Identification of a novel family of presenilin homologues

Identification of a novel family of presenilinhomologues

Chris P. Ponting1,*, Mike Hutton2, Andrew Nyborg2, Matthew Baker2, Karen Jansen2 and

Todd E Golde2

1MRC Functional Genetics Unit, University of Oxford, Department of Human Anatomy and Genetics, South Parks

Road, Oxford OX1 3QX, UK and 2Mayo Clinic Jacksonville, Department of Neuroscience, 4500 San Pablo Road,

Jacksonville, FL 32224, USA

Received December 11, 2001; Revised and Accepted February 25, 2002

Presenilin 1 and presenilin 2 are polytopic membrane proteins, whose genes are mutated in some individualswith Alzheimer’s disease. Presenilins have been shown to influence limited proteolysis of amyloid b proteinprecursor (APP), Notch and ErbB4, and have been proposed to be c-secretases that perform the terminalcleavage of APP. In this model, two conserved and apparently intramembranous aspartic acids participate incatalysis. Highly sequence-similar presenilin homologues are known in plants, invertebrates and vertebrates.In this work, we have used a combination of different sequence database search methods to identify a newfamily of proteins homologous to presenilins. Members of this family, which we term presenilin homologues(PSH), have significant sequence similarities to presenilins and also possess two conserved aspartic acidresidues within adjacent predicted transmembrane segments. The PSH family is found throughout theeukaryotes, in fungi as well as plants and animals, and in archaea. Five PSHs are detectable in the humangenome, of which three possess ‘protease-associated’ domains that are consistent with the proposedprotease function of PSs. Based on these findings, we propose that PSs and PSHs represent different sub-branches of a larger family of polytopic membrane-associated aspartyl proteases.

INTRODUCTION

Presenilin 1 (PS1) and presenilin 2 (PS2) are members of anevolutionarily conserved family of polytopic membraneproteins that are thought to span the membrane six toeight times (reviewed in 1). Presenilins were initiallyidentified through genetic linkage analysis of families withautosomal dominant forms of Alzheimer’s disease (AD).To date, numerous mutations in the chromosome 14-encodedPS1 gene and several in the chromosome 1-encoded PS2gene have been linked to rare forms of familial AD (see http://www.alzforum.org/members/resources/pres_mutations/index.html).

Studies of PSs and their role in the development of AD haveled to an appreciation that they regulate a number of diversefunctions in the cell. PSs have been shown to play a role inproteolytic processing of amyloid b protein precursor (APP)and APP family members (2,3), Notch and Notch familymembers (4,5), and ErbB4 (6). In all cases, PSs appear to berequired to permit the release of the cytoplasmic tail of theseproteins from a membrane-bound stub that is generated afterectodomain cleavage of the holoprotein. Significantly, inhibi-tion of the release of the membrane-bound stub of these

proteins alters signaling cascades that appear to be mediated bytranslocation of the cytoplasmic tail to the nucleus (6–8). PSshave also been shown to interact with a wide array of differentproteins, and have been implicated in IP3-mediated release ofendoplasmic reticulum (ER) calcium (9), capacitative calciumentry (10,11), b-catenin signaling (12–14) and proteintrafficking (15).

Much work on PSs has focused on their role in processingAPP (1). PSs have been shown to influence the final cleavagestep in the release of the approximately 4 kDa amyloid bprotein (Ab) from APP, a proteolysis that is referred to asg-secretase cleavage. This event generates Ab from amembrane stub of the APP, which in turn is produced by aprevious hydrolysis of the APP holoprotein by a membrane-bound aspartyl protease referred to as b-secretase. Signifi-cantly, g-secretase generates Ab peptides of varying lengths,with the two species of most interest being peptides of 40amino acids (Ab40) and 42 amino acids (Ab42). In all casesstudied to date, mutant PSs increase the relative level of Ab42production. As the longer Ab42 aggregates more rapidly thanother forms of Ab and had previously been shown to beincreased by AD-linked mutations in the APP, these studies notonly implicated PSs as modulators of g-secretase cleavage, but

*To whom correspondence should be addressed: Tel: þ44 1865 272175; Fax: þ44 1865 282651; Email: [email protected]

# 2002 Oxford University Press Human Molecular Genetics, 2002, Vol. 11, No. 9 1037–1044

by guest on May 25, 2016

http://hmg.oxfordjournals.org/

Dow

nloaded from


also convinced many in the AD field that this longer form ofAb was critical to AD pathogenesis (16).

Subsequent to these initial studies on AD-linked PSmutations, three lines of evidence have emerged to support adirect role of PS in g-secretase cleavage of APP, as well as theg-secretase cleavage that regulates the release of the cytoplas-mic tails of Notch and ErbB4. First, at the genetic level, PSsappear to be essential for g-cleavage. PS1 knockout markedlyinhibits g-secretase cleavage (3,4), whereas PS2 knockout hasno apparent effect on g-secretase activity (17), probably owingto compensation by the more widely expressed PS1. How-ever, a combined PS1/PS2 knockout completely abolishesg-secretase activity (18,19). Second, biochemical evidence alsosupports the identification of PSs as g-secretases. PSs co-fractionate with g-secretase activity in a high-molecular-weightcomplex, and this in vitro activity can be recovered in the pelletafter immunoprecipitation with antibodies to PS1 (20). Inaddition, mutation of two absolutely conserved aspartateresidues (D257 and D385 in PS1, and D263 and D366 inPS2) results in PSs that act in a dominant-negative fashion – atleast with respect to g-secretase activity (21,22). This leads tothe hypothesis that PSs represent a novel class of intramem-branous cleaving diaspartyl proteases, a hypothesis supportedby inhibitor studies (23,24). Third, four groups have been ableto show that inhibitors of g-secretase activity bind with varyingdegrees of specificity to both PS1 and PS2 (25–28).Collectively, these experiments indicate that compounds,including some with properties of protease inhibitors, can bindto PSs. Moreover, given that two groups had specificallydesigned their inhibitors to be transition state analogues ofaspartyl proteases, it certainly appears that, despite the lack ofdemonstrable homology to known aspartyl proteases, PSs maybe just that.

More recently, the primary sequence encompassing one ofthe aspartate residues (D385 in PS1 and D366 in PS2) in PSshas been proposed to be similar to a region of type IV prepilinpeptidases that contain a catalytic aspartate residue (29,30).This sequence motif similarity, and their common feature ofspanning the membrane several times, suggests that PSs andthe bacterial signal peptidases may be distinct members of anovel class of intramembranous proteases. Despite their localsequence similarities, PSs and type IV prepilin peptidases arenot demonstrably homologous. In order to investigate whetherPSs possess hitherto unappreciated divergent homologues, weundertook searches of protein and nucleotide sequencedatabases using PSI-BLAST (31) and a hidden Markov modelpackage (32). These searches revealed a family of sequenceswith significant similarities to presenilins. This observationmay assist in elucidating the molecular and cellular functionsof PSs.

RESULTS

Human PS1 and PS2 sequences were compared with a non-redundant database (NR) using PSI-BLAST (31) and anE-value threshold of 2� 10�3. This search revealed that amouse sequence of unknown function (GenInfo code

12849450) was marginally similar, albeit with non-significantstatistics, to PS1 and PS2 (E¼ 1.8 and 2.3, respectively; 2search rounds). When this mouse sequence was compared withNR, it was evident that it is but one of a large family of proteinswith representatives among the fungi, plants, arthropods,nematode worms, vertebrates and archaea. This family showedthree intriguing similarities with PSs. First, they are bothfamilies of transmembrane (TM) proteins whose sequences canbe aligned almost throughout their entire lengths (Fig. 1).Second, they both contain conserved YD, GhGD and PALmotifs (h represents a hydrophobic residue) in the samecollinear arrangement (Figs 1 and 2). Third, the YD and GhGDmotifs, which in PSs include their candidate active site asparticacid residues (21), are unusual in that they are present withinpredicted adjacent TM segments.

In order to investigate whether the newly identified proteinfamily is homologous to PSs, we constructed its multiplesequence alignment and compared a global hidden Markovmodel (32), derived from the alignment, with a second non-redundant database, nrdb90. Results showed that presenilinsrepresented all of the highest-scoring sequences, including aplant presenilin (Arabidopsis thaliana gene productAt2g29900) whose sequence similarity to the family wassignificant (E¼ 5.3� 10�3). These significant sequence simi-larities demonstrate that the eukaryotic and archaeal proteinsrepresent a novel family of presenilin homologues (PSHs).

Five distinct PSH genes were evident from the humangenome sequence. PSH genes were found in fungi, such asSaccharomyces cerevisiae, and in archaea such as Archaeo-globus fulgidus. This is the first time that PS homologues havebeen detected in eukaryotes other than plants and animals, andin prokaryotes.

As predicted from their presence in the expressed sequencetag (EST) database, the human PSH RT–PCR experimentsconfirm that each of the PSHs is expressed in humans (Fig. 3).PCR products can be amplified both from a human braincDNA library and from H4 cDNA. In these experiments, theH4 mRNA was treated with DNase I to remove trace DNAcontamination prior to reverse transcription, and non-reverse-transcribed DNase I-treated RNA was used as control to showthat the product originated from mRNA and not genomicDNA contamination. Thus, like other PSHs, the intronlessPSH2 mRNA is expressed. Full-length cDNAs for eachhomologue can also be amplified from H4 cell cDNA (datanot shown).

The proximity of PSH2 to the MAPT gene, which codes forthe microtubule-associated protein tau, on chromosome 17suggested that it might be a candidate gene for the variant ofFTDP-17 that occurs in families that lack tau pathology andobvious mutations in tau (33–35). Sequence analysis wastherefore performed in the probands from four families withfrontotemporal dementia (FTD) with similar clinical andpathological phenotypes to these tau-negative families.However, in each case, the FTD family was not large enoughto confirm linkage to chromosome 17. In addition, PSH2 wassequenced in control samples with H1/H1 and H2/H2 MAPTgenotypes to identify single nucleotide polymorphisms(SNPs) in linkage disequilibrium with these haplotypes inthe adjacent MAPT gene. This analysis demonstrated that

1038 Human Molecular Genetics, 2002, Vol. 11, No. 9



Dow

nloaded from


Figure 1. Multiple sequence alignment of presenilins (PSs; top) and PS homologues (PSHs; below) represented using CHROMA (http://www.lg.ndirect.co.uk/chroma/) and a 75% consensus. Alignment of the sequences is made using the 8-transmembrane (TM) model for PSs. PS1 and PS2 amino acids that are substitutedin individuals with familial Alzheimer’s disease (http://www.alzforum.org/members/resources/pres_mutations/) are shown in white-on-red. Amino acid changesdue to non-synonymous single nucleotide polymorphisms in human PSH2 and PSH3 are shown in white-on-blue; the amino acid substitution (Ala-to-Pro) inPSH3 just prior to the putative active site residue-containing ‘LGLGD motif’ might be deleterious to function. Aspartic acids that are thought to be active siteresidues are shown in white-on-magenta and are indicated by ‘ ’. The positions of seven of the predicted eight TM segments in PSs are shown; these correspondto the seven TM segments in PSHs. Numbers in parentheses represent numbers of amino acids excised from the alignment. ‘–’ represents a gap. The GenInfonumbers and amino acid limits of sequences are shown following the alignment. Proteins with asterisks (‘*’) contain N-terminal protease-associated (PA) domains.Protein and/or gene names are shown followed by species abbreviations: Af, Archaeoglobus fulgidus; At, Arabidopsis thaliana; Ce, Caenorhabditis elegans; Dm,Drosophila melanogaster; Dr, Danio rerio (zebrafish); Hl, Helix lucorum (a mollusc); Hs, Homo sapiens; Hsp, Halobacterium sp. NRC-1; Sp, Schizosaccharo-myces pombe; Ta, Thermoplasma acidophilum; Tv, Thermoplasma volcanium; Xl, Xenopus laevis.

Human Molecular Genetics, 2002, Vol. 11, No. 9 1039



Dow

nloaded from


PSH2 is highly polymorphic, with 12 SNPs being detected, ofwhich nine alter the encoded amino acid sequence (Table 1).Nine of the PSH2 SNPs were apparently in complete linkagedisequilibrium with the H1/H2 haplotypes in the adjacent

MAPT gene. However, none of the SNPs were obviouslypathogenic in the four FTD families, since all were present incontrol individuals or did not segregate with disease (R123Qand E209K).

Figure 1. (Continued).

Figure 2. Schematic representations of the predicted transmembrane topologies of presenilin 1 and human PSH2, which contains a protease-associated (PA)domain. The topology predictions are made on the basis of identifications of signal peptides and PA domains in PSHs and on the 8-TM model of PS topologies.The pink stars represent the putative active site aspartic acid residues in PSs and PSHs, and the red triangles represent conserved PAL(P) motifs.




Dow

nloaded from


DISCUSSION

The newly identified PSHs could be aligned over their entirelengths with PSs, encompassing PS TM segments 2–8 (Fig. 2).Despite their apparent lack of TM segment 1, they appear tohave the same membrane topology as PSs as a consequence oftheir signal peptide sequences. Regions that are highlyconserved between the two families include not only theputative active site aspartic acid residues, but also TMsequences and a ‘PALP’ motif that is reported to be obligatoryfor stabilization, complex formation and g-secretase activities

of presenilins (36). Several animal and plant PSHs were foundto contain N-terminal protease-associated (PA) domains thatoften co-occur with peptidase domains (37). This is consistentwith a hypothesis that PSHs and, also by homology, PSspossess peptidase function.

Of the five human PSH genes, the PSH1 gene neighbors alocus on chromosome 12q24 with linkage to bipolar risk (38).PSH2 is the most proximal gene to the MAPT gene, encodingthe tau protein, on chromosome 17q21.31. Hyperphosphory-lated forms of tau are often found in the brains of patients withAD, and MAPT mutations are associated with frontotemporaldementia with parkinsonism linked to chromosome 17(FTDP-17) (39,40). On one hand, the close proximity of a PShomologue to a gene whose dysfunction is intimatelyassociated with neurodegenerative conditions might be coin-cidental. On the other hand, the close proximity (� 50 kb) ofthese genes might be significant, since sequence analysis hasrevealed multiple (nine) SNPs in PSH2 that are in completelinkage disequilibrium with the extended H1/H2 haplotypes inthe MAPT gene (41). The H1 haplotype is a genetic risk factorfor the development of the sporadic tauopathies progressivesupranuclear palsy (41) and cortical basal degeneration (42). Inaddition, the location of PSH2 might be relevant to familiesthat have been described with FTDP-17 lacking tau pathologyand without obvious mutations in the MAPT gene (33–35).Sequencing of PSH2 in multiple MAPT mutation-negative FTDfamilies that have similar clinical and pathological phenotypesto these FTDP-17 families has thus far failed to reveal anyevidence of pathogenic mutations. However, none of thesequenced tau-negative FTD families is large enough todemonstrate linkage to chromosome 17q, and thus we cannotexclude PSH2 as a candidate gene for ‘tau-negative’ FTDP-17.The remaining three PSH genes are on chromosomes20q11.21, 19p13.3 and 15q21.2.

All of the PSHs appear to be widely expressed, since each isrepresented by numerous ESTs from diverse tissues and celllines. Significantly, even though the intronless PSH2 might bepredicted to be a non-translated pseudogene resulting fromretrotransposition of an ancestral PSH mRNA, it does in factappear to be expressed, at least at the mRNA level. In theseinitial non-quantitative RT–PCR experiments, expression ofPSH2 appeared to be lower than that of other PSHs. Morerigorous analysis of relative expression levels will be neededto determine the relative abundance of each of the PSHtranscripts.

The identification of a novel family of PS homologues islikely to lead to insights into PS function and evolution. Byinference from PSs, a diaspartyl peptidase function for PSHs isplausible. However it is perhaps unlikely that PSHs cleaveknown PS substrates, since the PSH family, represented amongthe archaea and eukaryotes, appear to have arisen considerablybefore the appearance of PSs, Ab, Notch and ErbB4. Moreover,double knockout of PS1 and PS2 appears sufficient to abolishg-secretase cleavage of APP and Notch (18,19). In any case,additional experiments will need to be conducted to determinewhether or not any of the PSHs can cleave known g-secretasesubstrates. Based on their apparent expression in the brain, it isunlikely that known g-secretase substrates are major substratesfor the PSHs. However, as has been shown for other enzymefamilies, the identification of a wider repertoire of PS/PSH

Figure 3. RT–PCR analysis of PSH1–5 in human brain and in H4 neurogliomacells. PS1–5 transcripts are expressed in brain and H4 cells. From these non-quantitative studies it appears that PSH2 is likely to be expressed at lower levelsthen the other PSHs. ‘� ’ indicates no cDNA; ‘�RT’ indicates H4 mRNA trea-ted with DNase I that is not reverse-transcribed; ‘Brain’ refers to amplificationof a brain cDNA library, and ‘H4’ refers to RT–PCR of H4 mRNA. Authenti-city of the products was verified by sequencing.

Table 1. SNPs identified by sequence analysis of PSH2

Polymorphism Nucleotide Allele on MAPT haplotype

R123Q 368G>A H1(G)–H1(A)E209K 625G>A H1(G)–H1(A)S224P 670T>C H1(T)–H2(C)H303R 908A>G H1(A)–H2(G)A332T 994G>A H1(G)–H2(A)R461P 1382G>C H1(G)–H2(C)I471V 1411A>G H1(A)–H2(G)T477T 1431C> T H1(C)–H2(T)D554D 1662T>C H1(T)–H2(C)G577G 1731A>G H2(A)–H2(G)S601P 1801T>C H1(T)–H2(C)G620R 1878G>A H1(G)–H2(A)

SNPs in italics were inherited with the H1/H2 haplotypes of the MAPT gene.




Dow

nloaded from


family members may now facilitate a greater understanding ofthe molecular and cellular functions of this biomedicallyimportant family. In particular, given the interest in developingg-secretase inhibitors that target PSs as potential therapeuticagents in AD (1), information gathered by studying this proteinfamily may offer important insights into the potential catalyticmechanisms and substrate-specificities of PS and PSH that willaid the development of such inhibitors.

MATERIALS AND METHODS

Bioinformatic methods

Known PS sequences were compared with a non-redundantprotein sequence database (NR; ftp://ftp.ncbi.nlm.nih.gov/pub/blast/db/nr; 808 320 sequences) using PSI-BLAST (31) and anE-value threshold of 2� 10�3. [An E-value (or expect value)for a given alignment score x represents the number ofalignments with scores x or higher that are expected purely bychance in the database search.] Similar PSI-BLAST searchesdetermined the extent of the protein family homologous to amouse sequence (GenInfo code 12849450). A multiplesequence alignment of this family’s sequences was constructedusing Clustal-W (43) and manually adjusted to minimize gappositions within secondary structures. A hidden Markov modelof this alignment was constructed using HMMER (32) andcompared with a second non-redundant protein sequencedatabase (nrdb90; ftp://ftp.ebi.ac.uk/pub/databases/nrdb90/;392 089 sequences).

Further members of the PSH sequence family were detectedby searching a non-redundant nucleotide sequence (NT; ftp://ftp.ncbi.nlm.nih.gov/pub/blast/db/nt) or expressed sequence tag(ftp://ftp.ncbi.nlm.nih.gov/pub/blast/db/est) databases usingBLAST. The positions of PSH genes in the human genomewere determined using BLAT (http://genome.cse.ucsc.edu/cgibin/hgBlat?command=start). Signal peptides were detectedusing SignalP (http://www.cbs.dtu.dk/services/SignalP/),and co-occurring domains were identified using Pfam(http://www.sanger.ac.uk/Pfam/). Transmembrane topologiesof PSs and PSHs were predicted using algorithms such asTMHMM (http://www.cbs.dtu.dk/services/TMHMM/) andTMPRED (http://www.ch.embnet.org/software/TMPRED/form.html).

RT–PCR

RNA was extracted from H4 (human neuroglioma) cells usingthe RNeasy RNA extraction kit (Qiagen, Chatsworth, CA)

according to the manufacturer’s instructions. RNA was treatedwith DNase using the DNA-free kit (Ambion, Austin TX), andcDNA was synthesized from 5 mg of RNA using SuperscriptReverse Transcriptase (Invitrogen, Carlsbad, CA), also accord-ing to the manufacturer’s instruction. A whole-brain cDNAlibrary was purchased from Invitrogen. PCR was performedwith Taq DNA polymerase (Invitrogen) on a Hybaid MBS 0.2Gthermocycler using a touchdown program with the followingcycling parameters: 10 cycles annealing at 60�C, followed by25 cycles annealing at 55�C. Primers for the PCR reactions areshown in Table 2. PCR products were analyzed on a 2%NuSieve gel (BioWhittaker, Rockland, ME).

PCR and sequence analysis

Primers were designed to generate three separate products:Product #1 was amplified using primers 1F and 3R, giving a1126 bp product, then sequenced with 1F, 1R, 2F, 2R, 3Fand 3R. Product #2 was generated using primers 3F and 5R,giving a 1088 bp product, then sequenced with 3F, 4F, 4Rand 5R. Product #3 was generated using primers 5F and 7R,giving an 852 bp product, and then sequenced with 5F, 6F,6R and 7R. The primer sequences are shown in Table 3.Reactions contained 50 ng of genomic DNA in a 50 mlmixture containing 20 pmol of each primer, 0.2 mM dNTPs, 1unit of Taq with buffer and Q-solution (Qiagen, California,UK). Amplifications were performed oil-free in HybaidTouchdown thermal cyclers (Hybaid, Cambridge, UK).Conditions were 35 cycles of 94�C for 30 s, 60�C to 50�Ctouchdown annealing for 30 s, and 72�C for 45 s, with afinal extension of 72�C for 10 min. All products were

Table 2. PCR primers for amplification of PSH

mRNA Forward primer Reverse primer Product (bp)

PSH1 50 GCCTGGTCTCCTACTATGC 30 50 CCAAATAGAGAAGGGCGGG 30 218PSH2 50 GAGCTGCCCTTCATCCCCC 30 50 CAAGGGAGCCTGGGTTCGACAT 30 226PSH3 50 GCTTTGCAGCCTACATCTTCG 30 50 TTTCTCTTTCTTCTCCAGCCCC 30 309PSH4 50 CTGCACCATCGCCTATGGC 30 50 GGACTTTCGCAAAGCCGCTG 30 179PSH5 50 GGTGCTGATGAAAAAGGGG 30C 50 TTGCTGGACAATCTGTTCACC 30 206Actin 50 CGCAACCGCTCATTGCC 30 50 ACCCACACTGTGCCCATCTA 30 290

Table 3. PCR and internal sequencing primers

Primer Sequence

1F GACTGCTCTGTGACAAAGG1R GTGGAAGCTGCAGTTACC2F ATGATGGCACCAAGGCAC2R TTCCTTCTGGGCTCCCTC3F TCCTGGCTGTGGGCACAGTG3R CAGCGGTCCTCATTGCGGTAG4F CTGTCCCTGCGGCAATAC4R CACATCAAAGCGGCAACAG5F TCTCCGCCTTGACCCTGTGCAG5R ATCTGCTGCGCCCTCCTGCTTC6F AGCTCAGCCTCTTCTGGAC6R TGAGTGGGATCAGCATGG7F GACCGCAGTGATAGCTCC7R ATGCCCTGATTTCTTGTTG




Dow

nloaded from


purified using the Qiaquick PCR Purification Kit (Qiagen,CA). 100 ng of product was sequenced in both directionsusing the Big Dye kit (Perkin Elmer). Sequencing wasperformed on an ABI377 automated sequencer andprocessed using Factura and Sequence Navigator software(Perkin Elmer).

REFERENCES

1. Golde, T.E. and Younkin, S.G. (2001) Presenilins as therapeutic targets forthe treatment of Alzheimer’s disease. Trends Mol. Med., 7, 264–269.

2. Scheuner, D., Eckman, C., Jensen, M., Song, X., Citron, M., Suzuki, N.,Bird, T.D., Hardy, J., Hutton, M., Kukull, W. et al. (1996) Secreted amyloidbeta-protein similar to that in the senile plaques of Alzheimer’s disease isincreased in vivo by the presenilin 1 and 2 and APP mutations linked tofamilial Alzheimer’s disease. Nature Med., 2, 864–870.

3. De Strooper, B., Saftig, P., Craessaerts, K., Vanderstichele, H., Guhde, G.,Annaert, W., Von Figura, K., and Van Leuven, F. (1998) Deficiency ofpresenilin-1 inhibits the normal cleavage of amyloid precursor protein.Nature, 391, 387–390.

4. De Strooper, B., Annaert, W., Cupers, P., Saftig, P., Craessaerts, K., Mumm, J.S.,Schroeter, E.H., Schrijvers, V., Wolfe, M.S., Ray, W.J. et al. (1999) Apresenilin-1-dependent gamma-secretase-like protease mediates release ofNotch intracellular domain. Nature, 398, 518–522.

5. Saxena, M.T., Schroeter, E.H., Mumm, J.S. and Kopan, R. (2001) Murinenotch homologs (n1–4) undergo presenilin-dependent proteolysis. J. Biol.Chem., 276, 40268–40273.

6. Ni, C.Y., Murphy, M.P., Golde, T.E. and Carpenter, G. (2001) g-Secretasecleavage and nuclear localization of ErbB-4 receptor tyrosine kinase.Science, 294, 2179–2181.

7. Mumm, J.S. and Kopan, R. (2000) Notch signaling: from the outside in.Dev. Biol., 228, 151–165.

8. Cao, X. and Sudhof, T.C. (2001) A transcriptionally active complex of APPwith Fe65 and histone acetyltransferase Tip60. Science, 293, 115–120.

9. Leissring, M.A., LaFerla, F.M., Callamaras, N. and Parker, I. (2001)Subcellular mechanisms of presenilin-mediated enhancement of calciumsignaling. Neurobiol. Dis., 8, 469–478.

10. Yoo, A.S., Cheng, I., Chung, S., Grenfell, T.Z., Lee, H., Pack-Chung, E.,Handler, M., Shen, J., Xia, W., Tesco, G., Saunders, A.J. et al. (2000)Presenilin-mediated modulation of capacitative calcium entry. Neuron, 27,561–572.

11. Leissring, M.A., Akbari, Y., Fanger, C.M., Cahalan, M.D., Mattson, M.P.and LaFerla, F.M. (2000) Capacitative calcium entry deficits and elevatedluminal calcium content in mutant presenilin-1 knockin mice. J. Cell. Biol.,149, 793–798.

12. Zhang, Z., Hartmann, H., Do, V.M., Abramowski, D., Sturchler-Pierrat, C.,Staufenbiel, M., Sommer, B., van de Wetering, M., Clevers, H., Saftig, P.et al. (1998) Destabilization of b-catenin by mutations in presenilin-1potentiates neuronal apoptosis. Nature, 395, 698–702.

13. Kang, D.E., Soriano, S., Frosch, M.P., Collins, T., Naruse, S., Sisodia, S.S.,Leibowitz, G., Levine, F. and Koo, E.H. (1999) Presenilin 1 facilitates theconstitutive turnover of beta-catenin: differential activity of Alzheimer’sdisease-linked PS1 mutants in the beta-catenin-signaling pathway.J. Neurosci., 19, 4229–4237.

14. Yu, G., Chen, F., Levesque, G., Nishimura, M., Zhang, D.M., Levesque, L.,Rogaeva, E., Xu, D., Liang, Y., Duthie, M. et al. (1998) The presenilin 1protein is a component of a high molecular weight intracellular complexthat contains beta-catenin. J. Biol. Chem., 273, 16470–16475.

15. Naruse, S., Thinakaran, G., Luo, J.J., Kusiak, J.W., Tomita, T., Iwatsubo, T.,Qian, X., Ginty, D.D., Price, D.L., Borchelt, D.R. et al. (1998) Effects ofPS1 deficiency on membrane protein trafficking in neurons. Neuron, 21,1213–1221.

16. Golde, T.E., Eckman, C.B., and Younkin, S.G. (2000) Biochemicaldetection of Ab isoforms: implications for pathogenesis, diagnosis, andtreatment of Alzheimer’s disease. Biochim. Biophys. Acta, 1502, 172–187.

17. Herreman, A., Hartmann, D., Annaert, W., Saftig, P., Craessaerts, K.,Serneels, L., Umans, L., Schrijvers, V., Checler, F., Vanderstichele, H. et al.(1999) Presenilin 2 deficiency causes a mild pulmonary phenotype and nochanges in amyloid precursor protein processing but enhances the

embryonic lethal phenotype of presenilin 1 deficiency. Proc. Natl Acad. Sci.USA, 96, 11872–11877.

18. Zhang, Z., Nadeau, P., Song, W., Donoviel, D., Yuan, M., Bernstein, A. andYankner, B.A. (2000) Presenilins are required for g-secretase cleavage of b-APP and transmembrane cleavage of Notch-1. Nature Cell Biol., 2, 463–465.

19. Herreman, A., Serneels, L., Annaert, W., Collen, D., Schoonjans, L. and DeStrooper, B. (2000) Total inactivation of g-secretase activity in presenilin-deficient embryonic stem cells. Nature Cell Biol., 2, 461–462.

20. Li, Y.M., Lai, M.T., Xu, M., Huang, Q., DiMuzio-Mower, J., Sardana, M.K.,Shi, X.P., Yin, K.C., Shafer, J.A. and Gardell, S.J. (2000) Presenilin 1 islinked with g-secretase activity in the detergent solubilized state. Proc. NatlAcad. Sci. USA, 97, 6138–6143.

21. Wolfe, M.S., Xia, W., Ostaszewski, B.L., Diehl, T.S., Kimberly, W.T.and Selkoe, D.J. (1999) Two transmembrane aspartates in presenilin-1required for presenilin endoproteolysis and gamma-secretase activity.Nature, 398, 513–517.

22. Steiner, H., Duff, K., Capell, A., Romig, H., Grim, M.G., Lincoln, S.,Hardy, J., Yu, X., Picciano, M., Fechteler, K. et al. (1999) A loss of functionmutation of presenilin-2 interferes with amyloid b-peptide production andnotch signaling. J. Biol. Chem., 274, 28669–28673.

23. Wolfe, M.S., Xia, W., Moore, C.L., Leatherwood, D.D., Ostaszewski, B.,Rahmati, T., Donkor, I.O. and Selkoe, D.J. (1999) Peptidomimetic probesand molecular modeling suggest that Alzheimer’s gamma-secretase is anintramembrane-cleaving aspartyl protease. Biochemistry, 38, 4720–4727.

24. Murphy, M.P., Hickman, L.J., Eckman, C.B., Uljon, S.N., Wang, R. andGolde, T.E. (1999) g-Secretase, evidence for multiple proteolytic activitiesand influence of membrane positioning of substrate on generation ofamyloid beta peptides of varying length. J. Biol. Chem., 274, 11914–11923.

25. Esler, W.P., Kimberly, W.T., Ostaszewski, B.L, Diehl, T.S., Moore, C.L.,Tsai, J.Y., Rahmati, T., Xia, W., Selkoe, D.J. and Wolfe, M.S. (2000)Transition-state analogue inhibitors of gamma-secretase bind directly topresenilin-1. Nature Cell Biol., 2, 428–434.

26. Li, Y.M., Xu, M., Lai, M.T., Huang, Q., Castro, J.L., DiMuzio-Mower, J.,Harrison, T., Lellis, C., Nadin, A., Neduvelil, J.G. et al. (2000)Photoactivated g-secretase inhibitors directed to the active site covalentlylabel presenilin 1. Nature, 405, 689–694.

27. Seiffert, D., Bradley, J.D., Rominger, C.M., Rominger, D.H., Yang, F.,Meredith, J.E. Jr., Wang, Q., Roach, A.H., Thompson, L.A., Spitz, S.M.et al. (2000) Presenilin-1 and -2 are molecular targets for gamma-secretaseinhibitors. J. Biol. Chem., 275, 34086–34091.

28. Evin, G., Sharples, R.A., Weidemann, A., Reinhard, F.B., Carbone, V.,Culvenor, J.G., Holsinger, R.M., Sernee, M.F., Beyreuther, K. andMasters, C.L. (2001) Aspartyl protease inhibitor pepstatin binds to thepresenilins of Alzheimer’s disease. Biochemistry, 40, 8359–8368.

29. LaPointe, C.F. and Taylor, R.K. (2000) The type 4 prepilin peptidasescomprise a novel family of aspartic acid proteases. J. Biol. Chem., 275,1502–1510.

30. Steiner, H., Kostka, M., Romig, H., Basset, G., Pesold, B., Hardy, J.,Capell, A., Meyn, L., Grim, M.L., Baumeister, R. et al. (2000) Glycine 384is required for presenilin-1 function and is conserved in bacterial polytopicaspartyl proteases. Nature Cell Biol., 2, 848–851.

31. Schaffer, A.A., Aravind, L., Madden, T.L., Shavirin, S., Spouge, J.L.,Wolf, Y.I., Koonin, E.V. and Altschul, S.F. (2001) Improving the accuracyof PSI-BLAST protein database searches with composition-based statisticsand other refinements. Nucleic Acids Res., 29, 2994–3005.

32. Eddy, S.R. (1998) Profile hidden Markov models. Bioinformatics, 14,755–763.

33. Lendon, C.L., Lynch, T., Norton, J., McKeel, D.W., Busfield, F. et al. (1998)Hereditary dysphasic disinhibition dementia: a frontotemporal dementialinked to 17q21–22. Neurology, 50, 1546–1555.

34. Froelich, S., Basun, H., Forsell, C., Lilius, L., Axelman, K. et al. (1997)Mapping of a disease locus for familial rapidly progressive frontotemporaldementia to chromosome 17q12–21. Am. J. Med. Genet., 74, 380–385.

35. Bird, T.D., Wijsman, E.M., Nochlin, D., Leehey, M., Sumi, S.M. et al. (1997)Chromosome 17 and hereditary dementia: linkage studies in three non-Alzheimer families and kindreds with late-onset FAD. Neurology, 48, 949–954.

36. Tomita, T., Watabiki, T., Takikawa, R., Morohashi, Y., Takasugi, N.,Kopan, R., De Strooper B. and Iwatsubo, T. (2001) The first proline ofPALP motif at the C terminus of presenilins is obligatory for stabilization,complex formation, and gamma-secretase activities of presenilins. J. Biol.Chem., 276, 33273–33281.




Dow

nloaded from


37. Mahon, P. and Bateman, A. (2000) The PA domain: a protease-associateddomain. Protein Sci., 9, 1930–1934.

38. Degn, B., Lundorf, M.D., Wang, A., Vang, M., Mors, O., Kruse, T.A. andEwald, H. (2001) Further evidence for a bipolar risk gene on chromosome12q24 suggested by investigation of haplotype sharing and allelicassociation in patients from the Faroe Islands. Mol. Psychiatry, 6, 450–455.

39. Wilhelmsen, K.C., Clark, L.N., Miller, B.L. and Geschwind, D.H. (1999)Tau mutations in frontotemporal dementia. Dement. Geriatr. Cogn. Disord.,10(Suppl 1), 88–92.

40. Hutton, M. (2000) Molecular genetics of chromosome 17 tauopathies. Ann.NY Acad. Sci., 920, 63–73.

41. Baker, M., Litvan, I., Houlden, H., Adamson, J., Dickson, D., Perez-Tur, J.,Hardy, J., Lynch, T., Bigio, E. and Hutton, M. (1999) Association of an

extended haplotype in the tau gene with progressive supranuclear palsy.Hum. Mol. Genet., 8, 711–715.

42. Houlden, H., Baker, M., Morris, H.R., MacDonald, N., Pickering-Brown, S.,Adamson, J., Lees, A.J., Rossor, M.N., Quinn, N.P., Kertesz, A., et al.(2001) Corticobasal degeneration shares the same tau haplotypeassociation as progressive supranuclear palsy. Neurology, 56,1702–1705.

43. Thompson, J.D., Higgins, D.G. and Gibson, T.J. (1994) CLUSTAL W:improving the sensitivity of progressive multiple sequence alignmentthrough sequence weighting, position-specific gap penalties and weightmatrix choice. Nucleic Acids Res., 22, 4673–4680.




Dow

nloaded from


Identification of a novel family of presenilin homologues

Documents

Transcript of Identification of a novel family of presenilin homologues