Heterozygosity and functional allelic variation in the Candida albicans efflux pump genes CDR1 and...

Heterozygosity and functional allelic variation in theCandida albicans efflux pump genes CDR1 and CDR2

Ann R. Holmes,1 Sarah Tsao,1† Soo-Wee Ong,1

Erwin Lamping,1 Kyoko Niimi,1 Brian C. Monk,1

Masakazu Niimi,2 Aki Kaneko,2 Barbara R. Holland,3

Jan Schmid4 and Richard D. Cannon1*1Department of Oral Sciences, School of Dentistry,University of Otago, Dunedin, New Zealand.2Department of Bioactive Molecules, National Institute ofInfectious Diseases, Tokyo, Japan.3Allan Wilson Centre, Massey University, PalmerstonNorth, New Zealand.4Institute of Molecular BioSciences, College ofSciences, Massey University, Palmerston North, NewZealand.

Summary

Elevated expression of the plasma membrane drugefflux pump proteins Cdr1p and Cdr2p was shownto accompany decreased azole susceptibility inCandida albicans clinical isolates. DNA sequenceanalysis revealed extensive allelic heterozygosity,particularly of CDR2. Cdr2p alleles showed differentabilities to transport azoles when individuallyexpressed in Saccharomyces cerevisiae. Loss ofheterozygosity, however, did not accompanydecreased azole sensitivity in isogenic clinical iso-lates. Two adjacent non-synonymous single nucle-otide polymorphisms (NS-SNPs), G1473A and I1474Vin the putative transmembrane (TM) helix 12 ofCDR2, were found to be present in six strainsincluding two isogenic pairs. Site-directed mutagen-esis showed that the TM-12 NS-SNPs, and princi-pally the G1473A NS-SNP, contributed to functionaldifferences between the proteins encoded by thetwo Cdr2p alleles in a single strain. Allele-specificPCR revealed that both alleles were equally frequentamong 69 clinical isolates and that the majority ofisolates (81%) were heterozygous at the G1473A/I1474V locus, a significant (P � 0.001) deviation from

the Hardy–Weinberg equilibrium. Phylogeneticanalysis by maximum likelihood (Paml) identified 33codons in CDR2 in which amino acid allelic changesshowed a high probability of being selectivelyadvantageous. In contrast, all codons in CDR1 wereunder purifying selection. Collectively, these resultsindicate that possession of two functionally differentCDR2 alleles in individual strains may confer aselective advantage, but that this is not necessarilydue to azole resistance.

Introduction

The ATP-binding cassette (ABC) class of transporterstranslocate a wide range of substrates across prokaryoticand eukaryotic cell membranes (Jones et al., 1999; Jonesand George, 2002; Schmitt and Tampe, 2002). Candidaalbicans, an opportunistic fungal pathogen of humans,possesses 28 putative ABC transporter genes (Gauret al., 2005) and co-ordinated transcriptional overexpres-sion of at least two, CDR1 and CDR2, correlates withresistance to azole antifungal drugs (Sanglard et al.,1995; White, 1997a; Maebashi et al., 2001; Perea et al.,2001; Rogers and Barker, 2003; Chau et al., 2004; Costeet al., 2004; Liu et al., 2005) which are currently the drugsof choice in the treatment of serious mucosal C. albicansinfections. Few studies of C. albicans azole resistance,however, have investigated its correlation with increasedfunctional expression of Cdr1p and Cdr2p polypeptides.Expression of Cdr1p at the cell surface has been demon-strated (Hernaez et al., 1998; Pasrija et al., 2005) and theexpression of both Cdr1p and Cdr2p was elevated in theplasma membranes of three fluconazole (FLC)-resistantclinical isolates relative to an unrelated sensitive strain(Schuetzer-Muehlbauer et al., 2003a). Cdr proteinexpression was also upregulated following transient expo-sure of a laboratory C. albicans strain to FLC (Coste et al.,2004). Studies from this laboratory have confirmed bothprotein expression and activity of the Cdr1p pump in alaboratory strain of C. albicans (Niimi et al., 2004a). Nostudies, however, have examined Cdr proteins in isogenicsensitive and resistant sequentially isolated clinicalisolates.

The diploid nature of C. albicans must be consideredin any analysis of C. albicans gene expression and

Accepted 27 July, 2006. *For correspondence. E-mail [email protected]; Tel. (+64) 3479 7081; Fax(+64) 3479 7078. †Present address: Institute for Research in Immu-nology and Cancer (IRIC), University of Montreal, Montreal, Quebec,Canada.

Molecular Microbiology (2006) 62(1), 170–186 doi:10.1111/j.1365-2958.2006.05357.xFirst published online 30 August 2006

© 2006 The AuthorsJournal compilation © 2006 Blackwell Publishing Ltd

mailto:[email protected]

function. The C. albicans genome sequence (Joneset al., 2004) has revealed an extensive, but highly vari-able, degree of heterozygosity. Intra-allelic sequencediversity affecting function has been noted for C. albi-cans ERG16 (White, 1997b) and ERG3 (Miyazaki et al.,1999) and single nucleotide polymorphisms (SNPs) inthe SAP2 promoter sequence were shown to mediatedifferential regulation of allele expression (Staib et al.,2002). Comparison of the primary protein structures ofdifferent ABC transporter alleles can provide importantclues about their function and regulation. More than 50SNPs have been reported for the human ABC multidrugtransporter P-glycoprotein (P-gp, ABCB1), many ofwhich affect the protein’s function (Ishikawa et al.,2004). Such intrinsic genetic variability may play animportant role in the response of organisms to xenobi-otics. ABC proteins contain nucleotide binding domains(NBDs) and transmembrane (TM) domains comprisingclustered TM spans. Determining how individual aminoacid changes within such domains can affect pumpactivity will help elucidate pumping mechanisms andmay aid the design of pump inhibitors. Single amino acidresidues have been shown to affect substrate recogni-tion and inhibitor susceptibilities of pump proteins (Ernstet al., 2005). In the Walker A motifs of fungal transporterNBD1 domains, cysteine replaces a lysine residue thatis commonly conserved in other organisms, and thiscysteine has been shown to be essential for ATPaseactivity in C. albicans (Jha et al., 2003a,b). The C. albi-cans NBD2 has the conventional lysine residue at asimilar position, which is also critical for function (Jhaet al., 2004). Site-directed mutation has shown thatF774 in TM segment 6 of Cdr1p affects the protein’strafficking and localization (Shukla et al., 2003). AT1351F mutation in the TM segment 11 of Cdr1p(Shukla et al., 2004) and mutations in the TM-10 of Sac-charomyces cerevisiae Pdr5p (Egner et al., 2000) affectsubstrate specificity.

Our approach to the analysis of Cdr protein functionhas been to hyperexpress the protein products of indi-vidual alleles in the heterologous, genetically tractable,yeast S. cerevisiae (Nakamura et al., 2001; Monk et al.,2002). Use of the host strain AD1-8u– (Decottignieset al., 1998) allows hyperexpression from the PDR5locus of functional heterologous proteins that are cor-rectly trafficked to the S. cerevisiae plasma membrane inequivalent amounts (Niimi et al., 2005; Saini et al.,2005). This allows the direct comparison of the functionof individual alleles, facilitating the identification of aminoacid residues that affect drug pump function. In thisstudy we have used heterologous expression tocompare the function of individual alleles of CDR1 andCDR2, and to investigate the possible significance ofextensive CDR2 heterozygosity.

Results

Candida albicans clinical isolates with decreased FLCsusceptibilities show elevated expression of Cdr1p andCdr2p and increased efflux of the Cdrp substraterhodamine 6G

Although the detection of elevated CDR mRNAs andpolypeptide synthesis has been reported for C. albicansclinical isolates with reduced azole susceptibilities,increased expression of Cdr1p and Cdr2p and theirassociated activities have not previously been confirmedfor isogenic strains (an azole-sensitive parent and itsresistant derivative). Plasma membranes were preparedfrom two isogenic pairs of strains (TL1/TL3 and FH1/FH8) isolated sequentially from different patients (Marret al., 2001), and from the laboratory strain ATCC 10261as a control (Fig. 1). As expected, the plasma mem-brane H+-ATPase Pma1p (~100 kDa, Fig. 1A) was thepredominant polypeptide in the preparations. The moststriking difference between the protein profiles was theoverexpression of proteins of 170 kDa in the FLC-resistant isolates TL3 and FH8. Anti-Cdr1p antibodiesreacted with a 170 kDa polypeptide band in plasmamembrane fractions from all the strains, but moststrongly with preparations from the FLC-resistant iso-lates (Fig. 1B). Anti-Cdr2p antibodies reacted with bandsof the same relative mobilities in membranes from theazole resistant strains, but not with any proteins from theFLC-sensitive strains ATCC 10261 or TL1 (Fig. 1C).Both antibodies reacted with 170 kDa polypeptides fromthe FH1 parental strain. This strain had an FLC minimalinhibitory concentration (MIC) of 4.0 mg ml-1 (Fig. 1D)and so demonstrated reduced FLC susceptibility relativeto the laboratory strain ATCC 10261 or the TL1 parentalstrain. The expression of both Cdr1p and Cdr2p in theazole-resistant isolate TL3 was confirmed by trypticmass spectrometry (MS) fingerprint analysis (Niimi et al.,2002) of the 170 kDa band excised following PAGEseparation (Fig. 1E). When strain-specific sequence wasused as input sequence for peak identification, ratherthan the default database sequences, nine Cdr1p-specific peaks, eight Cdr2p-specific peaks and 27 peaksthat were common to both proteins could be identifiedover the complete mass range analysed. Eighteenpeaks remained unidentified.

Activity of the efflux pumps in C. albicans strains withreduced FLC susceptibilities was demonstrated by mea-suring the ability of C. albicans cells to efflux rhodamine6G (R6G), a substrate of Cdr1p (Nakamura et al., 2001)and Cdr2p (Sanglard et al., 1997). The C. albicansstrains with reduced azole susceptibility and increasedCdr1p and Cdr2p expression had a higher pumpingactivity (Fig. 1F). A low background level of efflux wasobserved for the sensitive clinical isolate TL1. The FH1

C. albicans CDR allelic variation 171

© 2006 The AuthorsJournal compilation © 2006 Blackwell Publishing Ltd, Molecular Microbiology, 62, 170–186

parental strain, which has a slightly elevated MIC forFLC (4 mg ml-1), showed an increased R6G efflux com-pared with TL1. Strain FH8, the resistant derivative ofFH1, showed the greatest efflux rate. The initial intrac-ellular concentrations of R6G accumulated in the cellsunder glucose-deprived conditions prior to efflux assaywere similar for each strain (results not shown).

Hyperexpression of individual alleles of C. albicansCDR1 and CDR2 from laboratory strain ATCC 10261 inS. cerevisiae AD1-8u– demonstrates functional allelicvariation for these genes

Careful examination of the sequence chromatogramsobtained for CDR1 and CDR2 using C. albicans ATCC10261 genomic DNA as a template revealed the pres-ence of multiple double peaks and therefore allelic varia-tion for these genes in this strain. Each allele(designated A or B) of the ATCC 10261 CDR1 andCDR2 genes was separately cloned and hyperex-pressed in S. cerevisiae AD1-8u– (Fig. 2A). Coomassieblue-stained SDS-PAGE profiles of plasma membranefractions from the AD/CDR1 and AD/CDR2 strainsrevealed 170 kDa protein bands that were not present inthe control strain AD/pABC3 or in the parental AD1-8u–

strain (data not shown). Expression of Cdr1p and Cdr2pwas confirmed by Western blotting using antibodies spe-cific to Cdr1p or Cdr2p (Fig. 2B and C). Quantification ofthe plasma membrane protein profiles showed that thehyperexpressed Cdr proteins were expressed at equiva-lent amounts for each allele construct and contributed20–29% of plasma membrane protein.

The cloned pump alleles were functional when hyperex-pressed in S. cerevisiae, as determined by the measure-

A

B

C

ATC

C 1

0261

TL1

TL3

FH

1

FH

8

250

kDa

98

64

250

FLC MIC80 ( g ml-1)

0.5 1.0 32 4 64D

0.1

0.2

0.3

0.4

Eff

lux o

f R

6G

(n

mo

l10

7 c

ells

-1)

Time (min)

5 10 15

E

F

1 1

2

2

1 or 21 or 2

No ID

100

170

170

250

170

0

0.5

Fig. 1. Hyperexpression of Cdr1p and Cdr2p in FLC-resistantC. albicans clinical isolates.A. SDS-PAGE analysis of plasma membrane samples (30 mgprotein loaded per well) prepared from C. albicans strains. Openarrowhead: Pma1p, closed arrowhead: Cdr1p and Cdr2p.B and C. Western blot of samples used in (A), sequentially probedwith antibodies specific to Cdr1p (B) or Cdr2p (C). Bands weredetected by chemiluminescence as described in Experimentalprocedures.D. FLC susceptibilities of each strain determined by microdilutionMIC as described in Experimental procedures.E. Representative portion of the MS analysis of a tryptic digestionof the 170 kDa band excised from a PAGE separated plasmamembrane sample from C. albicans TL3. Tryptic peptide peaks(arrowed) were identified as being specifically from Cdr1p (1),Cdr2p (2) or from either Cdr1p or Cdr2p (1 or 2). Open arrowindicates unidentified peak.F. R6G efflux from yeast cells of the isogenic pairs of C. albicansclinical isolates TL1 and TL3 (open and filled circles respectively)and FH1 and FH8 (open and filled squares respectively). Cellswere pre-loaded with R6G under starvation conditions as describedin Experimental procedures. Efflux of R6G into the supernatant wasmeasured following the addition of glucose. Results shown are themeans of triplicate samples in a representative experiment.

172 A. R. Holmes et al.


ment of: (i) MICs of azole drugs (Table 1), (ii) oligomycin-sensitive ATPase activities of plasma membrane fractions(Table 1), (iii) glucose-dependent R6G efflux from starvedcells (Fig. 2D) and (iv) susceptibilities to other pump sub-strates (Fig. 3). The susceptibilities of strains expressingeach of the alleles to azole drugs were determined by amicrodilution method (Table 1). The control strain AD/pABC3 was sensitive to all azoles. MICs for the polyenenystatin which is not a substrate of the Cdr pumps, wereidentical for all strains. An increase in FLC MIC, relative tothe control, was observed for each strain expressing aCDR allele, and consistent differences in MIC (measuredin at least three separate experiments) between the allelepairs of CDR1, and of CDR2, were apparent (200 and300 mg ml-1, respectively, for AD/CDR1A and AD/CDR1B;60 and 120 mg ml-1, respectively, for AD/CDR2A and

AD/CDR2B). Cdr2p-expressing strains, but not Cdr1p-expressing strains, also showed intra-allelic variation inMICs for the azoles itraconazole (ITC) and ketoconazole(KTC). Pump function was also demonstrated for all allelesby assay of oligomycin-sensitive ATPase activities(Table 1) and by measurement of R6G efflux by wholecells, as described above for C. albicans strains. Recom-binant S. cerevisiae strains expressing Cdr1p or Cdr2palleles all effluxed R6G. For Cdr1p (alleles A and B)maximum efflux rates were 75 � 9 and 79 � 7 pmol 107

cells-1 min-1 respectively; for Cdr2p (alleles A and B)maximum efflux rates were 22 � 5 and 33 � 3 pmol 107

cells-1 min-1 respectively (Fig. 2D). Thus CDR2B appearsto confer greater FLC and R6G pumping activity on S. cer-evisiae than CDR2A. Negligible R6G efflux was observedfor control cultures of either the AD/pABC3 strain in the

A

C

B

AD

/pA

BC

3A

D/C

DR

1AA

D/C

DR

1BA

D/C

DR

2A

Eff

lux o

f R

6G

(n

mo

l10

7 c

ells

-1)

Cdr1p Cdr2p

0.2

0.4

0.6

0.8

D

AD

/CD

R2B

Time (min)

5 10 150 5 100

Fig. 2. Functional hyperexpression of C. albicans ATCC 10261 Cdr1p (A or B alleles) or Cdr2p (A or B alleles) in S. cerevisiae AD1-8u–.A. SDS-PAGE analysis of plasma membrane preparations from S. cerevisiae strains (listed in Table 7).B and C. Western blots of samples used in (A), sequentially probed with antibodies specific to Cdr1p (B) or Cdr2p (C). Bands were detectedusing chemiluminescence as described in Experimental procedures.D. Efflux of R6G from recombinant S. cerevisiae strains: AD/pABC3 (closed triangles); AD/CDR1A (open circles); AD/CDR1B (filled circles);AD/CDR2A (open squares); AD/CDR2B (filled squares). Representative results for the efflux of R6G from cells in the absence of glucose areshown for strain AD/CDR2A only (open triangles). The results are the means for triplicate samples in a representative experiment.

Table 1. Azole susceptibilities of S. cerevisiae strains expressing C. albicans ATCC 10261 CDR1 or CDR2 alleles.

S. cerevisiae straina

MIC (mg ml-1)

ATPase activityb (nmol Pi min-1 mg protein-1)FLC ITC KTC MCZ NYS

AD/pABC3c 0.5 0.031 � 0.016 � 0.016 2 7 � 2AD/CDR1A 200d � 16 3 2 2 185 � 4AD/CDR1B 300d � 16 3 2 2 188 � 3AD/CDR2A 60d 4 3d 2 2 128 � 9e

AD/CDR2B 120d � 16 4d 2 2 164 � 16e

a. Cells for MIC determinations were incubated at 30°C for 48 h in CSM medium (pH 7.0).b. Oligomycin-sensitive ATPase activity in plasma membranes prepared as described in Experimental procedures, measured at pH 7.5.c. Empty cloning cassette control.d. Drug dilutions were not twofold, see Experimental procedures.e. 200 mM oligomycin used in assays.



presence of glucose (Fig. 2D, closed triangles), or any ofthe Cdrp allele-expressing strains in the absence ofglucose (e.g. Fig. 2D, open triangles).

The allele-dependent differential susceptibilities of theCdr2p-expressing strains were also demonstrated usingagarose diffusion assays with FLC, ITC, KTC, voricona-zole (VRC), R6G and two other known Cdr pump sub-strates, trifluoperazine (TFP) and cerulenin (CER)(Nakamura et al., 2001) (Fig. 3). The control strainAD/pABC3 was sensitive to all drugs examined. Controldisks containing the polyene nystatin (not a pump sub-strate) inhibited growth of all strains to the same extent.The assays demonstrated a difference in the susceptibili-ties of the strains expressing the CDR2 A or B alleles toazole drugs FLC, ITC, miconazole (MCZ), KTC, VRC andCER but not to R6G or TFP. The differential susceptibili-ties of AD/CDR2A and AD/CDR2B to FLC and CER wereconfirmed by plating dilutions of cells on agar containingdifferent drug concentrations (Fig. 4).

This is the first report of functional intra-allelic variation inthe CDR genes of C. albicans. We therefore completelysequenced the alleles of both CDR1 and CDR2 from strainATCC 10261 and other clinical isolates in order to deter-mine the extent of heterozygosity within these genes.

Detection of heterozygosity in the CDR1 and CDR2genes of C. albicans ATCC 10261 and other C. albicansstrains including two isogenic pairs of clinical isolates

The sequences of the CDR1 and CDR2 genes of thelaboratory strain ATCC 10261 were determined usingPCR-amplified genomic DNA as a template. SNPs weredetected in both CDR1 (53) and CDR2 (89) and confirmedby sequencing each allele cloned in S. cerevisiae. This isequivalent to a polymorphism frequency of 1 per 84 bp and1 per 50 bp, for Cdr1p and Cdr2p respectively. The posi-

tions of the non-synonymous SNPs (NS-SNPs) in eachgene are shown in Fig. 5B. There were more NS-SNPs inATCC 10261 CDR2 (20) than in CDR1 (6). Most of theNS-SNPs were conservative; there were only two non-conservative NS-SNPs in CDR1 and seven in CDR2.

The observed functional differences between thecloned alleles of strain ATCC 10261, and the largenumber of SNPs in the CDR genes of this strain, sug-gested that recombination leading to loss of heterozy-gosity (LOH) in these genes could allow, in strains underselective pressure, duplication of an allele encoding amore active protein, as described for C. albicans ERG16(White, 1997b). We therefore examined the extent ofheterozygosity in the CDR genes of six other C. albicansstrains, including the related clinical isolates withreduced susceptibility to azole drugs. Genomic DNA wasprepared from seven of the strains listed in Table 6(ATCC 10261, SC5314, TIMM3163, TL1, TL3, FH1 andFH8) and the CDR1 and CDR2 genes were sequenced.All strains were heterozygous for both CDR1 and CDR2(Table 2) except for SC5314 [in which CDR1 and CDR2are contained within a homozygous region of chromo-some 3 (Arnaud et al., 2005)]. There were no NS-SNPsin any CDR1 gene except the laboratory strain ATCC10261 (Table 2) but all strains except SC5314 containedboth S-SNPs and NS-SNPs in CDR2. Comparison ofSNP maps for each strain of the two isogenic pairs (TL1and TL3; FH1 and FH8) revealed no evidence of LOH,whereas the pattern of SNPs varied between unrelatedstrains (results not shown). A pair of adjacent NS-SNPsin CDR2, however, was common to all heterozygousstrains (amino acids G1473A; I1474V, highlighted inFig. 5B). In strain SC5314 (homozygous at the CDR2locus) the amino acid pair GI was present at these posi-tions. The GI amino acid pair is also present in anotherpublished Cdr2p sequence [GenBank AAB96797 (Sang-

AD/pABC3

AD/CDR2A

AD/CDR2B

FLC ITC CER TFP R6G NYSMCZ VRCKTC

Fig. 3. Differential susceptibilities of S. cerevisiae strains AD/CDR2A, AD/CDR2B or cloning cassette control strain AD/pABC3, to differentdrugs and chemicals, determined by disk diffusion. Yeast cells (5 ¥ 105) were seeded in top agarose on CSM-ura agarose plates. Filter paperdiscs to which the drugs had been applied were placed on the agarose surface and the plates were incubated at 30°C for 48 h. The amountsof individual drugs or chemicals applied to the disks are given in Experimental procedures.



lard et al., 1997)] although this sequence is from anSC5314-derived strain.

Consistent segregation of the 1473/1474 SNP pair inseparately cloned alleles of CDR2 with differentialsusceptibility to FLC

In order to determine whether differential function of CDR2alleles occurred in clinical isolates as well as in the labo-ratory strain ATCC 10261, each allele of CDR2 from the

isogenic strains TL1 and TL3, the FLC-resistant clinicalisolate TIMM3163, and the single allele from SC5314, wereseparately cloned and expressed in S. cerevisiaeAD1-8u–.Representative clones expressing each allele from thesestrains were sequenced over the region containing theamino acid 1473/1474 SNP pair identified from the parentalgenomic sequences. In each case the SNP pairs at posi-tions 1473/1474 segregated consistently: one allele con-tained the residues GI and the other allele contained thesequenceAV. The alleles were designatedA-type (contain-ing GI) or B-type (containing AV). The susceptibility of eachrecombinant strain to FLC was determined by liquid MIC.Each set of strains expressing pairs of alleles showed asimilar differential FLC MIC as the strains expressing eitherthe A or B allele of C. albicans ATCC 10261 CDR2(Table 3). All strains expressing A-type alleles had lowerMICs (60–75 mg ml-1) of FLC than those expressing B-typealleles (100–150 mg ml-1). As with ATCC 10261, CDR2Balleles from all strains conferred on S. cerevisiae greaterFLC resistance than CDR2A alleles.

Site-directed mutagenesis identified that Cdr2p TM-12NS-SNP G1473A affects FLC susceptibility

To confirm that residues 1473 and 1474 in the TM-12domain of CDR2 affect the function of Cdr2p, site-directed

Fig. 4. Differential susceptibilities ofS. cerevisiae strains AD/CDR2A, AD/CDR2Bor cloning cassette control strain AD/pABC3,to FLC and CER, determined by agar platedrug resistance assays. Doubling dilutions ofcells were applied in 5 ml volumes to thesurface of agar plates containing either noadded drug, or FLC, or CER, at theconcentrations indicated in the Figure. Theplates were incubated at 30°C for 48 h.

AD/pABC3

AD/CDR2A

AD/CDR2B

AD/pABC3

AD/CDR2A

AD/CDR2B

No drug control

FLC 60 g ml-1 CER 3 g ml-1

CER 1.5 g ml-1FLC 40 g ml-1

AD/pABC3

AD/CDR2A

AD/CDR2B

Table 2. Heterozygosity of C. albicans CDR1 and CDR2.

C. albicansstrain

FLC MIC80

(mg ml-1)

SNPs

CDR1 CDR2

S NS S NS

SC5314 0.5 0 0 0 0ATCC 10261 0.5 47 6 69 20TL1 1.0 12 0 44 17TL3 32.0 12 0 44 17FH1 4.0 28 0 32 14FH8 64.0 28 0 32 14TIMM3163 32.0 32 0 36 11

Synonymous (S) and non-synonymous (NS) single nucleotide poly-morphisms (SNPs) in sequences from seven C. albicans strains,including three strains with reduced susceptibility to FLC.



mutagenesis (SDM) was used to alter these residues ineach of the cloned alleles of strain ATCC 10261. In initialexperiments, both residues of the TM-12 SNP pair werechanged from A-type to B-type and vice versa (Fig. 6A).The specific base-pair exchanges were confirmed bysequencing, and the presence of five other S-SNPs in theTM-12 region allowed ready confirmation of correctmutagenesis and cloning. All strains expressed equivalentamounts of Cdr2p in plasma membrane preparations(results not shown). The susceptibilities of strains

expressing mutated Cdr2ps to FLC were determined byliquid MIC and disk diffusion assays. Introduction of theB-type SNP pair into the A allele resulted in a strain(AD/CDR2A-AV) with an intermediate MIC for FLC(80 mg ml-1; Fig. 6B) relative to the two parental allelestrains (FLC MICs 60 and 120 mg ml-1; Fig. 6B, Table 3).Introduction of the A-type SNP pair into the B allele alsogave a strain (AD/CDR2B-GI) with an intermediate MIC(80 mg ml-1) as demonstrated by disk diffusion assay(Fig. 6C). Each amino acid of the A allele SNP pair wasalso separately introduced into the B allele by recombi-nant PCR SDM. The strain containing the G1473A sub-stitution (AD/CDR2B-GV) showed a similar zone ofinhibition for FLC and CER to the AD/CDR2B-GI doublemutant strain (Fig. 6C) and possessed a reduced FLCMIC (80 mg ml-1) relative to the parental B allele strain,whereas the I1474V substitution had no effect on suscep-tibility (strain AD/CDR2B-AI, Fig. 6C).

The A-type and B-type alleles of Cdr2p at residues1473 and 1474 are equally frequent and the majority ofC. albicans strains are heterozygous at this locus

Although Cdr2p showed allelic variation in function, noLOH in this gene was detected in isogenic strains isolatedfollowing azole treatment, compared with the sensitive

Fig. 5. Diagrammatic representation of CDRdomains and NS-SNPs within the CDR1 andCDR2 genes of C. albicans ATCC 10261.A. Domains in CDR genes as designated bythe NCBI Conserved Domain Database(Marchler-Bauer et al., 2005). The conservedWalker A and Walker B motifs are indicatedby filled arrowheads and the ABC transporterfamily signature sequence by an openarrowhead.B. NS-SNPs within the CDR1 and CDR2genes. The allele A amino acid residue isgiven first for each NS-SNP identified. Theadjacent pair of SNPs in the TM-12 region ofCDR2 are shown bold and italicized.*Non-conservative substitutions.TM

spans

ATCC10261

CDR1ATCC10261

CDR2

E214Q

F427Y

S842T

V916I

A1416E*

E396K*

A59TD50G*

K86Q*S142TE179K*

T348V*

E394K*

F439YY425F

G466R*S484A

S719GA741V

S812N*

R1069K

K860R

N1102D

M1497LG1473A; I1474V

ATG

TAA (1499)TAA (1501)

ATG

CDD Domains

12345

6

789

1011

12

A B

NBD1

NBD2

TM

spans

Table 3. FLC susceptibilities of S. cerevisiae strains expressing indi-vidual CDR2 alleles from five C. albicans strains.

C. albicansstrain Allele cloned TM-12 SNPs

FLC MIC80

(mg ml-1)a ofS. cerevisiaerecombinant

ATCC 10261 A GI 60B AV 120

TIMM3163 A GI 60B AV 100

TL1 A GI 75B AV 150

TL3 A GI 75B AV 150

SC5314 A GI 75

a. MIC values from representative experiment of triplicatedeterminations.



parental strains. The fact that the two azole-resistant iso-lates had not lost the CDR2 allele that conferred greaterazole sensitivity (allele A), suggested that possession oftwo functionally different alleles might confer advantagesthat outweigh the inferior function of one allele in convey-ing azole resistance. We therefore determined the fre-quency of the SNP pair at residues 1473 and 1474(Table 4) in a collection of 69 C. albicans strains from 12geographic regions (Schmid et al., 1999) using allele-specific PCRs (Moorhead et al., 2003). The PCRs weredesigned to be specific either for the GI amino acid pair(A-type allele) or for the AV amino acid pair (B-type allele).The heterozygous AB allele combination was significantlyoverrepresented: the frequencies of the AA, AB and BBgenotypes were 12%, 81% and 7%, compared with aHardy–Weinberg expectation of 27%, 50% and 23%

respectively, based on the observed frequencies of A andB alleles (chi square test P � 0.001). Deviations from theHardy–Weinberg equilibrium could be a result of the pre-dominantly clonal mode of reproduction of C. albicans(Fundyga et al., 2002). Clonality causes violation of theHardy–Weinberg equilibrium because mutant allelesremain restricted to the particular clonal lineages in whichthey have arisen (Tibayrenc, 1997). However, both alleleswere equally frequent (A: 52%; B: 48%) in the collection of69 strains which included genotyped isolates selected tobe representative of the species (Zhang et al., 2003).Thus it is unlikely that clonality is causing the observeddeviation from the Hardy–Weinberg equilibrium. Theequally high frequency of both alleles also suggests thatthe A allele is unlikely to be an inferior allele, possessionof which results in reduction in fitness. Similar allele fre-

GTT GCT TTT ATT GGT ATC AAT ATC V A F I G I N I

GTT GCC TTT ATT GCT GTC AAT ATC V A F I A V N I

PDR5 promoter URA3 PDR5CDR2

WT sequence A allele:

WT sequence B allele:

A Forward Primers (F2):To insert A allele SNP pair into B allele template:GTT GCC TTT ATT GGT ATC AAT ATC

To insert B allele SNP pair into A allele template:GTT GCT TTT ATT GCT GTC AAT ATC

1.00

0.75

0.50

0.25

0

OD

(A590)

FLC concentration

( g/ml)

15010050

B C

Amino acid residues 1469-1476

F1 R2

F2 R1

AscI

AscI

FLC

AD/CDR2A (GI)

AD/CDR2B (AV)

AD/CDR2B-GI

AD/CDR2B-GV

CER

AD/CDR2B-AI

Fig. 6. Site-directed mutagenesis of two adjacent amino acids in the TM-12 region of C. albicans CDR2, and its effect on FLC susceptibility.A. SDM strategy. S. cerevisiae PDR5 upstream and downstream sequences directing integration of amplified cassette are indicated by filledbars; the URA3 gene (shaded bar) is the transformation selection marker. Primer sites are indicated by arrows. All SNPs within the primersequences are underlined and the 1473/1474 SNP pair are shown in bold.B. FLC MICs for S. cerevisiae strains AD/CDR2A (open squares), AD/CDR2B (filled squares) and the double SDM mutant strainAD/CDR2A-AV (open triangles; contains B allele 1473A, 1474V residues within the A allele).C. Disk diffusion assays showing FLC and CER susceptibilities of the S. cerevisiae strains as follows: parental allele strains AD/CDR2A andAD/CDR2B; B allele SD mutant strains AD/CDR2B-GI (contains the A allele residues 1473G and 1474I); AD/CDR2B-GV (contains the A alleleresidue 1473G) and AD/CDR2B-AI (contains the A allele residue 1474I).



quencies and degrees of overrepresentation of heterozy-gotes were maintained when we divided the isolates intofour subgroups (Table 4), namely (i) 56 infection-causingisolates, (ii) 13 commensal isolates (Schmid et al., 1999),(iii) 39 strains belonging to a ubiquitous general-purposegenotype (GPG) cluster of strains that are successful asopportunistic pathogens and the most frequent amonginfection-associated isolates and (iv) 17 infection-causingisolates not belonging to this cluster. Statistically signifi-cant overrepresentation of heterozygotes (P � 0.001, chisquare test) was demonstrated for groups (i) and (iii), aswell as for the complete collection. Failure to demonstratestatistical significance for the data from groups (ii) and (iv)was probably due to the smaller number of strains inthese groups. Given that GPG strains are more clonalthan other strains (Holland et al., 2002), the similar degreeof overrepresentation of heterozygotes inside and outsidethe GPG cluster is an additional indication that excess

heterozygosity is not merely caused by clonality but thatthe heterozygosity is advantageous. The ubiquity of het-erozygosity across the groups also suggests that thisadvantage may be independent of the nature of interac-tion with the host (commensal or pathogenic) or geneticbackground. We have demonstrated that both alleles arecapable of producing functional proteins in the heterolo-gous S. cerevisiae expression system. To confirm thatexpression of both alleles also occurs in C. albicans weperformed semiquantitative reverse transcriptase PCR(RT-PCR). RNA was extracted from the FLC-resistantstrain TL3 and from FLC-sensitive strains ATCC 10261and TL1 with, and without, exposure to fluphenazine(FPH) which is known to induce CDR1 and CDR2 expres-sion (Karababa et al., 2004). These strains were all het-erozygous for CDR2. cDNA was prepared from RNAusing a CDR2-specific reverse primer that would annealto both alleles (Table 5). Each cDNA preparation was

Table 4. Excess heterozygosity at the 1473/1474 amino acid residues of Cdr2p in C. albicans strains as demonstrated by allele-specific PCR.

Strain group/designationTotal numberof strains in group

Number (%) of strains with indicated PCR resulta and predicted genotype

A+B–AA genotype (GI/GI)

A–B+BB genotype (AV/AV)

A+B+AB genotype (GI/AV)

All strains 69 8 (11.6) 5 (7.2) 56 (81.2)(i) Infection isolatesb 56 6 (10.7) 4 (7.1) 46 (82.2)(ii) Commensal isolatesb 13 2 (15.4) 1 (7.7) 10 (76.9)(iii) GPG cluster strainsc 39 2 (5.1) 2 (5.1) 35 (89.7)(iv) Non-GPG strains 17 4 (23.5) 2 (11.8) 11 (64.7)

a. PCRs were designed to be specific for either the A allele amino acid pair GI or the B allele amino acid pair AV, as described in Experimentalprocedures.b. Strains were defined as infection or commensal isolates as previously described (Schmid et al., 1995; 1999).c. General-purpose genotype cluster of strains that are successful as opportunistic pathogens and the most frequent among infection-associatedisolates (Schmid et al., 1999).

Table 5. PCR primers.

pABC cloningPacI CDR1 AAATTAATTAAAAAATGTCAGATTCTAAGATGTCGNotI CDR1 AAAGCGGCCGCATTTATTTCTTATTTTTTTTCTCTCTGPacI CDR2 GTCAAAATTAATTAAAAAATGAGTACTGCAAACACGTCTTTGTCGNotI CDR2 AAAGCGGCCGCCCTTATTTTTTCATCTTCTTTTCTCTATTACCN-terminal AscI GTTGGGCGCGCCCACACACATATATATAAGCCC-terminal AscI GCCGGCCGCACTAGACTTGGCGCGCCTACCGTTCTTTTTAGGC

TM12 SDMA-type SNP pair into B allele Forward GTTGCCTTTATTGGTATCAATATCA-type SNP pair into B allele Reverse GAATGATATTGATACCAATAAAGGCAACB-type SNP pair into A allele Forward GTTGCTTTTATTGCTGTCAATATCATTCB-type SNP pair into A allele Reverse GAATGATATTGACAGCAATAAAAGCAAC1st A-type SNP into B allele Forward GTTGCCTTTATTGGTGTCAATATCATTC1st A-type SNP into B allele Reverse GAATGATATTGACACCAATAAAGGCAAC2nd A-type SNP into B allele Forward GTTGCCTTTATTGCTATCAATATCATTC2nd A-type SNP into B allele Reverse GAATGATATTGATAGCAATAAAGGCAAC

SNP-specific PCRCommon Forward primer CCAATGCTGAACCG/CACAGACA-type SNP pair specific reverse AATAGTAAGAATGATATTGATACB-type SNP pair specific reverse ATAGTAAGAATGATATTGACAG

RT-PCRreverse primer for cDNA production CAA/TCTTCTTTTCTCTATTG/ACCA or B allele-specific PCR as for SNP-specific PCR above



used in PCRs with the SNP-specific primers (Table 5) toamplify allele-specific cDNA. No PCR products wereobtained in reverse transcriptase-minus controls indicat-ing there was no DNA contamination of RNA samples.Control amplifications using DNA from AD/CDR2A andAD/CDR2B demonstrated that the PCRs were allele-specific. Both A- and B-specific PCR amplicons weredetected in cDNA produced from all C. albicans strains(Fig. S1) indicating that both CDR2 alleles wereexpressed. There was more PCR product from FLC-resistant strain TL3 and FPH-induced ATCC 10261 andTL1 than from the uninduced FLC-sensitive strains.

Amino acid changes in Cdr2p have higher probability ofbeing selectively advantageous than amino acidchanges in Cdr1p

Cdr1p and Cdr2p have similar sequences (84% identity instrain SC5314), and have presumably arisen by duplica-tion of a common ancestral CDR gene. In BLAST searches,Cdr1p and Cdr2p gave high similarity scores with a set oforthologous proteins from other fungal species, but theCdr1p scores were always slightly higher than the Cdr2pscores. Together with the high frequency of NS-SNPs inCDR2 genes, this indicates that CDR2 is less conservedthan CDR1 and suggested a possible evolutionary reasonfor the high degree of CDR2 heterozygosity. CDR2 may infact be a copy of CDR1 in the process of acquiring a newfunction, somewhat different from that of CDR1, for whichneither of the two alleles has reached the state where itfunctions optimally. Therefore, possession of two versionsof Cdr2p with slightly different activities might be selec-tively advantageous. If this assumption were correct, wewould expect that non-synonymous mutations in CDR1would have a high probability of being disadvantageous(purifying selection), because the protein it encodes hasretained its original function. In CDR2, on the other hand,evolution towards a new function would increase the prob-ability that non-synonymous mutations are selectivelyadvantageous (positive selection). To test this we mea-sured w values (the ratio of non-synonymous to synony-mous substitution rates) for both genes. We used aneighbour joining tree as a basis to describe the phylogenybetween the C. albicans CDR1 and CDR2 genessequenced, and tested whether a model allowing differentw ratios among CDR1 sequences and among CDR2sequences gave a significantly better fit than a model inwhich w was identical for both genes. Allowing three differ-ent w values (one each for CDR1, CDR2 and the branchconnecting them) gave a significantly better explanation ofthe data than a model with just one w ratio (likelihood ratiotest; P � 0.0001), and the w ratio for CDR2 (0.0787) wasindeed higher than that for CDR1 (0.0177). Further evi-dence that amino acid changes have a higher probability of

being selectively advantageous in Cdr2p than in Cdr1pwas obtained when w ratios were calculated for individualcodons. Thirty-three codons in CDR2, distributed through-out the gene, showed evidence that amino acid changeswere selectively favoured (w ratios � 2.0). In contrast, forCDR1 there was no statistical support for any positiveselection (most codons showed w ratios � 0.1).

Discussion

The correlation of an increase in functional Cdrp expres-sion in plasma membranes from isogenic pairs of clinicalisolates with the development of resistance has not beenpreviously reported. In two such strain pairs, TL1/TL3 andFH1/FH8 (Marr et al., 2001), we found that an increase inFLC resistance corresponded with increased expressionof both Cdr1p and Cdr2p, as determined by Westernblotting and MS analysis, and also, importantly, withincreased pump activity, measured as energy-dependentefflux of the fluorescent pump substrate R6G (Fig. 1). R6Gis a substrate of both C. albicans Cdr1p (Nakamura et al.,2001) and Cdr2p (Gauthier et al., 2003). The ability tocompare the activities of Cdr1p and Cdr2p directly is crucialif the contribution of each pump protein to drug effluxfunction in clinical resistance is to be determined. We havedeveloped a heterologous expression system (Monk et al.,2002; Niimi et al., 2005) with which we achieved consistentand equivalent hyperexpression of individual alleles ofboth C. albicans Cdr1p and Cdr2p in S. cerevisiae (Fig. 2).This allowed reproducible measurements of differences inpump activities. Expression of individual Cdr1p allelesconferred a greater resistance to FLC, and an increasedrate of R6G efflux, than Cdr2p-expressing strains, butCdr2p-expressing strains showed equivalent (or slightlygreater) resistance to KTC and MCZ than the Cdr1pstrains. Differences in pump substrate susceptibilities ofcells heterologously expressing either Cdr1p or Cdr2phave been reported previously (Sanglard et al., 1997;Gauthier et al., 2003; Schuetzer-Muehlbauer et al.,2003b). However, because plasmid-encoded expressionwas used, equivalent levels of pump protein expressionwere not achieved, and these previous studies also did notdifferentiate between the alleles expressed. We foundsignificant functional differences between the ATCC 10261Cdr1p alleles (for FLC susceptibility only) and Cdr2p alleles(for FLC, ITC, KTC and CER susceptibilities) as demon-strated by MIC determination, disk diffusion and agar platedrug resistance assays (Table 3; Figs 2–4).

Thus, in addition to allowing the first direct comparisonof Cdr1p and Cdr2p function, the heterologous hyperex-pression system facilitated detection of intra-allelic func-tional variation. NS-SNPs were found in both C. albicansATCC 10261 CDR1 and CDR2 genes. We hypothesizedthat the amino acid sequence differences between alleles,



particularly of Cdr2p (which contained 20 NS-SNPs),affect function, as revealed by the differences in pheno-typic assays of the hyperexpressing strains. The intra-allelic functional variation observed for Cdr2p alleles wasinvestigated by exploiting the discovery that a pair ofNS-SNPs in the TM-12 region was common to six strainsfound to be heterozygous at the CDR2 locus (Table 2).Sequencing the TM-12 region in CDR2 alleles confirmedthat the SNP pair co-segregated, with the amino acid pairGI in one allele (A-type) and AV (B-type) in the other allele.B-type alleles conferred higher MICs for FLC than A-typealleles (Table 3). A role for this pair of amino acids inCdr2p function was confirmed by SDM of the C. albicansATCC 10261 CDR2 A or B alleles and their expression inS. cerevisiae. The B-type amino acid pair was introducedinto the A allele and vice versa. In each case, the FLC MICof the mutant strains was intermediate between the MICsof parental A and B allele recombinant strain MICs(Fig. 6). This result indicated that these amino acids had arole in Cdr2p function. The mutation did not completelyreverse the MIC of the parental allele, which may reflect amodulating role for some of the other 18 NS-SNPs in theCDR2 gene of this strain, but the G1473A substitutionappeared to be primarily responsible for the functionalvariation seen. The results of the disk diffusion assays(Fig. 3) also indicate that this region of the protein mayhave a role in substrate specificity for azoles and CER butnot for the substrates R6G and TFP. Previous studieshave implicated other TM regions of ABC transportersin substrate binding and specificity. Alanine scanningmutagenesis has identified single amino acid residues inTM-11 that affect Cdr1p function (Saini et al., 2005) andcysteine-scanning mutagenesis of human P-gp identifiedimportant residues for substrate binding in the TM-12region of this pump protein (Loo and Clarke, 2002).

The considerable heterozygosity in both CDR genes,and in particular for CDR2 (Table 2), was intriguing. TheC. albicans ATCC 10261 CDR1 gene had a SNP fre-quency of 1 per 84 bp and for CDR2 it was even higher at1 per 50 bp. Extensive heterozygosity is present to avariable degree across the C. albicans genome (Forcheet al., 2004), with an average SNP frequency of 1 in237 bp (Jones et al., 2004). C. albicans clinical isolatesare predominantly clonal (Graser et al., 1996; Fundygaet al., 2002), a fact presumed to be a result of the defec-tive (or limited) sexual cycle in C. albicans (Hull andJohnson, 1999; Hull et al., 2000; Magee and Magee,2000; 2004). However, genetic diversity is present(Tavanti et al., 2004) probably because LOH, via mitoticrecombination, gene conversion or chromosome deletion/duplication (Legrand et al., 2004; Wu et al., 2005) mayserve a genetic role homologous to sexual recombination(Yesland and Fonzi, 2000). Indeed, LOH events occurredat observable frequencies during passage of C. albicans

in an animal model of disseminated infection (Forcheet al., 2005). LOH in genes associated with azole resis-tance could represent a mechanism for increasing resis-tance during selective pressure by azole exposure.Induction of LOH at the ERG11 locus during developmentof azole resistance in clinical isolates has been demon-strated (White, 1997b). In addition, LOH of portions ofchromosome 5 allowed a hyperactive allele of the tran-scription factor Tac1p to be brought to homozygosity withsubsequent upregulation of CDR1 and CDR2 in pairs ofmatched azole-susceptible and azole-resistant isolates(Coste et al., 2006). Despite these observations for otheryeast genes, our results did not provide any evidence forLOH in CDR2 as a mechanism for selection of an alleleconferring increased azole resistance.

Our discovery that both CDR2 alleles are approximatelyequally frequent and widespread throughout the species,and that most strains possess both alleles, leads us tohypothesize that possession of the A allele provides selec-tive advantages that outweigh those that would be con-veyed by replacing it, even when azole treatment isadministered. In S. cerevisiae, the primary cellular functionof homologous membrane efflux pumps is the efflux oftoxins produced during cellular metabolism (Mamnunet al., 2004) and stress response (Wolfger et al., 2004). Ifthis is also the normal function of Cdr1p and Cdr2p inC. albicans, a reduced azole pumping capacity of one offour CDR alleles may be preferable to the loss of a CDR2allele which could be making a significant contribution tothe removal of other compounds toxic to the cell. Theconservation of the TM-12 SNP pair in a higher proportionof C. albicans isolates than expected according to theHardy–Weinberg equilibrium, and the high heterozygosityof CDR2 in all strains examined except SC5314, could beinterpreted as reflecting a need to maintain two functionallydistinct copies of the gene, as also suggested for the ALS9gene of C. albicans (Zhao et al., 2003). For example, twofunctions may be required in order to respond to differentgrowth conditions experienced in different tissues withinthe human host. Both Cdr2p proteins were functional whenexpressed in S. cerevisiae, and both genes wereexpressed in C. albicans strains grown under laboratoryconditions, as demonstrated by RT-PCR.

The high ratio of non-synonymous to synonymous muta-tions in CDR2 provides a preliminary insight into the evo-lution of the CDR genes. CDR2 may be a paralogue of anancestral CDR gene, which, unlike CDR1, is in the processof acquiring new functions. The Paml analysis indicatedthat CDR1 is under significantly stronger purifying selec-tion than CDR2. It appears that while CDR1 has reached astate where further modifications of the protein are largelydeleterious, this may not be the case for CDR2, where theresults suggest that many codons within CDR2 are underpositive selection. If neither of the two CDR2 alleles are at



a state where they can optimally carry out all possiblefunctions required by the cell, the B allele may be superiorto the A allele for some of these functions only.

The analysis of allelic variation in Cdr2p has allowedthe identification of amino acids in the TM-12 region witha role in pump function which could provide new insightsinto the relationship between structure and drug effluxpump mechanisms. Such information is also important forthe design of pump inhibitors, which could provide a basisfor novel antifungals. We also speculate that the highdegree of CDR2 heterozygosity may reflect a role for thediffering allelic proteins in adaptation by C. albicans to therange of environmental conditions experienced within thehuman host.

Experimental procedures

Yeast strains, media and culture conditions

The C. albicans and S. cerevisiae strains used in this studyare listed in Tables 6 and 7. C. albicans strains were main-tained on YPD agar, which contained 1% (wt/vol) yeastextract (Difco, Becton Dickinson, Sparks, MD), 2% (wt/vol)

Bacto Peptone (Difco), 2% (wt/vol) D-glucose and 2% (wt/vol)agar (pH 5.5). S. cerevisiae strains were routinely maintainedon complete synthetic medium without uracil (CSM-ura),which contained 0.67% (wt/vol) yeast nitrogen base (Difco),0.077% (wt/vol) CSM-ura (Bio 101, Vista, Ca), 2% (wt/vol)glucose and 2% (wt/vol) agar (pH 7.0). Uridine (0.02%;wt/vol) was added for AD1-8u– growth (Nakamura et al.,2001).

Chemicals and antifungal agents

The chemicals and antifungal agents used in this studywere obtained from the following sources: fluconazole (FLC)as Diflucan from Pfizer Laboratories, Auckland, NewZealand; itraconazole (ITC) from Janssen Research Foun-dation, Beerse, Belgium; ketoconazole (KTC) from Janssen;voriconazole (VRC) as synthesized by the NARD InstituteLtd (Osaka, Japan) Fujisawa Pharmaceutical; cerulenin(CER), nystatin (NYS), miconazole (MCZ), rhodamine 6G(R6G), trifluoperazine (TFP), oligomycin, sodium metavana-date, sodium azide, fluphenazine (FPH), ATP and HEPESfrom Sigma, St Louis, MO; phenylmethylsulphonyl fluoride,from Roche Diagnostics NZ, Auckland, New Zealand; dim-ethyl sulphoxide (DMSO) from BDH, Poole, UK; and acry-lamide from Bio-Rad Laboratories, Hercules, CA. ITC, KTC,

Table 6. C. albicans strains used in this study.

Strain FLC susceptibility Source Reference

ATCC 10261 S American Type Culture Collection, ManSC5314 S Candida albicans database strain Jones et al. (2004)TIMM3163 R Clinical isolate, from Teikyo University (Tokyo, Japan) Maebashi et al. (2001)TL1 S Clinical isolate, from T. White (Seattle, WA) Marr et al. (2001)TL3 R Clinical isolate, from T. White (Seattle, WA) Marr et al. (2001)FH1 S Clinical isolate, from T. White (Seattle, WA) Marr et al. (2001)FH8 R Clinical isolate, from T. White (Seattle, WA) Marr et al. (2001)Genotyped strains (69)a Not determined Strain collection of J Schmid (Massey University,

Palmerston North, New Zealand)Schmid et al. (1995)

Zhang et al. (2003)

a. List of strains and genotypes supplied in Table S1.

Table 7. Genotypes of S. cerevisiae strains used in this study.

Strain Source of cloned gene Genotypea Source

AD1-8u– Mata pdr1-3 ura3 his1 yor1D::hisG snq2D::hisG pdr10D::hisGpdr11D::hisG ycfD::hisG pdr3D::hisG pdr15D::hisG pdr5D::hisG

Decottignies et al. (1998)

AD/pABC3 Vector (empty cloningcassette control)

Mata pdr1-3 ura3 his1 yor1D::hisG snq2D::hisG pdr10D::hisGpdr11D::hisG ycfD::hisG pdr3D::hisG pdr15D::hisG pdr5D::URA3

Monk et al. (2002)Niimi et al. (2005)

AD/CDR1A C. albicans ATCC 10261b Mata pdr1-3 ura3 his1 yor1D::hisG snq2D::hisG pdr10D::hisGpdr11D::hisG ycfD::hisG pdr3D::hisG pdr15D::hisGpdr5D::CDR1A-URA3

This study

AD/CDR1B C. albicans ATCC 10261b Mata pdr1-3 ura3 his1 yor1D::hisG snq2D::hisG pdr10D::hisGpdr11D::hisG ycfD::hisG pdr3D::hisG pdr15D::hisGpdr5D::CDR1B-URA3

This study

AD/CDR2A C. albicans ATCC 10261b Mata pdr1-3 ura3 his1 yor1D::hisG snq2D::hisG pdr10D::hisGpdr11D::hisG ycfD::hisG pdr3D::hisG pdr15D::hisGpdr5D::CDR2A-URA3

This study

AD/CDR2B C. albicans ATCC 10261b Mata pdr1-3 ura3 his1 yor1D::hisG snq2D::hisG pdr10D::hisGpdr11D::hisG ycfD::hisG pdr3D::hisG pdr15D::hisGpdr5D::CDR2B-URA3

This study

a. Separate alleles of each transporter gene from C. albicans strains are designated A or B.b. In some experiments the source of the cloned gene was another strain listed in Table 3.



VRC, CER, FPH and oligomycin were prepared as stocksolutions dissolved in DMSO. R6G was prepared as a stocksolution dissolved in ethanol. Agarose was from Gibco(Invitrogen, Auckland, New Zealand).

Cloning of allelic and mutant variants of CDR1 andCDR2

Saccharomyces cerevisiae strains hyperexpressing sepa-rate alleles of C. albicans CDR1 or CDR2 were constructedusing a modification of a previously described method(Nakamura et al., 2001) with vector pABC3 (Monk et al.,2002). Briefly, the CDR ORFs were amplified from C. albi-cans genomic DNA isolated using a Y-DER kit (Pierce,Rockford, IL). N-terminal and C-terminal primers, used forPCR amplification, contained PacI and NotI restriction sitesrespectively, which enabled the genes to be cloned intothese sites in the shuttle vector pABC3 downstream of theS. cerevisiae PDR5 promoter and upstream of the S. cer-evisiae URA3 gene (Niimi et al., 2005). We did not modifythe CUG codons in these constructs even though the C. al-bicans CUG codon codes for serine rather than leucine(Santos et al., 1993). Such an approach was also chosenby other researchers cloning CDR2 (Sanglard et al., 1997;Smriti et al., 2002; Schuetzer-Muehlbauer et al., 2003b).The C. albicans ATCC 10261 CDR1 gene contained noCUG codons. The CDR2 A allele contained one CUG codon(amino acid residue 21) and the B allele contained two(residues 21 and 632). This differential CUG usage had noapparent effect on the expression or stability of Cdr2p inS. cerevisiae plasma membranes (Fig. 2A and C) and sub-sequent analysis of the CDR2 sequences from other strainsshowed no correlation between the presence of CUGcodons and differential activity.

CDR genes cloned in pABC3 were isolated as cassettescontaining the PDR5 promoter, the CDR ORF, the URA3marker and downstream PDR5 sequence, using AscI diges-tion (Fig. 6). S. cerevisiae AD1-8u– cells were transformed toUra+ with the excised cassette using the lithium acetatemethod (Alkali-Cation Yeast Transformation kit, Bio101,Irvine, CA). Primers used for cloning are listed in Table 5. Allcloning PCRs used the high-fidelity enzyme hot-start KODpolymerase (Novagen-Toyobo, Madison, WI). SDM of the Aand B alleles of C. albicans ATCC 10261 CDR2 was per-formed by recombinant PCR as outlined in Fig. 6 using theprimers listed in Table 5. The mutated allele fragmentswere PCR-amplified using genomic DNA isolated fromS. cerevisiae strains containing the opposite wild-type alleleas templates. The overlapping pairs of mutated fragmentswere used to transform AD1-8u– to Ura+. Correct integrationat the PDR5 locus was confirmed by colony PCR.

Plasma membranes were prepared from all recombinantstrains as described previously (Niimi et al., 2004b),and analysed by PAGE to confirm that equivalent amountsof the cloned pump proteins were expressed in eachstrain.

SNP-specific PCRs (GI- or AV-specific) were performedusing a common forward primer 300 bp upstream of thepolymorphism and a reverse primer with either the A-type-specific or the B-type specific codon pair of the 1473/1474polymorphism incorporated into the 3′ end (Table 5).

Sequence analysis

The CDR1 and CDR2 genes were PCR amplified as over-lapping fragments from genomic DNA templates ofC. albicans strains or S. cerevisiae strains expressing indi-vidual CDR alleles, and sequenced. SNPs were identified asdouble peaks in the C. albicans sequence data, and theassignment of nucleotides in all SNPs to the A or B alleleswas achieved by sequencing the individually cloned alleles(at least two individually isolated clones of each allele weresequenced). DNA was sequenced at the Center for GeneResearch, University of Otago, New Zealand using theDYEnamic ET Terminator Cycle Sequencing kit (GE Health-care UK, Little Chalfont, UK) or using the MegaBASE DNAanlysis system (GE Healthcare) at the University of Waikato,Hamilton, New Zealand, DNA sequencing facility.

RNA isolation and RT-PCR

Candida albicans cells were grown in YPD medium at 30°Cfor 16 h with shaking (200 rpm) and transferred to freshYPD (15 ml) at a cell concentration of 7.5 ¥ 106 cells ml-1.Cultures were incubated for 3 h before harvesting by cen-trifugation and snap-freezing. In some experiments, cultureswere exposed to FPH (Sigma, 10 mg ml-1) or to DMSOcontrol (15 ml) for 20 min before harvesting as above. RNAwas extracted by the hot phenol method as previouslydescribed (Albertson et al., 1996). RNA samples (5 mg)were treated to remove contaminating DNA using a DNA-freeTM kit (Ambion, Austin, TX) in a total volume of 10 ml.Treated samples (2 ml) were used as templates for cDNAproduction using a CDR2-specific reverse primer (Table 5)and reverse transcriptase (SuperScript III; Invitrogen) intotal volumes of 20 ml according to the manufacturer’sinstructions. Control reactions, to confirm that amplicons didnot result from DNA contamination of the RNA preparations,were treated in an identical fashion but without SuperScriptIII. The presence of either the A- or B-type CDR2 allele inthe cDNA samples (2 ml) was confirmed using the SNP-specific PCRs described above.

Paml analysis

Tests to detect relaxed purifying selection, and tests todetect sites under positive selection were carried out usingPaml version 3.14 (Yang, 1997). The tests to detect relaxedpurifying selection within different lineages allowed differentsets of branches to have different w values. Four nestedhypotheses were evaluated using likelihood ratio tests(Felsenstein, 2004). In order of increasing number ofparameters used these were: a model where all brancheshad equal w; a model where the middle branch linkingCDR1 and CDR2 was allowed a different w; a model withthree w values, one each for branches within CDR1,branches within CDR2, and the middle branch; and a modelwhere each branch was allowed its own w value. Paml set-tings and log-likelihoods for each model tested are providedin Table S2. The tests to detect positively selected siteswere carried out on two separate alignments, one of Cdr1proteins, and one of Cdr2 proteins. For each alignment, two



models were fitted, one without any positively selected sites(Paml settings, m = 0, ns = 7) and one with an extra param-eter allowing some sites to be in a class with a fixed w � 1(Paml settings, m = 0, ns = 8) (Yang et al., 2000). For Cdr1pa likelihood ratio test could not reject the simpler model, butfor Cdr2p the simpler model was rejected with a P-value of0.0034.

Isolation of plasma membranes

Plasma membranes from C. albicans and S. cerevisiaestrains were prepared as described previously (Niimi et al.,2004b).

SDS-PAGE, MS and Western blot analysis

SDS-PAGE was performed according to the Laemmli method(Laemmli and Quittner, 1974) using 8% separating gels.Separated polypeptides were visualised using CoomassieBlue R250 or electroblotted (100 V, 1 h, 4°C) onto nitrocellu-lose membranes (HybondTM-ECLTM, GE Healthcare).

For MS analysis, Coomassie Blue-stained protein bandswere excised from polyacrylamide gels. In-gel trypsindigestion procedures and matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) MS spectra acquisitionwere performed as described previously (Niimi et al., 2002).MS data were analysed using the programs MS-Fit andMS-Digest (Clauser et al., 1999). Possible post-translationaland chemical modifications such as oxidation of methionine,N-terminal acetylation, addition of N-terminal pyroglutamicacid, and carbamidomethylation of cysteine, were takeninto consideration, and for some analyses, strain-specificsequence was used as input sequence rather than the defaultdatabase sequence. The matched peptides covered 21% and18%, respectively, of Cdr1p and Cdr2p. A representativeportion of the chromatogram is shown in Fig. 1E.

Western blots were incubated with anti-Cdr1p antibodies(kindly provided by Dr D. Sanglard, University Hospital Lau-sanne, Institute of Microbiology, Lausanne, Switzerland) at a1:2000 dilution, or anti-Cdr2p antibodies (kindly provided byDr M. Raymond, Institute for Research in Immunology andCancer, University of Montreal, Montreal, QC, Canada) at a1:16 000 dilution. Immunoreactivity was detected usingperoxidase-labelled anti-rabbit immunoglobulins (DakoCyto-mation, DK-2600, Glostrup, Denmark) and ECLTM reagents(GE Healthcare) according to the manufacturer’s instructions.Each antibody reacted specifically with its respective170 kDa polypeptide band antigen and did not react with theother transporter antigen or with any proteins from the controlmembrane preparation.

Heterologously expressed ABC transporter ATPaseactivity

ATPase assays were carried out on plasma membranes pre-pared as described above at 30°C and pH 7.5 for 30 min with5–10 mg of membrane protein per assay, and the oligomycin(20 mM)-sensitive ATPase specific activities of the heterolo-gously hyperexpressed C. albicans ABC transporters were

corrected for background activity by subtraction of theoligomycin-sensitive specific activity detected in membranesfrom isogenic null strain AD1-8u– (Niimi et al., 2004b). Forexperiments to measure the less susceptible Cdr2p ATPaseactivity, the oligomycin concentration used was 200 mM.

Cellular efflux of R6G

Log-phase cells (100 ml, OD600 1.3–1.7) were stored on icefor 16 h. Cells were pre-loaded with R6G under energy-depleted conditions as follows: the cells were washed twicewith distilled water, resuspended in HEPES buffer (100 ml,OD600 1.0, 50 mM HEPES-NaOH, pH 7.0), and incubatedwith shaking (200 rpm, 30°C) in the presence of 5 mM2-deoxyglucose for 30 min, before addition of R6G to 15 mM,and incubation for a further 30 min. Cells were washed twiceand resuspended in HEPES buffer at OD600 10–15. Cellsamples (50 ml) were added to wells of a glass-fibre filtermicrotitre plate (Pall Corporation, East Hills, NY) and pre-incubated at 30°C for 5 min before the addition of 50 ml of 2%glucose to triplicate wells at timed intervals. The supernatantcontaining effluxed R6G was collected by vacuum (-50 kPa)into the wells of 96 well black flat-bottom microtitre plates(BMG Labtechnologies GmbH, Offenburg, Germany). Thefluorescence of R6G in the samples was measured, by com-parison to R6G standards prepared in assay buffer, using aPOLARstar OPTIMA plate reader (BMG Labtechnologies)with excitation and emission wavelengths of 485 and 520 nmrespectively. To determine the initial intracellular concentra-tion of R6G in pre-loaded cells, cell suspensions (300 ml)were pelleted by centrifugation. Cell pellets were extracted byheating (100°C 15 min) in 50 mM Tris buffer containing 2%(wt/vol) SDS and 2% (v/v) 2-mercaptoethanol. Following cen-trifugation, fluorescence of the R6G released into the super-natant was determined as above, relative to a no R6Gcontrol, by comparison to R6G standards prepared in theextraction buffer.

Drug susceptibility determinations

A. Liquid microdilution MIC assays. The MICs of compoundsfor C. albicans strains were determined using the microdilu-tion reference method of the National Committee for ClinicalLaboratory Standards (NCCLS guidelines document M27-A2, 2002). For S. cerevisiae yeast cells the method wasmodified by using a CSM-based medium buffered topH 7.0 (Nakamura et al., 2001), as S. cerevisiae AD1-8u–,and its derivative strains, do not grow in RPMI. In some cases(for FLC and ITC) additional drug dilutions were insertedbetween doubling dilution values. The MICs for azoles andnystatin were the minimum concentrations giving � 80% and100% growth inhibition, respectively, compared with theno-drug control.

B. Disk diffusion assays. The susceptibilities of yeast strainsto different compounds were compared using diffusionassays on solidified CSM agarose (CSM with 0.6% agarose).Plates were overlaid with CSM containing 0.4% agarose(5 ml) seeded with 5 ¥ 105 yeast cells (exponential phasecells grown in CSM). The following amounts of each drug



were applied to sterile BBLTM paper disks (Becton Dickinson,Sparks, MD) which were then placed on the overlays for eachstrain: FLC 80 mg; ITC 128 mg; MCZ 2 mg; VRC 2 mg; KTC4 mg; CER 3 mg; TFP 1.5 nmol; R6G 30 nmol. Cell growthwas monitored after incubation at 30°C for 48 h.

C. Agar plate drug resistance assays. Serial twofold dilutionsof exponential phase yeast cells (initial cell concentration1.0 ¥ 106) were prepared in YPD. A 5 ml portion of each dilu-tion was spotted onto YPD agar medium containing the indi-cated concentrations of test compound. Cell growth wasmonitored after incubation at 30°C for 48 h.

Nucleotide accession numbers

Sequence data have been submitted to the GenBank data-base under accession numbers DQ462358–DQ462361(CDR1 sequences) and DQ470007–DQ470012 (CDR2sequences).

Acknowledgements

This study was supported by the National Institutes of Health,USA (R21DE015075-RDC; R01DE016885-01-RDC) and aHealth and Labour Sciences Research Grants for Researchon Emerging and Re-emerging Infectious Diseases (Ministryof Health and Welfare, Japan). We thank Dr DominiqueSanglard, University Hospital Lausanne, Institute of Microbi-ology, Lausanne, Switzerland, and Dr Martine Raymond,Institute for Research in Immunology and Cancer (IRIC),University of Montreal, Montreal, Quebec, Canada, for thekind gifts of antibodies. We are grateful for the free availabilityof the Candida Genome Database (CGD; http://www.candidagenome.org/).

References

Albertson. G.D., Niimi, M., Cannon, R.D., and Jenkinson,H.F. (1996) Multiple efflux mechanisms are involved inCandida albicans fluconazole resistance. AntimicrobAgents Chemother 40: 2835–2841.

Arnaud, M.B., Costanzo, M.C., Skrzypek, M.S., Binkley, G.,Lane, C., Miyasato, S.R., and Sherlock, G. (2005) TheCandida Genome Database (CGD), a community resourcefor Candida albicans gene and protein information. NucleicAcids Res 33: D358–D363.

Chau, A.S., Mendrick, C.A., Sabatelli, F.J., Loebenberg, D.,and McNicholas, P.M. (2004) Application of real-time quan-titative PCR to molecular analysis of Candida albicansstrains exhibiting reduced susceptibility to azoles. Antimi-crob Agents Chemother 48: 2124–2131.

Clauser, K.R., Baker, P., and Burlingame, A.L. (1999) Role ofaccurate mass measurement (+/– 10 ppm) in protein iden-tification strategies employing MS or MS/MS and databasesearching. Anal Chem 71: 2871–2882.

Coste, A.T., Karababa, M., Ischer, F., Bille, J., and Sanglard,D. (2004) TAC1, transcriptional activator of CDR genes, isa new transcription factor involved in the regulation ofCandida albicans ABC transporters CDR1 and CDR2.Eukaryot Cell 3: 1639–1652.

Coste, A.T., Turner, V., Ischer, F., Morschhauser, J., Forche,A., Semelcki, A., et al. (2006) A mutation in Tac1p, atranscription factor regulating CDR1 and CDR2, is coupledwith loss of heterozygosity at Chromosome 5 to mediateantifungal resistance in Candida albicans. Genetics 172:2139–2156.

Decottignies, A., Grant, A.M., Nichols, J.W., de Wet, H.,McIntosh, D.B., and Goffeau, A. (1998) ATPase and mul-tidrug transport activities of the overexpressed yeast ABCprotein Yor1p. J Biol Chem 273: 12612–12622.

Egner, R., Bauer, B.E., and Kuchler, K. (2000) Thetransmembrane domain 10 of the yeast Pdr5p ABC anti-fungal efflux pump determines both substrate specificityand inhibitor susceptibility. Mol Microbiol 35: 1255–1263.

Ernst, R., Klemm, R., Schmitt, L., and Kuchler, K. (2005)Yeast ATP-binding cassette transporters: cellular cleaningpumps. Methods Enzymol 400: 460–484.

Felsenstein, J. (2004) Inferring Phylogenies. Sunderland,MA: Sinauer Associates.

Forche, A., Magee, P.T., Magee, B.B., and May, G. (2004)Genome-wide single-nucleotide polymorphism map forCandida albicans. Eukaryot Cell 3: 705–714.

Forche, A., May, G., and Magee, P.T. (2005) Demonstrationof loss of heterozygosity by single-nucleotide polymor-phism microarray analysis and alterations in strain mor-phology in Candida albicans strains during infection.Eukaryot Cell 4: 156–165.

Fundyga, R.E., Lott, T.J., and Arnold, J. (2002) Populationstructure of Candida albicans, a member of the humanflora, as determined by microsatellite loci. Infect GenetEvol 2: 57–68.

Gaur, M., Choudhury, D., and Prasad, R. (2005) Completeinventory of ABC proteins in human pathogenic yeast,Candida albicans. J Mol Microbiol Biotechnol 9: 3–15.

Gauthier, C., Weber, S., Alarco, A.M., Alqawi, O., Daoud, R.,Georges, E., and Raymond, M. (2003) Functional similari-ties and differences between Candida albicans Cdr1p andCdr2p transporters. Antimicrob Agents Chemother 47:1543–1554.

Graser, Y., Volovsek, M., Arrington, J., Schonian, G.,Presber, W., Mitchell, T.G., and Vilgalys, R. (1996)Molecular markers reveal that population structure of thehuman pathogen Candida albicans exhibits both clonalityand recombination. Proc Natl Acad Sci USA 93: 12473–12477.

Hernaez, M.L. Gil, C. Pla, J., and Nombela, C. (1998)Induced expression of the Candida albicans multidrugresistance gene CDR1 in response to fluconazole andother antifungals. Yeast 14: 517–526.

Holland, B. Huber, K. Dress, A., and Moulton, V. (2002)Delta-plots: a tool for analyzing phylogenetic distance data.Mol Biol Evol 19: 2051–2059.

Hull, C.M., and Johnson, A.D. (1999) Identification of amating type-like locus in the asexual pathogenic yeastCandida albicans. Science 285: 1271–1275.

Hull, C.M. Raisner, R.M., and Johnson, A.D. (2000) Evidencefor mating of the ‘asexual’ yeast Candida albicans in amammalian host. Science 289: 307–310.

Ishikawa, T. Onishi, Y. Hirano, H. Oosumi, K. Nagakura, M.,and Tarui, S. (2004) Pharmacogenomics of drug transport-



http://www

ers: a new approach to functional analysis of the geneticpolymorphisms of ABCB1 (P-glycoprotein/MDR1). BiolPharm Bull 27: 939–948.

Jha, S. Karnani, N. Dhar, S.K. Mukhopadhayay, K. Shukla, S.Saini, P., et al. (2003a) Purification and characterization ofthe N-terminal nucleotide binding domain of an ABC drugtransporter of Candida albicans: uncommon cysteine 193of Walker A is critical for ATP hydrolysis. Biochemistry 42:10822–10832.

Jha, S., Karnani, N., Lynn, A.M., and Prasad, R. (2003b)Covalent modification of cysteine 193 impairs ATPase func-tion of nucleotide-binding domain of a Candida drug effluxpump. Biochem Biophys Res Commun 310: 869–875.

Jha, S., Dabas, N., Karnani, N., Saini, P., and Prasad, R.(2004) ABC multidrug transporter Cdr1p of Candida albi-cans has divergent nucleotide-binding domains whichdisplay functional asymmetry. FEMS Yeast Res 5: 63–72.

Jones, J.L., Hanson, D.L., Dworkin, M.S., Alderton, D.L.,Fleming, P.L., Kaplan, J.E., and Ward, J. (1999) Surveil-lance for AIDS-defining opportunistic illnesses, 1992–1997. MMWR CDC Surveill Summ 48: 1–22.

Jones, P.M., and George, A.M. (2002) Mechanism of ABCtransporters: a molecular dynamics simulation of a wellcharacterized nucleotide-binding subunit. Proc Natl AcadSci USA 99: 12639–12644.

Jones, T., Federspiel, N.A., Chibana, H., Dungan, J.,Kalman, S., Magee, B.B., et al. (2004) The diploid genomesequence of Candida albicans. Proc Natl Acad Sci USA101: 7329–7334.

Karababa, M., Coste, A.T., Rognon, B., Bille, J., and Sanglard,D. (2004) Comparison of gene expression profiles ofCandida albicans azole-resistant clinical isolates and labo-ratory strains exposed to drugs inducing multidrug trans-porters. Antimicrob Agents Chemother 48: 3064–3079.

Laemmli, U.K., and Quittner, S.F. (1974) Maturation of thehead of bacteriophage T4. IV. The proteins of the core ofthe tubular polyheads and in vitro cleavage of the headproteins. Virology 62: 483–499.

Legrand, M., Lephart, P., Forche, A., Mueller, F.M., Walsh,T., Magee, P.T., and Magee, B.B. (2004) Homozygosity atthe MTL locus in clinical strains of Candida albicans: karyo-typic rearrangements and tetraploid formation. Mol Micro-biol 52: 1451–1462.

Liu, T.T., Lee, R.E., Barker, K.S., Wei, L., Homayouni, R., andRogers, P.D. (2005) Genome-wide expression profiling ofthe response to azole, polyene, echinocandin, and pyrimi-dine antifungal agents in Candida albicans. AntimicrobAgents Chemother 49: 2226–2236.

Loo, T.W., and Clarke, D.M. (2002) Location of therhodamine-binding site in the human multidrug resistanceP-glycoprotein. J Biol Chem 277: 44332–44338.

Maebashi, K., Niimi, M., Kudoh, M., Fischer, F.J., Makimura,K., Niimi, K., et al. (2001) Mechanisms of fluconazole resis-tance in Candida albicans isolates from Japanese AIDSpatients. J Antimicrob Chemother 47: 527–536.

Magee, B.B., and Magee, P.T. (2000) Induction of mating inCandida albicans by construction of MTLa and MTLalphastrains. Science 289: 310–313.

Magee, P.T., and Magee, B.B. (2004) Through a glassopaquely: the biological significance of mating in Candidaalbicans. Curr Opin Microbiol 7: 661–665.

Mamnun, Y.M., Schuller, C., and Kuchler, K. (2004) Expres-sion regulation of the yeast PDR5 ATP-binding cassette(ABC) transporter suggests a role in cellular detoxificationduring the exponential growth phase. FEBS Lett 559: 111–117.

Marchler-Bauer, A., Anderson, J.B., Cherukuri, P.F.,DeWeese-Scott, C., Geer, L.Y., Gwadz, M., et al. (2005)CDD: a Conserved Domain Database for proteinclassification. Nucleic Acids Res 33: D192–D196.

Marr, K.A., Lyons, C.N., Ha, K., Rustad, T.R., and White, T.C.(2001) Inducible azole resistance associated with aheterogeneous phenotype in Candida albicans. AntimicrobAgents Chemother 45: 52–59.

Miyazaki, Y., Geber, A., Miyazaki, H., Falconer, D., Parkin-son, T., Hitchcock, C., et al. (1999) Cloning, sequencing,expression and allelic sequence diversity of ERG3(C-5 sterol desaturase gene) in Candida albicans. Gene236: 43–51.

Monk, B.C., Cannon, R.D., Nakamura, K., Niimi, M., Niimi, K.,Harding, D.R.K., et al. (2002) Membrane protein expres-sion system and its application. International PatentPCT/NZ02/00163.

Moorhead, S.M., Dykes, G.A., and Cursons, R.T. (2003) AnSNP-based PCR assay to differentiate between Listeriamonocytogenes lineages derived from phylogenetic analy-sis of the sigB gene. J Microbiol Methods 55: 425–432.

Nakamura, K., Niimi, M., Niimi, K., Holmes, A.R., Yates, J.E.,Decottignies, A., et al. (2001) Functional expressionof Candida albicans drug efflux pump Cdr1p in aSaccharomyces cerevisiae strain deficient in membranetransporters. Antimicrob Agents Chemother 45: 3366–3374.

Niimi, K., Harding, D.R., Parshot, R., King, A., Lun, D.J.,Decottignies, A., et al. (2004b) Chemosensitization of flu-conazole resistance in Saccharomyces cerevisiae andpathogenic fungi by a D-octapeptide derivative. AntimicrobAgents Chemother 48: 1256–1271.

Niimi, M., Nagai, Y., Niimi, K., Wada, S., Cannon, R.D.,Uehara, Y., and Monk, B.C. (2002) Identification of twoproteins induced by exposure of the pathogenic fungusCandida glabrata to fluconazole. J Chromatogr B AnalTechnol Biomed Life Sci 782: 245–252.

Niimi, M., Niimi, K., Takano, Y., Holmes, A.R., Fischer, F.J.,Uehara, Y., and Cannon, R.D. (2004a) Regulatedoverexpression of CDR1 in Candida albicans confersmultidrug resistance. J Antimicrob Chemother 54: 999–1006.

Niimi, M., Wada, S., Tanabe, K., Kaneko, A., Takano, Y.,Umeyama, T., et al. (2005) Functional analysis of fungaldrug efflux transporters by heterologous expression in Sac-charomyces cerevisiae. Jpn J Infect Dis 58: 1–7.

Pasrija, R., Prasad, T., and Prasad, R. (2005) Membrane raftlipid constituents affect drug susceptibilities of Candidaalbicans. Biochem Soc Trans 33: 1219–1223.

Perea, S., Lopez-Ribot, J.L., Kirkpatrick, W.R., McAtee, R.K.,Santillan, R.A., Martinez, M., et al. (2001) Prevalence ofmolecular mechanisms of resistance to azole antifungalagents in Candida albicans strains displaying high-levelfluconazole resistance isolated from human immuno-deficiency virus-infected patients. Antimicrob AgentsChemother 45: 2676–2684.



Rogers, P.D., and Barker, K.S. (2003) Genome-wide expres-sion profile analysis reveals coordinately regulated genesassociated with stepwise acquisition of azole resistance inCandida albicans clinical isolates. Antimicrob AgentsChemother 47: 1220–1227.

Saini, P., Prasad, T., Akhtar Gaur, N., Shukla, S., Jha, S.,Sudha Komath, S., et al. (2005) Alanine scanning of trans-membrane helix 11 of Cdr1p ABC antifungal efflux pump ofCandida albicans: identification of amino acid residuescritical for drug efflux. J Antimicrob Chemother 56: 77–86.

Sanglard, D., Kuchler, K., Ischer, F., Pagani, J.L., Monod, M.,and Bille, J. (1995) Mechanisms of resistance to azoleantifungal agents in Candida albicans isolates from AIDSpatients involve specific multidrug transporters. AntimicrobAgents Chemother 39: 2378–2386.

Sanglard, D., Ischer, F., Monod, M., and Bille, J. (1997)Cloning of Candida albicans genes conferring resistance toazole antifungal agents: characterization of CDR2, a newmultidrug ABC transporter gene. Microbiology 143: 405–416.

Santos, M.A., Keith, G., and Tuite, M.F. (1993) Non-standardtranslational events in Candida albicans mediated by anunusual seryl-tRNA with a 5′-CAG-3′ (leucine) anticodon.EMBO J 12: 607–616.

Schmid, J., Hunter, P.R., White, G.C., Nand, A.K., andCannon, R.D. (1995) Physiological traits associated withsuccess of Candida albicans strains as commensal colo-nizers and pathogens. J Clin Microbiol 33: 2920–2926.

Schmid, J., Herd, S., Hunter, P.R., Cannon, R.D., Yasin,M.S., Samad, S., et al. (1999) Evidence for a general-purpose genotype in Candida albicans, highly prevalent inmultiple geographical regions, patient types and types ofinfection. Microbiology 145: 2405–2413.

Schmitt, L., and Tampe, R. (2002) Structure and mechanismof ABC transporters. Curr Opin Struct Biol 12: 754–760.

Schuetzer-Muehlbauer, M., Willinger, B., Egner, R., Ecker,G., and Kuchler, K. (2003a) Reversal of antifungal resis-tance mediated by ABC efflux pumps from Candida albi-cans functionally expressed in yeast. Int J AntimicrobAgents 22: 291–300.

Schuetzer-Muehlbauer, M., Willinger, B., Krapf, G., Enzinger,S., Presterl, E., and Kuchler, K. (2003b) The Candida albi-cans Cdr2pATP-binding cassette (ABC) transporter confersresistance to caspofungin. Mol Microbiol 48: 225–235.

Shukla, S., Saini, P., Smriti, Jha, S., Ambudkar, S.V., andPrasad, R. (2003) Functional characterization of Candidaalbicans ABC transporter Cdr1p. Eukaryot Cell 2: 1361–1375.

Shukla, S., Ambudkar, S.V., and Prasad, R. (2004) Substitu-tion of threonine-1351 in the multidrug transporter Cdr1p ofCandida albicans results in hypersusceptibility to antifungalagents and threonine-1351 is essential for synergic effectsof calcineurin inhibitor FK520. J Antimicrob Chemother 54:38–45.

Smriti, Krishnamurthy, S., Dixit, B.L., Gupta, C.M., Milewski,S., and Prasad, R. (2002) ABC transporters Cdr1p, Cdr2pand Cdr3p of a human pathogen Candida albicans aregeneral phospholipid translocators. Yeast 19: 303–318.

Staib, P., Kretschmar, M., Nichterlein, T., Hof, H., and Mor-schhauser, J. (2002) Host versus in vitro signals andintrastrain allelic differences in the expression of aCandida albicans virulence gene. Mol Microbiol 44:1351–1366.

Tavanti, A., Gow, N.A., Maiden, M.C., Odds, F.C., and Shaw,D.J. (2004) Genetic evidence for recombination in Candidaalbicans based on haplotype analysis. Fungal Genet Biol41: 553–562.

Tibayrenc, M. (1997) Are Candida albicans natural popula-tions subdivided? Trends Microbiol 5: 253–254; discussion254–257.

White, T.C. (1997a) Increased mRNA levels of ERG16, CDR,and MDR1 correlate with increases in azole resistance inCandida albicans isolates from a patient infected withhuman immunodeficiency virus. Antimicrob AgentsChemother 41: 1482–1487.

White, T.C. (1997b) The presence of an R467K amino acidsubstitution and loss of allelic variation correlate with anazole-resistant lanosterol 14a demethylase in Candidaalbicans. Antimicrob Agents Chemother 41: 1488–1494.

Wolfger, H., Mamnun, Y.M., and Kuchler, K. (2004) The yeastPdr15p ATP-binding cassette (ABC) protein is a generalstress response factor implicated in cellular detoxification.J Biol Chem 279: 11593–11599.

Wu, W., Pujol, C., Lockhart, S.R., and Soll, D.R. (2005)Chromosome loss followed by duplication is the majormechanism of spontaneous mating-type locus homozygo-sis in Candida albicans. Genetics 169: 1311–1327.

Yang, Z. (1997) PAML: a program package for phylogeneticanalysis by maximum likelihood. Comput Appl Biosci 13:555–556.

Yang, Z., Nielsen, R., Goldman, N., and Pedersen, A.M.(2000) Codon-substitution models for heterogeneous selec-tion pressure at amino acid sites. Genetics 155: 431–449.

Yesland, K., and Fonzi, W.A. (2000) Allele-specific genetargeting in Candida albicans results from heterologybetween alleles. Microbiology 146: 2097–2104.

Zhang, N., Harrex, A.L., Holland, B.R., Fenton, L.E., Cannon,R.D., and Schmid, J. (2003) Sixty alleles of the ALS7 openreading frame in Candida albicans: ALS7 is a hypermut-able contingency locus. Genome Res 13: 2005–2017.

Zhao, X., Pujol, C., Soll, D.R., and Hoyer, L.L. (2003) Allelicvariation in the contiguous loci encoding Candida albicansALS5, ALS1, and ALS9. Microbiology 149: 2947–2960.

Supplementary material

The following supplementary material is available for thisarticle online:Fig. S1. Expression of CDR2A and CDR2B allele mRNA inC. albicans strains.Table S1. Candida albicans clinical isolates used in theSNP-specific PCR analysis.Table S2. Paml settings and log-likelihoods for each modeltested.

This material is available as part of the online article fromhttp://www.blackwell-synergy.com



http://www.blackwell-synergy.com

Heterozygosity and functional allelic variation in the Candida albicans efflux pump genes CDR1 and...

Documents

Transcript of Heterozygosity and functional allelic variation in the Candida albicans efflux pump genes CDR1 and...