffected. Significant (P<0.05)

reduction in feed intake due to feed restrictions was

reported by Mehmood et al. (2013). Also, feed intake

was significantly reduced due to duration of restriction

and level of restriction (Omosebi et al., 2014). But,

Saber et al. (2011) and Afsharmanesh et al. (2016)

observed non-significant feed intake due to feed

restriction in their respective studies.

There was no significant difference in feed

conversion ratio from 1st to 4th week of age. But at 5th

week of age, T4 group of birds with late feed restriction

and garlic supplementation had significantly (P<0.05)

better feed conversion ratio as compared to control (T1)

and late feed restriction without garlic supplementation

(T5). Malpotra et al. (2017) and Omosebi et al. (2014)

had reported (P<0.05) better FCR with feed

restrictions. But, Sidhu et al. (2017) and Saber et al.

(2011) did not found any significant effects of feed

restrictions on FCR. Earlier research workers (Raeesi

et al., 2010; Patel et al., 2017; Ratika et al., 2018)

reported better FCR in garlic powder supplemented

groups. But, Onibi et al. (2009) did not found any

significant difference in FCR in garlic supplemented

broilers.

There was no significant difference in PER due

to early and late feed restriction with or without garlic

supplementation in different weeks of age from 1st to

5th week of age. Garlic supplementation in early and

late feed restrictions had no significant effect on protein

efficiency ratio. However, in overall period, PER was

numerically higher in feed restricted groups and garlic

supplemented groups (T2 and T

4) as compared to

control (T1). Sidhu et al. (2017) and Butzen et al. (2015)

reported no significant differences in PER during

different phases due to feed restrictions. Ratika et al.

(2018) reported that PER was significantly (P<0.05)

better in garlic supplemented groups than the control

group. But, PER was significantly (P<0.05) higher in

feed restricted group during 2nd week and fourth week;

collected for three consecutive days of each replicate

were mixed properly. The sample of excreta after

drying at 80°C were grounded and analyzed for various

proximate parameters (AOAC, 2005). The protein

(PER) and calories efficiency ratio (CER) were

calculated using standard procedures. Meat samples

from sacrificed birds were sent to Department of

Livestock Products and Technology, GADVASU where

sensory evaluation was conducted by expert panel of 7

analysts on 8-point Hedonic scale. The data collected in

the experiment were subjected to statistical analysis using

one-way ANOVA using Software Package for Social

Sciences (SPSS, version 22.0).


The data pertaining to effect of feed restriction

and garlic supplementation on growth performance in

female broiler is presented in Table 2. Early feed

restriction without garlic supplementation (T3)

significantly (P<0.05) reduced the average body weight

gain at 2nd and 3rd week of age as compared to control

(T1). But, early feed restrictions with garlic

supplementation (T2) had no significant difference as

compared to control (T1) at 2nd and 3rd week of age.

Early feed restrictions with garlic supplemented group

(T2) had significantly (P<0.05) better results as

compared to late feed restrictions without garlic

supplementation (T5) at 4th week of age. There was no

significant effect of garlic supplementation and feed

restriction at 1st and 5th week of age. Significantly

(P<0.05) reduced average body weight gain due to feed

restriction was reported by Malpotra et al. (2017),

Omosebi et al. (2014) and Zhan et al. (2007).

Significantly (P<0.05) reduced average feed

intake was observed in early feed restriction (8-17 DOA)

with garlic (T2) and without garlic (T

3) at 2nd and 3rd

week of age as compared to control (T1). Irrespective

of age late feed restrictions (18-27 DOA) with or

without garlic (T4 and T

5) had no significant effect on

average feed intake as compared to control (T1).

However, late feed restrictions with or without garlic

supplementations (T4 and T

5) had significantly (P<0.05)

reduced average feed intake as compared to T2 at

4th week of age. It was indicated that early feed


155

similarly improved PER due to feed restriction during

4th week was reported by Malpotra et al. (2017).

Overall (P<0.05) improved protein feed efficiency due

to feed restrictions followed by compensatory growth

was reported by Al-Taleb (2003).

There was no significant difference in CER due

to early and late feed restriction with or without garlic

supplementation in different weeks of age from 1st to

5th week of age. Sidhu et al. (2017) also reported no

significant difference in the CER due to feed

restrictions. But, Malpotra et al. (2017) observed that

feed restriction during 2nd week gave significantly

(P<0.05) higher value of CER during 2nd week and 4th

week, CER was found significantly (P<0.05) lower

during fourth week in feed restricted groups; but during

5th week, feed restricted groups gave significantly

better value. Saleh et al. (2005) also reported (P<0.05)

improved calorie efficiency ratio following feed

restrictions. But, effect of garlic supplementation in early

and late feed restrictions in female broiler is not

Table 2. Effect of feed restriction and garlic supplementation on growth performance in female broilers

Period Treatment groups S.E.M

T1

T2

T3

T4

T5

Average body weight gain

1st week 84.47 85.95 83.37 84.41 82.63 0.813

2nd week 149.87a 139.437ab 132.54b 150.41a 148.93a 2.077

3rd week 222.35ab 216.79ab 214.75b 224.77a 221.89ab 1.395

4th week 247.77ab 252.14a 248.41ab 244.22ab 243.33b 1.278

5th week 320.29 325.72 318.22 326.16 321.82 1.562

Average feed intake

1st week 144.37 142.32 140.25 141.55 137.88 1.051

2nd week 257.56a 229.36b 229.40b 252.98a 253.78a 2.328

3rd week 414.794a 399.146b 403.225b 418.61a 420.35a 1.643

4th week 492.792ab 497.40a 492.208ab 486.77b 484.72b 1.524

5th week 776.5 779.57 787.57 773.25 785.52 1.837

Feed conversion ratio

1st week 1.70 1.65 1.68 1.67 1.66 0.193

2nd week 1.71 1.64 1.73 1.68 1.70 0.195

3rd week 1.86 1.84 1.87 1.86 1.89 0.184

4th week 1.98 1.97 1.98 1.99 1.99 0.183

5th week 2.42a 2.39ab 2.47a 2.37b 2.44a 0.202

Protein efficiency ratio

1st week 2.64 2.73 2.69 2.69 2.71 0.1

2nd week 2.63 2.75 2.61 2.69 2.65 0.102

3rd week 2.50 2.53 2.48 2.50 2.46 0.091

4th week 2.59 2.61 2.60 2.58 2.58 0.09

5th week 2.14 2.17 2.11 2.17 2.13 0.109

Calorie efficiency ratio

1st week 0.195 0.201 0.198 0.199 0.200 0.054

2nd week 0.194 0.203 0.193 0.198 0.196 0.042

3rd week 0.175 0.178 0.174 0.176 0.173 0.074

4th week 0.162 0.163 0.163 0.162 0.162 0.041

5th week 0.134 0.136 0.132 0.136 0.133 0.042

*a,bValues with different superscripts differ significantly (P≤0.05) within each row

Singh et al.


156

available in the literature.

Data pertaining to effect of feed restriction and

garlic supplementation on nutrient utilization and meat

quality in female broiler is presented in Table 3. Early

and late feed restrictions with garlic supplementation

(T2 and T

4) gave significantly (P<0.05) higher apparent

metabolizability of organic matter and N retention as

compared to control (T1). There was no significant

difference in apparent retention of calcium and

phosphorus due to early and late feed restriction with or

without garlic supplementation. But, Teeter and Smith

(1985) reported that feed restriction increased nutrient

digestibility. However, significantly (P<0.05) lower value

for phosphorus retention were observed in third week

of restrictions as compared to second week of

restrictions as reported by by Malpotra et al. (2017).

Singh et al. (2017) reported significantly (P<0.05) higher

calcium in garlic supplemented diets but dry matter

metabolizability, ether extract digestibility, percent

nitrogen and phosphorus retention remained unaffected.

Sidhu et al. (2017) reported significant (P<0.05) increase

in digestibility coefficients of ether extract in feed

restricted groups.

Data pertaining to meat quality parameters

revealed that garlic supplementation with early and late

feed restriction (T2 and T

4) had significantly (P<0.05)

better color and appearance, odour, texture, juiciness

and as well as overall acceptability of meat than the

control (T1). Similarly, Singh et al. (2015) reported that

supplementation of whole bulb garlic powder at 1.0, 1.5

and 2.0 % supplementation levels lead to significantly

(P<0.05) better appearance and color, flavour,

tenderness, juiciness and overall acceptability of chicken

meat. Kim et al. (2009) also observed positive

influence of garlic supplementation on culinary traits of

poultry meat. Malpotra et al. (2017) reported that odour

was unaffected by feed restriction while colour,

texture, juiciness and overall acceptability were

significantly (P<0.05) beter during 2nd week feed

restriction. It showed that garlic supplementation was

useful in enhancing the quality of the meat of female

birds.

CONCLUSIONS

From the study it was concluded that early feed

restriction without garlic supplementation significantly

reduced the average body weight gain and average feed

intake at 2nd and 3rd week of age in female birds. Late

feed restriction and garlic supplementation had better

feed conversion ratio at 5th week of age. Garlic

supplementation with early and late feed restriction

improved colour and appearance, odour, texture,

juiciness and as well as overall acceptability meat.

ACKNOWLEDGEMENTS

The authors acknowledge the help rendered by

faculty of Department of Livestock Products and

Table 3. Effect of feed restriction and garlic supplementation on nutrient digestibility and meat quality in

female broilers

Variables Treatments S.E.M.

T1

T2

T3

T4

T5

Nutrient utilization

N retained (% intake) 60.69b 64.10a 60.31b 63.87a 60.16b 0.832

AMOM (%) 70.54b 75.70a 70.68b 74.54a 69.58b 0.757

Ca retained (% intake) 48.63 48.70 48.41 48.68 48.46 0.212

P retained (% intake) 46.12 46.17 45.90 46.19 45.95 0.378

Meat quality

Color and Appearance 7.07b 7.46a 7.14b 7.34a 7.09b 0.131

Odour 6.75b 7.41a 6.72b 7.35a 6.79b 0.127

Texture 6.97b 7.14a 6.84b 7.09a 6.93b 0.146

Juiciness 7.14b 7.41a 6.94b 7.35a 6.97b 0.138

Overall acceptability 6.96b 7.35a 6.91b 7.24a 6.88b 0.144

*a,bValues with different superscripts differ significantly (p≤0.05) within each row


157

Technology, GADVASU for sensory evaluation of meat

samples.

REFERENCES

Afsharmanesh, M., Lotfi, M. and Mehdipour, Z. 2016. Effects

of wet feeding and early feed restriction on blood

parameters and growth performance of broiler

chickens. Anim. Nutr. 2: 168-172.

Al-Taleb, S.S. 2003. Effect of an Early Feed Restriction of

Broiler’s on Productive Performance and Carcass

Quality. Online J. Biol. Sci. 3: 607-611.

AOAC, 2005. Officials Methods of Analysis. 18th rev. edn.

Association of Official Analytical Chemists,

Arlington, Virginia, USA.

Butzen, F.M., Vieira, M.M., Kessler, A.M., Aristimunha, P.C.,

Marx, F.R., Bockor, L. and Ribeiro, A.M.L. 2015. Early

feed restriction in broilers. II: Body composition and

nutrient gain. J. Appl. Poult. Res. 24: 198-205.

ICAR. 2013. Nutrient Requirements of Animals - Poultry

(ICAR-NIANP) 3rd edition. Krishi Bhawan. New Delhi.

Kim, Y.J., Jin, S.K. and Yang, H.S. 2009. Effect of dietary

garlic bulb and husk on the physicochemical

properties of chicken meat. Poult. Sci. 88: 398-405.

Malpotra, K., Singh, U. and Sethi, A.P.S. 2017. Effects of

feed restriction and additional fat supplementation

on chemical composition and sensory evaluation

of broiler’s meat. Indian J. Poult. Sci. 52: 327-31.

McMurtry, J.P., Rosebrough, R.W., Plavnik, I. and Cartwright,

A.I. 1988. Influence of early plane of nutrition on

enzyme systems and subsequent tissue deposition.

In: Biomechanisms Regulating Growth and

Development (G. L. Steffens and T. S. Rumseyed).

Betsville Symposia Agric. Res. 329-341.

Mehmood, S., Sahota, A.W., Akram, M., Javed, K., Hussain,

J., Sharif, H. and Jatoi, A.S. 2013. Influence of feed

restriction regimes on growth performance of broilers

with different initial weight categories. J. Anim. Plant

Sci. 26: 1522-1526.

Onibi, G.E., Adebisi, O.E. and Fajemisin, A.N. 2009. Response

of broiler chickens in terms of performance and meat

quality to garlic (Allium sativum) supplementation.

Afr. J. Agric. Res. 4: 511-517.

Omosebi, D.J., Adeyemi, O.A., Sogunle, O.M., Idowu, O.M.O.

and Njoku, C.P. 2014. Effects of duration and level

of feed restriction on performance and meat quality

of broiler chickens. Arch. de Zoote. 63: 611-621.

Patel, R.M., Garg, D., Patel, V.R., Vahora, S., Raval, A. and

Choubey, M. 2017. Effect of dietary supplementation

of garlic (Allium sativum) and fenugreek (Trigonella

foenum-graecum) seed powder on growth

performance, carcass characteristics and economics

of feeding in broilers. J. Anim. Res. 7: 313-318.

Plavnik, I. and Hurwitz, S. 1991. Response of broiler chickens

and turkey poults to food restriction of varied severity

during early life. Br. Poult. Sci. 32: 343-52.

Raeesi, M., Hoeini-Aliabad, S.A., Roofchaee, A., Zare

Shahneh, A. and Pirali, S. 2010. Effect of periodically

use of garlic (allium sativum) powder on performance

and carcass characteristics in broiler chickens. World

Acad. Sci. Eng. Technol. 68: 1213-1219.

Ratika, K., Singh, R.J. and Singh, R.K. 2018. Effect of garlic

(Allium sativum) and turmeric (Cucurma longa)

powder supplementation on blood parameters of starter

and finisher growth phase of broilers. Int. J. Pure Appl.

Biosci. 6: 562-567.

Saber, S.N., Maheri-Sis, N., Shaddel-Telli, A., Hatefinezhad,

K., Gorbani, A. and Yousefi, J. 2011. Effect of feed

restriction on growth performance of broiler chickens.

Ann. Biol. Res. 2: 247-252.

Saleh, E.A., Watkins, S.E., Waldroup, A.L. and Waldroup, P.W.

2005. Effects of early quantitative feed restriction on

live performance and carcass composition of male

broilers grown for further processing. J. Appl. Poult.

Res. 14: 87-93.

Sidhu, N.S., Singh, U., Sethi, A.P.S., Hundal, J.S., Lamba, J.S.

and Sharma, A. 2017. Effect of black pepper and jaggery

supplementation with or without feed restriction on

broilers performance. J. Anim. Res. 7: 903-12.

Singh, J., Sethi, A.P.S., Sikka, S.S., Chatli, M.K. and Kumar, P.

2015. Effect of sun dried whole bulb garlic powder on

growth, carcass characteristics and meat quality of

commercial broilers. Indian J. Anim. Sci. 85: 67-71.

Singh, J., Sharma, M., Singh, N.D., Kaur, P., Sethi, A.P.S. and

Sikka, S.S. 2017. Effect of sun dried whole bulb garlic

powder on nutrient utilization, blood parameters,

duodenum morphology and faecal microbial load in

broiler chickens. Indian J. Anim. Sci. 87: 195-198.

Teeter, R.G. and Smith, M.O. 1985. Feed intake effects upon

gain, carcass yield, and ration digestibility in broilers

force fed five feed intakes. Poult. Sci. 64: 2155-2160.

Zhan, X.A., Wang, M., Ren, H., Zhao, R.Q., Li, J.X. and Tan,

Z.L. 2007. Effect of early feed restriction on metabolic

programming and compensatory growth in broiler

chickens. Poult. Sci. 86: 654-660.

Singh et al.



158

Indian Journal of

Animal Nutrition

Effect of Eugenia jambolana and Psidium guajava Leaf Meal Mixture

Supplementation on Antioxidant Indices and Immune Responses

in Broiler Chicks

M.A. Zargar, A.K. Pathak*, R.K. Sharma and M.I. Daing

Division of Animal Nutrition, Faculty of Veterinary Sciences & AH,

Sher-e-Kashmir University of Agricultural Sciences and Technology of Jammu,

R.S. Pura, (J & K), India

ABSTRACT

This experiment was conducted to study the effect Eugenia jambolana and Psidium guajava leaf meal

mixture (LMM) supplementation on antioxidant and immune indices of broilers. One-hundred-and-twenty

day-old unsexed broiler chicks were randomly distributed into 4 groups of 30 birds per treatment, each

having 3 replicates (10 chicks / replicate) in an experiment based on completely randomized design (CRD).

All the birds were fed standard rations to meet their nutrient requirements. Rations of the birds of groups T1, T

2,

T3 and T

4 were supplemented with LMM at 0, 2.5, 5.0 and 7.5 % of diet, respectively. Feed intake during 0-3,

4-6 and 0-6 weeks were significantly (P<0.05) higher in T1 followed by T

2, T

3 and least in T

4 groups. Weight

gain during 0-3, 4-6 and 0-6 weeks of broiler chicks were significantly (P<0.05) higher in T1 as compared to

T2, T

3 and T

4 groups. Feed conversion ratio (FCR) during 0-3 weeks among groups was statistically non-

significant (P<0.05), while, at 4-6 weeks, it was found to be lowest in T4, whereas, during 0-6 weeks FCR was

significantly (P<0.05) lower in T1 than that of other groups. LMM supplementation decreased (P<0.068)

average body weight during metabolism trial in T4 than that of T

1 group. Nitrogen (N) intake and retention were

significantly (P<0.021, P<0.001) lower and N excretion was significantly higher (P<0. 006) in T3 and T

4 than

that of T1 and T

2. Mean haemoglobin and packed cell volume were significantly (P<0. 034, P<0.002) higher in T

1

and T2 than that of T

3 and T

4. The LMM supplemented groups showed better antioxidant indices (P<0.05), cell

mediated (P<0.05) and humoral immune responses (P<0.05) as compared to control. It was concluded that LMM

supplementation (2.5 %) improved antioxidant status, immune response and growth performance of broiler

chicks.

Key words: Antioxidant indices, Broilers, Immune response, Leaf meal mixture

*Corresponding author; Email: [email protected], Assistant Professor (SS), Division of Animal Nutrition, Faculty of Veterinary

Sciences & AH, SKUAST-Jammu-181102, India

INTRODUCTION

Phytogenic feed additives are the products of

plant origin used in livestock and poultry feeding as non-

nutritive compounds to improve their nutritional and

health status, and their productive performance. Now a

days, application of these phytogenic feed additives in

the ration of poultry gained importance due to the ban

of synthetic drugs as growth promoters by European

Union (Windisch et al., 2008). Leaf meal (LM) and/

or leaf meal mixture (LMM) of Eugenia jambolana

and Psidium guajava containing plant secondary

metabolites (PSMs) especially condensed tannins (CT)

are promising alternatives to synthetic drugs in the

poultry ration. The CT’s are naturally occurring water


doi: 10.5958/2231-6744.2020.00026.2

soluble poly-phenolic compounds with varying

molecular weight. Presence of large number of

phenolic hydroxyl groups in CTs enables them to show

the beneficial effects (Pathak, 2013; Pathak et al.,

2013a,b,c; Pathak et al., 2016, 2017). Possible

mechanisms of antioxidant activity of CT are free

radical scavenging activity, chelation of transition

metals and inhibition of pro-oxidative enzymes (Decker,

1997). Condensed tannins are also known to prevent

superoxide formation and lipid peroxidation (Pathak,

2013; Pathak et al., 2017). Additionally, LMM are good

source of various nutrients and excellent source of

antioxidants (Atawodi et al., 2013; Zargar et al., 2016;

Zargar et al., 2017; Pathak et al., 2017).


159

To date, some tree leaves and their extracts have

been evaluated for possible antimicrobial, anti-parasitic

and antioxidant activities (Daing et al., 2017a; Daing et

al., 2017b; Pathak et al., 2013; Pathak et al., 2014;

Zargar et al., 2016; Zargar et al., 2017) and compounds

isolated from LMM have shown great potential against

infectious agents such as pathogenic bacteria,

gastrointestinal nematodes and coccidian spp., etc.

Psidium guajava (PS) is used as a traditional medicine

in all over the world. It is traditionally used to treat

diarrhoea and dehydration, gastroenteritis, dysentery,

stomach pain, diabetes mellitus, and wounds.

In addition, PS showed anthelmintic, antioxidant,

antibacterial, anti-inflammatory properties as well as

growth promoting potential.

Eugenia jambolana, commonly known as black

plum or Jamun is an important medicinal plant. The

leaves are potential source CTs. Different parts of the

Eugenia jambolana are also reported for anthelmintic,

antioxidant, anti-inflammatory, neuro-psycho-pharma

cological, anti-microbial, anti-bacterial, and antifugal,

nitric oxide scavenging, free radical scavenging,

anti-diarrheal, anti-fertility, gastro-protective, anti-

ulcerogenic and radio-protective activities. Keeping all

these points in view, the present study was planned to

investigate the dietary incorporation of graded level of

tanniferous LMM comprising of Eugenia jambolana

and Psidium guajava on antioxidants indices, immune

status and growth performance of broiler chickens.


The experimental study was conducted in the

Division of Animal Nutrition, Faculty of Veterinary

Sciences & AH, Sher-e-Kashmir University of

Agricultural Sciences and Technology of Jammu, R.S.

Pura, Jammu. Fresh leaves of Eugenia jambolana and

Psidium guajava were harvested from Faculty

premises of R.S. Pura, Jammu. Both tree leaves were

air-dried in the shed for 12-15 days. The dried tree

leaves of Eugenia jambolana and Psidium guajava

were milled in the laboratory hammer mill. The ground

tree leaves were thoroughly mixed in proper ratio (50:50)

on the cemented floor and suitable LMM was prepared

for in-vivo trial.

A total of 120 day-old unsexed and healthy

commercial broiler chicks of Cobb-K strains were

purchased from Kashmir Valley Poultry Breeding Farm

and Hatchery, Jammu They were randomly distributed

into four dietary treatment groups (T1, T

2, T

3 and T

4) of

30 birds per group, and brooded on a partitioned deep

litter house at the experimental site. Each group was

sub-divided into three replicates of 10 birds per

replicate in an experiment based on CRD. On arrival

chicks were given water and feed ad libitum, small

amount of feed was sprinkled on papers inside brooding

area for easier consumption and recognition of feed by

chicks up to ten days of age. Temperatures were kept

at 32oC for the first 7 days. Water and respective diets

were supplied ad libitum i.e. birds in T1 group were

given control diet (0% LMM) to meet their nutrient

requirements, while the birds in T2, T

3 and T

4 groups

were given diet containing LMM of Eugenia jambolana

and Psidium guajava at 2.5, 5.0 and 7.5 %,

respectively. Broiler starter and finisher diets were

prepared as per BIS (1992). Ingredient and chemical

composition of experimental diets are presented in the

Table 1.

The parameters measured were feed intake, body

weight gain, FCR, haematological profile, antioxidant

indices and immune response of broiler birds. Daily feed

intake per bird was calculated every morning by

subtracting the amount of feed left in the feeding trough

from what was offered the previous day and then

dividing it by the number of birds in the replicate. Chicks

in a pen were weighed individually with a digital

weighing scale and the previous weight was subtracted

from the current weight to determine the body weight

gain per bird for the week. FCR was calculated by

dividing the feed consumed by the live weight gain.

Samples of tree leaves, LMM, feed offered and

residue left were analyzed for various proximate

principles viz., dry matter (DM), organic matter (OM),

crude protein (CP), ether extract (EE), nitrogen-free

extract (NFE) and total ash as per AOAC (1995) and

calcium (Talapatra et al., 1940) and phosphorus (AOAC,

2000). Excreta samples were analysed for N, Ca and P.

Zargar et al.


160

The CT content of tree leaves and LMM was estimated

by using butanol-HCl method (Makkar, 2000).

Metabolizable energy (ME) values of experimental

diets were calculated according to the formula given by

Pauzenga (1985).

Blood samples were collected from each bird at

the time of slaughter. Two birds were randomly selected

from each replicate for bleeding and slaughter. Out of 6

ml of blood, about 2.0 ml of blood was collected into

labelled sterile universal bottles containing ethylene-

diamine-tetra-acetic acid (EDTA) at 1 mg/ml of blood

as anticoagulant for estimating haematological profile.

Hemoglobin (Hb) and packed cell volume (PCV) were

estimated in whole blood immediately after the

collection of blood by cyanomethhaemoglobin method

(Dacie and Lewis, 1969) and Wintrobe’s tube (Jain,

1986), respectively. Another 2 ml of blood was collected

in tubes containing acid citrate dextrose (ACD) at 1.5

ml/10 ml blood as anticoagulant, centrifuged at 2000 rpm

for 15 min at 4°C, followed by separation of plasma and

Table 1. Ingredients and chemical composition of experimental broiler diets

Attributes Experimental diets

Broiler starter diets Broiler finisher diets

T1

T2

T3

T4

T1

T2

T3

T4

Ingredient composition (%)

Maize 51.00 48.50 46.00 43.50 57.00 54.50 52.00 49.50

Rice polish 3.75 3.75 3.75 3.75 6.50 6.50 6.50 6.50

Soybean meal 35.00 35.00 35.00 35.00 27.50 27.50 27.50 27.50

MBM 5.00 5.00 5.00 5.00 4.00 4.00 4.00 4.00

Soybean oil 1.75 1.75 1.75 1.75 2.00 2.00 2.00 2.00

DCP 1.16 1.16 1.16 1.16 1.00 1.00 1.00 1.00

LSP 1.00 1.00 1.00 1.00 0.70 0.70 0.70 0.70

Salt 0.40 0.40 0.40 0.40 0.40 0.40 0.40 0.40*Premix 0.47 0.47 0.47 0.47 0.45 0.45 0.45 0.45

Lysine 0.31 0.31 0.31 0.31 0.30 0.30 0.30 0.30

Methionine 0.16 0.16 0.16 0.16 0.15 0.15 0.15 0.15

LMM 0.00 2.50 5.00 7.50 0.00 2.50 5.00 7.50

Chemical composition (% DM)

OM 92.55 92.43 92.11 91.99 92.14 92.08 91.97 91.88

CP 22.93 22.83 22.97 23.07 20.01 20.13 19.81 19.80

EE 4.45 4.40 4.23 4.64 5.04 5.12 5.22 5.07

CF 4.42 4.53 4.69 4.82 4.63 4.38 4.72 4.83

NFE 60.75 60.67 60.22 59.46 62.46 62.45 62.20 62.18

Total ash 7.45 7.57 7.89 8.01 7.86 7.92 8.03 8.12

AIA 2.43 2.61 2.78 2.92 2.50 2.43 2.76 2.91

Calcium 1.67 1.64 1.77 1.83 1.73 1.56 1.83 1.77

Phosphorus 0.76 0.77 0.73 0.70 0.69 0.67 0.63 0.61

ME (KcalKg-1) 2818 2790 2762 2734 2925 2897 2869 2841

CT (% of diet) 0.0 0.18 0.37 0.53 0.0 0.19 0.39 0.54

*Premix (vitamins &minerals) added at the rate of 470 g/100 kg feed which contained: vitamin A, 5000 IU; vitamin D, 1000 IU, vitamin E, 10

mg; vitamin K, 850 mg; vitamin B1, 600 mg; vitamin B2, 2 mg; vitamin B6, 1.8 mg; vitamin B12, 4 mcg; niacin, 1.2 mg; folic acid, 2 mg; d

pantothenic acid, 3.2 mg, Cu, 2.6 mg; Mn, 19.2 mg; Zn, 16 mg; Se, 0.45 mg; Fe, 9.5 mg; Co, 0.25 mg and I, 0.55 mg

Antioxidant indices and immune response broiler chicks fed LMM


161

buffy coat. The resulting erythrocyte pellet was washed

thrice with 250 mOsm/litre (pH-7.4) of phosphate

buffered saline (PBS) as per Yagi et al. (1989) to

determine the various antioxidant enzymes activity, while

remainder of about 2 ml of blood sample was collected

in sterile centrifuge tube for collection of serum to

determine humoral immune response against previously

sensitized birds with sheep RBC (SRBC) as antigen.

Various antioxidant indices viz. reduced

glutathione (GSH; µ mol/mg Hb), glutathione-

S-transferase (GST; µ mol/mg Hb), super oxide dismutase

(SOD; U/mg Hb), catalase (Cat; U/mg Hb), lipid

peroxidise (LPO; µ mol/mg Hb), total-thiol (T-SH; µ

mol/ml), protein-thiol (TP-SH; µ mol/mg Hb) and

non-protein thiol groups (NP-SH; µ mol/ml) were

determined by using standard protocols. The GSH was

estimated by DTNB method of Prins and Loos (1969),

whereas, GST activity was determined as per the

method described by Habig et al. (1974). Catalase was

assayed in erythrocytes by the spectrophotometric

method as described by Bergmeyer (1983). The SOD

activity in erythrocytes and LPO level in RBC

haemolysate were determined as per the methods

described by Marklund and Marklund (1967) and Placer

et al. (1966), respectively. Total thiol (T-SH) groups in

the RBC haemolysate were determined following the

method of Sedlak and Lindsay (1968).

The effect of CT containing LMM supple-

mentation in broiler chicks on CMI response (foot pad

thickness) was assessed through in vivo cutaneous

delayed-type hypersensitivity (DTH) reaction against

phytohaemagglutin-P (PHA-P). Towards the beginning

of experimental feeding of 6th weeks, two birds from

each replicate were used. The foot pad area of tested

birds was cleaned with cotton swab containing sprit and

the thickness of the foot pad was measured with the

help of digital Vernier callipers, which would represent

the basal (0 h) value. All the tested birds were injected

intradermally with 25 µl of PHA-P solution. The

thickness of the foot pad was subsequently measured

at 24 h and then at 48 h and 72 hours.

Assessment of humoral immune response was

assessed through haemagglutination (HA) titre on 24

broiler finisher chicks selected at random at 32 days.

Venous blood from sheep was collected aseptically in

equal volume of Alsever’s solution and stabilized for

one week. Finally, a suspension of 0.5 % sheep red blood

cells (SRBC) was adjusted with phosphate buffer

saline (PBS) solution. For immunization, 100 µl of this

suspension was injected intravenously in wing vein of

each tested bird. Blood from immunized birds was

collected after 10 days for collection of serum. Total

SRBC antibody titres were assayed in the serum of each

bird according to the agglutination method described by

Hudson and Hay (1991). Antibody titters were reported

as log2 of the highest dilution of serum that agglutinated

an equal volume of a 0.5% SRBC in PBS solution.

The results obtained were subjected to analysis

of variance and treatment means were ranked using

Duncan’s multiple range test (DMRT). The periodic

alterations in CMI response was analyzed using

General linear model (GLM) procedures. Significance

was declared at P<0.05 unless otherwise stated. All the

statistical procedures were performed as per Snedecor

and Cochran (2004).


The ingredients and chemical composition of

experimental diets of broiler chicks has been presented

in the table 1. The proximate compositions of all the

experimental diets during both starter and finisher phases

were within the range as suggested by BIS (1992). The

CT content of LMM was 7.69 percent.

Data pertaining to cumulative feed intake, body

weight gain and feed conversion ratio (FCR) are

presented in table 2. Feed intake (g) during 0-3, 4-6 and

0-6 weeks were significantly (P<0.05) higher in T1

followed by T2, T

3 and least feed intake was recorded

in T4 groups. Lower feed intake in T

3 and T

4 groups

may be due to high percentage of CT which is having

astringent property. At higher level, CTs bind with

glycoprotein of the saliva and may also form complex

with other nutrients that may causes a sensation in the

oral cavity, resulting in reduced palatability and decreased

feed intake in broiler birds. Present results are

contradictory to the findings of Rahman et al.

(2013 who reported that P. guajava leaf meal up to .

Zargar et al.


162

reduced (P<0.05) PCV but not below the level

considered normal for birds.

Data pertaining to antioxidant indices are presented

in table 3. Mean values of catalase, and GST were

significantly (P<0.05) higher in CT containing LMM

supplemented groups (T2, T

3 and T

4) as compared

control (T1) group. The highest GSH activity was

evident in T4 followed by T

3 and T

2, whereas the least

GSH activity was observed in T1. Significantly (P<0.006)

higher SOD activity was obtained in T3 as compared to

T1, T

2 and T

4. The LPO activity (µ mol/ mg Hb)

drastically (P<0.001) reduced as the level of CT

containing LMM increased and it was found to be

lowest in T4 followed by T

3, T

2 and the highest LPO

activity was observed in T1. Significantly (P<0.012)

higher T-SH activity was evident in T4 as compared to

T1, T

2 and T

3 groups, while NP-SH activity was found

to be highest in T4 followed by in T

3, T

2 and least

NP-SH activity was noted in T1.

It clearly indicated that tanniferous LMM

supplementation significantly (P<0.001) increased

NP-SH activity in broiler chicks. However, P-SH did

not differ significantly among groups. Results of the

present study showed that CT containing LMM

supplementation at 2.5, 5.0 and 7.5 % of the broiler

diets significantly (P<0.05) improved the antioxidant

indices as indicated by increased levels of catalase, GSH,

GST, SOD, T-SH and NP-SH and decreased level of

LPO. Further CT prevents superoxide formation and

lipid peroxidation (Lau and King, 2003). The presence

of catecholic B-ring and free hydroxyl groups in CT

structures are the key factors responsible for their

potent antioxidant activities. The antioxidant activity is

further enhanced by the polymerization of flavan-3-ols.

Thus, the CT acts as potent antioxidant via H-atom

transfer or single –electron transfer mechanism.

Several earlier studies in ruminants have demonstrated

the antioxidant properties of CT containing LM and/or

LMM (Dutta et al., 2012; Dey and De, 2014; Dey et

al., 2015; Pathak et al., 2017). It was reported that

dietary supplementation of CT through LMM improved

activity of GSH, GST, SOD, catalase, T-SH and P-

SH and significantly reduced LPO levels in CT

supplemented groups.

The CMI response against PHA-P as antigen

injected intra-dermally in the foot pad of broiler chicks

is illustrated in the Fig. 1. The CMI response (foot pad

thickness) of broiler chicks increased significantly

Table 2. Effect of Eugenia jambolana and Psidium guajava leaf meal Mixture supplementation on

cumulative body weight gain, feed intake and FCR in broiler chicks

Time Groups SEM P Value

T1

T2

T3

T4

Body weight gain (g)

0-3 weeks 627b 593ab 592ab 589a 6.29 0. 038

4-6 weeks 1247d 1132c 1075a 1106b 15.34 0.001

0-6 weeks 1874d 1725c 1667b 1694a 16.89 0.001

Feed intake (g)

0-3 weeks 1085d 1052c 1035b 997a 2.93 0.001

4-6 weeks 2935d 2866c 2831b 2684a 8.40 0.001

0-6 weeks 4021d 3918c 3866b 3681a 11.29 0.001

Feed conversion ratio (FCR)

0-3 weeks 1.75b 1.80c 1.76b 1.72a 0.02 0.546

4-6 weeks 2.38b 2.58c 2.68d 2.50a 0.03 0.011

0-6 weeks 2.16a 2.30c 2.34d 2.20b 0.02 0.005

a,b,c,dMeans with different superscript within a row differ significantly (P<0.05)



163

(P<0.05) with increasing level of LMM. Significantly

higher CMI response was observed in T4 followed by

T3, T

2 and the lower CMI response was recorded in T

1

group. The maximum foot pad thickness was recorded

after 24 h onward and up to 72 h post inoculation of

PHA-P in broiler chicks.

It is clearly indicated that the dietary

supplementation of CT containing LMM in broiler diets

significantly improved CMI response. The birds fed

red sorghum (containing tannins) exhibited higher

immune-responsiveness than their reconstituted

counterparts assessed through cellular (footpad index)

immune response (Kumar et al., 2007). The role

of tanniferous LMM on immune response can be

understood as flavonoids, CTs and microelements have

been suggested to act as antioxidants and exert their

antioxidant activity by scavenging the free radicals and

preventing lipid peroxidation (Yuting et al., 1990).

Latshaw (1991) have suggested that cellular integrity is

very important for receiving and responding to messages

needed to coordinate an immune response. The improved

total thiol group and decrease in lipid peroxidation in the

present study might have improved cellular integrity so

that CMI response was increased. In an earlier report

(Yokozawa et al., 1997), green tea tannin eliminated

oxidative stress in rats, which might be the reason

for improved immune performance observed in

LMM supplemented broiler chicks than that of

un-supplemented control.

Humoral immune response (HA titre, log2

value) against sheep RBC (SRBC) in broiler chicks fed

CT containing LMM supplemented diets is depicted in

Table 3. Effect of Eugenia jambolana and Psidium guajava leaf meal mixture supplementation on

haematological profile and antioxidant indices of broiler finisher chicks

Parameters Groups SEM P Value

T1

T2

T3

T4

Haematological profile

Haemoglobin (g/dl) 10.73b 10.54ab 11.00b 10.02a 0.13 0.034

PCV (%) 29.83ab 30.83bc 31.17c 28.83a 0.27 0.002

Antioxidant indices

Catalase (U/mg Hb) 2.50a 3.61b 3.88b 3.78b 0.21 0.043

GSH (µ mol/mg Hb) 1.29a 1.53a 1.64ab 1.96b 0.09 0.017

GST (µ mol/mg Hb) 4.51a 6.29b 6.61b 6.99b 0.32 0.005

SOD (U/mg Hb) 6.45a 7.52a 11.94b 7.32a 0.74 0.006

LPO (µ mol/mg Hb) 1.75d 1.04c 0.58b 0.26a 0.17 0.001

TP-SH (µ mol/mg Hb)1.14a 2.35a 2.42a 4.92b 0.49 0.012

NP-SH (µ mol/ml) 0.64a 1.72b 1.77b 3.15c 0.29 0.001

P-SH (µ mol/ml) 0.51 0.64 0.66 1.77 0.26 0.311

a,b,cMeans with different superscript within a row differ significantly (P<0.05)

Zargar et al.


48 hr

×

10

9

8

7

6

5

0hr

Hrs post inoculation

24 hr 72hr

Footp

ad

th

ick

nes

s (m

m)

Fig. 1. DTH response to PHA-P (foot pad

thickness) in broiler chicks fed on LMM

supplemented diets

164

Figure 2. Dietary supplementation of tanniferous LMM

in broiler chicken significantly (P<0.001) increased

the HA titre (log2) value in LMM (T2, T

3 and T

4)

supplemented groups as compared to un-supplemented

control (T1) group, however, HA titre (log2) values not

differ significantly among three treatment groups (T2,

T3 and T

4). Similarly, Durrani et al. (2008) reported the

immune-stimulatory effects of neem (A. indica) leaves

infusion in broiler chicks. They found that A. indica

infusion successfully improved antibody titre at the level

of 50 ml/liter of fresh drinking water in broilers. Present

findings are also in line with Sadekar et al. (1998),

who fed dry leaves powder of A. indica to broilers (2g/

kg), which significantly enhanced the antibody titers

against IBD and ND virus antigens. Subapriya and

Nagini (2005) also reported antiviral properties of neem

leaf and its constituents. The immune-stimulating

properties of LMM as observed in the present study

might be due to presence of CT. Many previous studies

also reported immune-stimulating properties of CT

containing LMM (Dubey et al., 2012; Pathak et al.,

2014; Singh et al., 2015).

CONCLUSION

It was concluded that Eugenia jambolana

and Psidium guajava leaf meal mixture (50:50)

supplementation (2.5 %) in broiler chicks improved

antioxidant status, cell mediated and humoral immune

responses without affecting performance.

ACKNOWLEDGEMENT

The authors are thankful to Hon’ble Vice

Chancellor and worthy Dean, SKUAST-Jammu for

providing necessary facilities to carry out the research

work.

REFERENCES

AOAC. 1995. Official Methods of Analysis (16th edn).


Washington, DC.

AOAC. 2000. Official Methods of Analysis (16th edn).


Washington, DC.

Atawodi, S.E., Yakubu, O.E. and Umar, I.A. 2013. Antioxidant

and hepatoprotective effects of Parinari curatellifolia

root. Int. J. Agric. Biol. 15: 523-528.

Bergmeyer, H. U. 1983. UV method of catalase assay. In:

Methods of enzymatic Analysis. Vol. 3rd, Weinheim,

Deerfield Beach, Florida, Bansal. pp. 273.

BIS. 1992. Bureau of Indian Standards. Requirements for

Chicken Feeds. IS 1374-1992. Manak Bhavan, 9,

Bhadursha Zafar Marg, New Delhi, pp. 1-3.

Bounous, D. and Stedman, N. 2000. Normal avian

hematology: chicken and turkey. In: Feldman, B.F., Zinkl,

J.G., Jain, N.C., edn. Schalm’s Veterinary Hematology.

New York: Wiley, pp. 1147-1154.

Dacie, J.V and LEWIS, S.M. 1975. Practical Haematology, 4th

Edn. F. A. Davis, Philadelphia, USA.

Daing, M.I., Pathak, A.K., Bhat, M.A. and Zargar, M.A. 2017a.

Antioxidant andantibacterial potential of condensed

tannins containing tree leaves extract. Vet. Pract. 18:

118-121.

Daing, M.I., Pathak, A.K., Bhat, M.A., Sharma, R.K. and Zargar,

M.A. 2017b. In vitro antioxidant and antibacterial

efficacy of condensed tannins containing tree leaves

extract of Jammu Province. J. Anim. Res. 7: 165-174.

Decker, E. A. 1997. Phenolics: Prooxidantsor antioxidants. Nutr.

Rev. 55: 396-407.

Dey, A. and Sarathi De, P. 2014. Influence of Condensed

tannins from Ficus bengalensis leaves on feed

utilization, milk production and antioxidant status of

crossbred cows. Asian Australas. J. Anim. Sci. 27:

342-348.

Dey, A., Dutta, N., Pattanaik, A. K. and Sharma, K. 2015.

Antioxidant status, metabolic profile and immune

response of lambs supplemented with tannin rich

Ficus infectoria leaf meal. Jap. J. Vet. Res. 63: 15-24.

Dubey, M., Dutta, N., Banerjee, P. S., Pattanaik, A. K., Sharma,

K. and Singh, M. 2012. Effect of condensed tannins

supplementation through a tree leaves mixture on

erythrocytic antioxidant status and gastrointestinal

nematodes in kids. Anim. Nutr. Feed Technol. 12:

91-102.

IIA

tit

re (

log 2

valu

e)

2.500

2.000

1.500

1.000

Groups

0.500

0.000

Fig. 2. Humoral immune response (HA titre,

log2 value) of broiler chicks fed LMM

supplemented diet



165

Durrani, F.R., Chand, N., Jan, M., Sultan, A., Durrani, Z. and

Akhtar, S. 2008. Immunomodulatory and growth

promoting effects of neem (Azadirachta indica) leaves

infusion in broiler chicks. Sarhad J. Agric. 24: 655-659.

Dutta, N., Dubey, M., Banerjee, P. S., Pattanaik, A. K., Sharma,

K., Kumar, P. and Narang, A. 2012. Effect of

supplementing tanniferous tree leaves mixture on

immune response and GI nematodes in kids. Livest.

Res. Rural Dev. 24.

El-Deek A. A., Asar, M. A., Hamdy, S. M. and Abdalla, A. A.

2009. Utilization of guava by-products in broiler

finisher diets. Egypt. Poult. Sci. 29: 53-75.

Hebig, W. H., Pabst, M. J. and Jacoby, W. B. 1974. Glutathione

S-transferases, the first enzymatic step in the

mercapturic acid formation. J. Biol. Chem. 249: 7130-

7139.

Hudson, L. and Hay, F.C. 1991. Practical Immunology,

Blackwell Scientific Publications. 3rd edn. London.

Jain, N.C. 1986. Schalm’s Veterinary Haematology, 4th Edn.

Lea and Febiger. Philadelphia.

Kumar, V., Elangovan, A.V., Mandal, A.B., Tyagi, P.K., Bhanja,

S.K. and Dash, B. B. 2007. Effects of feeding raw or

reconstituted high tannin red sorghum on nutrient

utilization and certain welfare parameters of broiler

chickens. Br. Poult. Sci. 48: 198-204.

Latshaw, J. D. 1991. Nutrition - mechanism of

immunosupression. Vet. Immunol. Immunopathol. 30:

111-120.

Lau, D.W. and King, A.J. 2003. Pre and post mortem use of

grape seed extract in dark poultry meat to inhibit

development of thiobarbituric acid reactive

substances. J. Agric. Food Chem. 51: 1602-1607.

Makkar, H.P.S. 2000. Quantification of tannins in tree foliage.

Joint FAO/IAEA working document, IAEA, Viena. Pp

1-26.

Marklund, S. and Marklund, G. 1967. Involvement of

superoxide anion radicals in autoxidation of pyrogallol

and convenient assay for superoxide dismutase. Eur.

J. Biochem. 47: 469-474.

Obikaonu, H.O., Okoli, I.C., Opara, M. N., Okoro, V.M. O.,

Ogbuewu, I.P., Etuk, E.B. and Udedibie, A.B.I. 2012.

Haematological and serum biochemical indices of

starter broilers fed leaf meal of neem (Azadirachta

indica). J. Agric. Technol. 8: 71-79.

Onu, P.N. and Aniebo, A.O. 2011. Influence of Moringa

oleifera leaf meal on the performance and blood

chemistry of starter broilers. Int. J. Food Agric. Vet.

Sci. 1: 38-44.

Pathak A.K. 2013. Potential of using condensed tannins to

control gastrointestinal nematodes and improve small

ruminant performance. Int. J. Mol. Vet. Res. 3: 36-50.

Pathak, A.K., Dutta, N., Banerjee, P.S. and Sharma, K. 2013b.

Effect of tannin extracts from tropical tree leaves on

larvae and adult Haemonchus contortus. Indian Vet.

J. 90: 32-34.

Pathak, A.K., Dutta, N., Banerjee, P.S., Pattanaik, A.K.

and Sharma, K. 2013a. Influence of dietary

supplementation of condensed tannins through leaf

meal mixture on nutrient intake, utilization and

performance of Haemonchus contortus infected sheep.

Asian-Australas. J. Anim. Sci. 26: 1446-1458.

Pathak, A.K., Dutta, N., Pattanaik, A.K., Sharma, K., Banerjee,

P.S. and Goswami, T.K. 2017. Effect of condensed

tannins supplementation through Ficus infectoria and

Psidium guajava leaf meal mixture on erythrocytic

antioxidant status, immune response and gastro-

intestinal nematodes in lambs (Ovis aries). Vet. Archiv.

87: 139-156.

Pathak, A.K., Dutta, Narayan, Banerjee, P.S., Goswami, T.K.


supplementation through leaf meal mixture on

voluntary feed intake, immune response and worm

burden in Haemonchus contortus infected sheep. J.

Para. Dis. 40: 100-105.

Pathak, A.K., Dutta, Narayan, Banerjee, P.S., Sharma, K. and

Pattanaik, A.K. 2013c. Efficacy of various condensed

tannins extracts from tanniferous tree leaves on egg

hatching inhibition of Haemonchus contortus. Vet.

Pract. 14: 127-129.

Pauzenga, U. 1985. Feeding Parent Stock. Zootec. Int., pp.

22-24.

Placer, Z.A., Cushman, L.L. and Johnson, B. 1966. Estimation

of product of lipid peroxidation (malondialdehyde) in

biochemical system. Anal. Biochem. 16: 359-364.

Prins, H. K. and Loos, I. A. 1969. In: Biochemical Methods in

Red Cell Genetics. (J. J. Yunis ed.), Newyork, pp.

126-130.

Rahman, Z., Siddique, M. N., Khatun, M. A., kamruzzaman,

M. 2013. Effect of Guava (Psidium guajava) leaf meal

on production performances and antimicrobial

sensitivity in commercial broiler. J. Nat. Prod. 6: 177-

187.

Sadekar, R.D., Kolte, A.Y., Barmase, B.S. and Desai, V.F. 1998.

Immunopotentiating effects of Azadirachta indica

(Neem) dry leaves powder in broilers, naturally infected

with IBD virus. Indian J. Exp. Biol. 36: 1151-1153.

Sedlak, J. and Lindsay, R.H. 1968. Estimation of total protein

bound and non-protein sulphhydril groups in tissue

Zargar et al.


166

with Ellman’s reagent. Anal. Biochem. 25: 192-205.

Shafey, T.M., Almufarij, S.I. and Albatshan, S.I. 2013. Effect of

feeding olive leaves on the performance, intestinal and

carcass characteristics of broiler chickens. Int. J. Agric.

Biol. 15: 585 589.

Shafey, T.M., M.A. Alodan, H.A. Al-Batshan, M.A. Abouheif,

M.S. Alamri and I.M. Al-Ruqaie, 2011. Performance,

Egg Characteristics and Economic Impact of Laying

Hens Fed Extruded Bakery Waste. J. Anim. Vet. Adv.

10: 2248-2252.

Singh, S., Pathak, A.K., Sharma, R.K. and Khan, M. 2015.

Effect of tanniferous leaf meal based multi nutrient

blocks on feed intake, haematological profile, immune

response and body weight changes in Haemonchus

contortus infected goats. Vet. World. 8: 572-579.

Simol, C.F., Tuen, A.A., Khan, H. H. A., Chubo, J.K., King,

P.J.H. and Ong, K.H. 2012. Performance of chicken

broilers fed with diets substituted with mulberry leaf

powder. Afr. J. Biotechnol. 11: 16106-16111.

Snedecor, G.W. and Cochran, W.G. 2004. Statistical Methods

(8th Edn.). East West Press Pvt. Ltd., New Delhi.

Subapriya, R. and Nagini, S. 2005. Medicinal properties of

neem leaves: A review. Curr. Med. Chem. Anti-cancer

Agents. 5: 149-156.

Talpatra, S.K., Ray, S.C. and Sen, K.C. 1940. Estimation of


potassium in foodstuffs. Indian J. Vet. Sci. Anim. Husb.

10: 243-258.



Windisch, W., Schedle, K., Plitzner, C. and Kroismayer, A.

2008. Use of Phytogenic products as feed additives

for swine and poultry. J. Anim. Sci. 86 (E suppl.): E140-

E148.

Yagi, Y., Furunchi, S., Takashi, H. and Koyama, H. 1989.

Abnormality of osmotic fragility and morphological

disorder of bovine erythrocytes infected with

Theileria sargonti. J. Vet. Sci. 51: 389-395.

Yokozawa, T., Dong, E., Chung, H. Y., Oura, H. and Nakagawa,

H. 1997. Inhibitory effect of green tea on injury to a

cultured renal epithelial cell line, LLC-PK. Biosci.

Biotechnol. Biochem. 61: 204-206.

Yuting, C., Rongliang, Z, Zhongjian, J. and Yong, J. 1990.

Flavonoids as superoxide scavengers and antioxidants.

Free Rad. Biol. Med. 9: 19-23.

Zargar M.A., Pathak, A.K. and Daing, M.I. 2017. Screening

and evaluation of antioxidants and anticoccidial

properties of condensed tannins containing tree leaves

of Jammu province. Indian J. Anim. Res. 51: 1105-1112.

Zargar, M.A., Pathak, A.K., Sharma, R.K. and Daing, M.I. 2016.

Antioxidants and Anticoccidial potential of aqueous

extract from various tree leaves containing condensed

tannins. J. Anim. Res. 6: 563-570.


167

Indian Journal of

Animal Nutrition

Effect of Replacement of Maize by Animal Fat on Growth and Nutrient

Utilization of Growing Large White Yorkshire Pigs

N. Elanchezhian1* and K. Ally2

Department of Animal Nutrition, College of Veterinary and Animal Sciences,

Mannuthy, Trichur, Kerala, India.

ABSTRACT

In order to study the effect of replacement of maize by animal fat on growth and nutrient utilization, thirty

weaned female Large White Yorkshire piglets were divided in to three groups with five replicates in each group

and were maintained under identical management conditions for the period of 70 days. The piglets were

randomly allocated to one of the three treatments namely T1 (control ration), T

2 (50 per cent of maize of control

ration replaced by animal fat) and T3 (100 per cent of maize of control ration replaced by animal fat). The average

daily gain and feed conversion efficiency were 813.00, 769.86, 678.43 g, and 2.80, 2.88, 3.08, respectively

for three dietary treatments. The pigs of T1 had higher (P<0.05) average body weight gain than that of

other treatments. The crude fibre digestibility was higher (P<0.05) for T1 and T

2 rations than that of T

3. The

digestibility of dry matter, organic matter, crude protein and NFE was higher for T1 ration as compared to other

groups. Availability of calcium, magnesium and manganese was lowered (P<0.01) in T3 group. It can be

concluded that partial (50 per cent) replacement of the maize in the feed for pigs by animal fat did not affect the

weight gain, feed intake, feed conversion efficiency and nutrient utilization.

Key words: Animal fat, Growth, Nutrient digestibility, Pig, Replacement of maize

1Corresponding author; Email: [email protected]; Department of Animal Nutrition, Rajiv Gandhi Institute of Veterinary Education and

Research, Puducherry-605 009; *Part of Ph.D. thesis entitled “Dietary modifications on lipid profiles of pigs fed animal fat” submitted to the

Kerala Veterinary and Animal Sciences University, Kerala; 2Department of Animal Nutrition, College of Veterinary and Animal Sciences,

Mannuthy, Trichur, Kerala, India.

INTRODUCTION

Cereal grain forms the major source of energy in

the swine feed. Even though India produces more than

20 million MT of maize per year, it could meet only 60

per cent of the requirement of the country. The lower

availability and increasing price of maize, necessitate

an alternative energy source for incorporation in the

swine feed. Animal fat is a byproduct of meat industry

and can be included as a source of energy in swine

ration. India produces 0.14 million MT of tallow and

0.02 million MT of lard per year (Best, 2012). The use

of fat as an energy source for pigs has been shown to

increase digestibility of nutrients, improve growth rate

and also reduces dustiness of feeds and increases

palatability (Apple et al., 2007). However, studies on

the effects of adding animal fat to swine diets have

yielded variable results. Hence, the present was

undertaken to study the effect of replacement of maize

by animal fat on growth and nutrient utilization of

growing Large White Yorkshire pigs.


doi: 10.5958/2231-6744.2020.00027.4


Thirty weaned female Large White Yorkshire

piglets were randomly divided into three groups of five

replicates in each group. Each replicates were allotted

with two piglets and housed in a single pen. All piglets

were maintained under identical management conditions

throughout the experimental period of 70 days.

Restricted feeding was followed and daily feed intake

was recorded. The animals were fed with standard

grower ration containing 18 per cent of crude protein

(CP) and 3265 kcal of metabolizable energy (ME)/kg

of feed up to 50 kg body weight and finisher ration with

16 per cent CP and 3265 kcal of ME /kg of feed from

50 kg body weight as per NRC (2012). Ingredient

composition and proximate composition of the grower

and finisher ration is given in the table 1 and 2. Piglets

were randomly distributed into three dietary treatment

groups; namely T1 (control ration), T

2 (50 per cent of

maize of control ration replaced by animal fat) and T3

(100 per cent of maize of control ration replaced by


168

animal fat). The pigs were weighed at the beginning of

the experiment and subsequently at fortnight intervals.

Digestibility trial was conducted at the end of the

experiment following total collection method. The

samples of feed and faeces were analyzed for

proximate principles (AOAC, 2010) and minerals such

as calcium, magnesium, zinc, copper and manganese;

were analyzed using Atomic Absorption Spectrophoto-

Replacement value of animal fat for maize in pig diet

Table 1. Ingredient composition (%) of pig grower and finisher rations

Ingredients Grower rations1 Finisher rations1

T1

T2

T3

T1

T2

T3

Yellow maize 70 35 0 74 37 0

Wheat bran 1.5 31 59.8 3.6 34.7 64.9

Soyabean meal 26.25 25.5 25.0 20.5 19.7 19.2

Animal fat 0 6.5 13 0 7 14

Salt 0.5 0.5 0.5 0.5 0.5 0.5

Dicalcium phosphate 0.9 0.4 0 0.65 0.10 0

Calcite 0.85 1.1 1.7 0.75 1.0 1.4

Total 100 100 100 100 100 100

Nicomix AB2D3K 1, g 25 25 25 25 25 25

Nicomix BE 2, g 25 25 25 25 25 25

Zinc Oxide3, g 45 13 0 30 0 0

Oxylock antioxidant 4, g 10 10 10 10 10 10

1Nicomix A, B2, D

3, K (Nicholas Piramal India Ltd, Mumbai) containing vitamin A- 82,500 IU, vitamin B

2-50 mg, vitamin D

3-12,000 IU and

vitamin K-10 mg per gram; 2Nicomix BE (Nicholas Piramal India Ltd, Mumbai) containing vitamin B1-4 mg, vitamin B

6-8 mg, Vitamin B

12-

40 mg, Niacin-60 mg, Calcium pantothenate- 40 mg and Vitamin E-40 mg per gram; 3Zinc oxide (Nice Chemicals Pvt. Ltd., Kochi) containing

81.38% of Zn; 4Oxylock antioxidant (Vetline Ltd., Indore) contains ethoxyquin, butylated hydroxytoluene (BHT), chelators and surfactant.

Table 2. Chemical composition of pig grower and finisher rations

Parameters Grower rations1 Finisher rations1

T1

T2

T3

T1

T2

T3

DM, % 89.20±0.12 90.56±0.11 91.41±0.13 89.11±0.12 90.41±0.17 91.50±0.18

on DM basis

CP, % 18.25±0.11 18.18±0.17 18.03±0.13 16.39±0.10 16.28±0.06 16.06±0.18

EE, % 3.10±0.05 8.53±0.09 13.69±0.10 3.28±0.06 9.04±0.11 14.11±0.07

CF, % 3.72±0.11 6.58±0.13 9.42±0.10 3.73±0.07 6.54±0.10 9.40±0.03

Total ash, % 5.64±0.17 9.50±0.20 12.40±0.18 5.54±0.15 9.54±0.12 12.47±0.14

NFE, % 69.29±0.16 57.21±0.21 46.46±0.21 71.06±0.20 58.60±0.30 47.96±0.05

AIA, % 1.10±0.02 4.51±0.09 6.63±0.12 1.04±0.06 4.29±0.13 6.52±0.16

GE, kcal/kg 4132±22.9 4134.9±14.9 4213 ±9.21 4165±22.2 4203±17.1 4448±36.7

Ca, % 0.59±0.01 0.62±0.006 0.78±0.01 0.62±0.02 0.65±0.01 0.77±0.02

P, % 0.58±0.01 0.71±0.01 0.85±0.01 0.55±0.02 0.72±0.02 0.83±0.01

Mg % 0.14±0.006 0.24±0.009 0.40±0.007 0.13±0.008 0.25±0.01 0.37±0.02

Mn, ppm 16.78±0.38 39.14±1.76 69.99±1.18 16.59±0.45 38.76±0.96 69.85±1.31

Cu, ppm 6.35±0.08 9.34±0.06 12.62±0.19 6.15±0.15 9.17±0.08 12.39±0.15

Zn, ppm 71.52±1.29 67.19±2.23 88.52±1.15 71.39±1.36 64.95±1.47 88.50±1.62

DM, dry matter; OM, organic matter, CP, crude protein; EE, ether extract, CF, crude fibre; NFE, nitrogen free extract; AIA, acid insoluble ash;

GE, gross energy; 1Mean of four values with SE


169

meter (Perkin Elmer 3110, USA). Phosphorus contents

of both feed and faecal samples were analyzed

according to AOAC (2010). Data collected were

statistically analyzed using Statistical Package for

Social Studies (SPSS. 17.0.1V, 2008) software.


The data on the body weight, feed intake, daily

gain and feed conversion efficiency of pigs fed the

experimental rations are presented in Table 3. The

average initial and final body weight of piglets belonging

to three groups were 23.94, 23.96 and 24.01 kg, and

80.85, 77.85 and 71.50 kg, respectively. Replacement

of maize at 50 per cent by animal fat had no significant

effect on body weight of pigs. However, pigs reared on

T1 had higher (P<0.01) final body weight than that of T

3

treatment. In agreement to the results obtained in the

present study non-significant growth performance in pigs

fed different levels of supplemental fat were reported

by Reis et al. (2000), Guo et al. (2006) and Realini et

al. (2010) (animal fat at five per cent).

In this present study pigs maintained on T3

treatment recorded significantly lower growth rate as

compared to T1 group. This may be due to the higher

level of wheat bran (64.9 per cent) in T3 ration which

resulted in high crude fibre (9.40 per cent) and acid

insoluble ash (6.52 per cent) content in the ration. The

total feed intake recorded for three treatments were

159.28, 154.98 and 145.98 kg, respectively. There was

no significant difference in total feed intake among three

treatments. This is in agreement with Bhar et al. (2000)

who observed similar feed intake in crossbred pigs fed

diet with 0, 50 and 100 per cent replacement of maize

by wheat bran.

The average daily gain was 813.00, 769.86 and

678.43 g, respectively for three treatments. Statistical

analysis revealed no difference in average daily gain

between T1 and T

2 treatments, whereas T

1 treatment

had higher (P<0.05) gain than that of T3 treatment. The

feed conversion efficiency for three treatment groups

was 2.80, 2.88 and 3.08, respectively. There was no

difference in feed efficiency between T1 and T

2; but

both had better (P<0.05) feed efficiency than that of

T3. In the present study T

3 treatment recorded

significantly lower average daily gain and feed efficiency

compared to other groups. This may be due to high crude

fibre (9.40 per cent) and acid insoluble ash (6.52 per

cent) content in the ration which might have affected

the digestion and utilization of the nutrients. Growth rate

and feed efficiency of pigs were depressed as fiber level

in the diet increased (Lewis and Southern, 2000). Sheikh

et al. (2011) observed significant deterioration in feed

conversion efficiency in crossbred pigs fed diet

containing paddy grain (rice) instead of maize. No

significant difference was observed on growth

performance and cost of production in LWY pigs fed

diet containing 0 and 50 per cent replacement of maize

by wheat bran whereas at 100 per cent replacement of

maize by wheat bran showed significantly lower growth

rate and higher production cost (Elanchezhian and Ally,

2016).

Data on apparent digestibility of nutrients and

availability of minerals is presented in Table 4. Ether

Table 3. Weight gain, feed intake, average daily gain and feed conversion efficiency of pigs maintained

on the three experimental rations

Parameters Treatments

T1

T2

T3

Initial body weight, kg 23.94±1.30 23.96±1.55 24.01±1.19

*Final body weight, kg 80.85b±2.76 77.85ab±2.35 71.50a±2.00

**Total weight gain, kg 56.91b±1.48 53.89b±0.85 47.49a±1.26

**Average daily gain, g 813.00b±21.20 769.86b±12.16 678.43a±18.06

Total feed intake, kg 159.28±6.54 154.98±4.42 145.98±3.30

**Feed conversion efficiency 2.80a±0.05 2.88a±0.05b 3.08b±0.06

a,bMeans with different superscripts within the same row differ significantly; *(P<0.05); **(P<0.01)

Elanchezhian and Ally


170

extract digestibility was similar in all the three

treatments. The digestibility of all other nutrients in the

control group was higher than the other groups. Pigs

fed ration with 50 per cent of maize replaced with

animal fat had higher (P<0.05) digestibility of nutrients

than T3. The crude fibre digestibility was higher (P<0.05)

in T1 and T

2 as compared to T

3, in which it was the

lowest. In T3 (100 per cent maize replacement) group

the level of wheat bran was 64.9 per cent, compared to

34.7 per cent in T2. The level of crude fibre and acid

insoluble ash in the three rations were 3.73 and 1.04;

6.54 and 4.29 and 9.4 and 6.52, respectively for T1, T

2

and T3. The higher levels of crude fibre and acid

insoluble ash might have contributed to the lowered

digestibility of all nutrients except ether extract. Bhar et

al. (2000) also observed decreased digestibility of dry

matter, organic matter, crude fibre, total carbohydrate,

nitrogen free extract and energy with increased level of

wheat bran in the diet of crossbred pigs. The digestive

tract enlarges to accommodate a larger volume of

feed rich in crude fibre and the rate of passage of

ingesta increases, resulting in reduction in digestibility

of nutrients (Lentle and Janssen, 2008). Sikka et al.

(1987) found that replacement of maize and rice bran

with paddy in growing and finishing pigs led to a

significant decrease in the digestibility of organic matter

and crude fibre. Sheikh (2011) observed a significant

reduction in digestibility of dry matter, ether extract,

crude fibre and NFE in crossbred pigs fed diet

containing paddy grain instead of maize. The digestible

energy values of the three experimental rations were

3558, 3104 and 2837 kcal/kg, respectively. The control

group (T1) had higher (P<0.01) DE than T

2 and T

3 and

the lowest DE was recorded in T3.

Significant improvement in digestibility of energy

as a result of fat supplementation in the diet of pigs was

reported by Reis et al. (2000) (eight per cent tallow).

However, no significant difference in the energy

digestibility in pigs by supplementation of tallow at five

per cent in the diet was observed by Garry et al. (2007)

and Huang et al. (2010). As the level of replacement of

maize by animal fat increased, the efficiency of energy

utilization was reduced in pigs (Elanchezhian et al., 2014;

Elanchezhian and Ally, 2020).

From the present study, it was observed that there

was no difference in the availability of phosphorus,

copper and zinc between the three rations, whereas the

availability of calcium, magnesium and manganese

were lowered (P<0.01) in T3 group. The comparatively

higher levels of phosphorus (0.83 per cent) in T3 might

have caused an imbalance between calcium and

phosphorus resulting in lowered absorption of calcium.

The high level of wheat bran (64.7 per cent) in 100 per

cent maize replacement (T3) group might have led to a

Table 4. Apparent digestibility of nutrients and availability of minerals of the three experimental rations

Parameters Treatments

T1

T2

T3

Dry matter, % 85.73c±0.36 72.18b±1.57 59.07a±1.77

Organic matter, % 87.95c±0.40 76.14b±1.28 64.00a±1.48

Crude protein, % 84.48c±0.68 77.59b±1.03 67.94a±2.39

Ether extract, % 67.60±2.07 62.83±3.47 58.62±4.15

Crude fibre, % 55.36b±1.49 49.63b±1.70 38.84a±3.05

Nitrogen free extract, % 91.49c±0.54 80.48b±1.23 69.21a±1.75

DE, kcal/kg 3558.12c±3.47c 3104.22b±76.15 2837.96a±61.48

Calcium, % 60.34b±1.77 55.28ab±2.11 47.53a±2.27

Phosphorus, % 54.53±2.74 51.38±3.23 46.22±2.36

Magnesium, % 66.29b±2.29 58.82ab±2.53 52.95a±2.40

Manganese, % 71.38b±1.38 64.13b±2.06 54.92a±2.23

Copper, % 62.02±1.74 57.41±3.70 53.08±2.22

Zinc, % 63.40±1.94 61.48±2.80 56.65±2.76

a,b,cMeans with different superscripts within the same row differ significantly, (P<0.01)

Replacement value of animal fat for maize in pig diet


171

decrease in availability of minerals like magnesium and

manganese. Fibrous feedstuffs such as peanut hulls, oat

hulls, wheat bran, and soyabean hulls have been shown

to decrease mineral absorption in pigs (Kornegay and

Moore, 1986).

CONCLUSION

Results obtained in the experiment indicates that

50% replacement of the maize by animal fat in the diet

of pigs did not affect the weight gain, feed intake, feed

conversion efficiency and nutrient utilization. However,

100% replacement of maize with animal fat showed

adverse impact on weight gain, feed conversion

efficiency and nutrient utilization. Thus, 50% of maize

can be replaced be replaced with animal fat in the diets

of pigs without any adverse impact.

ACKNOWLEDGMENT

The authors are very much thankful to Dean,

College of Veterinary and Animal Sciences, Mannuthy

for providing necessary facilities for successful conduct

of the work.

REFERENCES

AOAC. 2010. Official Methods of Analysis.18th rev. ed.

Association of Official Analytical Chemists,

Arlington, Washington DC, USA.

Apple, J. K., Maxwell, C.V., Sawyer, J.T., Kutz, B.R., Rakes,

L.K., Davis, M.E., Johnson, Z.B., Carr, S.N. and

Armstrong, T.A. 2007. Interactive effect of ractopamine

and dietary fat source on quality characteristics of fresh

pork bellies. J. Anim. Sci. 85: 2682-2690.

Best, P. 2012, July-August, 2012. Global pig production: Trends

shaping the pork industry. Pig International-

Bimonthly, 42(4): pp. 8-11. Available: www.WATTAg

Net.com.

Bhar, R., Pathak, N.N. and Paul, S. 2000. Performance of

crossbred (Landrace × local Indian) finisher barrows

fed maize or wheat bran based diets: Short note.

Asian-Australas. J. Anim. Sci. 13: 1429-1432.

Lewis, A.J. and Southern, L.L. (eds.), 2000. Swine Nutrition

(2nd Ed.). CRC press, Florida, USA.

Elanchezhian, N., Ally, K., Mercy, A.D., Gangadevi, P.,

Kuttinarayanan, P. and Usha, A.P. 2014. Effect of

supplementation of animal fat on plasma and muscle

lipid profile of Large White Yorkshire pigs. Indian J.

Anim. Nutr. 30: 423-427.

Elanchezhian, N. and Ally, K. 2016. Influence of replacement

of maize by wheat bran on cost of production in pigs.

Indian J. Anim. Nutr. 33: 236-240.

Elanchezhian, N. and Ally, K. 2020. Effect of replacement of

maize by animal fat on energy utilization in pigs.

Indian J. Anim. Nutr. 37: 57-61.

Garry, B.P., Pierce, K.M. and O’Doherty, J.V. 2007. The effect

of phase-feeding on the growth performance, carcass

characteristics and nitrogen balance of growing and

finishing pigs. Irish J. Agric. Food Res. 46: 93-104.

Guo, Q., Richert, B.T., Burgess, J.R., Webel, D.M., Orr, D.E.,

Blair, M., Grant, A.L. and Gerrard, D.E. 2006. Effect of

dietary vitamin E supplementation and feeding Period

on pork quality. J. Anim. Sci. 84: 3071-3078.

Huang, Y., Yoo, J.S., Kim, H.J., Wang, Y., Chen, Y.J., Cho, J.H.

and Kim, I.H. 2010. The Effects of different copper

(inorganic and organic) and energy (tallow and

glycerol) sources on growth performance, nutrient

digestibility, and fecal excretion profiles in growing

pigs. Asian-Australas. J. Anim. Sci. 23: 573-579.

Kornegay, E. T. and Moore, R.J. 1986. Dietary fiber sources

may affect mineral use in swine. Feedstuffs. 58: 36.

Lentle, R.G. and Janssen, P.W.M. 2008. Physical

characteristics of digesta and their influence on flow

and mixing in the mammalian intestine: A review. J.

Comp. Physiol. 178: 673-690.

NRC. 2012. Nutrient Requirements of Swine (11th Ed.).

National Academy of Sciences, Washington, D. C.,

210p.

Realini, C.E., Duran-montage, P., Lizardo, R., Gisperta, M.,

Oliver, M.A. and Esteve-Garcia, E. 2010. Effect of

source of dietary fat on pig performance, carcass

characteristics and carcass content, distribution and

fatty acid composition. Meat Sci. 85: 606-612.

Reis de souza, T.C., Aumaitre, A., Mourot, J. and Peiniau, J.

2000. Effect of graded levels of tallow in the diet on

performance, digestibility of fat, lipogenesis and body

lipid deposition of the weaned piglet. Asian-Australas.

J. Anim. Sci. 13: 497-505.

Sheikh, G.G., Ganie, A.A., Baghel, R.P.S. and Nayak, S. 2011.

Effect of paddy grain as maize replacer on the growth

performance and nutrient utilization in growing and

finishing pigs. Indian J. Anim. Nutr. 28: 437-440.

Sikka, S.S., Chawla, J.S. and Ichhponani, J.S. 1987. Effect of

protein levels on the performance of growing pigs

during different season. Indian J. Anim. Sci. 57: 164-

167.

SPSS. 2008. 17.0.1 V. Windows user’s guide 2008 by Statistical

Package for the Social Sciences Inc. USA.


Elanchezhian and Ally


172

Indian Journal of

Animal Nutrition

Effect of Feeding Different Levels of Rice Distillers Dried Grains with

Soluble (RDDGS) on Performance of Broiler

Niharika Singh, Meenu Dubey*, Raina Doneria, M.K. Gendley,

O.P. Dinani and R.C. Ramteke

Department of Animal Nutrition, College of Veterinary Science and A.H., Anjora

Chhattisgarh Kamdhenu Vishwavidyalaya, Durg

ABSTRACT

Rice distillers dried grains with solubles (RDDGS) is a co-product of rice-based ethanol production that

can be a valuable source of energy, digestible amino acids, and available phosphorus in poultry feeds. The

present study was conducted for 5 weeks to study the effect of different dietary inclusion levels of rice DDGS

on performance of broiler chickens. The diets were prepared using conventional feed ingredients: maize,

deoiled soybean cakes, soy oil, rice DDGS and premixes containing trace minerals and vitamins. The average

body weight of chicks at the end of pre-starter and starter phase was significantly (P<0.05) higher in birds fed

diet with 10 and 15% rice DDGS as compared to control, however, at 35 d the difference in body weight was not

significant amongst the group. No significant effect of rice DDGS inclusion on weekly and cumulative feed

intake was observed. The cumulative FCR up to 3 weeks was significantly (P<0.05) better in all the treatment

groups irrespective of level of rice DDGS, however, at the end of experiment the difference amongst the group

was not significant. No significant effect of different dietary inclusion levels of rice DDGS on metabolizability

of DM was observed. The N and Ca balance also did not vary significantly among the groups, however, the P

balance was significantly (P<0.05) higher in all the treatment groups irrespective of level of rice DDGS. Birds fed

diet with 10% DDGS gave best response in terms of net profit per kilogram of body weight. It is therefore

concluded that rice DDGS can be incorporated at 10% level in broiler feed.

Key Words: RDDGS, Growth, Nutrient utilization, Broiler chickens

*Corresponding author; Email: [email protected]; Mobile No. 09926130785

INTRODUCTION

Poultry is one of the fastest growing segments of

the agriculture sector in India and is one of the key

industries to provide feed security to a large population

in terms of energy and protein as well as employment to

people. A major constraint affecting the growth of the

poultry industry in India is price and availability of feed

resources. Feed costs are primarily driven by the cost

of protein sources. With increasing feed prices, the

interest in using alternative feed sources like DDGS

in poultry diets has escalated during recent years.

Distillers dried grain with solubles (DDGS) is a

co-product of ethanol industry which is obtained from

grains through a process of dry milling. The DDGS is a

unique feedstuff that provides high levels of protein,

energy, digestible fibre and minerals (Schingoethe et al.,

2009). Chemical analysis on as such basis indicated that

rice DDGS is high in protein (44.68%) and gross

energy 4232 kcal/kg (Dinani et al., 2019). It is also more


doi: 10.5958/2231-6744.2020.00028.6

nutritious than the cereals from which it is made up of,

as it contains other nutrients recovered from fermented

grains. The DDGS is being used either wet or dry but

performance is usually similar whether fed as wet or

dried products (Koger et al., 2010). Furthermore, DDGS

also contains moderate level of fat and readily

digestible fibre which contributes to the higher energy

concentration. The high energy and protein content of

DDGS makes it a very attractive resource for partial

replacement of some of the more expensive traditional

energy (maize) and protein (soybean meal) ingredients

used in animal feeds. Keeping in view the above facts,

the present experiment was planned to study the effect

of different dietary inclusion level of rice DDGS on

growth performance, nutrient utilization and economics

of rearing broiler chicken up to 35 d of age.

MATERIAL AND METHODS

The experiment was conducted in the poultry shed

of College of Veterinary Science & A. H., Anjora, Durg.


173

A biological experiment of five weeks duration was

conducted following completely randomized design

(CRD). A total of 180, day-old Ross AP strain broiler

chicks were reared under deep litter system. The chicks

were divided into 4 dietary treatment groups (T1-T

4).

Each group had 3 replicates of 15 chicks in each.

The diets were formulated as per ICAR (2013)

specification for pre-starter (0-14 d), starter (15-21 d)

and finisher (22-35 d) stages. The pre- starter diets

contained 22% CP and 3000 kcal ME, starter diet

contained 21.5% CP and 3050 kcal ME, and finisher

diet contained 19.5% CP and 3100 kcal ME/kg feed.

Four types of diets were formulated for each phase

using maize, soy DOC, rice DDGS, soy oil, premixes

containing minerals, vitamins and feed additives. Diet I

served as control with no rice DDGS, diet II, III and IV

contained 5%, 10% and 15% rice DDGS respectively

replacing soy DOC and some part of maize (Table 1).

All the diets were made iso-caloric and iso-nitrogenous.

The body weight of individual bird was recorded every

week and gain in weight was calculated. Weekly and

cumulative feed consumption was recorded and feed

conversion ratio was calculated in each treatment group.

A metabolism trial of 4-day duration was conducted

between d 30-35 to determine the nutrient balance (N,

Ca and P) in the broilers. The sample of diet and

excreta were analyzed for various proximate principles,

namely N (AOAC, 2000), Ca (Talapatra et al., 1940)

Table 1. Ingredient and chemical composition of pre starter, starter and finisher broiler diet

Particulars Pre starter Starter Finisher

(%) T1

T2

T3

T4

T1

T2

T3

T4

T1

T2

T3

T4

Maize 55.72 55.90 55.92 53.54 55.72 55.90 55.92 53.54 55.72 55.90 55.92 53.54

Soy DOC 37.95 33.55 28.26 25.57 37.95 33.55 28.26 25.57 37.95 33.55 28.26 25.57

RDDGS - 5.00 10.00 15.00 - 5.00 10.00 15.00 - 5.00 10.00 15.00

Soy oil 2.86 2.00 2.12 2.14 2.86 2.00 2.12 2.14 2.86 2.00 2.12 2.14

DCP 1.28 1.31 1.34 1.34 1.28 1.31 1.34 1.34 1.28 1.31 1.34 1.34

LSP 1.08 1.10 1.11 1.13 1.08 1.10 1.11 1.13 1.08 1.10 1.11 1.13

Premix* 0.42 0.42 0.42 0.42 0.42 0.42 0.42 0.42 0.42 0.42 0.42 0.42

Salt 0.35 0.35 0.31 0.30 0.35 0.35 0.31 0.30 0.35 0.35 0.31 0.30

Methionine 0.14 0.13 0.12 0.10 0.14 0.13 0.12 0.10 0.14 0.13 0.12 0.10

Lysine 0.07 0.07 0.18 0.22 0.07 0.07 0.18 0.22 0.07 0.07 0.18 0.22

Soda bicarb 0.09 0.09 0.14 0.16 0.09 0.09 0.14 0.16 0.09 0.09 0.14 0.16

Choline 0.08 0.08 0.08 0.08 0.08 0.08 0.08 0.08 0.08 0.08 0.08 0.08

Total 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00

Chemical Composition (%)

Moisture 11.92 11.5 11.78 12.41 11.24 12.42 11.92 12.12 10.47 10.21 10.88 11.21

CP 21.94 21.86 22.01 21.94 21.56 21.60 21.72 21.68 19.57 19.61 19.52 19.63

CF 3.52 3.79 4.56 4.88 3.41 3.78 4.28 4.7 4.3 4.44 4.56 4.70

EE 4.71 4.22 3.52 3.72 5.29 5.52 5.71 5.21 6.6 6.72 6.79 6.5

Total ash 7.02 6.88 6.80 6.36 7.21 6.01 7.91 7.52 6.81 6.31 6.87 6.41

Ca 1.04 1.05 1.10 1.07 1.10 1.07 1.04 1.08 1.10 1.21 1.23 1.21

P 0.63 0.62 0.65 0.64 0.61 0.67 0.63 0.70 0.7 1.12 1.1 1.1

RDDGS -rice distillers dried grain with soluble, Soy DOC-Soy deoiled cake, DCP-dicalcium phosphate, LSP Limestone powder; *Trace

mineral and vitamin premix; Trace mineral premix per kg diet contained CoCo3 0.20 mg, ZnO 112.0 mg, Fe(So4)3 85 mg, MnSo4 105 mg,

CuSo4 22.5 mg, Sodium salenite 0.30 mg and potassium iodide 2.5 mg. Vitamin premix per kg diet contained vitamin A 15.60 MIU, vitamin

D3 5.25 MIU, vitamin B1 3.60 mg, B2 12.0 mg, B6 8.0 mg, B12 0.02 mg, biotin 0.18 mg, Ca D pantothenate 15.0 mg, vitamin E 120 mg, folic

acid 5.0 mg, vitamin K 4.0 mg and niacin 57.5 mg

Singh et al.


174

and P (Fiske and Subbarao, 1925) to determine the

nutrient balance. Data obtained were analyzed

statistically (snedecor and Cochran, 1998).


Data pertaining to the comparative proximate

composition of rice DDGS and soy DOC are presented

in table 2. Nutrient content of RDDGS is comparable to

soy DOC. Previous researchers (Dinani et al., 2019;

Gupta et al., 2015; Rao et al., 2016) reported 45% CP

in RDDGS. Dietary inclusion of rice DDGS at different

levels accrued significant variation in average body

weight of chicks at the end of pre-starter phase (0-14

d). The body weight was significantly (P<0.05) higher

in birds fed diet with 10% and 15% rice DDGS

as compared to control. Inclusion of rice DDGS

irrespective of level of inclusion significantly (P<0.05)

improved the live weight as compared to control at day

21 (Table 3). Amongst the treatment group the

difference in body weight was not significantly

different during this phase. The findings corroborate well

with the results of Shim et al., (2011) who reported

increased weight gain in broilers fed 8, 16 or 24% DDGS

during the starter (0-18 d) period. No significant effect

of different dietary inclusion levels of rice DDGS on

average body weight was observed at the end of

finisher stage (Table 3). The findings are in accordance

with the observations of previous researchers (AbdEl-

Hack, 2015; Choi et al., 2008 and Youssef et al., 2013)

who reported no adverse effect on growth performance

when corn DDGS was included in broiler diet. In

contrast, reduction in body weight gain was reported by

Dinani et al. (2019) when RDDGS was included at 15%

level in broiler feed. Reduction in body weight gain was

also reported by some other researchers (Loar et al.,

2010; Sonu et al., 2018) when higher level of corn

DDGS was incorporated in broiler feed. On the other

hand, higher body weight gain at 42 d in Japanese quail

was reported by El – Abd (2013) when corn DDGS

was used at 50 and 100% level.

The weekly feed intake due to different inclusion

levels of rice DDGS differed non-significantly amongst

the groups during pre-starter and starter phase (Table

3). The cumulative feed intake at the end of 35 d was

2965.9, 2879.8, 2858.1 and 2959.4 g in groups T1, T

2, T

3

and T4, respectively. No significant effect of different

inclusion levels of rice DDGS on cumulative feed

intake was reported in the study. The findings are in

accordance with the results of earlier researcher

(Romero et al., 2012) who reported no significant

difference in feed intake for hens fed corn DDGS up to

20 %. Dinani et al. (2019) also observed that rice DDGS

up to 12.5% level in broiler feed did not have any

significant effect on feed intake, but at 15% level

significant (P<0.05) reduction in feed intake was

observed. Deniz et al. (2013) and Thein et al. (2020)

also reported that the use of 20% DDGS in the diets

significantly depressed the feed intake of birds. Abd El

Hack (2015) reported that increasing DDGS in the diet

up to 16.5% was associated with an increase in feed

intake while increasing the level up to 22% led to a

marked depression in feed intake.

The feed conversion ratio was significantly

Table 2.Comparative proximate composition of soy DOC with rice DDGS

Attributes (%) Soy DOC Rice DDGS

Dry matter 91.17 90.51

Moisture 8.83 9.49

Crude protein 45.77 42.10

Crude fat 1.40 7.11

Crude fiber 6.70 9.05

NFE 39.23 48.82

Total ash 6.90 4.89

Acid insoluble ash 2.43 1.20

Feeding value rice distillers dried grains for broiler


175

(P<0.05) better in groups T3 and T

4 as compared to

control during pre-starter phase. The cumulative FCR

at 21 d was significantly (P<0.05) better in all the

treatment groups as compared to control, however at

the end of finisher stage the effect of rice DDGS

inclusion on cumulative FCR was not significant (Table

3).The findings corroborate well with previous reports

(Youssef et al., 2013: Lumpkins et al., 2004) which

indicated no negative effect on FCR when DDGS was

used in broiler feed. In contrast, some researchers (Deniz

et al., 2013; Ghazalah et al., 2011; Jiang et al., 2013;

Loar et al., 2011; Wang et al., 2007) observed negative

effect on F: G ratio when DDGS was incorporated

in the broiler feed. Better feed conversion ratio in

Japanese quail was reported by EI-Abd (2013) when

chicks were fed 50 and 100% corn DDGS.

Table 3. Effect of different dietary inclusion levels of rice distillers dried grains with solubles (RDDGS)

on feed intake, body weight gain and FCR

Days of Groups P Value

Observation T1

T2

T3

T4

Average weekly body weight (g)

0 42.97±1.17 43.26±1.24 43.83±0.17 43.09±0.54 0.90

07 156.43±2.02 165.51±2.52 162.89±5.49 172.72±2.77 0.06

14 401.83a±4.71 426.45ab±18.84 456.16b±12.16 464.26b±18.12 0.02

21 829.06a±13.41 882.24b±6.01 882.25b±17.53 888.73b±4.73 0.02

28 1384.22±49.86 1364.46±19.26 1403.51±24.93 1441.15±16.39 0.38

35 1970.30±60.13 2002.56±29.49 1993.27±28.71 2016.06±37.04 0.87

Cumulative feed intake

0-7 139.86±2.89 138.86±0.14 142.33±3.28 139.13±0.08 0.68

0-14 443.02±6.80 428.96±0.34 439.43±10.34 436.53±6.83 0.57

0-21 1041.62±31.86 989.36±1.39 1011.23±23.35 1009.43±19.67 0.45

0-28 1906.91±70.23 1790.91±3.74 1825.00±26.35 1865.46±34.31 0.29

0-35 2965.99±70.71 2879.81±25.90 2858.08±43.72 2959.38±85.24 0.52

Cumulative feed conversion ratio

0-7 1.09±0.05 1.03±0.01 1.07±0.03 0.97±0.02 0.12

0-14 1.22b±0.12 1.12ab±0.05 1.06a±0.02 1.03a±0.02 0.01

0-21 1.32b±0.02 1.18a±0.08 1.20a±0.01 1.19a±0.01 0.01

0-28 1.42±0.05 1.35±0.02 1.34±0.008 1.33±0.03 0.37

0-35 1.53±0.01 1.47±0.01 1.46±0.01 1.50±0.07 0.53

a,bMeans in the same row with different superscript (a,b) differ significantly

Table 4. Effect of different dietary inclusion levels of rice distillers dried grain with soluble (RDDGS) on

DM, CP and EE utilization in broilers

Particulars Groups P Value

T1

T2

T3

T4

Dry matter Intake (g) 129.99±5.55 115.72±4.96 117.34±0.82 122.77±14.44 0.61

Outgo (g) 22.58±1.77 21.82±1.35 23.63±3.38 21.32±4.02 0.82

Balance (g) 107.40±8.42 93.90±2.85 93.70±5.32 101.44±12.15 0.54

Metabolizability(%) 82.51±3.02 81.14±1.42 79.83±3.98 82.46±1.16 0.56

Singh et al.


176

No significant effect of different dietary inclusion

levels of rice DDGS on metabolizability of dry matter

was observed in birds of different groups (Table 4). The

findings corroborate well with the results of Ghazalah

et al., (2011) and Shalash et al., (2009) who reported

no significant variation among DDGS levels for DM,

OM, EE and NFE digestibility. The findings are not in

line with observations of previous researchers

(Abdelrahim et al., 2011; Gibb et al., 2008 and Sahin et

al., 2013) who reported decreased digestibility of DM,

OM and crude protein with increased levels of corn

DDGS.

No significant effect of different dietary inclusion

levels of rice DDGS on N intake, N outgo, balance and

per cent N retention was observed in the study (Table

5). The findings are not in line with the results of Dinani

et al. (2019) who reported decreased N retention (%)

when rice DDGS was included at 15% level in broiler

feed. Swiatkiewicz et al. (2014) also reported decreased

N retention, when DDGS was used in the broiler feed.

Min et al. (2011) reported increased N in excreta with

the inclusion of DDGS in the broiler feed. Similarly, no

significant difference was observed in the intake, outgo,

balance and per cent retention of Ca in the birds of

Table 5. Effect of different dietary inclusion levels of rice distillers dried grain with solubles (RDDGS)

on N, Ca and P balance in broilers

Particulars Groups P Value

T1

T2

T3

T4

Nitrogen Intake (g) 4.05±0.17 3.74±0.16 3.67±0.02 3.95±0.46 0.63

Outgo (g) 1.03±0.07 1.04±0.05 1.011±0.14 1.01±0.12 0.94

Balance (g) 3.02±0.23 2.57±1.54 2.65±0.16 2.83±0.35 0.58

Retention (%) 74.23±2.82 71.13±1.31 72.37±4.06 73.46±1.76 0.76

Calcium Intake(g) 1.54±0.06 1.41±0.06 1.46±0.01 1.57±0.18 0.68

Outgo(g) 0.53±0.05 0.55±0.03 0.57±0.14 0.53±0.06 0.95

Balance(g) 1.01±0.09 0.86±0.04 0.88±0.14 1.03±0.10 0.56

Retention (%) 65.16±4.2 60.94±1.68 60.56±9.65 65.73±2.35 0.74

Phosphorus Intake (g) 1.01±0.04 1.27±0.05 1.35±0.009 1.40±0.16 0.59

Outgo (g) 0.34±0.19 0.32±0.01 0.34±0.05 0.31±0.06 0.84

Balance (g) 0.66a±0.05 0.95b±0.05 1.01b±0.06 1.09b±0.10 0.02

Retention (%) 65.34a±3.28 74.73b±1.48 74.79b±4.5 77.54b±2.17 0.03

a,bMeans in the same row with different superscript differ significantly

different groups. The P intake was significantly (P<0.05)

higher in birds fed diet with 10 (T3) and 15% (T

4) levels

of rice DDGS as compared to control, however the

difference in P intake between group T1 and T

2 was not

significant. The outgo of P by the birds of different groups

did not vary significantly, however, the P balance was

significantly (P<0.05) higher in all the treatment groups

irrespective of level of rice DDGS. Increase in the level

of rice DDGS gradually increased the value of P

balance as a result the per cent retention of P was

significantly (P<0.05) high in all the treatment groups

as compared to control (Table 5). Phosphorus

bioavailability of DDGS coming from ethanol plants

was expected to be higher than that in typical beverage

plant due to the fermentation process involved in

ethanol production. The reason behind this may be the

alteration of phytate structure under increased heat

causing more phosphorus release. In addition,

fermentation was believed to reduce phytic acid in

DDGS (El Hag et al., 2002).

The relative economics of raising broiler on diet

with different inclusion levels of rice DDGS was

calculated based on total cost of rearing of bird up to 35

days and the amount received from the selling of bird



177

@ ` 80/- kg live weight. The total cost of rearing per

bird was ̀ 121.66, 118.02, 116.35 and 117.9 and the net

profit per kg body weight was ̀ 18.25, 21.06, 21.63 and

21.52 in group T1, T

2, T

3 and T

4 respectively. In the

experiment, birds fed diet containing 10% RDDGS gave

best response in terms of net profit per kilogram of

body weight.

CONCLUSION

Rice DDGS is a viable feed ingredient and can

be incorporated up to 15% level in broiler feed without

any adverse effect on growth performance and nutrient

utilization, however inclusion level 10% of rice DDGS

was more economical as compared to other levels of

inclusion. It is therefore recommended to include rice

DDGS up to 10% level in broiler feed.

REFERENCES

AOAC. 2000. Official Methods of Analysis. 17thedn.

Association of Analytical Chemists.Verginia, USDA,

Washington, D.C.

Abd El-Hack, M.E., Alagawany, M., Farag., M.R. and Dhama,

K. 2015. Use of maize distiller’s dried grains with

solubles (DDGS) in laying hen diets: Trends and

Advances. Asian J. Anim. Vet. Adv.10: 690-707.

Abdelrahim, G. M., Khativada, J. and Gurung, N. K. 2014.

Effects of dried distillers grains with solubles on

performance and carcass characteristics of lamb. J.

Anim. Res. Technol. 1: 25-30.

Choi, H. S., Lee, H.L., Shin, M.H., Jo, C., Lee, S.K. and Lee,

B.D. 2008.Nutritive and economic values of corn

distiller’s dried grains with solubles in broiler diets.

Asian-Austalas. J. Anim. Sci. 21: 414-419.

Deniz, G., Gencoglu, H., Gezen, S.S., Turkmen, I.I., Orman, A.

and Kara, C. 2013. Effects of feeding corn distiller’s

dried grains with solubles with and without enzyme

cocktail supplementation to laying hens on

performance, egg quality, selected manure parameters

and feed cost. Livest. Sci.152: 174-181.

Dinani, O.P., Tyagi, P.K., Mandal, A.B., Tyagi, P. K. and Dutta,

N. 2019. Evaluation of feeding value of rice based

distillers dried grains with soluble (DDGS) for broiler

chickens. Indian J. Anim. Res. 53: 901-906.

El-Abd, N. M. 2013. Evaluation of using distillers dried grains

with solubles (DDGS) in Japanese quail diets. World

Appl. Sci. J. 22: 17-21.

El-Hag, M.E., El-Tinay A.H. and. Yousif, N.E 2002. Effect

of fermentation and dehulling on starch, total

polyphenols, phytic acid content and in vitro protein

digestibility of pearl millet. Food Chem. 77: 193-196.

Fiske, C.H. and Subbarao, Y. 1925. The colorimetric

determination of phosphorus. J. Biol. Chem. 66: 375-

400.

Ghazalah, A.A., Abd-Elsamee, M.O. and Moustafa, E.S. 2011.

Use of distillers dried grains with solubles (DDGS) as

replacement for soybean meal in laying hen diets. Int.

J. Poult. Sci. 10: 505-513.

Gibb, D. J., Hao, X. and McAllister, T. A. 2008. Effect of dried

distillers’ grains from wheat on diet digestibility and

performance of feedlot cattle. Can. J. Anim. Sci. 88:

659-665.

Gupta, S.L., Tyagi, P. K., Tyagi., P. K., Mandal, A. B., Mir, N.A.

and Sharma, M. 2015. Intestinal histomorphometry of

laying hens fed diets containing rice based dry

distiller’s grains with solubles. Indian J. Poult. Sci.50:

294-299.

ICAR. 2013. Nutrient Requirements of Livestock and

Poultry, Indian Council of Agricultural Research, New

Delhi, pp 13-16.

Jiang, W., Zhang, L. and Shan, A. 2013. The effect of vitamin

E on laying performance and egg quality in laying

hens fed corn dried distillers grains with soluble. Poult.

Sci. 92: 2956-2964.

Koger, T. J., Wulf, D. M., Weaver, A. D., Wright, C. L., Tjardes,

K. E., Mateo, K, S., Engle, T. E., Maddock, R. J., and

Smart, A.J. 2010. Influence of feeding various

quantities of wet and dry distillers grains to finishing

steers on carcass characteristics, meat quality,

retail-case life of ground beef, and fatty acid profile of

longissimus muscle. J. Anim. Sci. 88: 3399-3408.

Loar, R. E. and Corzo, A. 2011. Effects of varying levels of

distillers dried grains with solubles on growth

performance of broiler chicks. Brazilian J. Poult. Sci.13:

279-281.

Lumpkins, B., Batal, A. and Dale, N.M. 2005. Use of distillers

dried grains plus solubles in laying hen diets. J. Appl.

Poult. Res. 14: 25-31.

Min, Y. N., Liu, F.Z., Karimi, A., Coto, C., Lu, C., Yan, F. and

Waldroup, P.W. 2011. Effect of Rovabio® Max AP on

performance, energy and nitrogen digestibility of

diets high in distillers dried grains with solubles

(DDGS) in broilers. Int. J. Poult. Sci.10: 796-803.

Rao Rama, S.V., Raju, M.V.L.N., Prakash, B., Reddy, E.P.K. and

Anusha, R. 2016. Effect of dietary supplement of

distillery dried grain soluble from rice on performance

of commercial broilers and White Leghorn layers. In

Proc. XXV World’s Poultry Congress, Beijing. pp- 52.

Singh et al.


178

Romero, C., Abdallh, M.E., Powers, W., Angel, R. and

Applegate, T.J. 2012. Effect of dietary adipic acid and

corn dried distillers grains with solubles on laying hen

performance and nitrogen loss from stored excreta with

or without sodium bisulfate. Poult. Sci. 91: 1149-1157.

Sahin, T., Kaya, O., Elmali, D.A. and Kaya, I. 2013. Effects of

dietary supplementation with distiller dried grain with

solubles in growing lambs on growth, nutrient

digestibility and rumen parameters. Rev. de Med. Vet.

164:173-178.

Schingoethe, D.J., Kalscheur, K.F., Hippen, A.R., Garcia, A.D.

2009. Invited review.The use of distillers’ products in

dairy cattle diets. J. Dairy Sci. 95: 5802-5813.

Shalash, S.M.M., Ali, M.N., Sayed, M.A.M., El-Gabry, H.E.,

and Shabaan, M. 2009. Novel method for improving

the utilization of corn dried distillers grains with

solubles in broiler diets. Int. J. Poult. Sci. 8: 545-552.

Shim, M.Y., Pesti, G.M., Bakalli, R.I., Tillman, P.B. and Payne,

R.L. 2011. Evaluation of corn distillers dried grains with

soluble as an alternative ingredient for broilers. Poult.

Sci. 90: 369-376.

Snedecor, G. W. and Cochran, W.G. 1998. Statistical Methods,

8th Edn, Oxford and IBH Publishing Company, New

Delhi.

Sonu, Z.S. Sihag, Dalal, R. and Ahlawat, P. 2018. Effect of

multienzyme cocktail on growth performance,

digestibility and carcass characteristic of broilers fed

soybean meal replaced with distillers dried grain

solubles (DDGS) and maize based diet. Int. J. Pure

Appl. Biosci.6: 718-724.

Swiatkiewicz, S., Arczewska-Wloseka, A. and Jozefiak, D. 2014.

Feed enzymes, probiotic, or chitosan can improve the

nutritional efficacy of broiler chicken diets containinga

high level of distillers dried grains with solubles. Livest.

Sci. 163: 110-119.

Talpatra, S.K., Ray, S.N. and Sen, K.C. 1940. Estimation of


potassium in food stuffs. Indian J. Vet. Sci. Anim. Husb.

10: 243-246.

Thein, S.M., Thu, T.M., Thu, K.L., Thu, W.W.W., Thae, C.,

Thet, M., Thant, M.K., Thant, K.Z., Thant, M., Than,

Z.M., Thein, Z., Myint, K.S., Kyawt, Y.Y., Aung, M.

and Mu. K.S. 2020. Effects of dietary supplementation

of rice distillers dried grains in grower phase on growth

performance and digestibility of broiler chicken. Adv.

Anim. Vet. Sci. 8: 444-451

Wang, Z., Cerrate, S., Coto, C., Yan, F. and Waldroup, P.W.

2007. Effect of rapid and multiple changes in level of

distillers dried grain with solubles (DDGS) in broiler

diets on performance and carcass characteristics. Int.

J. Poult. Sci. 6: 725-731.

Youssef, A. W., AbdEl-Azeem, N.A., El-Daly, E.F. and

El-Monairy, M.M. 2013. The impact of feeding graded

levels of distillers dried grains with solubles (DDGS)

on broiler performance, hematological and

histological parameters. Asian J. Poult. Sci. 7: 41-54.




179

Indian Journal of

Animal Nutrition

Effect of Organic Copper, Zinc and Manganese Supplementation on

Immunity and Hatchability of Egg in Japanese Quail

(Coturnix coturnix japonica)

A.K. Satapathy, S.K. Das, K. Sethy*, R.K Swain, S.K. Mishra K. Behera and S. Pati

Department of Animal Nutrition, College of Veterinary Science and Animal Husbandry,

Odisha University of Agriculture and Technology, Bhubaneshwar-751 003, India

ABSTRACT

To assess the effect of organic copper (Cu), zinc (Zn) and manganese (Mn) supplementation on

immunity and hatchability, 405 six week old Japanese quails (Coturnix coturnix japonica) were randomly

distributed into nine dietary treatment groups and the experiment continued till the period up to 13th week. The

dietary treatments were T0:100 % inorganic minerals (Cu, Zn and Mn); T

1: 100 % organic minerals (Cu, Zn and

Mn); T2: 100 % inorganic Zn and Cu with 100 % organic Mn; T

3: 100 % inorganic Zn and Cu with 50 % organic

Mn and 50% inorganic Mn; T4 : 100 % inorganic Zn and Mn with 100 % organic Cu; T

5 : 100 % inorganic Zn and

Mn with 50 % organic Cu and 50% inorganic Cu; T6 :

100 % inorganic Mn and Cu with 100 % organic Zn; T7 : 100

% inorganic Mn and Cu with 50 % organic Zn and 50% inorganic Zn; T8 : 50 % organic Zn, Cu and Mn with 50

% inorganic Zn, Cu and Mn. Basal diets were supplemented with Cu, Zn and Mn at the levels of 5, 25 and 60

ppm, respectively. Results revealed that supplementation of organic Cu, Zn and Mn had no effect on growth

rate, blood chemistry and weight of lymphoid organs, but the hatchability of eggs and cutaneous basophil

hypersensitivity response were significantly (P<0.05) higher in 100% organic supplemented groups as

compared to other groups. So, it may be concluded that supplementation of 100% organic copper, zinc and

manganese improved the immunity and hatchability of eggs in Japanese quail.

Key words: Growth, Hatchability, Immunity, Organic minerals


INTRODUCTION

Trace minerals, such as Cu, Zn and Mn are

constituents of proteins involved in intermediary

metabolism, hormone secretion pathways and immune

defense systems (Dozier et al., 2003). Traditionally,

these trace minerals are supplemented in the inorganic

form, such as sulfates, oxides and carbonates.

However, an excess of supplemental inorganic

minerals leads to waste and environmental

contamination from excessive excretion (Leeson, 2003).

Use of organically complexed trace minerals can help

in preventing these losses, due to increased stability in

the upper gastrointestinal tract of the birds (Aksu et al.,

2010). Organic complexed mineral is a type of mineral

linked to protein/peptide/amino acids that has a higher

bioavailability than those inorganic salts (Swiatkiewicz

et al., 2014). Therefore, organic complexed minerals

are supposed to be more effective than the inorganic

minerals in broilers (Abdallah et al., 2009).


doi: 10.5958/2231-6744.2020.00029.8

Supplementation of organic minerals enhanced the

enzyme secretion, immune response, tissue and bone

development and integrity, eggshell formation, and

protection against oxidative stress (Richards et al.,

2010). Organic Cu is related to iron metabolism and

absorption, oxygen metabolism, collagen and elastin

synthesis, bone formation, feathers development and

colouring (Scheideler, 1991). Organic Zn and Mn

improved utilization of feed via participating in the

metabolism of carbohydrates, fats and proteins (Aksu

et al., 2010). Considering the importance of organic

minerals in birds, the present study was envisaged to

evaluate the combined effect organic Cu, Zn and Mn at

different combinations on growth, blood chemistry,

immunity and hatchability of egg in Japanese quail.


Four hundred and five Japanese quail (Coturnix

coturnix japonica) of 6 weeks of age were divided

into nine treatment groups having three replicates of 15


180

birds each. The dietary treatments were T0: 100 %

inorganic minerals (Cu, Zn and Mn); T1: 100 % organic

minerals (Cu, Zn and Mn); T2: 100 % inorganic Zn and

Cu with 100 % organic Mn; T3: 100 % inorganic Zn and

Cu with 50 % organic Mn and 50% inorganic Mn; T4 :

100 % inorganic Zn and Mn with 100 % organic Cu; T5

: 100 % inorganic Zn and Mn with 50 % organic Cu and

50% inorganic Cu; T6 :

100 % inorganic Mn and Cu with

100 % organic Zn; T7 : 100 % inorganic Mn and Cu with

50 % organic Zn and 50% inorganic Zn; T8: 50 %

organic Zn, Cu and Mn with 50 % inorganic Zn, Cu and

Mn. Cu, Zn and Mn were supplemented at the levels of

5, 25, and 60 ppm, respectively over the basal diet (BIS,

1992). Inorganic sources of Cu, Zn and Mn were in the

form of sulphates and the organic forms were in the

form of methionate complexes of respective minerals.

Before the onset of the experiment, the quail house

was thoroughly cleaned, disinfected and dried. The quails

were wing-banded, weighed group wise and transferred

to experimental shed in the farm itself with standard

management and health care practices. A basal diet was

prepared to meet the nutrient requirement of birds (BIS,

1992). The experimental feed was analysed as per

AOAC (1995). Calcium was measured according to

the method of Talapatra et al. (1940). The ingredients

and chemical composition of the experimental diets are

presented in Table 1. The organic Cu, Zn and Mn were

obtained from Surging Ahead (SA) Pharmaceuticals Pvt.

Limited, Vadodara, Gujurat, India. The analytical report

revealed that Cu, Zn and Mn content were (%) 18.20,

12.67 and 14.85 respectively in the organic minerals.

The quails were weighed treatment wise by top

pan electronic balance in each week up to the end of

13th week. Blood samples were collected from the birds

at 13th week of age and blood glucose, triglycerides,

cholesterol, total protein, AST (asparate transaminase)

and ALT (alanine transaminase) were estimated by

using kit (Crest Biosystems, Mumbai, India). At the end

of experiment, three birds from each replicate were

slaughtered for collection of spleen and thymus.

At 13th week of age, three birds in each replicate

were injected intra-dermally 100 micro gram of

Phyto-haemaglutinin-P (PHA-p) in 0.1 ml of normal

saline per bird in the foot pad to measure the cellular

immune response by cutaneous basophillc hyper

sensitivity (CBH) test (Edelman et al., 1986). The

Organic trace elements in Japanese quail diet

Table 1. Ingredients and chemical composition of basal diet

Dietary composition Chemical composition

Ingredients Parts per Parameters Percentage on

quintal dry matter basis

Yellow maize 50 Dry matter 90.20

Soya bean meal 35 On DM basis

Deoiled rice bran 3 Crude protein 22.60

Vegetable oil 4 Ether extract 5.52

Dicalcium phosphate 2 Crude fibre 4.90

Oyster shell 5 Total ash 8.10

Mineral mixture# 1 Acid insoluble ash 2.90

Nitrogen free extract* 58.88

Calcium 2.50

Metabolizable energy* (kcal/kg) 2918

Copper (ppm) 3.83

Zinc (ppm) 12.63

Manganese (ppm) 5.68

#Mineral mixture (without zinc, copper and manganese) contained (g/100g): calcium carbonate 33.28, magnesium oxide 1.48, ferrous sulphate

1.40, potassium iodide0.001, potassium chloride 17.09 and sodium selinate 0.001. *Calculated value


181

thickness of foot pad was measured using digital

calliper before (0 h) and 24 h post inoculation and CBH

response was calculated using the formula:

100 thicknessinjection -Pre

nessskin thickinjection Post response CBH ×=

At 13th weeks of the experiment, total of 1239

eggs were collected from different treatments. The eggs

were candled on 15th day of incubation to remove the

infertile eggs and dead in germ eggs, then the live

embryos were transferred to the Hatcher. The chicks

were taken out on 18th day. Hatchability was calculated

on the basis total eggs set (TES).

Hatchability % (on TES) =

100 set eggs ofnumber Total

out hatched chicks ofNumber ×

Data obtained were subjected to one-way

analysis of variance using Software Package for Social

Sciences (SPSS) version 17.0 (2008) and comparison

among treatment means was made by Duncan’s

multiple range test (Duncan, 1955) with significance level

of P<0.05.


The weekly body weight (g) gain of quail birds of

different dietary treatments did not differed significantly

(P>0.05) among the groups (Table 2). The non-

significant effect on body weight gain corroborated with

the findings of Nollet et al. (2007). Various workers

had reported non-significant effect of mineral

supplementation on body weight of broilers either in

inorganic or organic form (Rossi et al., 2007; Zhao et

al., 2010). In contrast to this, Idowu et al. (2011) and

Dozier et al. (2003) reported that the body weight gain

was significantly higher in birds supplemented with

organic minerals than control. The increased body weight

in above experiments might be due to difference in age

group of birds.

Blood biochemical parameters like glucose,

triglycerides, cholesterol, total protein, AST and ALT

did not differed significantly (P>0.05) among the

treatment groups (Table.3). Similarly, non-significant

change in serum glucose levels was reported by Parak

and Strakova (2011) in breeding cocks supplemented

with organic zinc. Similar to the present result, non-

Table 2. Body weight gain (g) of birds of different dietary treatments

Week Treatments P Value

T0

T1

T2

T3

T4

T5

T6

T7

T8

6th 5.85± 5.88± 5.84± 5.91± 5.87± 5.85± 5.97± 5.90± 5.90± 0.20

0.03 0.04 0.03 0.03 0.03 0.03 0.02 0.04 0.03

7th 6.46± 6.43± 6.50± 6.49± 6.42± 6.47± 6.51± 6.50± 6.48± 0.96

0.03 0.04 0.07 6.49± 0.10 0.04 0.02 0.02 0.02

8th 6.91± 6.98± 6.93± 6.97± 7.02± 7.01± 6.96± 6.99± 6.98± 0.74

0.03 0.06 0.04 0.05 0.05 0.06 0.04 0.02 0.03

9th 6.98± 6.99± 6.92± 6.97± 6.99± 6.95± 6.92± 6.94± 6.97± 0.79

0.04 0.01 0.03 0.02 0.02 0.04 0.03 0.06 0.04

10th 6.88± 6.89± 6.87± 6.85± 6.83± 6.88± 6.89± 6.88± 6.88± 0.99

0.02 0.02 0.05 0.07 0.05 0.07 0.08 0.02 0.01

11th 6.97± 7.01± 7.02± 6.98± 6.99± 6.99± 6.89± 7.01± 6.98± 0.46

0.02 0.07 0.06 0.02 0.03 0.03 0.02 0.03 0.03

12th 6.98± 7.04± 7.01± 7.04± 6.96± 6.99± 7.01± 6.99± 6.93± 0.55

0.03 0.03 0.09 0.02 0.03 0.03 0.03 0.02 0.02

13th 7.09± 7.12± 7.05± 7.11± 7.03± 7.02± 7.07± 7.09± 7.03± 0.27

0.05 0.02 0.07 0.02 0.03 0.01 0.02 0.02 0.02

Satapathy et al.


182

significant level of serum ALT in organic zinc fed groups

was reported by Aksu et al. (2010) on feeding different

levels of organic Zn, Cu and Mn in broiler ration. Idowu

et al. (2011) reported that Zn sources had no significant

(P>0.05) effect on serum glucose, protein and ALT

concentrations which corroborated with the present

findings.

Lymphoid organ parameters viz. thymus and

spleen weight of quails as percentage of body weight at

13th week did not differ significantly (P>0.05) among

various treatment groups (Table 4). The results were

corroborated with the findings of Moghaddam

and Jahanian (2009) and Feng et al. (2010).

Supplementation of zinc did not improve the weight of

the lymphoid organs as more nutrients being repatriated

to develop body weight and production whereas immune

system needed a small amount of nutrient in relation to

that needed for growth and production (Badawy et

al.,1987). However, Idowu et al. (2011) observed

significantly higher percentage of spleen in

zinc-proteanate group than the inorganic group.

Data pertaining to CBH response of quails at 13th

week of age is presented in Table 5. Higher CBH

response was observed in quails fed 100% organic

mineral supplement than other treatments. Trace

elements, especially Cu, Zn and selenium (Se)

markedly influence humoral and cellular immunity

(Allgower et al., 1995). The quails provided diets

supplemented with organic minerals might have

increased thymulin activity, therefore enhancing immune

response through increased maturation of

T- lymphocyte (Hudson et al., 2004). The better

immune response might be due to the fact that

antagonism between the minerals could have been

avoided through using chelated forms of the mineral

(Abdallah et al., 2009).

Table 3. Blood biochemical constituents of experimental quails on different dietary treatments

Attributes Treatments P Value

T0

T1

T2

T3

T4

T5

T6

T7

T8

Glucose 312.59± 315.62± 320.50± 318.51± 323.17± 312.58± 310.16± 322.12± 305.13± 0.14

(mg/dl) 7.92 8.56 14.23 9.33 16.52 13.52 9.17 8.72 8.76

Cholesterol 156.44± 152.67± 149.02± 154.95± 154.95± 154.03± 151.06± 153.47± 152.03± 0.18

(mg/dl) 1.98 1.98 2.47 2.47 4.45 6.44 3.46 0.99 9.41

Triglyceride 120.27± 120.08± 120.17± 120.54± 120.08± 119.9± 119.45± 119.4± 119.4± 0.31

(mg/dl) 12.09 2.55 10.72 4.44 9.09 0.40 25.33 6.36 21.69

Protein (g/dl) 3.96± 4.06± 3.85± 3.68± 3.83± 4.04± 3.70± 3.91± 4.01± 0.10

0.03 0.44 0.24 0.06 0.13 0.15 0.18 0.09 0.04

AST(U/L) 59.18± 58.39± 57.59± 60.13± 61.75± 61.72± 60.14± 60.93± 60.45± 0.09

2.38 2.22 0.15 0.15 0.79 1.74 0.63 3.81 1.74

ALT(U/L) 50.64± 50.83± 50.58± 50.62± 50.66± 50.69± 50.68± 50.88± 50.55± 0.88

3.23 0.85 1.74 0.45 0.98 4.33 2.32 3.66 0.56

Table 4. Weight of lymphoid organs (% BW) of experimental quails

Organs Treatments P Value

T0

T1

T2

T3

T4

T5

T6

T7

T8

Spleen 0.25± 0.24± 0.24± 0.24± 0.24± 0.24± 0.26± 0.24± 0.24± 0.92

0.05 0.03 0.02 0.02 0.01 0.05 0.001 0.03 0.04

Thymus 0.14± 0.13± 0.13± 0.14± 0.13± 0.13± 0.13± 0.13± 0.14± 0.81

0.01 0.02 0.00 0.01 0.00 0.00 0.01 0.00 0.01



183

Table 5. Effect on immune response and hatchability of eggs in quails

Attributes Treatments P Value

T0

T1

T2

T3

T4

T5

T6

T7

T8

CMI 273a± 445e± 309ab± 308ab± 328bc± 327bc± 382d± 324b± 370cd± <0.01

2.25 13.17 4.19 4.36 3.80 8.72 7.55 12.30 20.16

Hatchability 68.80 a± 87.2 d 1± 80.00 bc± 78.47bc± 80.30bc± 77.20 b± 80.13bc± 80.76bc± 83.33cd± <0.01

(%) 1.36 1.10 1.09 2.21 0.75 0.42 1.00 2.31 1.00

a,b,c,dMeans with different superscript in a row differed significantly (P<0.05)

Data on hatchability of eggs are presented on

Table 5. The hatchability percent of T1 group was

significantly (P<0.05) higher as compared other

treatment groups. The lower hatchability percent in all

other treatments might be due to inadequate

transmission of minerals from the hen to the hatching

egg (Kienholz et al., 1961). In contradiction to the

present findings, Kidd et al. (1996) reported that

feeding of zinc from inorganic and organic sources did

not have any significant effect on the hatchability. This

might be due to higher zinc concentration in the basal

diet of the birds in the previous study.

CONCLUSION

It can be concluded that dietary supplementation

of 100 percent organic copper, magnesia and zinc

improved cell mediated immunity and egg hatchability

of quails.

ACKNOWLEDGEMENTS

The authors are thankful to the Odisha

University of Agriculture and Technology, Bhubaneswar

for providing necessary funds and facilities to carry out

this research.

REFERENCES

Abdallah, A.G., El-Husseiny, O.M. and Abdel-Latit, K.O.

2009. Influence of some dietary organic mineral

supplementations on broiler performance. Int. J. Poult.

Sci. 8: 291-198.

Aksu, D.S., Asku, T., Ozsoy, B. and Baytok, E. 2010. The

effects of replacing inorganic with a lower level of

organically complexed minerals (Cu, Zn and Mn) in

broiler diets on lipid peroxidation and antioxidant

defense systems. Asian-Australas. J. Anim. Sci. 23:

1066-1072.

Allgower, M., Schoenenberger, G.A. and Sparkes, B.G.1995.

Burning the largest immune organs. Burns. 21: 7-47.

AOAC. 1995. Official Methods of Analysis, 16th ed.,

Association of Official Analytical Chemist,

Washington, D.C. USA.

Badawy, E.M., Edrise, B.M. and Al-Wakeel, A.M. 1987. The

relationship between quality, egg constituents and

hatchability of the eggs of Hubbard broiler breeders, a

field study. J. Vet. Med. 35 :105-115.

BIS. 1992. Bureau of Indian Standards. Poultry Feeds

Specification, 4th rev. ed. Bureau of Indian Standards,

New Delhi, India.

Dozier, W. A., Davis, A. J., Freeman, M. E. and Ward, T. L.

2003.Early growth and environmental implications of

dietary zinc and copper concentrations and sources of

broiler chicks.Br. Poult. Sci. 44: 726-731.

Duncan, D.B. 1955. Multiple range and multiple “F” tests.

Biometrics. 11: 1-42.

Edelman, A.S., Sachez, P.I., Robinson, M.E., Hochwalad, G.M.

and Thorbecke, G.J. 1986 Primary and secondary

swelling response to phytohaemagglutinin as a

measure of immune competence in chickens. Avian Dis.

30: 105-111.

Feng, J., Ma, W.Q., Niu, H.H., Wu, X.M.,Wang, Y. and Feng, J.

2010. Effects of zinc glycine chelate on growth,

hematological, and immunological characteristics in

broilers. Biol. Trace Elem. Res. 133: 203-211.

Hudson, B.P., Dozier, W.A. and Wilson, J.L. 2004. Broiler live

performance response to dietary zinc source and the

influence of zinc supplementation in broiler breeder

diets. Egypt. Poult. Sci. J. 118: 329-335.

Idowu, O.M.O., Ajuwon, R.O., Oso, A.O. and Akinloye, A.O.

2011. Effect of zinc supplementation on laying

performance, serum chemistry and Zn residue in tibia

bone, liver.excreta and egg shell of laying hens. Int. J.

Poult. Sci. 10: 225-230.

Kidd, M.T., Ferket P.R. and Qureshi, M.A. 1996. Zinc

metabolism with special reference to its role in

immunity World Poult. Sci. J. 52: 309-324.

Satapathy et al.


184

Kienholz, E.W., Turk, D.E., Sunde, M.L. and Hoekstra, W.G.

1961. Effect of zinc deficiency in the diets of hens. J.

Nutr. 75: 211-221.

Leeson, S.2003. A new look at trace mineral nutrition of

poultry: Can we reduce the environmental burden

of poultry manure? Pages 125-129 in Nutritional

Biotechnology in the Feed and Food Industries. Proc.

Alltech’s 19th Ann. Symp. T. P. Lyons and K. A. Jacques,

Ed. Nottingham Univ. Press Nottingham, UK.

Moghaddam, H.N. and Jahanian, R. 2009. Immunological

responses of broiler chicks can be modulated by

dietary supplementation of zinc methionine in place of

inorganic zinc sources. Asia-Australas. J. Anim. Sci.

22: 396-403.

Nollet, L., Klis, J.D., Lensing, M. And Spring, P. 2007. Effect of

replacing inorganic with organic trace minerals in broiler

diets on productive performance and mineral

excreation. J. Appl. Poult. Res. 16: 592-597.

Parak, Tomas and Strakova, E. 2011. Zinc as a feed

supplement and its impact on plasma cholesterol

concentrations in breeding cocks. Acta Vet. Brno. 80:

281-285.

Richards, J.D., Zhao, J., Robert, J.H., Cindy, A.A. and Julia,

J.D. 2010. Trace mineral nutrition in poultry and swine.

Asia-Australas. J. Anim. Sci. 23: 1527-1534.

Rossi, P., Rutz, F., Anciuti, M.A., Rech, J.L. and Zauk, N.H.F.

2007. Influence of graded levels of organic Zinc on

growth performance and carcass traits of broilers. J.

Appl. Poult. Res. 16: 219-225.

Scheideler, S.E. 1991. Interaction of dietary calcium,

manganese and manganese source (manganese oxide

or manganese methionine chelate) on chick

performance and manganese utilization. Biol. Trace

Elem. Res. 29: 217–223.

SPSS. 2008. Statistical Packages for Social Sciences,

Version 17.0, SPSS Inc., Illinois, USA.

Swiatkiewicz, S., Arczewskawlosek, A. and Jozefiak, D. 2014.

The efficacy of organic minerals in poultry nutrition:

review and implications of recent studies. World Poult.

Sci. J. 70: 475-486.

Talapatra, S.K., Ray, S.C. and Sen, K.C. 1940. The analysis

of mineral constituents in biological materials. 1.

Estimation of phosphorus, chloride, calcium,

magnesium, sodium and potassium in food stuff.

Indian J. Vet. Sci. Anim. Husb. 10: 243-258.

Zhao, J., Shirley, R.B., Vazquez-Anon, M., Dibner, J.J., Richards,

J.D., Fisher, P., Hampton, T., Christensen, K.D., Allard,

J.P. and Giesen, A.F. 2010. Effect of chelated trace

minerals on growth performance, breast meat yield,

and footpad health in commercial meat broiler. J. Appl.

Poult. Res.19: 365-372.




185

Indian Journal of

Animal Nutrition

Effect of Feeding Probiotics and Milk Powder Supplemented Creep

Ration on the Growth Performance and Efficiency of Feed Utilization

in Pre-weaning Piglets

Monica Tissopi1, J.P. Bordoloi1, Jakir Hussain1, H. F. Ahmed2and Rajib Kro3.1Department of Livestock Production and Management, College of Veterinary Science,

Assam Agricultural University, Guwahati-781 022, India

ABSTRACT

The experiment was conducted to study the effect of creep feeding and its enrichment with probiotics

and milk powder on the growth performance and efficiency of feed utilization in pre-weaning piglets. For the

study, 28 piglets of uniform size and body weight were selected from four litters of Hampshire sows of similar

parity and allocated to 4 different dietary groups: T0 (fed conventional creep feed alone, control), T

1 (fed 5%

milk powder supplemented creep feed), T2 (fed probiotics supplemented creep feed added at 1g per kg creep

feed) and T3 (fed creep feed supplemented with 5% milk powder + probiotics at 1g per kg creep feed). The

experimental protocol was followed upto weaning age. Body weights at 8th week of age was found to be

significantly (P<0.01) higher in the treatment groups as compared to the control group. Piglets getting

combined supplementation of milk powder and probiotics (T3) had highest (P<0.01) feed consumption with

better feed gain ratio followed by T2, T

1 and T

0 groups. It was concluded that supplementation of probiotics

and milk powder in the creep ration of suckling piglets resulted in a positive impact on their growth performance

with an efficient feed utilization.

Key words: Feed conversion ratio, Growth performance, Hampshire piglets, Milk powder, Probiotics,

Pre-weaning

1Corresponding author; Email: [email protected]; 2Department of Animal Nutrition, College of Veterinary Science, Assam

Agricultural University, Guwahati-781022, India; 3Department of Livestock Production and Management, Vanbandhu College of Veterinary

Science and Animal Husbandry, Navsari Agricultural University, Navsari-396 450, India.

INTRODUCTION

The strong positive relationship between

weaning weight and growth of pigs post-weaning

suggests that there are considerable economic

advantages associated with increasing the weaning

weight of pigs (Mahan and Lepine, 1991). Thus,

efficient piglet rearing right from their birth undoubtedly

is an important aspect of overall successful pig farming.

Though sow milk consumption remains as the main

source of nutrients for neonatal pigs, providing

alternative food sources may offer numerous benefits

(Sulabo, 2009). Another interesting fact is that the time

that milk is available to the piglets is only approximately

10 to 20 seconds (Fraser, 1980), so the piglets should be

able to start suckling as soon as milk is available,

because a 5-second delay will cause a 25 to 50% loss

of access to milk. As such, the importance of a quality

creep feed holds more goods especially in case of

prolific sows with larger litters and less functional


doi: 10.5958/2231-6744.2020.00030.4

mammary glands (Sarandan et al., 2009). Thus, an

appropriate creep feeding practice of the suckling

piglets from an early age of 7 to 10 days or so in a

standard management environment makes possible the

farmers to obtain higher litter weight at weaning.

When the basal liquid milk diet is reduced and

the stage where-in the piglets are offered with solid

creep feed from the 10th day after birth, the digestive

physiology changes wherein the intervention of

different feed additives is needed to have the maximum

nutrient utilization (Suiryanrayna et al., 2015). Among

various feed additives, probiotics is gaining importance

as a potential alternative to antibiotics to improve

production efûciency of animals, including pigs (Lee et

al., 2010). Probiotics may contain one or more strains

of microorganisms and may be given either alone or in

combination with other additives in feed or water

(Thomke and Elwinger, 1998). Also, the effects of

probiotics appear to be more consistent and positive in


186

piglets rather than in growing finishing pigs (William,

2000). Pollmann et al. (1980) in his study found

improved feed utilization in piglets with feeding probiotics

(PROBIOS) alone or in conjugation with lactose, which

is a milk sugar.

Therefore, the hypothesis of the present study is

that the nutrient intake and efficiency of nutrient

utilization is limited in suckling piglets and that higher

pre-weaning growth rates can be achieved through

supplemental nutrient sources by providing milk powder

and probiotics incorporated creep feed to suckling

piglets. Considering the above facts and views, the

present research work of feeding milk powder and

probiotics supplemented creep feed was undertaken to

study their effect on growth performance and efficiency

of feed utilization in pre-weaning piglets.


The animal experimental protocol was approved

by the Institutional Animal Ethics Committee (IAEC) of

the Assam Agricultural University and carried out as

per the guidelines of the Committee for the Purpose of

Control and Supervision of Experiments in Animals

(CPCSEA), Ministry of Environment, Forest and

Climate Change, Government of India.

The experiment was conducted at the 30-Sow

Teaching Unit of the Department of Livestock

Production and Management while laboratory analysis

of feed samples was done in the Department of Animal

Nutrition, College of Veterinary Science, Assam

Agricultural University, Khanapara, Guwahati, India.

Four Hampshire litters from sows of similar parity were

selected for the study. Seven healthy piglets of uniform

size and body weight were selected from each of the

litters constituting one group and thus four dietary

groups were formed. So, a total of 28 numbers of

experimental animals were finally selected for feeding

trial and recording of experimental data. Each of the

experimental piglets was randomly assigned to one of

the four dietary groups viz., T0 (fed conventional creep

feed alone, control), T1 (fed creep feed supplemented

with 5% milk powder of Sagar brand i.e 5 kg milk

powder were added in addition to 100 kg of basal feed),

T2 (fed creep feed supplemented with probiotics of

Probiotics and milk powder as feed additives in suckling piglets

Table 1. The formula of the basal conventional

farm ration

Name of the ingredients kg/100 kg

Maize crushed 50

Wheat bran 12

Ground nut cake (de-oiled) 27

Fish meal 8

Mineral mixture 2.5

Salt 0.5

Vitamins (A,D,E,K) Added at 200 g/

100 kg feed

Table 2. Composition of farm ration, milk powder (Sagar brand) and probiotics (Probios)

Farm ration (%) Milk powder (per 100 g) Probiotics (Viable lactic

acid bacteria/ gm)

DM (basal feed) 95 Energy (kcal) 366 Enterococcus faecium, 10 million

Lactobacillus acidophilus, CFU

Lactobacillus casei and

Lactobacillus plantarum

DM (left over feed) 92 Total fat (g) 1.5

on % DM basis

Crude protein 22.1 Total carbohydrate (gm) 52

Ether extract 5.06 Protein(g) 35

Crude fibre 4.75 Sodium (mg) 549

Total ash 7.75 Calcium (mg) 1200

NFE 60.34


187

Probios brand added at 1g per kg creep feed i.e 100 g

probiotics were added in addition to 100 kg of basal

feed) and T3 (fed creep feed supplemented with 5%

milk powder + probiotics at 1g per kg creep feed).

All the experimental piglets were raised entirely

on their dams’ milk from birth to 7 days of age. From

day-8 onward, the piglets of T0, T

1, T

2 and T

3 groups

were offered respective experimental feed twice daily

as per the feeding schedule up to weaning at 56 days of

age. The piglets were separated from their sows daily

in the morning and evening for a period of 1 to 2 h

following suckling and offered feed in the outdoor run

and fed to appetite. The piglets were provided clean

water ad libitum round the clock. The formula of the

basal conventional farm ration and also compositions of

the farm ration, milk powder (Sagar brand) and probiotics

(Probios) used for the piglets are shown in Tables 1 and

2, respectively. The proximate analysis of the feed

samples was done as per methods described in AOAC

(1990).

The body weight of the individual piglets was

weighed using a hanging balance and recorded in kg in

the morning before offering feed and water. The first

(initial) body weights were recorded on 8th day morning

and then subsequently at weekly interval up to weaning

at 56 days of age. The body weight gain of the piglets in

a particular week were worked out by subtracting the

previous week’s body weight from the present body

weight and was recorded in kg.

The daily quantity of feed offered and leftover

thereon in each group of piglets were measured by

using a digital balance, and the consumption were

calculated by subtracting the left-over amount from the

quantity offered and was expressed in kg on D.M

basis. The daily feed consumption of the seven days of

a week was summed up to arrive at the weekly feed

consumption. The weekly feed conversion ratio (FCR)

was calculated as feed consumed in a week/ body

weight gain during that week (Sapra and Shingari, 1991).

Data obtained were subjected to ANOVA (two-way

analysis) using software package of SAS (Guide4.3).

Treatment means were separated by Duncan multiple

range test and level of significance was set at P<0.05.


The findings of this study indicated that both the

overall and final body weights at 8 weeks of age (Table

3) of all the four groups differed significantly (P<0.01)

among themselves, it was highest in probiotics cum milk

powder group (T3), followed by probiotics (T

2), milk

powder (T1) and was lowest in control group (T

0).

The results showed that probiotics and milk powder

supplementation had significant positive effect (P<0.01)

on body weight of the piglets in all the subsequent weeks.

The present findings are in agreement with the findings

of King et al. (1998), who reported that litters given

milk supplements grew faster than litters receiving no

supplemental milk. Researchers like Novotni-Danko

et al. (2015) and Azain et al. (1996) also reported

significantly higher body weights of piglets at weaning

in milk supplemented group than the control group. The

findings of significant effect of probiotics in body weight

is well supported by Venkatachalapathy et al. (2013)

who found in their study that concentrate feed mixture

supplemented with multi-species probiotics strains

showed significantly higher litter weight at weaning than

the control fed only concentrate mixture.

The result of average weekly body weight gains

(Table 3) was found to be highest in T3 followed by T

2,

T1 and T

0 group. The differences were significant

(P<0.01) among all the four dietary groups. The piglets

showed a trend of steady weekly gain from 2nd week

onward in all the treatment groups. The better growth

performance in T3 group could be attributed to the

probiotics action of stabilization of gut microbiota

resulting in better digestion and utilization of nutrients in

milk powder enriched ration. Researchers like Rava

(1991) found that milk powder supplementation in diet

resulted in significantly higher weight gain than the

un-supplemented piglets. Ha et al. (2011) in an

experiment found that creep feed with milk replacer

from early lactation may be effective for increasing

weight gain of light piglets. On the contrary, Douglas et

al. (2014) observed no significant difference at any stage

from birth to slaughter in the average daily gain (ADG)

of piglets given access to supplementary milk or

not (P>0.05). In respect of effect of probiotics

Tissopi et al.


188

supplementation, Pollmann et al. (1980) found that

addition of PROBIOS with lactose in feed tended to

improve average daily gain in starter pigs. Abe et al.

(1995) in a trial, obtained higher body weight gain

in probiotics fed newborn piglets than the control

group. On the contrary, Shim et al. (2005) and Lahteinen

et al. (2015) found no significant effect of dietary

supplementation of probiotics on body weight gain in

piglets.

Feed consumption (Table 4) was significantly

(P<0.01) different in treatment groups as compared to

control groups, it was the highest in group T3 getting

combined supplementation of milk powder and probiotics,

followed by T2, T

1 and the lowest value was observed

in group T0. It is inferred that feed consumption pattern

is positively influenced by the palatability of the ration

due to addition of milk powder. Result of this

experiment is in agreement with the findings of Kharpran

(2014) and Toi (2017) who reported that piglets

supplemented with probiotics had higher feed

consumption than piglets with no supplementation of

probiotics. Furthermore, Pustal et al. (2015) also

reported significantly (P<0.01) more creep feed

consumption in milk supplemented group of piglets

than piglets of control group. However, the finding of

Dlamini et al. (2017) is contradictory to the present

result, which reported that the supplementation of

probiotics had no effect on feed intake of the piglets.

These differences to the present findings may be due to

the different managemental practices followed and type

of supplements or probiotics used.

The FCR values (Table 4) of T2 and T

3 was

significantly lower (P<0.01) than T0 andT

1, also FCR

value of T1 was significantly lower (P<0.01) than T

0.

The lower FCR in T3 and T

2 than T

1 and T

0 is due to the

higher body weight gain in relation to feed consumption

Table 3. Average weekly body weight (kg) and body weight gain (kg) of piglets of different treatment

groups

Weeks Parameters Treatment groups*

T0

T1

T2

T3

1st Body weight 2.28a±0.01 2.31a±0.02 2.32a±0.01 2.30a±0.01

2nd Body weight 2.76b±0.04 3.10a±0.04 3.18a±0.04 3.23a±0.06

Body weight gain 0.51c±0.01 0.79b±0.03 0.86ab±0.03 0.93a±0.02

3rd Body weight 3.36d±0.03 4.05c±0.04 4.23b±0.05 4.39a±0.03

Body weight gain 0.60c±0.01 0.97b±0.49 1.05b±0.03 1.17a±0.02

4th Body weight 4.19c±0.03 5.06b±0.04 5.48a±0.12 5.60a±0.11

Body weight gain 0.82d±0.01 0.99c±0.03 1.08b±±0.03 1.21a±0.03


Body weight gain 1.03c±0.02 1.10b±0.03 1.25a±0.03 1.30a±0.01


Body weight gain 1.16b±0.075 1.21b±0.03 1.27b±0.03 1.54a±0.03

7th Body weight 7.50d±0.03 8.61c±0.10 9.43b±0.09 10.29a±0.08

Body weight gain 1.15c±0.04 1.24c±0.01 1.72b±0.05 1.85a±0.03

8th Body weight 8.78d±0.07 9.94c±0.10 11.23b±0.09 12.40a±0.05

Body weight gain 1.28c±0.03 1.33c±0.05 1.81b±0.05 2.11a±0.05

Overall Body weight 5.05d±0.30 5.83c±0.34 6.38b±0.40 6.70a±0.44

Body weight gain 0.94d±0.04 1.09c±0.03 1.29b±0.05 1.4a±0.06

*(P<0.05); **a,b,c Means with different superscript differ significantly; *Piglets of the control group (T0) were fed conventional creep feed

alone, whereas, basal diet was supplemented with 5% milk powder (Sagar brand), probiotics (Probios brand) added at 1g per kg creep feed,

and 5% milk powder + 1g probiotics per kg creep feed in groups T1, T

2 and T

3, respectively.



189

rate in T2 and T

3 groups as compared to T

0 and T

1

groups. Researcher like Pollmann et al. (1980) found

that Probios, a probiotics alone or in conjugation with

lactose, a milk sugar to improve feed utilization.

Contrary to the present findings, Toi (2017) did not

observe any significant difference of FCR in piglets fed

with solid-state fermented feed (done by Lacto-

bacillus plantarum) from the control piglets. These

differences to the present findings may be due to the

different managemental practices followed and type of

supplements or probiotics used.

CONCLUSION

The results of the present study conclude that

feeding of a suitable probiotic is always beneficial while

simultaneous enrichment of the feed with a good

supplement like milk powder is even better for the

piglets to attain maximum weight at weaning and might

affect their post weaning growth performance.

Table 4. Average weekly feed consumption (kg/piglet) and feed conversion ratio (FCR) of piglets of

different treatment groups

Weeks Parameters Treatment groups*

T0

T1

T2

T3

2nd Feed Consumption 0.42c±0.01 0.55b±0.01 0.57b±0.01 0.62a±0.01

FCR 0.83a±0.02 0.70b±0.03 0.66b±0.02 0.67b±0.02

3rd Feed Consumption 0.58d±0.01 0.74c±0.01 0.79b±0.01 0.85a±0.01

FCR 0.97a±0.02 0.77b±0.04 0.76b±0.03 0.73b±0.01

4th Feed Consumption 0.75d±0.02 0.87c±0.01 0.98b±0.01 1.14a±0.01

FCR 0.92a±0.02 0.88a±0.02 0.92a±0.02 0.95a±0.02

5th Feed Consumption 0.89d±0.00 0.98c±0.01 1.12b±0.02 1.25a±0.01

FCR 0.86b±0.01 0.89b±0.02 0.90b±0.03 0.96a±0.01

6th Feed Consumption 1.05c±0.04 1.15b±0.03 1.20b±0.01 1.40a±0.02

FCR 0.93a±0.06 0.95a±0.04 0.95a±0.015 0.91a±0.01

7th Feed Consumption 1.11c±0.03 1.21b±0.01 1.48a±0.02 1.50a±0.03

FCR 0.97a±0.04 0.97a±0.01 0.87b±0.03 0.81b±0.02

8th Feed Consumption 1.25c±0.03 1.31c±0.03 1.68b±0.02 1.88a±0.01

FCR 0.98a±0.04 0.99a±0.04 0.94a±0.04 0.90a±0.02

Overall Feed Consumption 0.86d±0.04 0.97c±0.04 1.12b±0.05 1.23a±0.02

FCR 0.92a±0.02 0.89b±0.02 0.86c±0.02 0.85c±0.02

*(P<0.05); **a,b,c Means with different superscript differ significantly; *Piglets of the control group (T0) were fed conventional creep feed

alone, whereas, basal diet was supplemented with 5% milk powder (Sagar brand), probiotics (Probios brand) added at 1g per kg creep feed

, and 5% milk powder + 1g probiotics per kg creep feed in groups T1, T

2 and T

3, respectively.

REFERENCES

Abe, F., Ishibashi, N. and Shimamura, S. 1995. Effect of

administration of bifido bacteria and lactic acid

bacteria to newborn calves and piglets. J. Dairy Sci.

78: 2838-2846.

AOAC, 1990. Official Methods of Analysis. 15th edn.


Washington, DC., USA, pp. 152-164.

Azain, M.J., Tomkins, T., Sowinski, J.S., Arentson, R.A. and

Jewell, D.E. 1996. Effect of supplemental pig milk

replacer on litter performance: Seasonal variation in

response. J. Anim. Sci. 74: 2195-2202.

Dlamini, Z.C., Langa, R.L.S., Aiyegoro, O.A. and Okoh, A.I.

2017. Effects of probiotics on growth performance,

blood parameters, and antibody stimulation in

piglets. S. Afr. J. Anim. Sci.47: 766-775.

Douglas, S.L., Edwards, S.A. and Kyriazakis, I. 2014.

Management strategies to improve the performance of

low birth weight pigs to weaning and their long-term

consequences. J. Anim. Sci. 92: 2280-2288.

Fraser, D.1980. A review of the behavioural mechanism of milk

ejection of the domestic pig. Appl. Anim. Ethol. 6:

Tissopi et al.


190

247-255.

Ha, D.M., Jang, K.S., Won, H.S., Ha, S.H., Park, M.J., Kim,

S.W. and Lee, C. 2011. Effects of creep feed and milk

replacer and nursery phase-feeding programs on

pre-and post-weaning growth of pigs. J. Anim. Sci.

Technol.53: 333-339.

Kharpran, S. 2014. Performance of Pre-Weaned Hampshire

Piglets fed with Dietary Supplementation of Dried

Brewing Yeast. M.V.Sc. Thesis. College of Veterinary

Science, (Assam Agricultural University), Guwahati-

781022, Assam, India.

King, R.H., Boyce, J.M. and Dunshea, F.R. 1998. Effect of

supplemental nutrients on the growth performance of

sucking pigs. Aust. J. Agric. Res. 49: 883-887.

Lahteinen, T., Rinttila, T., Koort, J.M.K., Kant, R., Levonen,

K., Viljanen, M.J., Bjorkroth, J. and Palva, A. 2015.

Effects of a multispecies Lactobacillus formation as a

feeding supplement on the performance and immune

function of piglets. Livest. Sci. 180: 164- 171.

Lee,K.W., Lillehoj,H.S. and Siragusa,G.R. 2010. Direct-fed

microbials and their impact on the intestinal microflora

and immune system of chickens. J. Poult. Sci.47:

106-114.

Mahan, D.C. and Lepine, A.J. 1991. Effect of piglet weaning

weight and associated nursery feeding programs on

subsequent performance to 105 kilograms body weight.

J. Anim. Sci. 69: 1370-1378.

Novotni Danko, G., Balogh, P., Huzsvai, L. and Gyori, Z. 2015.

Effect of feeding liquid milk supplement on litter

performances and on sow back-fat thickness change

during the suckling period. Arch. Anim. Breed.58:

229-235.

Pollmann, D.S., Danielson, D.M. and Peo, E.R. 1980. Effect of

Lactobacillus Acidophilus on starter pigs fed a diet

supplemented with lactose. J. Anim. Sci. 51: 638-644.

Pustal, J., Traulsen, I., Preibler, R., Muller, K., Grosse Beilage,

T., Borries, U. and Kemper, N. 2015. Providing

supplementary, artificial milk for large litters during

lactation: effects on performance and health of sows

and piglets: a case study. Porcine Hlth. Manage. 1:

1-13.

Rava, S. 1991. Effect of Skim Milk Feeding and Early

Weaning on the Growth Performance of Hampshire

Pigs. M.V.Sc. Thesis. College of Veterinary Science,

(Assam Agricultural University), Guwahati-781 022,

Assam, India.

Sapra, K.L. and Shingari, B.K. 1991. Effect of feeding livol on

growth in Turkeys. Indian J. Indg. Med. 8: 96-98.

Sarandan, H., Sarandan, R., Petroman, I., Ognean, L., Sarandan,

M., Rada, O., Balint, A. and Faur, B. 2009. Growth rate

and mortality in suckling piglets and their correlation

to the sows’ milk yield. Scientific Papers Anim. Sci.

Biotechnol. 42: 277-282.

Shim, S.B., Verstegen, M.W.A., Kim, I.H., Kwon, O.S.

and Verdonk, J.M.A.J. 2005. Effects of feeding

antibiotic-free creep feed supplemented with

oligofructose, probiotics or synbiotics to suckling

piglets increases the preweaning weight gain and

composition of intestinal microbiota. Arch. Anim.

Nutr. 59: 419-427.

Suiryanrayna, M.V. and Ramana, J.V. 2015. A review of the

effects of dietary organic acids fed to swine. J. Anim.

Sci. Biotechnol. 6: 45.

Sulabo, R.C. 2009. Influence of Creep Feeding on Individual

Consumption Characteristics and Growth

Performance of Neonatal and weanling Pigs. Ph.D.

Dissertation, Department of Animal Sciences and

Industry, College of Agriculture, Kansas State

University.

Thomke, S. and Elwinger, K. 1998. Growth promotants in

feeding pigs and poultry II. Mode of action of

antibiotic growth promotants. Ann. Zootech.47:

153-167.

Toi, S.M. 2017. Effect of Feeding Solid State Fermented

Ration on the Performance of Hampshire Piglets.

M.V.Sc. Thesis. College of Veterinary Science, (Assam

Agricultural University), Guwahati-781022, Assam,

India.

Venkatachalapathy, R.T., Gopalakrishnan, S.P. and Usha, A.P.

2013. Effect of Probiotics Supplementation on the

Performance of Preweaned Piglets. Probiotics In:

Sustainable Food Production: Current Status and

Future Prospects “Probiotics in Food Production”,

Ramanathan, A. and Senthivel, T. (Eds.), 2, p.281.

William, H C. 2000. Producing pigs without antibiotic growth

promoters. Adv. Pork. Prod. 11: 47-56.




191

Indian Journal of

Animal Nutrition

Effect of Graded Levels of Broken Rice on Egg Quality of White Pekin

Ducks during Second Year of laying

P.K. Naik*, B.K. Swain, S.K. Sahoo, D. Kumar and S.K. MishraICAR-Central Avian Research Institute Regional Centre, Bhubaneswar, Odisha-751 019, India

ABSTRACT

A study was conducted to find out the effect of feeding different levels of broken rice (BR) replacing

wheat in the diet of White pekin ducks in second year of laying on egg quality parameters. White pekin laying

ducks (75; 82 weeks) were divided into five groups; and diets without (BR-0) and with BR, replacing 25 (BR-25),

50 (BR-50), 75 (BR-75) and 100 (BR-100) percent of wheat; were fed for a period of 73 days. There was no

significant difference in the egg weight, albumen index, yolk index, Haugh unit, shell thickness (without

membrane), percentage of albumen, yolk and shell. The egg shape index was significantly (P<0.05) higher in

BR-100 than BR-0. The shell thickness with membrane was significantly (P<0.05) higher in all the groups fed

broken rice than the control group. It can be concluded that wheat can be completely replaced by broken rice

in the diets of white Pekin laying ducks during second year of egg production without affecting egg quality.

Key words: Ducks, Egg, Rice, Wheat, White Pekin, Quality


doi: 10.5958/2231-6744.2020.00031.6

(BR-75) and 100 (BR-100), percent of wheat (Table

1). White Pekin laying ducks (n=75; 82 weeks of age)

were divided into five groups; each group having three

replicates with five ducks per replicate, and were

allocated randomly to either of the above five diets for a

period of 73 days. All the birds were reared on deep

litter system and were fed the respective diets ad lib.

during the experimental period. Standard management

practices were followed and clean drinking water was

made available ad lib. throughout the experiment. For

external egg quality parameters, weight, length and width

of the egg were recorded weekly and the egg shape

index was calculated. For internal egg quality

parameters, percent of albumen, yolk, shell, shell

thickness; and length, width and height of albumen and

yolk were recorded weekly; and albumen index, yolk

index and Haugh unit were calculated. The external egg

quality parameters were determined as per the formula

of Shultz (1953); while the internal egg quality

parameters were calculated as per the formula of

Heiman and Carver (1936), Sharp and Powell (1930),

Haugh (1937) and Funk (1948). The data were

statistically analysed for the test of significance

(Snedecor and Cochran 1994).

The chemical compositions of the feeds are

*Corresponding author; E-mail: [email protected]

In India, ducks contribute next to chicken, in total

egg and bird meat production. Therefore, special

emphasis is being given on duck farming to meet the

egg and meat requirements of the country. There are

many advantages of ducks over chickens, in which

laying potential in second year is one of them. White

Pekin ducks are used both for egg and meat production.

Wheat is used as a source of energy in duck feed (Behera

et al., 2016). However, in rural areas, farmers prefer to

keep ducks in back-yard with supplementation of

locally available feed ingredients (Sahoo et al., 2014;

Swain et al., 2018). Broken rice or rice kani is available

throughout India and its price is usually lower to that of

other cereals (Tyagi et al., 2014). As the cost of wheat

is increasing exorbitantly, the locally available broken

rice is being preferred by the farmers for feeding their

ducks. However, very little literature is available on

feeding of broken rice to ducks, particularly in second

year of laying. Therefore, a study was conducted to

find out the effect of feeding different levels of broken

rice replacing wheat on egg quality in White Pekin ducks

during second year of laying.

Five iso-nitrogenous and iso-caloric diets were

prepared without (BR-0) and with the inclusion of

broken rice (BR), replacing 25 (BR-25), 50 (BR-50), 75

SHORT COMMUNICATION


192

presented in Table 1. All the diets were iso-nitrogenous

(18.33-18.37 %CP) and iso-caloric (2614-2661kcalME/

kg). The egg weight (71.33-73.33, g) was similar among

the groups (Table 2). Earlier workers (Rath et al., 2016;

Swain et al., 2018) have also reported similar egg weight

(72.05-72.52) in White Pekin ducks. However, higher

(74.61-74.79 g) and lower egg weights (59.03 g) in

White Pekin ducks have also been reported by Swain et

al. (2018) and Kavitha et al. (2017), respectively than

the present study. In general, egg weight in ducks is

heavier than the chickens; and further, egg weight in

White Pekin is higher than the other breeds of ducks,

that might be due to their heavier body weight. The egg

shape indices in all the BR fed groups (71.03-73.44)

Table 1. Ingredient composition (%) of feeds

Attributes Diets

BR-0 BR-25 BR-50 BR-75 BR-100

Ingredients

Wheat 55 41 27.5 14 0

Broken rice 0 14 27.5 41 55

Soybean meal 25 26 27.5 29 31

De-oiled rice bran 07 06 4.5 3.0 01

Oyster shell 10 10 10 10 10

Di-calcium phosphate 02 02 02 02 02

Calcite 01 01 01 01 01

Trace minerals 0.5 0.5 0.5 0.5 0.5

DL-methionine 0.2 0.2 0.2 0.2 0.2

Lysine 0.1 0.1 0.1 0.1 0.1

Vitamin AD3B2K 0.025 0.025 0.025 0.025 0.025

Vitamin E and Se 0.03 0.03 0.03 0.03 0.03

Vitamin B Complex 0.025 0.025 0.025 0.025 0.025

Toxin binder 0.15 0.15 0.15 0.15 0.15

Choline chloride 0.15 0.15 0.15 0.15 0.15

Dry matter and nutrient content (%DM)

Dry Matter 96.63 97.37 98.20 97.84 98.70

Organic Matter 87.63 87.64 87.81 87.79 87.95

Crude Protein 18.36 18.37 18.36 18.33 18.37

Ether Extract 1.45 1.60 1.61 1.57 1.44

Crude Fibre 9.75 9.82 9.67 9.72 9.65

NFE 58.07 57.85 58.17 58.17 58.49

Total Ash 12.37 12.36 12.19 12.21 12.05

Calculated nutrient supply

Energy (ME, kcal/kg) 2614 2620 2661 2638 2650

Lysine (%) 1.03 1.05 1.07 1.10 1.13

Methionine (%) 0.52 0.53 0.54 0.54 0.55

Ca (%) 4.64 4.64 4.63 4.62 4.61

Available P (%) 0.59 0.59 0.58 0.58 0.58

NFE, nitrogen free extract; ME metabolizable energy

Effect of broken rice on egg quality of White Pekin ducks


193

were similar; however, the egg shape index in BR-100

group was higher (P<0.05) than the BR-0 (68.97). Egg

shape index of 74.36-77.63 (Rath et al., 2016); 75.63

(Kavitha et al., 2017); and 71.12-72.69 (Swain et al.,

2018) have been reported by the earlier workers in White

Pekin ducks. There was no difference (P>0.05) in

albumen index (0.12-0.14), yolk index (0.41-0.46), and

Haugh unit ((94.13-96.00) among the groups. Our

findings corroborate well with those of the earlier

workers in White Pekin ducks (Rath et al., 2016;

Kavitha et al., 2017; Swain et al., 2018). The egg

contents viz. percentage of albumen (51.09-51.51), yolk

(33.52-33.97) and shell weights (14.94-15.03) were

similar among the groups. However, similar albumen

weight (50.32-55.10%), but higher yolk weight (34.53-

36.87%) and lower shell weight (9.07-13.63%) have

been reported by the earlier workers (Rath et al., 2016;

Swain et al., 2018). The CP content of wheat is higher

(10.30%) than BR (7.9%) and the comparative amino

acid profile of the two cereals reveals that wheat

contains higher amount of lysine than BR (0.47 vs 0.42

%) (Singh and Panda, 1996; Panda, 2013). In spite of

these, no adverse impact on egg quality parameters was

observed, when wheat was replaced completely with

BR. It could be explained on the basis that the absolute

contribution of cereal grains to the CP (23.68-30.88 %),

lysine (20.35-25.24%) and methionine (21.82-23.08%)

supply is rather low. Moreover, the rations were

balanced to be iso-nitrogenous by adjusting the amount

of soybean meal in the ration. The shell thickness (mm)

with membrane was higher (P>0.05) in all the groups

fed broken rice (0.52-0.53, mm) than the control group

(0.50); however, the shell thickness without membrane

(0.43-0.44, mm) were similar (P>0.05) among the

groups. Lower (0.35-0.47, mm) and higher (0.55-0.56,

mm) egg shell thickness have also been recorded in White

Pekin ducks (Palanivel and Harikrishnan, 2011; Rath

et al., 2016; Kavitha et al., 2017; Swain et al., 2018).

However, egg shell thickness without membrane of 0.46-

0.48 mm have been observed by Swain et al. (2018),

which are very much close to the findings of the present

study. The similar shell thickness (without membrane)

among the groups indicates that shell thickness was not

affected by substitution of wheat with BR, even though

wheat contains higher (0.18%) Ca than BR (0.11%); as

the contribution of the cereals to total Ca supply was

only 1.30-2.2% (Singh and Panda, 1996). Thus, the

reduction in absolute Ca supply due to substitution of

Table 2. Effect of feeding graded levels of broken rice, by replacing wheat on egg quality

Parameters Treatments SEM

BR-0 BR-25 BR-50 BR-75 BR-100

External egg quality

Egg weight (g) 71.53 72.51 73.33 72.47 71.33 0.30

Egg shape index 68.97a 71.03ab 71.16ab 71.36ab 73.44b 0.46

Internal egg quality

Albumen index 0.12 0.12 0.13 0.13 0.14 <0.01

Yolk index 0.41 0.42 0.43 0.43 0.46 0.01

Haugh Unit 94.15 94.13 94.99 95.34 96.00 0.30

% Albumen weight 51.51 51.33 51.09 51.33 51.21 0.27

% Yolk weight 33.52 33.71 33.97 33.72 33.75 0.12

% Shell weight 14.97 14.96 14.94 14.95 15.03 0.21

Shell thickness 0.50a 0.52b 0.53b 0.53b 0.53b <0.01

with membrane (mm)

Shell thickness without 0.43 0.43 0.44 0.44 0.44 <0.01

membrane (mm)

a,bMean with different superscript in a row differ significantly

Naik et al.


194

wheat was rather meagre to cause any adverse impact

on shell formation.

It can be concluded that wheat can be completely

replaced by broken rice in the diets of white Pekin

laying ducks during second year of egg production

without affecting egg quality.

ACKNOWLEDGEMENT

The authors are thankful to Indian Council

ofAgricultural Research (ICAR), New Delhi; for

providing financial support to conduct the study.

REFERENCES

Behera, N.K., Babu, L.K., Sahoo, S.K., Giri, S.C., Pati, P.K.,

Panigrahi, B. And Joshi, S.K. 2016. Effect of feeding

different levels of protein on mortality, carcass

characteristics, biochemical parameters, time motion

study and economics of desi ducks under intensive

system of rearing. Asian J. Anim. Sci. 10: 106-112.

Funk, E.M. 1948. The relation of yolk index determined in

natural position to the yolk index as determined after

separating the yolk from the albumen. Poult. Sci.27:

367.

Haugh, R.R. 1937. The Haugh unit for measuring egg quality.

U.S. Egg and Poultry Magazine, 43: 552-555 and 572-

573.

Heiman, V., and Carver, J.S. 1936. The albumen index as a

physical measurement of observed egg quality. Poult.

Sci.15: 141-148.

Kavitha, K., Manohar, G.R., Vairamuthu, S., and Ramamurthy,

N. 2017. Comparative study of egg quality traits in

White Pekin and indigenous ducks of Tamilnadu. Int.

J. Sci., Environ. Technol. 6: 3520-3523.

Palanivel, P. and Harikrishnan, S. 2011. A glance at internal

and external qualities of Kuttand, White Pekin and

commercial duck eggs. Egg Quality-Engormix.

Panda, A.K. 2013. Cereals & their byproducts. In Poultry

Feedstuffs and feed additives. PP 25-52. Hind

Publications (ISBN-978-93-83397-00-6). Hyderabad,

India.

Rath, R., Mishra, M., Panigrahi, B., Singh, V., Tewari, H.

and Tyagi, K. 2016. Effect of dietary choline

supplementation on egg quality and serum

biochemical profile in White Pekin ducks. Indian J.

Anim. Res., DOI: 10.18805/ijar.9639.

Sahoo, S.K., Naskar, S.K., Giri, S.C., Padhi, M.K.and Panda,

S.K. 2014. Performance of White Pekin ducks on

replacement of maize with cassava tuber meals. Anim.

Nutr. Feed Technol., 14: 291-300.

Singh, K.S. and Panda, B. 1996. Poultry Nutrition. Kalyani

Publishers, New Delhi, India.

Sharp, P.F. and Powell, C.K. 1930. Decrease in internal quality

of hens egg during storage as indicated by the yolk.

Indian J. Chem. 22: 909-910.

Shultz, P.T. 1953. Analysis of egg shape in chickens.

Biometrics. 9: 336.


8th edn. Oxford and IBHPublishing Co. Calcutta, India.

Swain, B.K., Naik, P.K., Sahoo, S.K., Mishra, S.K. and Kumar,

D. 2018.Effect of Feeding of Azolla (Azollapinnata) on

the Performance of White Pekin Laying Ducks. Int. J.

Livest. Res. 8: 248-253.

Tyagi, P.K., Tyagi, P.K. and Mandal, A.B. 2014. Broken rice.

In: Feed stuffs for livestock and poultry (Mandal. A.

B., Elangovan, A. V., Tyagi, P. K., Tyagi, P. K. And

Singh, R.; eds.), pp.21-23. CARI, Izatnagar, UP, India.

Effect of broken rice on egg quality of White Pekin ducks


Received on 28-02-2-2020 and accepted on 22-07-2020

indian journal of animal nutrition

Documents

Transcript of indian journal of animal nutrition