Increased adherence and actin pedestal formation bydam-deficient enterohaemorrhagic Escherichia coliO157:H7

Kenneth G. Campellone,1 Andrew J. Roe,2

Anders Løbner-Olesen,3 Kenan C. Murphy,1

Loranne Magoun,1 Michael J. Brady,1

Arthur Donohue-Rolfe,4 Saul Tzipori,4

David L. Gally,2 John M. Leong1 and M. G. Marinus5*1Department of Molecular Genetics and Microbiology,University of Massachusetts Medical School, Worcester,MA 01655, USA.2Zoonotic and Animal Pathogens Laboratory, Center forInfectious Disease, The University of Edinburgh,Edinburgh EH16 4SB, UK.3Department of Life Sciences and Chemistry, RoskildeUniversity, DK-4000 Roskilde, Denmark.4Division of Infectious Diseases, Tufts University Schoolof Veterinary Medicine, North Grafton, MA 01536, USA.5Department of Biochemistry and MolecularPharmacology, University of Massachusetts MedicalSchool, Worcester, MA 01655, USA.

Summary

Enterohaemorrhagic Escherichia coli (EHEC) arehighly infectious pathogens capable of causingsevere diarrhoeal illnesses. As a critical step duringtheir colonization, EHEC adhere intimately to intesti-nal epithelial cells and generate F-actin ‘pedestal’structures that elevate them above surrounding cellsurfaces. Intimate adhesion and pedestal formationresult from delivery of the EHEC type III secretionsystem (TTSS) effector proteins Tir and EspFU into thehost cell and expression of the bacterial outer mem-brane adhesin, intimin. To investigate a role for DNAmethylation during the regulation of adhesion andpedestal formation in EHEC, we deleted the dam(DNA adenine methyltransferase) gene from EHECO157:H7 and demonstrate that this mutation resultsin increased interactions with cultured host cells.EHECDdam exhibits dramatically elevated levels ofadherence and pedestal formation when comparedwith wild-type EHEC, and expresses significantly

higher protein levels of intimin, Tir and EspFU. Analy-ses of GFP fusions, Northern blotting, reverse tran-scription polymerase chain reaction, and microarrayexperiments indicate that the abundance of Tir in thedam mutant is not due to increased transcriptionlevels, raising the possibility that Dam methylationcan indirectly control protein expression by a post-transcriptional mechanism. In contrast to otherdam-deficient pathogens, EHECDdam is capableof robust intestinal colonization of experimentallyinfected animals.

Introduction

Enterohaemorrhagic Escherichia coli (EHEC) are amongthe leading causes of food- and water-borne illnessesaffecting humans in the US, Europe and Japan (forreview, see Donnenberg and Whittam, 2001; Kaper et al.,2004; Spears et al., 2006). These bacteria are highlyinfectious and ingestion of only 100–200 organisms issufficient to trigger debilitating diarrhoeal disease.Although most EHEC infections resolve spontaneouslyafter 5–10 days of abdominal cramping and bloody diar-rhoea, approximately 2–7% of cases progress to thepotentially–fatal haemolytic uremic syndrome due, in part,to the production of cytotoxic Shiga toxins which arecapable of promoting kidney failure.

As a critical step during their colonization and patho-genesis, EHEC strains produce ‘attaching and effacing’(AE) lesions on the intestinal epithelial cell surface (forreview, see Dean et al., 2005; Garmendia et al., 2005;Hayward et al., 2006). These lesions are marked bydestruction of brush border microvilli and intimate bacte-rial adhesion to enterocytes. Localized cellular accumula-tion of actin filaments (F-actin) beneath these adherentbacteria generates ‘pedestals’ that can elevate themabove the surrounding cell surfaces.

Both intimate adhesion and actin pedestal formationresult from the transfer of E. coli secreted proteins (Esps)into the host cell where they interact with mammaliansignalling molecules that control actin assembly. Transferoccurs via the bacterial type III secretion system (TTSS),which is encoded by a chromosomal pathogenicity islandcalled the locus of enterocyte effacement (LEE) (for

Accepted 9 January, 2007. *For correspondence. E-mailMartin.Marinus@umassmed.edu; Tel. (+1) 508 856 3330; Fax(+1) 508 856 2003.

Molecular Microbiology (2007) 63(5), 1468–1481 doi:10.1111/j.1365-2958.2007.05602.x

© 2007 The AuthorsJournal compilation © 2007 Blackwell Publishing Ltd

review, see Dean et al., 2005; Garmendia et al., 2005;Hayward et al., 2006). One of the Esps encoded withinthe LEE is Tir (translocated intimin receptor) (Kenny et al.,1997; Deibel et al., 1998; DeVinney et al., 1999), which isdelivered, with the help of its chaperone CesT, into theplasma membrane of target cells where it adopts ahairpin-loop conformation and serves as a receptor forintimin, an adhesin encoded by the LEE eae gene (Jerseet al., 1990). Intimin binds to the central extracellulardomain of Tir to trigger clustering of its N- and C-terminalcytoplasmic regions and subsequent actin assemblybeneath the plasma membrane (Rosenshine et al., 1996).A non-LEE-encoded effector, EspFU (also called TccP),associates with Tir and is essential for F-actin assemblybecause it promotes recruitment of the host actin-nucleating machinery to sites of bacterial adherence(Campellone et al., 2004; Garmendia et al., 2004).

Regulation of effector translocation by the EHEC TTSS,and thus intimate adhesion and actin pedestal formation,are highly co-ordinated processes subjected to extensivetranscriptional regulation (reviewed in Sperandio et al.,2003; Spears et al., 2006). The LEE activator and repres-sor proteins, GrlA and GrlR, respectively, control expres-sion of the critical LEE-encoded regulator, Ler (Mellieset al., 1999; Deng et al., 2004). Ler is capable of activat-ing the majority of operons found within the LEE (Fried-berg et al., 1999; Elliott et al., 2000), but may do so in onlysubpopulations of bacteria (Roe et al., 2004). Expressionof Ler, and therefore other LEE genes, are significantlyinfluenced by non-LEE-encoded factors that respond toexternal stimuli, including global regulatory systemsinvolving quorum sensing and the DNA organizingprotein, H-NS (Sperandio et al., 1999; Kanamaru et al.,2000; Bustamante et al., 2001).

An additional mechanism by which EHEC virulencegene expression could be controlled is via DNAmethylation. In non-pathogenic E. coli K-12 strains, thedam gene encodes a DNA adenine methyltransferase(Dam) with multiple functions during many cellular pro-cesses including chromosome replication, DNA mismatchrepair, stimulation of the SOS response, and transcrip-tional regulation (Lobner-Olesen et al., 2005; Wion andCasadesus, 2006). Indeed, loss of Dam in E. coli K-12alters the level of expression of many genes comparedwith wild type (Oshima et al., 2002; Lobner-Olesen et al.,2003; Robbins-Manke et al., 2005).

Dam has also been shown to play necessary roles inthe pathogenesis of a number of bacterial species. Forexample, in Salmonella enterica Serovar Typhiumurium,Dam can control the expression of multiple virulencefactors, including some TTSS effectors (the Sips) (Garcia-del Portillo et al., 1999; Heithoff et al., 1999). Thus, aS. enterica Serovar Typhiumurium dam mutant is severelydefective at cell invasion, avirulent in a murine infection

model, and can serve as an effective live vaccine (Garcia-del Portillo et al., 1999; Heithoff et al., 1999). Anotherenteric pathogen, Shigella flexneri exhibits partial defectsin intracellular growth and cell-to-cell spread followingdam inactivation (Honma et al., 2004). The dam gene isessential for the viability of Vibrio cholerae and somestrains of Yersinia pseudotuberculosis, where overex-pression of Dam leads to dysregulated secretion of type IIIeffectors (the Yops) and attenuation of virulence (Julioet al., 2001). Lastly, Dam directs phase variation in uro-pathogenic E. coli, because methylation of regulatory pro-moter sequences controls the binding of different proteinsthat modulate transcription of the gene encoding theadhesive Pap pilus (Hernday et al., 2003).

The most common disease-causing EHEC serotype isE. coli O157:H7 and the genome of strain EDL933 hasbeen completely sequenced. Not surprisingly, it contains adam gene that is 99% identical to dam from E. coli K-12(Perna et al., 2001). However, unlike K-12, which onlypossesses the archetypical dam gene, EDL933 harboursseveral prophages that are predicted to encode otherputative Dam-like methyltransferases of unknownfunction. We asked if the chromosomal prototype damgene is responsible for Dam methylation in EHEC, andbecause intimate adhesion and pedestal formation arecritical for pathogenesis and are controlled by intimin, theTTSS, Tir and EspFU, whether Dam methylation affectshost cell interactions by regulating the expression of thesevirulence factors. We show that deletion of the prototypedam gene of EHEC O157:H7 results in a loss of Dammethylation and a dramatic increase in adherence andactin pedestal formation on cultured human cells com-pared with wild-type EHEC. Increases in adherence andpedestal formation in vitro correlate with elevated proteinlevels of intimin, Tir and EspFU. Finally, consistent with itscapacity for vigorous interaction with mammalian cellsin vitro and unlike dam mutants of several other entericpathogens, the dam mutant of EHEC O157:H7 is capableof robust colonization of the intestines of infected animals.

Results

Deletion of the archetypical dam gene of EHECO157:H7 results in a mutant that exhibits DNAmethylation patterns, growth characteristics and mutatorphenotypes similar to those of an E. coli K-12 dammutant

To determine whether the prototype dam gene in EHECencoded a functional methyltransferase that was largelyresponsible for Dam methylation in this bacterium,Lambda Red-mediated recombination (Murphy andCampellone, 2003) was used to construct EHECDdam, adam-deleted mutant of TUV93-0 (which is referred to as

Dam regulation of EHEC virulence factors 1469

© 2007 The AuthorsJournal compilation © 2007 Blackwell Publishing Ltd, Molecular Microbiology, 63, 1468–1481

‘wild-type EHEC’ hereafter), a derivative of EHECEDL933 that is incapable of producing Shiga toxin. Toassess the DNA methylation state of wild-type EHEC andEHECDdam, these strains were transformed withpBR322, grown in Luria–Bertani (LB) media, and theirDNA subjected to restriction enzyme analyses usingSau3A, DpnI and DpnII. Sau3A digests DNA independentof its methylation state, whereas DpnI and DpnII digestmethylated and unmethylated DNA respectively. InFig. 1A, DNA fragments migrating faster than 4.4 kb arethose of pBR322 and those larger than this size arederived from chromosomal DNA. As expected, treatmentof DNA from wild-type EHEC with Sau3A and DpnIresulted in identical DNA digestion patterns, whereasDpnII was without effect (Fig. 1A, lanes 1–3). Conversely,the Sau3A and DpnII digestion patterns were the same forEHECDdam, but the DNA derived from this strain wasresistant to DpnI digestion (Fig. 1A, lanes 4–6). Thus, thearchetypical Dam protein is required for DNA methylationin EHEC under these common culturing conditions.

In E. coli K-12, dam mutants display subtle growthdefects, exhibit aberrant cellular morphology, haveincreased expression levels of SOS genes, and possesselevated mutation frequencies (Marinus, 1996; Lobner-Olesen et al., 2005; Wion and Casadesus, 2006). Asobserved for E. coli K-12, the optical densities of wild-typeEHEC and EHECDdam broth cultures were indistinguish-able over time (Fig. 1B). These patterns were unaffectedby the presence of a complementing Dam plasmid,pBRdam or a pBR322 vector control (Fig. 1B). However,when growth was measured by viable cell counts (colony-forming units), the dam mutant showed lower values thanwild type, a phenotype that could be complemented by thepresence of plasmid-encoded dam, but not pBR322(Fig. 1C). This apparent discrepancy between dam-proficient and dam-deficient strains is explained by anincreased tendency of EHECDdam to form elongatedbacilli (Fig. 1D) and/or interconnected filaments as hasbeen observed for E. coli K-12 (Marinus, 1996). Suchchanges in bacterial morphology likely result from induc-

Fig. 1. An EHEC O157:H7 dam mutant displays minor growth defects and an elevated mutation frequency.A. Bacterial DNA from EHEC/pBR322 and EHECDdam/pBR322 was treated with Sau3A to digest methylated and non-methylated DNA (lanes1,4), DpnI to digest methylated DNA (lanes 2,5) or DpnII to digest non-methylated DNA (lanes 3,6), and resolved on a 1% agarose gel. A DNAmarker is shown to the left.B. EHEC cultures grown to saturation in LB (EHEC and EHECDdam) or LB plus ampicillin (EHECDdam/pBR322 and EHECDdam/pBRdam)were diluted ~1000-fold into fresh medium and grown with agitation at 37°C. OD600 values were measured at the indicated times.C. EHEC cultures grown as in B were titred on LB agar plates.D. EHEC cultures grown in LB or LB + ampicillin were fixed onto glass coverslips, stained with fluorescent anti-O157 antibodies, andexamined microscopically. Examples of elongated EHEC bacilli are indicated with arrows.E. Equivalent levels of protein extracts from wild-type EHEC and EHECDdam (see OmpA blotting in Fig. 5A) were separated by SDS-PAGEand blotted with an antibody to RecA.F. EHEC cultures grown to saturation were spread on LB agar plates to determine bacterial titres and on LB plus rifampicin plates to identifyspontaneously resistant mutants. Data are the means � SD of seven experiments.

1470 K. G. Campellone et al.

© 2007 The AuthorsJournal compilation © 2007 Blackwell Publishing Ltd, Molecular Microbiology, 63, 1468–1481

tion of the SOS regulon (Marinus, 1996). Consistent withSOS induction, immunoblotting for the RecA protein, aknown component of the SOS response, indicated that it isexpressed at higher levels in EHECDdam than in wild-typeEHEC (Fig. 1E). Additional microarray analyses indicatedthat transcription of recN, a member of the SOS regulon,was increased 2.9-fold in EHECDdam relative to wild-typeEHEC (KM, ALO and MM, manuscript in preparation). Asexpected, the elongated morphology of EHECDdam couldbe suppressed by the dam plasmid (Fig. 1D), indicatingthat Dam expression can rescue the cell division defect.

Analogous to E. coli K-12, EHECDdam also displayed anincrease in spontaneous mutation rate, as determined by amore than 12-fold elevation in frequency of resistance tothe RNA polymerase inhibitor, rifampicin (Fig. 1F). Thismutator phenotype was also capable of being suppressedby the pBRdam plasmid (Fig. 1F). Thus, the collectivegrowth-related phenotypes associated with deletion ofdam in EHEC are comparable to those that result frominactivation of the dam gene in E. coli K-12.

An EHEC dam mutant adheres to cultured mammaliancells more rapidly than wild-type EHEC

To examine whether Dam regulates the ability of EHEC tointeract with mammalian host cells, we aimed to next

measure the efficiencies with which dam-proficient anddam-deficient EHEC strains could adhere to cultured epi-thelial cells. However, it was first necessary to determinewhether EHEC dam mutants could replicate normally inconditions that have been established for optimal infectionof host cells in vitro (serum-containing mammalian cellculture medium in an atmosphere containing 5% CO2).Therefore, EHEC strains grown to saturation in LB mediawere diluted into this infection medium and cultivated in amanner identical to that typically used during infection ofcultured mammalian cells. In fact, EHECDdam andEHECDdam/pBR322 were capable of multiplying in thiscell culture medium, but at rates that were slightly slowerthan wild-type EHEC or EHECDdam/pBRdam+ whenmeasured by optical density after 4–5 h of growth(Fig. 2A) and when comparing viable counts after 3–5 h ofgrowth (Fig. 2B). Nevertheless, these levels were suffi-cient to allow an investigation of the proficiency of cellbinding.

To compare the efficiency of binding by dam-proficientand dam-deficient strains, cultured HeLa cells wereinfected with EHEC for various times, fixed, and pro-cessed for microscopic examination. Bacteria were iden-tified by staining with anti-O157 antibodies and thenumber of adherent bacteria per mammalian cell wasquantified by immunoflourescence microscopy. Notably,

Fig. 2. An EHEC O157:H7 dam mutant adheres to cultured mammalian cells more rapidly than wild-type EHEC.A. EHEC cultures grown to saturation in LB or LB plus ampicillin were diluted ~200-fold into antibiotic-free cell culture medium and grownunder conditions typically used during infection of mammalian cells. OD600 values were measured at the indicated times.B. EHEC cultures grown as in A were tittered on LB agar plates.C. EHEC strains grown in LB or LB plus ampicillin were diluted into antibiotic-free cell culture medium and used to infect HeLa cells. Infectedsamples were treated with anti-O157 antibodies to identify bacteria and phalloidin to visualize mammalian cells. Numbers of cell-associatedbacteria were measured at the depicted time points. Data are the means � SD of three experiments.

Dam regulation of EHEC virulence factors 1471

© 2007 The AuthorsJournal compilation © 2007 Blackwell Publishing Ltd, Molecular Microbiology, 63, 1468–1481

EHECDdam exhibited two- to threefold higher levels ofcell binding than wild-type EHEC after 1 h, 2 h and 3 h ofinfection (Fig. 2C). This elevated cell binding by EHECD-dam was reduced to wild-type levels at the 1 h and 2 htime points by the complementing plasmid, pBRdam, butnot by the pBR322 vector alone (Fig. 2C). Adherence byDam-deficient bacteria was indistinguishable from that ofDam-proficient bacteria at 4 h post infection (Fig. 2C).These analyses indicate that Dam negatively regulatesthe initial association between EHEC and its host cells,because strains lacking this methyltransferase haveenhanced cell-binding properties at early time pointsduring infection in vitro.

An EHEC dam mutant generates actin pedestals morefrequently than wild-type EHEC

To next examine whether Dam regulates the ability ofEHEC to trigger actin pedestal formation within cultured

cells, EHEC strains were grown in LB and used to infectHeLa cells for various times. Infected cells were treatedwith phalloidin to stain F-actin, and the number ofactin pedestals per mammalian cell was quantifiedmicroscopically. Remarkably, after 3 h of infection,EHECDdam generated greater than 60-fold more pedes-tals than wild-type EHEC (Fig. 3A). Similarly, after 4 h and5 h of infection, EHECDdam formed approximately 20-and 13-fold more pedestals than wild type (Fig. 3A).Unexpectedly, the pBR322 vector caused a significantsuppression of actin pedestal formation by EHECDdam(Fig. 3A). Nevertheless, the presence of the dam genewithin pBR322 reduced pedestal formation even further,to levels similar to wild type (Fig. 3A), indicating that damprovided in trans can complement EHECDdam for pedes-tal formation.

While these results demonstrate that EHECDdamgrown in LB can subsequently generate actin pedestalson mammalian cells in a rapid and efficient manner, cul-

Fig. 3. An EHEC O157:H7 dam mutant generates actin pedestals more frequently than wild-type EHEC.A. EHEC strains grown in LB or LB plus ampicillin were diluted into antibiotic-free cell culture medium and used to infect HeLa cells. Infectedsamples were treated with anti-O157 antibodies to identify bacteria and phalloidin to visualize F-actin. Frequencies of actin pedestal formationwere measured at the depicted times. Data are the means � SD of three experiments.B. EHEC strains were grown under pre-inducing conditions, diluted into antibiotic-free cell culture medium, and used to infect HeLa cells for5 h. Infected samples were treated with anti-O157 antibodies to identify bacteria and phalloidin to visualize F-actin.C. Pedestal formation frequencies were measured for the infections described in B. Data are the mean of two experiments. Similar resultswere observed in at least four other experiments.

1472 K. G. Campellone et al.

© 2007 The AuthorsJournal compilation © 2007 Blackwell Publishing Ltd, Molecular Microbiology, 63, 1468–1481

tivation in serum-free cell culture medium, instead of LB,has been previously shown to ‘pre-induce’ the ability ofEHEC to signal to host cells (Beltrametti et al., 1999). Theabilities of wild type and dam-deficient EHEC to stimulateactin assembly were therefore also compared aftergrowth under these conditions. Similar to results obtainedwhen bacteria were precultured in LB, EHECDdam andEHECDdam/pBR322 (Fig. 3B, bottom panels) triggeredactin polymerization more frequently than wild-type EHECand EHECDdam/pBRdam+ (Fig. 3B, top panels) after 5 hof infection. Quantification of pedestal formation by wild-type EHEC and EHECDdam revealed that, as expected,the overall frequency of pedestal formation by both strainswas elevated dramatically when grown under pre-inducing conditions relative to bacteria grown in LB(compare Fig. 3C with 3A, right panel). Nevertheless,dam-deficient EHEC was still nearly five times more effec-tive at generating pedestals than its parental strain(Fig. 3C).

To determine, at a higher resolution, whether theseactin pedestals formed by EHECDdam were morphologi-cally similar to AE lesions normally generated by wild-typeEHEC, infected HeLa cells were examined by electronmicroscopy. Scanning electron micrographs indicated thatbound EHEC and EHECDdam were both associated withfilopodia on the surfaces of HeLa cells (Fig. 4A and B, leftpanels). The presence of these finger-like projections islikely a consequence of the translocated effector proteinMap (Kenny, 2002). In addition, transmission electronmicroscopy demonstrated that wild-type EHEC andEHECDdam adhered intimately to HeLa cells, as bacteriaappeared very tightly opposed to the plasma membrane(Fig. 4A and B, right panels). Consistent with an accumu-lation of F-actin beneath sites of bacterial attachment,

these cellular regions often contained an enrichment ofelectron-dense material (Fig. 4A and B, right panels).Thus, there are no discernible morphological differencesbetween the pedestals generated by wild type and dam-deficient EHEC.

Dam-deficient EHEC O157:H7 strains express elevatedlevels of proteins required for intimate adherence andactin pedestal formation

In E. coli K-12, Dam deficiency correlates with alterationsin levels of gene expression which can either increase ordecrease (Marinus, 1987; Lobner-Olesen et al., 2005;Wion and Casadesus, 2006). To establish a molecularbasis for the rapid kinetics and elevated frequencies ofadherence and actin pedestal formation by EHECDdam invitro, bacteria grown in LB were collected and examinedby immunoblotting for several known or putative virulencefactors: two surface adhesins (intimin and OmpA), a com-ponent of the type III translocon (EspD), and the twoeffectors known to be directly required for pedestal forma-tion (Tir and EspFU). The levels of OmpA, a protein whichappears to be involved in non-intimate adherence but notpedestal formation (Torres and Kaper, 2003) were equiva-lent in both dam-proficient and dam-deficient EHECstrains (Fig. 5A), suggesting that this adhesin is notinvolved in the increased cell binding by EHECDdam. Incontrast, each of the other EHEC proteins, which partici-pate in different processes leading to intimate adherenceand pedestal formation, were upregulated in EHECDdamcompared with wild-type EHEC (Fig. 5A). Intimin, a LEE-encoded outer membrane protein involved in initial andintimate adherence (Garmendia et al., 2005), was foundin significantly greater quantities in dam-deficient strains

Fig. 4. Pedestals generated by an EHECO157:H7 dam mutant are morphologicallyindistinguishable from pedestals formed bywild-type EHEC. HeLa cells were infectedwith (A) wild-type EHEC or (B) EHECDdamunder conditions described in Fig. 3B andsubjected to scanning electron microscopy(left panels) or transmission electronmicroscopy (middle and right panels).

Dam regulation of EHEC virulence factors 1473

© 2007 The AuthorsJournal compilation © 2007 Blackwell Publishing Ltd, Molecular Microbiology, 63, 1468–1481

(lanes 2–3) than in dam-proficient strains (lanes 1,4).EspD, a LEE-derived protein required for forming a porein the host membrane to promote delivery of other effectorproteins (Dean et al., 2005), was expressed at slightlyhigher levels in EHECDdam (lane 2) than wild-type EHEC(lane 1). Tir, the LEE-encoded receptor for intimin (Kennyet al., 1997; Deibel et al., 1998), was also overexpressedin dam-deficient strains (lanes 2–3) compared with dam-proficient strains (lanes 1,4). Lastly, EspFU, an effectorthat links Tir to the actin assembly machinery and isencoded on a pathogenicity island distinct from the LEE(Campellone et al., 2004; Garmendia et al., 2004), wasproduced at higher levels in EHECDdam (lane 6) than inwild type (lane 5). Overexpression of intimin, EspD, Tirand EspFU by EHECDdam, relative to wild-type EHEC,was also observed when these bacteria were grownunder pre-inducing conditions (Fig. 5B). Collectively,these results suggest that in the absence of Dam methy-lation, EHEC exhibits an upregulation of both LEE-encoded and non-LEE-derived proteins which stimulateintimate adherence and actin assembly.

Overexpression of Tir is not associated with discerniblyincreased levels of transcription

To determine whether high levels of Tir protein correlatewith increased levels of tir transcription, dam-proficientand dam-deficient bacteria were transformed with a tir-gfpplasmid. This fusion consists of the tir promoter region,the Shine-Dalgarno sequence and the first few tir codonsfused to the coding sequence of GFP (Roe et al., 2004).As a control, an EHEC strain harbouring a plasmid encod-ing a GFP-fusion to the promoter for the ribosomal subunitgene rpsM was also analysed. Upon growth of the strains

in LB, the GFP fluorescence over time of dam-deficientstrains harbouring rpsM::gfp, or tir::gfp were both some-what lower than the corresponding wild-type strains(Fig. 6A), raising the possibility that transcription is glo-bally reduced in the absence of Dam methylation. Toassess the frequency of GFP expression by individualbacteria in these populations, culture samples were alsoexamined for fluorescence microscopically. Each set ofbacteria harbouring the rpsM::gfp reporter exhibited arelatively homogeneous expression pattern (Fig. 6B, toppanels). In contrast, just a fraction of wild type andEHECDdam bacteria fluoresced brightly (Fig. 6B, bottompanels), similar to previous observations that tir expres-sion only occurs in a proportion of cultured bacteria (Roeet al., 2004). Overall, these results indicate that inEHECDdam, tir is not differentially transcribed relative to aribosomal protein, suggesting that the striking increase inthe level of Tir protein may not be due to a correspondingincrease in transcription.

To assess transcription from the endogenous tir pro-moter located on the chromosome, rather than a plasmid-encoded copy, bacterial RNA was collected from wild-typeEHEC and EHECDdam and examined by Northern blottingusing probes directed against tir and a control gene, pgi(phosphoglucose isomerase) (Fig. 6C). While the stron-gest tir hybridization signal was observed at 1.6 kb for eachstrain, additional bands consistent with a polycistronicmessage encoding tir, cesT (the Tir chaparone) and eae(intimin) were also observed. Indeed, the sizes of theapproximately 5.2 kb, 2.2 kb and 1.6 kb RNA species cor-respond with the predicted tir-cesT-eae, tir-cesT and tirtranscripts, respectively, although the 5.2 kb and 2.2 kbspecies were not characterized further. None of the tir-hybridizing transcripts appeared more abundant in the

Fig. 5. Dam-deficient EHEC O157:H7 strains express elevated levels of proteins required for intimate adherence and actin pedestal formation.A. EHEC cultures grown in LB or LB plus ampicillin were collected by centrifugation and lysed in SDS-PAGE sample buffer. Protein samplesderived from 0.1 OD units of each culture were separated by SDS-PAGE and examined by immunoblotting with antibodies to intimin, EspD,Tir, OmpA and myc-tagged EspFU.B. EHEC cultures grown under pre-inducing conditions were processed as in A.

1474 K. G. Campellone et al.

© 2007 The AuthorsJournal compilation © 2007 Blackwell Publishing Ltd, Molecular Microbiology, 63, 1468–1481

dam mutant compared with wild type, whereas the controlpgi transcript from the same preparation of RNA appearedslightly more abundant in the mutant background, indicat-ing that the low tir-specific signal in the dam mutant was notdue to general degradation of mRNA in that preparation.

To assess the abundance of tir transcripts, along withthose of other LEE genes like espD, eae and cesT whenwild type and dam-deficient EHEC strains were grownunder the same conditions used for measuring actin ped-estal formation, transcription was measured globally usinga DNA microarray. Consistent with GFP-fusion and North-ern blotting data, these experiments revealed no signifi-cant differences (less than twofold) between wild-typeEHEC and EHECDdam in transcript levels of tir, espD, eaeor cesT (KM, ALO and MGM, manuscript in preparation).

The relative abundance of tir transcript in EHECDdamversus wild type was 1.5:1. To confirm that tir transcriptionwas not discernibly increased in EHECDdam, RNAisolatedfrom wild-type EHEC and EHECDdam was also examinedby quantitative reverse transcription polymerase chainreaction (RT-PCR). These experiments indicated that tirtranscript levels were not significantly elevated relative tothe control gene gapA (glyceraldehyde-3-phosphate dehy-drogenase). The abundance of tir transcript in EHECDdamversus wild type was 1.7:1. Overall, the observations thatsubstantial increases in tir transcription could not bedetected in the dam mutant in any of the above assayssuggests that the ability of EHECDdam to overexpress Tir,and possibly other factors like intimin, is not likely due to anincrease in transcription.

Fig. 6. Overexpression of tir is not due to increased levels of transcription.A. EHEC strains harbouring reporter plasmids containing the GFP gene downstream of the rpsM or tir promoters were grown in LB containingthe appropriate antibiotics. Culture densities were estimated by measuring OD600, while GFP expression levels were quantified fluorometrically.Data are the means of triplicate experiments.B. EHEC samples derived from experiments described in A were fixed onto glass coverslips and examined microscopically for GFPfluorescence.C. RNA samples from EHEC cultures grown in LB were subjected to Northern analyses using DNA probes for tir or pgi. Arrows indicatepositions of transcripts at the depicted sizes.

Dam regulation of EHEC virulence factors 1475

© 2007 The AuthorsJournal compilation © 2007 Blackwell Publishing Ltd, Molecular Microbiology, 63, 1468–1481

EHECDdam is capable of colonizing the intestines ofgnotobiotic piglets

Dam-deficient mutants of some enteric pathogens, likeS. enterica Serovar Typhiumurium, are avirulent in animalinfection models and can serve as effective live vaccines(Low et al., 2001; Casadesus and Low, 2006). To assessthe pathogenicity of the EHEC dam mutant, an estab-lished gnotobiotic piglet infection model in which wild-typeEHEC normally colonizes the large intestine was utilized(Tzipori et al., 1992; Donohue-Rolfe et al., 2000). Bacteriawere administered orally, the animals were sacrificed after72 h, and tissues from the small and large intestine wereprepared for histology and scored for colonization asdescribed previously (Tzipori et al., 1992; Donohue-Rolfeet al., 2000). While wild-type EHEC colonized the entirepiglet intestine, a control strain lacking intimin(EHECDeae) did not colonize at all (Table 1). With theexception the proximal portions of the small intestine,EHECDdam was observed to colonize the entire intestine,and was closely associated with the epithelium from theileum through the spiral colon. Indeed, in the caecum, aprimary site of wild-type EHEC colonization, the dammutant colonized in a robust manner indistinguishablefrom wild type. Thus, unlike some other enteric patho-gens, and in spite of its previously observed defects ingrowth in vitro (Fig. 1), EHECDdam was capable of exten-sive intestinal colonization.

Discussion

In this study, we first identified the archetypical dam geneas the primary source of adenine methylation in EHEC,because inactivation of this gene resulted in a completeabsence of detectable adenine methylation. Yet, whenplaced under control of an inducible promoter, the EHECVT2-Sa prophage-derived dam homologue could beexpressed and methylate GATC sequences (Radlinskaand Bujnicki, 2001), indicating that such prophage-derived Dam proteins may be capable of methylating

DNA. However, our results suggest that prophage-encoded EHEC dam genes are not expressed duringstandard bacterial culturing conditions, and thus we couldnot establish a biological function for any dam genes otherthan the archetype.

The alteration of SOS gene expression and increasesin filamentation and spontaneous mutagenesis observedfor the dam-deficient EHEC strains are entirely analogousto phenotypes of dam-deficient E. coli K-12 (Fig. 1), sug-gesting, not surprisingly, that adenine methylation controlssimilar cellular functions in these related bacteria.However, given that adenine methylation is a requirementfor virulence in many enteric pathogens, an unexpectedresult was that the EHEC dam mutant demonstratedincreased adherence to cultured mammalian cells com-pared with wild-type EHEC (Fig. 2). Higher levels ofadherence were manifested most prominently in the firstfew hours after encountering cultured cells. This phenom-enon likely reflects differences in gene expression thateither precede and/or occur rapidly after these bacteriaare introduced into mammalian cell culture medium.Enhanced levels of intimin, EspD, Tir and EspFU arereadily apparent in cultured EHECDdam prior to infection(Fig. 5), demonstrating that these bacteria are alreadyequipped for efficient infection. After 4 h of infection,however, no differences in adherence were observedbetween the wild type and dam-deficient strains. Becauseseveral adhesive mechanisms are induced by pathogenicE. coli after incubation with mammalian cells (Giron et al.,2002), expression of such putative pathways at later timepoints could explain the restriction of measurable differ-ences in binding between the mutant and wild-type strainsto early time points.

The relative increase in mammalian cell interaction bythe EHECDdam strain was also reflected by a strikingdifference in actin pedestal formation. When grown under‘non-inducing’ conditions (in LB), the dam-deficient mutantgenerated pedestals as much as 60-fold more efficientlythan wild type, and even under ‘inducing’ growth conditions

Table 1. An EHECDdam mutant colonizes the intestines of gnotobiotic piglets.

EHEC strain

Small intestine

Large intestine

Duodenum

Jejunum

IleumProximal Distal Caecum Spiral colon

WT 1 2 2 3 3 3Ddam 0 0 1 2 3 2Deae 0 0 0 0 0 0

Gnotobiotic piglets were infected orally with 5 ¥ 109 EHEC, EHECDdam or EHECDeae. Animals were sacrificed 72 h after infection and theindicated tissues were removed, fixed, stained histologically and scored for colonization on a scale of 0–4. A score of 0 indicates the absence ofbacteria, 1 denotes free bacteria in the lumen, 2 shows the appearance of bacteria associated with enterocytes, 3 and 4 equal greater degreesof enterocyte association (adapted from Tzipori et al., 1992). Values represent averaged colonization scores from at least three piglets.WT, wild type.

1476 K. G. Campellone et al.

© 2007 The AuthorsJournal compilation © 2007 Blackwell Publishing Ltd, Molecular Microbiology, 63, 1468–1481

that are known to dramatically increase pedestal formationby wild-type EHEC, the mutant was almost fivefold better atpedestal formation (Fig. 3). The higher levels of EspD, Tir,EspFU and intimin that we observed under both of theseconditions likely contribute to this enhanced signallingcapacity of EHECDdam. Surprisingly, reporter fusion,Northern blotting, microarray and RT-PCR analysis of tirrevealed no significant difference in the transcription levelsof EHECDdam versus wild-type bacteria, suggesting thatalteration of transcription initiation frequency or messagestability are not the primary cause of the increased produc-tion of this protein. At least two mechanisms of post-transcriptional regulation mediated by Dam methylationhave been described for other bacteria (Bell and Cupples,2001; Camacho and Casadesus, 2005), and further inves-tigation of the regulation of espD, tir, eae, espFU and othergenes that promote host cell interaction will be required toconfirm and characterize the post-transcriptional nature ofregulation and its potential mechanisms.

Among enteric pathogens harbouring TTSSs, such asShigella, Yersinia and Salmonella, improper regulation ofgene expression following disruption of Dam methyltrans-ferase activity results in a decrease in levels of entry intocultured target cells by these intracellular pathogens, anda concomitant modest to very dramatic decreases in viru-lence, raising the possibility that such strains might serveas good vaccine candidates or that the Dam protein maybe a useful therapeutic target (Low et al., 2001; Casa-desus and Low, 2006). In contrast, our data indicate thatin spite of some in vitro growth defects, dam inactivation inEHEC results in enhanced interactions with cultured cells,likely due in part to the constitutively high expressionlevels of intimin, EspD, Tir and EspFU. Consistent withthis, EHECDdam is also capable of extensive colonizationof gnotobiotic piglets at levels equal to or only slightly lessthan wild-type EHEC (Table 1). The finding that epithelialcolonization of the small bowel and spiral colon byEHECDdam was slightly less extensive than by wild type(in contrast to its enhanced relative level of interactionwith cultured cells) is likely a result of a dramatic increasein the levels of intimin, Tir and EspFU, and type III trans-location by wild-type EHEC upon infection of the mamma-lian host (MB and JL, manuscript in preparation).Regardless, the finding that EHECDdam interacts exten-sively with mammalian cells in vitro and appears to retainsignificant virulence in vivo indicates that therapeuticstrategies that target Dam methyltransferase in EHEC, orthat utilize EHEC dam mutants as attenuated vaccinestrains, are not particularly promising. On the other hand,investigation into how Dam methyltransferase influencesvirulence gene regulation, perhaps through post-transcriptional means, may shed light on regulatory net-works that are integral to the pathogenesis of EHEC andother bacteria.

Experimental procedures

Strains, plasmids and DNA manipulations

Most EHEC strains used in this study were derived fromTUV93-0, a Shiga toxin-deficient form of prototype EDL933.TUV93-0 (Campellone et al., 2002) was generated in thefollowing manner. Plasmid pTUV9 (Donohue-Rolfe et al.,2000), a derivative of suicide vector pGP704 that contains thegenes for levansucrase (sacB) and a 1433 bp fragment rep-resenting a 500 bp deletion of stx-1, was introduced intostrain EDL933 by plate mating with E. coli pTUV9/SM10(lambda pir) (Miller and Mekalanos, 1988). EDL933 exconju-gants were grown on LB plates containing sucrose andsucrose-resistant colonies were screened by ELISA for Stx1and Stx2 production. Toxin-negative colonies were furtheranalysed by PCR and by Southern blot analysis using EcoRIdigested DNA from stx-1 (933J) and stx-2 (933W) convertingphages as probes. At some time during this strain construc-tion, the stx2 gene was also inactivated. EHECDdam (KM67)was created by Lambda Red-mediated recombination inTUV93-0. The upstream region of TUV93-0 dam was gener-ated by PCR using primers ATCATCGAGCTCCTGGTCGTTCTCGTCAATCTTCTG and TGCCGATCAACGTCTCATGCGGCCGCAGCGCGATTTTTCTTCATGCTGAC, while thedam downstream region was generated with primers AATGGCAGAAATTCGAAAGCGGCCGCACCCGCGAAAAAATAATTCTCAAGG and ATCATCGCATGCAATCACCACGCTGAAGTATTTGGC. PCR products were digested either with SacIplus NotI or NotI plus SphI. Both fragments were ligatedtogether in a mixture containing the SacI-SphI backbone ofpUC19 to generate the Ddam-containing plasmid pKM210.This plasmid contains an in-frame fusion of dam consisting ofthe first six dam codons, a 9 bp sequence containing a NotIsite, and the last four dam codons. The fusion is flanked by1.3 kb of sequence upstream and 1.2 kb of sequence down-stream of dam. A derivative of pKM210, pKM212(Ddam::kan), was generated by ligating a kanamycin drugresistance cassette into the NotI site. Plasmid digests con-taining this dam substitution were electroporated intoTUV93-0 containing the Red-producing plasmid pTP223 asdescribed previously (Murphy and Campellone, 2003).Primers used to test for the presence/absence of the dam ordam::kan gene by PCR were TCGGTGTTTCTCAACACCand CGCTTGTTGTTCAAGCGT. A chloramphenicol resistantEHECDdam derivative (used in Fig. 5, right panels) was gen-erated by Lambda Red-mediated recombination by elec-troporating TUV93-0 with a PCR product containing the catgene flanked by 50 nucleotides of dam-specific sequence.Wild-type EDL933 and a Ddam mutant of EDL933, KM69(KM, ALO and MM, manuscript in preparation), were used inmicroarray experiments. The construction of the EHECDeaestrain has been described elsewhere (Murphy and Campel-lone, 2003). The Dam complementation plasmid, pBRdam(pMQ148) is a derivative of pBR322, contains the dam geneon a BamHI fragment, and expresses low levels of Damprotein (roughly twofold that of wild type; not enough toinduce mutagenesis) (Arraj et al., 1990). The EspFU-mycplasmid and reporter plasmids for measuring transcription ofrpsM, and tir have been described previously (Campelloneet al., 2004; Roe et al., 2004). EHEC genomic DNA wasprepared using the MasterPure DNA Purification kit (Epicen-

Dam regulation of EHEC virulence factors 1477

© 2007 The AuthorsJournal compilation © 2007 Blackwell Publishing Ltd, Molecular Microbiology, 63, 1468–1481

tre Biotechnologies) and digested with restriction enzymes(New England Biolabs) by standard methods.

Bacterial and mammalian cell culture

For routine passage, all EHEC strains were grown in LBmedia (plus appropriate antibiotics) at 37°C. Prior to infec-tions, EHEC were usually grown to saturation in LB (plus50 ug ml-1 ampicillin to maintain pBR322-based plasmids,25 ug ml-1 kanamycin to maintain pEspFU-myc, or 15 ug ml-1

chloramphenicol to maintain GFP-reporter plasmids), diluted500-fold and grown for an additional 15 h. To pre-induceEHEC (e.g. in Figs 3B and C, 4 and 5B), bacteria were diluted500-fold into DMEM + 100 mM HEPES pH 7.4 and grown in5% CO2 without agitation for 15 h. To measure EHEC growthrates, bacteria were diluted to 2 ¥ 106 ml-1 in LB (plus appro-priate antibiotics) or 107 ml-1 in DMEM + 3% FBS + 25 mMHEPES pH 7.4, and culture optical densities (OD600) andcolony-forming units measured hourly. Representativeexperiments are shown in Figs 1 and 2. To measure sponta-neous mutation rates, EHEC cultures grown in LB broth (plusappropriate antibiotics) were spread on LB agar plates or LBagar plates containing 100 ug ml-1 rifampicin and the fre-quency of RifR mutants per ml of culture was calculated. ForRT-PCR and microarray experiments, bacteria grown inDMEM + 100 mM HEPES were diluted 200-fold intoDMEM + 3% FBS + 25 mM HEPES pH 7.4 and grown in 5%CO2 without agitation for 5 h, conditions used for optimalinfection of cultured cells. HeLa cell cultures were maintainedin DMEM + 10% FBS at 37°C in 5% CO2. To measure theinteractions between mammalian cells and EHEC, HeLa cellsgrown to 50–90% confluency on 12 mm glass coverslipswere infected with 107 bacteria in DMEM + 3% FBS + 25 mMHEPES pH 7.4 for up to 5 h as described previously(Campellone et al., 2002).

Immunofluorescence microscopy

Bacteria and HeLa cells were fixed onto glass coverslips bytreatment with PBS + 2.5% paraformaldehyde for 20–30 minas described previously (Campellone et al., 2002). Prior tostaining, mammalian cell membranes were permeabilizedwith 0.1% TritonX-100. Bacteria were detected by treatmentwith rabbit anti0157 antibodies (diluted 1:500 inPBS + 1%BSA) for 30 min prior to washing and addition ofAlexa488 goat anti-rabbit antibodies (1:200). F-actin wasvisualized by staining with Alexa568-phalloidin (1:100).

Immunoblotting

To prepare EHEC lysates, bacteria cultured in LB were centri-fuged, washed once with PBS, and resuspended in SDS-PAGE sample buffer (Campellone et al., 2002). Proteinsamples were boiled for 10 min, centrifuged, and sampleamounts corresponding to 0.1 OD units were separated by10% SDS-PAGE prior to transferring to PVDF membranes.Membranes were blocked for 30 min in PBS + 5% milk(PBSM) before treatment with rabbit anti-RecA (diluted1:10 000 in PBSM; a gift from Kendall Knight), sheep anti-intimin (1:1000; a gift from Alison O’Brien), mouse anti-EspD

and anti-TirM (1:500; gifts from Trinad Chakraborty), rabbitanti-OmpA (1:10 000; a gift from Carol Kumamoto) or mouseantic-myc (1:300; Sigma) for 2–3 h, similar to previous experi-ments (Roe et al., 2003; Campellone et al., 2004; Campelloneand Leong, 2005). Following washes, membranes weretreated with secondary antibodies and developed. Similarresults were observed in at least three sets of immunoblots.

Quantification of EHEC adherence and actin pedestalformation

The cell-binding frequencies of EHEC strains were quantifiedby measuring the number of bacteria (identified by anti-O157-staining) associated with randomly chosen HeLa cells. Onehundred and fifty cells were examined after 1 h, 2 h or 3 h ofinfection and 50 cells were examined after 4 h of infection ineach of three separate experiments. Pedestal formationfrequencies were quantified by measuring the number oflocalized F-actin pedestals (identified by intense phalloidin-staining) on randomly chosen HeLa cells. One hundred andfifty cells were examined after 3 h of infection and 50 cellswere examined after 4 h or 5 h of infection in each of threeseparate experiments.

Electron microscopy

Samples of infected HeLa cells in buffered formalin wereprocessed as described previously for electron microscopy(Tzipori et al., 1989).

Transcriptional analyses

Enterohaemorrhagic Escherichia coli strains harbouring theappropriate GFP reporter plasmids (pAJR75 and pAJR145;Roe et al., 2004) were grown to saturation in LB and dilutedinto fresh LB to a starting OD600 of 0.05. Aliquots wereremoved at subsequent time intervals and fluorescencelevels determined using a Fluostar 96-well plate reader. OD600

readings were taken in parallel, and all samples with an ODhigher than 1.0 were diluted to accurately measure celldensity. Cultures appeared to still be in exponential phasegrowth at OD 3.5 when measured in this way. The promoter-less plasmid pAJR70 transformed into EHEC strains acted asa control for fluorescence produced independent of promoteractivity. For single cell analyses of GFP expression, 20 mlaliquots were dried on glass slides, washed three times withPBS, and cover slips applied using DAKO fluorescent mount-ing medium. Northern blotting was performed on EHEC cul-tures grown to an OD600 of 3.5 in LB, similar to experimentsdescribed previously (Roe et al., 2003; Zhang et al., 2004).Oligonucleotide sequences used to create the PCR-generated tir probe were ATGCCTATTGGTAATCTTGGTCand TTAAGAGTATCGAGCGGACC. For microarray experi-ments, RNA was isolated from EDL933 and its Ddam deriva-tive, KM69, using the MasterPure RNA Purification kit(Epicentre Biotechnologies), processed as recommended inthe Affymetrix Expression Analysis Technical Manual (http://www.affymetrix.com), and hybridized to GeneChip® E. coliGenome 2.0 Arrays. These arrays did not have espFU

1478 K. G. Campellone et al.

© 2007 The AuthorsJournal compilation © 2007 Blackwell Publishing Ltd, Molecular Microbiology, 63, 1468–1481

sequences, so expression from this locus could not bemonitored. Raw data were processed using the MicroarraySuite version 5.0 software (Affymetrix) and exported toMicrosoft Excel (Microsoft Corporation). The data files can beaccessed at http://users.umassmed.edu/martin.marinus/arrays/. For RT-PCR experiments, RNA isolated using theMasterPure RNA Purification kit was used as substrate forfirst strand cDNA synthesis with Superscript III RT (Invitro-gen) as recommended by the supplier. The sequence of theRT primers were CTGGTGGGTTATTCGAAGTATTC for tirand GAGATGTGAGCGATCAGGTCC for gapA. PCR primerswere CTAAACTTTGGTTGGCGTTGG and TCGCAGTTTCAGTTGCACTTG for tir and CGCTGAACGTGATCCGGCTAA and ACCAGCGGTGATGTGTTTACG for gapA. PCRwas performed with Quantitect SYBR Green (Qiagen) in anOpticon 2 Continuous Fluorescence Detector (MJ Research)for 40 cycles according to the manufacturer’s instructions.Relative gene expression values were determined using the2–DDCT method (Livak and Schmittgen, 2001). Each experi-ment was carried out in triplicate and included controls todetect contaminating DNA.

Animal infections

Gnotobiotic piglet infections were performed as describedpreviously (Tzipori et al., 1992). Briefly, animals were derivedby cesarean section and maintained in microbiologicalisolation. Twenty-four h after cesarean delivery, animals weregiven a single oral challenge of 5 ¥ 109 colony-forming unitsof EHEC (24 piglets), EHECDdam (10 piglets) or EHECDeae(three piglets). Animals were monitored for up to 72 h, sacri-ficed, and formalin-fixed tissues from the small and largeintestine were prepared for histology by haematoxylin andeosin staining and scored for colonization. To confirm theabsence of cross-contamination between isolators, gut con-tents were cultured for bacterial growth and individual colo-nies tested for antibiotic resistance. In all cases, bacteriaharvested from infected piglets displayed the appropriateantibiotic resistance profile (data not shown).

Acknowledgements

We thank Ken Knight, Alison O’Brien, Trinad Chakraborty andCarol Kumamoto for providing antibodies and Alla Segova forinstruction in RT-PCR. This work was supported by GrantsNIH R01-A46454 to J.M.L., the DEFRA VTRI Fellowship toA.J.R. and D.L.G., and the Danish Natural SciencesResearch Council to A.L.O.

References

Arraj, J.A., Wu, T.-H., and Marinus, M.G. (1990) Expressionof a DNA methylation (dam) gene in Escherichia coli K-12.Curr Microbiol 20: 133–136.

Bell, D.C., and Cupples, C.G. (2001) Very-short-patchrepair in Escherichia coli requires the dam adeninemethyltransferase. J Bacteriol 183: 3631–3635.

Beltrametti, F., Kresse, A.U., and Guzman, C.A. (1999) Tran-scriptional regulation of the esp genes of enterohemor-rhagic Escherichia coli. J Bacteriol 181: 3409–3418.

Bustamante, V.H., Santana, F.J., Calva, E., and Puente, J.L.(2001) Transcriptional regulation of type III secretion genesin enteropathogenic Escherichia coli: Ler antagonizesH-NS-dependent repression. Mol Microbiol 39: 664–678.

Camacho, E.M., and Casadesus, J. (2005) Regulation of traJtranscription in the Salmonella virulence plasmid by strand-specific DNA adenine hemimethylation. Mol Microbiol 57:1700–1718.

Campellone, K.G., and Leong, J.M. (2005) Nck-independentactin assembly is mediated by two phosphorylatedtyrosines within enteropathogenic Escherichia coli Tir. MolMicrobiol 56: 416–432.

Campellone, K.G., Giese, A., Tipper, D.J., and Leong, J.M.(2002) A tyrosine-phosphorylated 12-amino-acid sequenceof enteropathogenic Escherichia coli Tir binds the hostadaptor protein Nck and is required for Nck localization toactin pedestals. Mol Microbiol 43: 1227–1241.

Campellone, K.G., Robbins, D., and Leong, J.M. (2004)EspFU is a translocated EHEC effector that interacts withTir and N-WASP and promotes Nck-independent actinassembly. Dev Cell 7: 217–228.

Casadesus, J., and Low, D. (2006) Epigenetic gene regula-tion in the bacterial world. Microbiol Mol Biol Rev 70: 830–856.

Dean, P., Maresca, M., and Kenny, B. (2005) EPEC’sweapons of mass subversion. Curr Opin Microbiol 8:28–34.

Deibel, C., Kramer, S., Chakraborty, T., and Ebel, F. (1998)EspE, a novel secreted protein of attaching and effacingbacteria, is directly translocated into infected host cells,where it appears as a tyrosine-phosphorylated 90 kDaprotein. Mol Microbiol 28: 463–474.

Deng, W., Puente, J.L., Gruenheid, S., Li, Y., Vallance, B.A.,Vazquez, A., et al. (2004) Dissecting virulence: systematicand functional analyses of a pathogenicity island. Proc NatlAcad Sci USA 101: 3597–3602.

DeVinney, R., Stein, M., Reinscheid, D., Abe, A., Rusch-kowski, S., and Finlay, B.B. (1999) EnterohemorrhagicEscherichia coli O157:H7 produces Tir, which is translo-cated to the host cell membrane but is not tyrosinephosphorylated. Infect Immun 67: 2389–2398.

Donnenberg, M.S., and Whittam, T.S. (2001) Pathogenesisand evolution of virulence in enteropathogenic and entero-hemorrhagic Escherichia coli. J Clin Invest 107: 539–548.

Donohue-Rolfe, A., Kondova, I., Oswald, S., Hutto, D., andTzipori, S. (2000) Escherichia coli O157:H7 strains thatexpress Shiga toxin (Stx) 2 alone are more neurotropic forgnotobiotic piglets than are isotypes producing only Stx1 orboth Stx1 and Stx2. J Infect Dis 181: 1825–1829.

Elliott, S.J., Sperandio, V., Giron, J.A., Shin, S., Mellies, J.L.,Wainwright, L., et al. (2000) The locus of enterocyte efface-ment (LEE)-encoded regulator controls expression of bothLEE- and non-LEE-encoded virulence factors in entero-pathogenic and enterohemorrhagic Escherichia coli. InfectImmun 68: 6115–6126.

Friedberg, D., Umanski, T., Fang, Y., and Rosenshine, I.(1999) Hierarchy in the expression of the locus of entero-cyte effacement genes of enteropathogenic Escherichiacoli. Mol Microbiol 34: 941–952.

Garcia-del Portillo, F., Pucciarelli, M.G., and Casadesus, J.(1999) DNA adenine methyltransferase mutants of Salmo-

Dam regulation of EHEC virulence factors 1479

© 2007 The AuthorsJournal compilation © 2007 Blackwell Publishing Ltd, Molecular Microbiology, 63, 1468–1481

nella enterica Serovar Typhiumurium show defects inprotein secretion, cell invasion, and M cell cytotoxicity.Proc Natl Acad Sci USA 96: 11578–11583.

Garmendia, J., Phillips, A.D., Carlier, M.F., Chong, Y.,Schuller, S., Marches, O., et al. (2004) TccP is an entero-haemorrhagic Escherichia coli O157:H7 type III effectorprotein that couples Tir to the actin-cytoskeleton. CellMicrobiol 6: 1167–1183.

Garmendia, J., Frankel, G., and Crepin, V.F. (2005) Entero-pathogenic and enterohemorrhagic Escherichia coliinfections: translocation, translocation, translocation. InfectImmun 73: 2573–2585.

Giron, J.A., Torres, A.G., Freer, E., and Kaper, J.B. (2002)The flagella of enteropathogenic Escherichia coli mediateadherence to epithelial cells. Mol Microbiol 44: 361–379.

Hayward, R.D., Leong, J.M., Koronakis, V., and Campellone,K.G. (2006) Exploiting pathogenic Escherichia coli tomodel transmembrane receptor signalling. Nat Rev Micro-biol 4: 358–370.

Heithoff, D.M., Sinsheimer, R.L., Low, D.A., and Mahan, M.J.(1999) An essential role for DNA adenine methylation inbacterial virulence. Science 284: 967–970.

Hernday, A.D., Braaten, B.A., and Low, D.A. (2003) Themechanism by which DNA adenine methyltransferase andPapI activate the pap epigenetic switch. Mol Cell 12: 947–957.

Honma, Y., Fernandez, R.E., and Maurelli, A.T. (2004) ADNA adenine methyltransferase mutant of Shigella flexnerishows no significant attenuation of virulence. Microbiology150: 1073–1078.

Jerse, A.E., Yu, J., Tall, B.D., and Kaper, J.B. (1990) Agenetic locus of enteropathogenic Escherichia coli neces-sary for the production of attaching and effacing lesions ontissue culture cells. Proc Natl Acad Sci USA 87: 7839–7843.

Julio, S.M., Heithoff, D.M., Provenzano, D., Klose, K.E.,Sinsheimer, R.L., Low, D.A., and Mahan, M.J. (2001)DNA adenine methyltransferase is essential for viabilityand plays a role in the pathogenesis of Yersiniapseudotuberculosis and Vibrio cholerae. Infect Immun 69:7610–7615.

Kanamaru, K., Kanamaru, K., Tatsuno, I., Tobe, T., andSasakawa, C. (2000) SdiA, an Escherichia coli homologueof quorum-sensing regulators, controls the expression ofvirulence factors in enterohaemorrhagic Escherichia coliO157:H7. Mol Microbiol 38: 805–816.

Kaper, J.B., Nataro, J.P., and Mobley, H.L. (2004) Patho-genic Escherichia coli. Nat Rev Microbiol 2: 123–140.

Kenny, B. (2002) Mechanism of action of EPEC type IIIeffector molecules. Int J Med Microbiol 291: 469–477.

Kenny, B., DeVinney, R., Stein, M., Reinscheid, D.J., Frey,E.A., and Finlay, B.B. (1997) Enteropathogenic E. coli(EPEC) transfers its receptor for intimate adherence intomammalian cells. Cell 91: 511–520.

Livak, K.J., and Schmittgen, T.D. (2001) Analysis of relativegene expression data using real-time quantitative PCR andthe 2–DDCT method. Methods 25: 402–408.

Lobner-Olesen, A., Marinus, M.G., and Hansen, F.G. (2003)Role of SeqA and Dam in Escherichia coli gene expres-sion: a global/microarray analysis. Proc Natl Acad Sci USA100: 4672–4677.

Lobner-Olesen, A., Skovgaard, O., and Marinus, M.G. (2005)Dam methylation: coordinating cellular processes. CurrOpin Microbiol 8: 154–160.

Low, D.A., Weyand, N.J., and Mahan, M.J. (2001) Roles ofDNA adenine methylation in regulating bacterial geneexpression and virulence. Infect Immun 69: 7197–7204.

Marinus, M.G. (1987) DNA methylation in Escherichia coli.Annu Rev Genet 21: 113–131.

Marinus, M.G. (1996) Methylation of DNA. In Escherichia Coliand Salmonella: Cellular and Molecular Biology. Neidhardt,F.C., Curtiss, R., Ingraham, J.L., Lin, E.C.C., Low, K.B.,Magasanik, B., et al. (eds). Washington, DC: AmericanSociety for Microbiology Press, pp. 782–791.

Mellies, J.L., Elliott, S.J., Sperandio, V., Donnenberg, M.S.,and Kaper, J.B. (1999) The Per regulon of enteropatho-genic Escherichia coli: identification of a regulatorycascade and a novel transcriptional activator, the locus ofenterocyte effacement (LEE)-encoded regulator (Ler). MolMicrobiol 33: 296–306.

Miller, V.L., and Mekalanos, J.J. (1988) A novel suicide vectorand its use in construction of insertion mutations: osmo-regulation of outer membrane proteins and virulence deter-minants in Vibrio cholerae requires toxR. J Bacteriol 170:2575–2583.

Murphy, K.C., and Campellone, K.G. (2003) Lambda Red-mediated recombinogenic engineering of enterohemor-rhagic and enteropathogenic E. coli. BMC Mol Biol 4: 11.

Oshima, T., Wada, C., Kawagoe, Y., Ara, T., Maeda, M.,Masuda, Y., et al. (2002) Genome-wide analysis of deoxy-adenosine methyltransferase-mediated control of geneexpression in Escherichia coli. Mol Microbiol 45: 673–695.

Perna, N.T., Plunkett, G., III, Burland, V., Mau, B., Glasner,J.D., Rose, D.J., et al. (2001) Genome sequence of entero-haemorrhagic Escherichia coli O157:H7. Nature 409: 529–533.

Radlinska, M., and Bujnicki, J.M. (2001) Cloning ofenterohemorrhagic Escherichia coli phage VT-2 dammethyltransferase. Acta Microbiol Pol 50: 161–167.

Robbins-Manke, J.L., Zdraveski, Z.Z., Marinus, M., andEssigmann, J.M. (2005) Analysis of global gene expres-sion and double-strand-break formation in DNA adeninemethyltransferase- and mismatch repair-deficient Escheri-chia coli. J Bacteriol 187: 7027–7037.

Roe, A.J., Hoey, D.E., and Gally, D.L. (2003) Regulation,secretion and activity of type III-secreted proteins ofenterohaemorrhagic Escherichia coli O157. Biochem SocTrans 31: 98–103.

Roe, A.J., Naylor, S.W., Spears, K.J., Yull, H.M., Dransfield,T.A., Oxford, M., et al. (2004) Co-ordinate single-cellexpression of LEE4- and LEE5-encoded proteins ofEscherichia coli O157:H7. Mol Microbiol 54: 337–352.

Rosenshine, I., Ruschkowski, S., Stein, M., Reinscheid, D.J.,Mills, S.D., and Finlay, B.B. (1996) A pathogenic bacteriumtriggers epithelial signals to form a functional bacterialreceptor that mediates actin pseudopod formation. EMBOJ 15: 2613–2624.

Spears, K.J., Roe, A.J., and Gally, D.L. (2006) A comparisonof enteropathogenic and enterohaemorrhagic Escherichiacoli pathogenesis. FEMS Microbiol Lett 255: 187–202.

Sperandio, V., Mellies, J.L., Nguyen, W., Shin, S., and Kaper,J.B. (1999) Quorum sensing controls expression of the

1480 K. G. Campellone et al.

© 2007 The AuthorsJournal compilation © 2007 Blackwell Publishing Ltd, Molecular Microbiology, 63, 1468–1481

type III secretion gene transcription and protein secretion inenterohemorrhagic and enteropathogenic Escherichia coli.Proc Natl Acad Sci USA 96: 15196–15201.

Sperandio, V., Torres, A.G., Jarvis, B., Nataro, J.P., andKaper, J.B. (2003) Bacteria-host communication: the lan-guage of hormones. Proc Natl Acad Sci USA 100: 8951–8956.

Torres, A.G., and Kaper, J.B. (2003) Multiple elements con-trolling adherence of enterohemorrhagic Escherichia coliO157:H7 to HeLa cells. Infect Immun 71: 4985–4995.

Tzipori, S., Gibson, R., and Montanaro, J. (1989) Nature anddistribution of mucosal lesions associated with entero-pathogenic and enterohemorrhagic Escherichia coli inpiglets and the role of plasmid-mediated factors. InfectImmun 57: 1142–1150.

Tzipori, S., Montanaro, J., Robins-Browne, R.M., Vial, P.,Gibson, R., and Levine, M.M. (1992) Studies withenteroaggregative Escherichia coli in the gnotobioticpiglet gastroenteritis model. Infect Immun 60: 5302–5306.

Wion, D., and Casadesus, J. (2006) N6-methyl-adenine: anepigenetic signal for DNA–protein interactions. Nat RevMicrobiol 4: 183–192.

Zhang, L., Chaudhuri, R.R., Constantinidou, C., Hobman,J.L., Patel, M.D., Jones, A.C., et al. (2004) Re-gulators encoded in the Escherichia coli type III secretionsystem 2 gene cluster influence expression ofgenes within the locus for enterocyte effacement inenterohemorrhagic E. coli O157:H7. Infect Immun 72:7282–7293.

Dam regulation of EHEC virulence factors 1481

© 2007 The AuthorsJournal compilation © 2007 Blackwell Publishing Ltd, Molecular Microbiology, 63, 1468–1481