REGULAR PAPER

Heme oxygenase 2 of the cyanobacterium Synechocystis sp. PCC6803 is induced under a microaerobic atmosphere and is requiredfor microaerobic growth at high light intensity

Mete Yilmaz • Ilgu Kang • Samuel I. Beale

Received: 21 August 2009 / Accepted: 4 November 2009 / Published online: 24 November 2009

� Springer Science+Business Media B.V. 2009

Abstract Cyanobacteria, red algae, and cryptomonad

algae utilize phycobilin chromophores that are attached to

phycobiliproteins to harvest solar energy. Heme oxygenase

(HO) in these organisms catalyzes the first step in phyco-

bilin formation through the conversion of heme to bili-

verdin IXa, CO, and iron. The Synechocystis sp. PCC 6803

genome contains two open reading frames, ho1 (sll1184)

and ho2 (sll1875), whose products have in vitro HO

activity. We report that HO2, the protein encoded by ho2,

was induced in the cells growing under a microaerobic

atmosphere [0.2% (v/v) O2], whereas HO1 was constitu-

tively expressed under both aerobic and microaerobic

atmospheres. Light intensity did not have an effect on the

expression of both the HOs. Cells, in which ho2 was dis-

rupted, were unable to grow microaerobically at a light

intensity of 40 lmol m-2 s-1, but did grow microaero-

bically at 10 lmol m-2 s-1 light intensity. These cells

grew normally aerobically at both light intensities. Com-

parative analysis of complete cyanobacterial genomes

revealed that possession of two HOs is common in

cyanobacteria. In phylogenetic analysis of their amino acid

sequences, cyanobacterial HO1 and HO2 homologs formed

distinct clades. HO sequences of cyanobacteria that have

only one isoform were most similar to HO1 sequences. We

propose that HO2 might be the more ancient HO homolog

that functioned under low O2 tension, whereas the derived

HO1 can better accommodate increased O2 tension in the

environment.

Keywords Heme oxygenase � Cyanobacteria �Synechocystis sp. PCC 6803 � Microaerobic � Phycobilin �Chlorophyll

Introduction

Cyanobacteria, red algae, and cryptomonad algae harvest

solar energy with phycobilins, in addition to chlorophylls

and other accessory pigments (Beale 1993). Phycobilins

are covalently linked to apoproteins (phycobiliproteins),

which are organized into phycobilisomes (MacColl 1998).

Similar bilin chromophores (phytochromobilins) are also

found in higher plant phytochromes, where they function in

light-regulated development (Montgomery and Lagarias

2002). Phytochromes have also been found in some cya-

nobacteria and other bacteria. Whereas cyanobacteria use

phycocyanobilin as the bacteriophytochrome chromophore,

other bacteria utilize biliverdin IXa (Wegele et al. 2004).

Phycobilins and phytochrome chromophores are linear

tetrapyrrole molecules whose synthesis begins with the

opening of the heme macrocycle by the enzyme heme

oxygenase (HO) (Beale 1993). The HO reaction requires

three molecules of O2 and several reducing equivalents to

convert protoheme to biliverdin IXa, free iron (Fe?2), and

carbon monoxide (CO). Most HO reactions specifically

Electronic supplementary material The online version of thisarticle (doi:10.1007/s11120-009-9506-3) contains supplementarymaterial, which is available to authorized users.

M. Yilmaz � I. Kang � S. I. Beale (&)

Division of Biology and Medicine, Brown University,

Providence, RI 02912, USA

e-mail: sib@brown.edu

Present Address:M. Yilmaz

School of Forest Resources and Conservation, Program in

Fisheries and Aquatic Sciences, University of Florida,

7922 N.W. 71st Street, Gainesville, FL 32653, USA

123

Photosynth Res (2010) 103:47–59

DOI 10.1007/s11120-009-9506-3

produce the a isomer of biliverdin IX, although one of the

HOs of Pseudomonas aeruginosa (PigA) has been reported

to produce a mixture of b and d isomers (Ratliff et al.

2001).

Some infectious bacteria use HOs to extract Fe?2 after

heme is transported into the cells from the infected host

(Schmitt 1997; Wilks and Schmitt 1998; Zhu et al. 2000).

HO in anaerobic bacteria has also been proposed to act as

an O2 scavenger (Bruggemann et al. 2004). Interestingly,

other heme degrading enzymes are present in some bacteria

that show no sequence and structural similarity to known

HOs (Skaar et al. 2004; Puri and O’Brian 2006). The

reaction requirements and products of both the types of

heme degrading enzymes are similar (Skaar et al. 2004).

Animals also contain HOs. Mammalian HOs function in

heme catabolism, and the bilin products appear to be

antioxidants (Dore et al. 1999) and, perhaps, neuronal

messengers (Verma et al. 1993). Whereas the bacterial and

plant HOs are soluble proteins, in mammalian systems they

are membrane-bound microsomal enzymes with a C-ter-

minal hydrophobic tail that anchors the protein to micro-

somal membranes. Reducing equivalents are supplied by

NADPH via another membrane-bound enzyme, NADPH-

cytochrome P450 reductase (cytochrome c reductase), in

mammalian HOs (Unno et al. 2007). In bacteria and plants,

ferredoxin is probably the physiological electron donor.

Plant HOs also contain an N-terminal plastid transit peptide

(Terry et al. 2002).

The role of HOs in the formation of phycobilins in

cyanobacteria was first shown in the extracts of Synecho-

cystis sp. PCC 6701 and PCC 6803 (Cornejo and Beale

1997). Later, the genome sequence of Synechocystis sp.

PCC 6803 revealed two putative HOs, and both the prod-

ucts, named HO1 and HO2, have been shown to be true

HOs (Cornejo et al. 1998; Migita et al. 2003; Zhang et al.

2005). Crystal structures of both HOs showed similar

folding patterns as mammalian and bacterial counterparts

(Sugishima et al. 2004; Sugishima et al. 2005). HO1

mRNA was constitutively expressed in cells growing under

normal growth conditions, but expression of HO2 mRNA

was not detected (Cornejo et al. 1998). Furthermore, HO1

mRNA was induced by iron limitation, possibly in

response to an insufficiency of phycocyanobilin to meet the

requirements of the cell, due to iron-limited synthesis of

the heme precursor (Cornejo et al. 1998). Among the

currently sequenced cyanobacterial genomes, 11 species

have two HOs, and 24 have only one isoform. The presence

of two isoforms of an enzyme suggests either two different

functions or regulation under different environmental

parameters. Here, we report that the HO2 enzyme in Syn-

echocystis sp. PCC 6803 is induced under low O2 tension

and is required for microaerobic growth at high light

intensity.

Materials and methods

Strains and growth conditions

Wild-type Synechocystis sp. PCC 6803, a photosystem-II

deletion strain (DPSII), and a ho2 deletion strain (Dho2)

were grown in BG-11 medium (Stanier et al. 1971) sup-

plemented with 30 mM D-glucose. Twenty-five micro-

grams per milliliter chloramphenicol and 25 lg ml-1

kanamycin were added to the medium for the DPSII and

Dho2 strains, respectively. Cultures were grown at 25�C in

flasks on an orbital shaker at 175 rpm, in continuous light

provided by cool white fluorescent tubes at high intensity

(40 lmol m-2 s-1) or low intensity (10 lmol m-2 s-1,

produced by shrouding the flasks with white filter paper).

The culture atmosphere was either aerobic or microaerobic

[provided by sparging the flasks with N2 containing 1%

(v/v) air, equivalent to 0.21% (v/v) O2]. Growth was

monitored by absorbance at 750 nm.

Culture samples for C-phycocyanin measurement and

protein extraction were immediately put on ice and then

centrifuged at 10,0009g for 10 min at 4�C. For C-phyco-

cyanin extraction, after centrifugation, cells were washed

once with distilled water and then centrifuged again. These

cells were broken by a combination of acid-washed glass

beads and sonication in 50 mM Na-PO4 buffer, pH 7, and

C-phycocyanin content was determined according to Gla-

zer (1988).

Construction of HO1 and HO2 expression plasmids

Full-length ho1 and ho2 were amplified by the polymerase

chain reaction (PCR) using Synechocystis sp. PCC 6803

genomic DNA as the template. DNA was isolated according

to standard protocols (Sambrook and Russell 2001). PCR

was performed with Pfu DNA polymerase (Stratagene, La

Jolla, CA, USA) in accordance with the manufacturer’s

instructions. Oligonucleotides HO1F1 (50-ATATACATAT

GAGTGTCAACTTAGCTTCCCAGTTGCGGGAA, NdeI

restriction site underlined) and HO1R1 (50-TATATCTC

GAGTCACTAGCCTTCGGAGGTGGCGA, XhoI restric-

tion site underlined) were used to amplify a 745-bp region

containing the full-length ho1 gene. Similarly, oligonucle-

otides HO2F1 (50-ATATACATATGACTAACCTTGCAC

AAAAACTCCGCTACGGTA, NdeI restriction site under-

lined) and HO2R1 (50-TATATCTCGAGTCACTATTCAC

CTACCATTAGGGTGATGGGA, XhoI restriction site

underlined) were used to amplify a 775-bp region contain-

ing the full-length ho2 gene. Extra bases ATATA and

TATAT were used at 50 ends to provide foot holding for

restriction enzymes. In order to ensure translation termi-

nation, reverse primers also had an extra TCA after the XhoI

site to provide a stop codon in addition to the native stop

48 Photosynth Res (2010) 103:47–59

123

codon. The PCR products were cloned into pET24a

expression vector (Novagen, Gibbstown, NJ, USA) utilizing

NdeI and XhoI restriction sites to create the expression

vectors pET24aho1 and pET24aho2.

Expression of HO1 and HO2

Plasmids pET24aho1 and pET24aho2 were transformed

into Escherichia coli BL21 (DE3) (Novagen). Single col-

onies of transformed bacteria were inoculated in liquid LB-

kanamycin (100 lg ml-1) media to prepare seed stocks

overnight at 37�C. Large-scale cultures were inoculated

with 10% (v/v) seed culture, and further incubated for 4 h

at 37�C. Expression of HO1 and HO2 was induced by

adding 0.5 to 1 mM IPTG followed by 4 h of incubation at

the same temperature. After induction, cells were harvested

by centrifugation and broken by sonication. Soluble

supernatants were obtained by centrifugation. Expression

of the proteins was confirmed by SDS-PAGE and Coo-

massie Blue Staining (Sambrook and Russell 2001).

Purification of HO1 and HO2 for antibody production

Expressed HO1 was purified by serial chromatography

through columns of DE52 anion exchange resin (Whatman,

Piscataway, NJ, USA), methyl HIC resin (Biorad, Hercu-

les, CA, USA), and hydroxyapatite resin (Biorad) as fol-

lows: HO1-expressing BL21(DE3)/pET24aho1 cells were

pelleted by centrifugation. Pellets were resuspended in

50 ml of lysis buffer (10 mM Tris, 1 mM EDTA, 5 mM

2-mercaptoethanol, pH 8), and the cells were disrupted by

sonication. Soluble supernatants were obtained by centri-

fugation. A 5-ml column of DE52 was equilibrated with

lysis buffer. Supernatant containing HO1 was loaded onto

the column, and the column was washed with 50 ml of

lysis buffer. HO1 was eluted with a 0 mM to 500 mM

NaCl linear gradient in lysis buffer. HO1-containing frac-

tions were identified by SDS-PAGE and pooled. A 5-ml

column of methyl HIC was equilibrated with 1.5 M

(NH4)2SO4 in the lysis buffer. An equal volume of 3 M

(NH4)2SO4 in lysis buffer was mixed with the DE52-eluted

pool of HO1; the mixture was centrifuged at 12,0009g for

30 min at 4�C to remove precipitate, and then it was loaded

onto the HIC column. After washing the column with

20 ml of 1.5 M (NH4)2SO4-containing buffer, HO1 was

eluted with a 1.5 to 0 M linear reverse gradient of

(NH4)2SO4 in buffer. HO1-containing fractions were col-

lected, and (NH4)2SO4 was removed by dialysis against

HAT buffer (10 mM K-PO4, 1 mM 2-mercaptoethanol,

pH 7). A 2-ml hydroxyapatite column was equilibrated

with HAT buffer. The dialyzed HO1 fraction was loaded,

and the column was washed with 20 ml of HAT buffer.

HO1 was eluted with a linear gradient of 10–300 mM

K-PO4, pH 7 containing 1 mM 2-mercaptoethanol in total

volume of 30 ml. HO1-containing fractions were pooled

and concentrated by centrifugation in Centricon columns

(Millipore, Billerica, MA, USA).

Expressed HO2 was purified on a blue-dye affinity

column as follows: HO2-expressing BL21(DE3)/

pET24aho2 cells were pelleted by centrifugation. Cell

pellets were resuspended in 15 ml of assay buffer [50 mM

Tris, 10% (v/v) glycerol, pH 8], and cells were disrupted

by sonication. The cell suspension was centrifuged at

12,0009g for 30 min at 4�C. A column packed with 7 ml

of Cibacron Blue 3GA agarose (Sigma Aldrich, St. Louis,

MO, USA) was equilibrated with the assay buffer, and 5 ml

of the clarified cell extract was loaded. The column was

washed with 30 ml of assay buffer, and the bound HO2

was eluted with 0.5 M NaCl in assay buffer.

Samples of purified HO1 and HO2 were used to obtain

specific polyclonal antibodies generated in rabbits (Animal

Pharm Services, Healdsburg, CA, USA).

Gel electrophoresis and immunoblotting

For protein extraction, equal amounts of cells were used

within individual experiments. Synechocystis sp. PCC 6803

cells were broken by sonication in the presence of acid-

washed glass beads in TE buffer, pH 8. Proteins were

resolved on a 12% (w/v) SDS-PAGE gel and transferred

onto a PVDF membrane by the semi-dry method. After

blocking with 3% (w/v) dry nonfat milk in TBS buffer

[10 mM Tris–Cl, 150 mM NaCl, 0.1% (w/v) Tween 20,

pH 8], the membranes were incubated with primary and

secondary antibodies. Secondary antibodies were alkaline

phosphatase-conjugated antibodies (Sigma Aldrich). Col-

orimetric detection was done with the BCIP/NBT Liquid

Substrate System (Sigma Aldrich).

Inactivation of ho2

Genomic DNA was prepared from Synechocystis sp. PCC

6803, and a region corresponding to full-length ho2 was

amplified by PCR using HO2F2 (50-CCATATGACTA

ACCTTGCACAAAAAC, NdeI restriction site underlined)

and HO2R2 (50-TTGGATCCCTATTCACCTACC, BamHI

restriction site underlined) primers. The PCR reaction

contained 1 ll of genomic DNA, 5 ll of 109 Pfu buffer,

2.5 U of Pfu DNA polymerase (Stratagene), 100 lm of

each deoxynucleoside triphosphate, 1.5 mM MgCl2, and

20 pmol of each primer in a total volume of 50 ll.

Amplification for HO2 started with an initial denaturation

step at 95�C for 5 min, followed by 30 cycles of 95�C for

30 s, 60�C for 30 s, and 72�C for 2 min. Final exten-

sion was at 72�C for 10 min. The amplified DNA

was purified and cloned into pET3a (Novagen) to create

Photosynth Res (2010) 103:47–59 49

123

pET3aho2. This plasmid was used as the template for

partial ho2 amplification. Primers HO2ER (50-AGCTCTC

GAGCGTAAAGCTGCTTCTAGGGCAC, XhoI restric-

tion site underlined) and HO2LF (50-GATCGAGCTCGCT

TGCCCTTAGATGAAGCCAC, SacI restriction site

underlined) were used to amplify pET3aho2 with a large

deletion in the middle of ho2 (Fig. 1a). The kanamycin-

resistance (kanR) gene, along with its own promoter, was

amplified from pET24a using primers KanF (50-GATCGA

GCTCTCATGAACAATAAAACTGTCTGC, SacI restric-

tion site underlined) and KanR (50-AGCTCTCGAGTTTT

CGGGGAAATGTGCGCGGA, XhoI restriction site

underlined). Each PCR reaction contained 5 ll of template,

5 ll of 109 buffer, 2.5 U of Taq Polymerase (Promega,

Madison, WI), 100 lM of each deoxynucleoside triphos-

phate, 1.5 mM MgCl2, and 20 pmol of each primer in a

total volume of 50 ll. Conditions for all amplifications

were 95�C for 5 min, 25 cycles of 95�C for 1 min, 67�C for

1 min, 72�C for 6 min, and a final extension step at 72�C

for 10 min. The amplified kanR gene was ligated in reverse

orientation into the amplified vector containing the ho2

deletion between the XhoI and SacI restriction sites, and

the resulting plasmid was amplified in E. coli cells, iso-

lated, linearized, and used to transform wild-type Syn-

echocystis sp. PCC 6803 cells (Williams 1988).

Transformed cells were plated on kanamycin-containing

BG-11 plates and grown for several segregation rounds.

Completeness of segregation was verified by PCR. The

predicted sizes of the PCR products obtained from the

intact ho2 gene and the partially-deleted, kanR-interrupted

ho2 gene, using HO2F2 and HO2R2 primers, are 765 and

1,358 bp, respectively (Fig. 1b).

Phylogenetic analysis

Sequences used in alignments and phylogenetic tree con-

structions were obtained using BLAST-P (http://blast.ncbi.

nlm.nih.gov/Blast.cgi) with the Synechocystis sp. PCC

6803 HO1 amino acid sequence as a query and a cutoff E

value of 10-5. All the cyanobacterial sequences found in

the BLAST-P search were included in the alignment.

Alignment was performed by Clustal W as implemented in

Mega Version 4 (Tamura et al. 2007). The resulting

alignments were then manually edited, removing the ends

of the sequences that appeared to be ambiguously aligned.

The edited alignment was 213 amino acid positions in

length. Phylogenetic trees were constructed using Maxi-

mum-Likelihood (ML), implemented in PhyML 3.0.1

(Guindon and Gascuel 2003). The ML analysis used the Le

and Gascuel (LG) substitution matrix (Le and Gascuel

2008), with rate variation among sites modeled by esti-

mating the invariable sites and a discrete gamma distri-

bution with four rate classes. A neighbor-joining tree was

used as the starting tree for the tree search, and the

approximate likelihood ratio test (aLRT) (Anisimova and

Gascuel 2006) was used to estimate the branch support.

This test of branch support estimation is based on the

classical likelihood ratio test. It has been shown to be

accurate and computationally much faster than the ML

bootstrap or Bayesian inference (Anisimova and Gascuel

2006). Trees were visualized and edited in Mega 4.

Accession numbers, lengths of sequences (Table S1), and

the alignment (Fig. S1) used in the analysis are presented

in the Supplemental Material.

Results

Cloning, expression, and purification of recombinant

HO1 and HO2

In an earlier study, Cornejo et al. (1998) reported the

cloning and expression of HO1 from Synechocystis sp.

PCC 6803 in soluble form. The expressed protein had

ferredoxin-dependent HO activity. The second recombi-

nant expression product, HO2, was obtained as an insoluble

and inactive protein. Furthermore, the expression of the

latter enzyme was not detected in Synechocystis sp. PCC

6803 cells under normal growth conditions or under iron

limitation. In this study, by using a different expression

system, high expression of both proteins in E. coli was

Fig. 1 Schematic illustration of the construction of the Dho2

mutation (a) by replacing a 367-bp central portion of ho2 (whitearrow) with a 960-bp kanamycin-resistance gene (black arrow).

Primers used to construct the deletion are identified (horizontalarrows) along with restriction enzyme sites (vertical arrows).

Complete segregation of the mutant sequence in Synechocystis sp.

PCC 6803 was confirmed by PCR with genomic DNA from Dho2 and

wild-type (WT) cells (b). PCR products were electrophoresed through

a 1.5% (w/v) agarose gel, stained with ethidium bromide and

visualized under UV transillumination

50 Photosynth Res (2010) 103:47–59

123

obtained (Fig. 2). Both proteins were in the soluble fraction

as expected for native cyanobacterial HOs. The color of the

induced cells expressing HO1 was green due to the accu-

mulation of biliverdin IXa, as reported earlier (Cornejo

et al. 1998). However, there was no change in color in the

cells expressing HO2. This suggests the existence of a

required component that is missing in the induced E. coli

cells or an adverse environment for the proper functioning

of HO2. The ho1 and ho2 genes were cloned without

affinity tags or other extra sequences to yield unmodified

native proteins. The expressed HO1 and HO2 had the

predicted sizes of 27,050 and 28,540 Da, respectively.

Expressed HO1 and HO2 were purified to near homo-

geneity by serial chromatography on anion exchange,

hydrophobic interaction, hydroxyapatite columns for HO1

and a blue-dye affinity column for HO2 (Fig. 3). Purified

HO2 had HO activity as reported previously (Zhang et al.

2005) (data not shown). The purified proteins were used to

develop specific polyclonal antibodies against HO1 and

HO2. The specificity was high for each antibody when

incubated with recombinant E. coli cell extracts (Fig. 4).

Growth and C-phycocyanin production at low O2

tension

The Synechocystis sp. PCC 6803 ho1 gene (sll1184) is

located approximately 220 bp upstream of an O2-depen-

dent coproporphyrinogen III oxidase gene (hemF-sll1185),

whereas ho2 (sll1875) is located approximately 260 bp

upstream of an O2-independent coproporphyrinogen III

oxidase gene (hemN1-sll1876). Recently, microaerobic

induction of several transcripts in Synechocystis sp. PCC

6803, including chlAII (sll1874), ho2 (sll1875), and hemN1

(sll1876), have been reported (Minamizaki et al. 2008).

Synechocystis sp. PCC 6803 can grow under a microaero-

bic atmosphere, but not under an unsupplemented com-

pletely anaerobic atmosphere (Howitt et al. 2001).

However, anaerobic growth in the presence of H2 has been

reported (Serebryakova et al. 2002). The cells grew equally

under aerobic and microaerobic atmospheres (Fig. 5a). The

concentrations of phycocyanin in the cells, during the

growth trials, were determined. Phycocyanin is a phyco-

cyanobilin-bearing biliprotein, and synthesis of the phyc-

ocyanobilin chromophore starts with HO-catalyzed

opening of the heme macrocycle, which is an O2-dependent

reaction. The cells cultured under a microaerobic atmo-

sphere were able to synthesize phycocyanins. However, the

amount accumulated was slightly lower than in cells grown

under an aerobic atmosphere (Fig. 5b). Inactivation of HO2

in Synechocystis sp. PCC 6803 resulted in light sensitivity

during growth trials of this mutant strain, but only when

growing under a microaerobic atmosphere. There was no

difference in the growth of mutant cells cultured under an

aerobic atmosphere at either high or low light intensity.

Fig. 2 SDS-PAGE showing the expression of recombinant Synecho-cystis sp. PCC 6803 HO1 (a) and HO2 (b) in induced E. coli cells.

Control was the total extract of uninduced E. coli

Fig. 3 SDS-PAGE showing the purification of recombinant Syn-echocystis sp. PCC 6803 HO1 (a) in serial steps using anion exchange

(Purification 1), methyl HIC (purification 2), hydroxyapatite (Purifi-

cation 3) resins; and purification of recombinant Synechocystis sp.

PCC 6803 HO2 (b) on a blue-dye affinity column for different elution

fractions. Controls are the total extracts of either induced or

uninduced untransformed E. coli cells

Fig. 4 Immunoblots demonstrating the specificity of Synechocystissp. PCC 6803 HO1 (a) and HO2 (b) antibodies against recombinant

HO1 (rHO1) and HO2 (rHO2). Untransformed E. coli was used a

negative control. The relative amounts of proteins loaded on the gels

were approximately as shown in Fig. 2

Photosynth Res (2010) 103:47–59 51

123

Under a microaerobic atmosphere, mutant cells initially

grew about equally well at high and low light intensities.

However, there was eventual growth cessation in the

microaerobic atmosphere at high light intensity, in contrast

to continued growth of cells at low light intensity or at

either light intensity under an aerobic atmosphere (Fig. 6a).

For this reason, further experiments with this mutant strain

were performed at low light intensity. At low light inten-

sity, Dho2 cells grew similarly or better microaerobically

than aerobically (Fig. 6b). C-phycocyanin concentrations

were also similar in the cells cultured under both the

atmospheres at low light intensity (Fig. 6c).

In vivo expression of HO1 and HO2 in the cells

cultured under aerobic and microaerobic atmospheres

The ability of Synechocystis sp. PCC 6803 cells to grow

and produce phycocyanin under a microaerobic atmo-

sphere, and the genomic location of ho1 and ho2 relative to

O2-dependent and -independent coproporphyrinogen III

oxidases, respectively, prompted us to investigate the

in vivo production of HOs in the cells cultured under

aerobic versus microaerobic atmospheres. After several

days of growth in the respective atmospheres, expression of

each HO was determined by specific antibodies to each

protein. HO1 was expressed constitutively in the cells

cultured under either aerobic or microaerobic atmospheres.

In contrast, HO2 was induced in the cells cultured under a

microaerobic atmosphere in accordance with increased ho2

transcript levels as reported earlier (Minamizaki et al.

2008) (Fig. 7). Both HO1 and HO2 appeared in the soluble

fraction of the extracts. In order to understand the time

course of HO2 expression, aerobically grown exponential-

phase Synechocystis sp. PCC 6803 cells were transferred to

either aerobic or microaerobic atmospheres and grown for

8 h, after which they were switched to the other atmo-

sphere. Each culture was sampled every 2 h. The HO1

expression was relatively similar under both aerobic and

microaerobic atmospheres during a 10-h culture (Fig. 8a),

suggesting that this enzyme is active in Synechocystis sp.

PCC 6803 in both atmospheres. The HO2 expression

Fig. 5 Growth (a) and C-phycocyanin content (b) of wild-type

Synechocystis sp. PCC 6803 cells cultured for 72 h under either

aerobic (filled square) or microaerobic (open square) atmospheres

Fig. 6 a Growth of Dho2 Synechocystis sp. PCC 6803 cultured for

6 days microaerobically at low (filled square) and high (filled circle)

light intensity, or aerobically at low (filled triangle) and high (opensquare) light intensity. Also shown are growth (b) and C-phycocyanin

content (c) of Dho2 cells cultured for 72 h at low light intensity either

aerobically (filled square) or microaerobically (open square)

52 Photosynth Res (2010) 103:47–59

123

started to increase 2 h after the aerobic cells were switched

to a microaerobic atmosphere and continued to increase

until the last sample was collected at 8 h. HO2 was still

present for 2 h after microaerobically cultured cells were

switched to the aerobic atmosphere (Fig. 8b). Inactivation

of ho2 did not cause a difference in HO1 expression: Dho2

cells that were grown at low light intensity either micro-

aerobically or aerobically contained approximately equal

amounts of HO1 (Fig. S2).

Effects of light intensity on in vivo expression of HO2

The effect of light intensity on the in vivo expression of

both HOs was examined. Although all experimental cul-

tures were normally grown in continuous light, prolonged

exposure of cells to darkness induced HO2 expression

similar to cells cultured under low O2 tension. This induced

expression could be due to a direct effect of light or to

decreased O2 tension caused by respiration of cells in the

dark. In order to test for a direct effect of light on the

expression of HOs, cells were grown under aerobic or

microaerobic atmospheres in the dark and at low and high

light intensities. The light intensity did not have an effect

on HO1 expression after 6 h of growth under a microaer-

obic atmosphere (Fig. 9a). HO2 was not expressed at both

light intensities under an aerobic atmosphere. However,

HO2 was expressed in the cells that were grown micro-

aerobically at both light intensities, although there was

slightly less expression at the higher light intensity

(Fig. 9b). In order to test for the possibility that photo-

synthetically produced O2 is the cause of the lower

expression at the higher light intensity, the DPSII mutant,

which is defective in photosynthetic O2 evolution, was also

utilized with the same experimental protocol. Similar to the

wild-type cells, DPSII cells expressed HO2 only under a

microaerobic atmosphere, and in these cells, its expression

was equal at the two light intensities (Fig. 9c). These

results indicate that there is no direct effect of light on HO2

expression and that, in photosynthetically competent cells,

the differences in HO2 expression at the different light

Fig. 7 Immunoblots showing the expression of HO1 (a) and HO2 (b)

in wild-type Synechocystis sp. PCC 6803 cells cultured under aerobic

or microaerobic atmospheres. The negative control is E. coli extract

and the positive controls are recombinant HO1 (rHO1) and HO2

(rHO2). The relative amounts of proteins loaded on the gels were

approximately as shown in Fig. 2

Fig. 8 Immunoblots demonstrating the time course of HO1 (a) and

HO2 (b) expression in wild-type Synechocystis sp. PCC 6803 cultured

for 10 h under either aerobic or microaerobic atmospheres. Sampling

was done every 2 h. rHO1 and rHO2 are recombinant HO1 and HO2,

respectively, used as positive controls. The relative amounts of

proteins loaded on the gels were approximately as shown in Fig. 2

Fig. 9 Immunoblots showing the effects of light intensity on the

in vivo expression of HO1 (a) and HO2 (b) in wild-type Synecho-cystis sp. PCC 6803 and (c) expression of HO2 in Synechocystis sp.

PCC 6803 DPSII, either under aerobic or microaerobic (1% air)

atmospheres. High and low light intensities are indicated by ‘‘light’’and ‘‘shaded,’’ respectively. The relative amounts of proteins loaded

on the gels were approximately as shown in Fig. 2

Photosynth Res (2010) 103:47–59 53

123

intensities are the indirect effects caused by photosynthetic

O2 production.

Phylogenetic analysis and genomic arrangement

of HOs in cyanobacteria

Five highly supported major HO clades were apparent in

the phylogenetic tree (Fig. 10). The tree was rooted with

the clade that contained the proteobacteria. The firmicutes

and actinobacteria also formed well-supported clades, as do

the mammalian and fish sequences. Mammalian HO1 and

HO2 sequences formed distinct clades, and fish sequences

were sister to the mammalian HO1 sequences. All the

cyanobacterial sequences formed a highly supported fifth

clade. Five subgroups were also apparent in the cyano-

bacterial lineage. The first one was the Gloeobacter/

Acaryochloris/thermophilic Synechococcus group. Plastid

HO sequences formed another subgroup within cyanobac-

terial HO sequences, in accord with the cyanobacterial

origin of chloroplasts (Gray 1989). HO1 and HO1-like

sequences formed the third subgroup. The fourth subgroup

included the Prochlorococcus/Synechococcus sequences.

The fifth subgroup included the cyanobacterial HO2

sequences. Phage PSSM2 also grouped with cyanobacterial

sequences, sister to the subgroups.

Several interesting results emerge from the phylogenetic

analysis. Although we did not include an extensive list of

bacterial sequences in our dataset, the bacterial and

cyanobacterial sequences formed distinct clades. All the

cyanobacterial HO2 sequences grouped together with high

support. Synechocystis sp. PCC 6803 HO1 and HO2

sequences only share 48% identity, whereas HO2 of this

organism is more similar to HO2 of Synechococcus sp.

PCC 7002, with 63% identity. Similarly, HO1 of Syn-

echocystis sp. PCC 6803 shares 73% identity with HO1 of

Synechococcus sp. PCC 7002. Acaryochloris was repre-

sented by three HO sequences, the third one being a plas-

mid sequence, which was sister to the HO1 subgroup. The

HO1 sequence of this strain was grouped with the first

subgroup. HO1 or HO2 sequences of Cyanothece strains

grouped together, except for the strain PCC 7425, sug-

gesting that this strain might have acquired its HO

sequences via horizontal transfers. Crocosphaera watsonii

HO1 and HO2 sequences always grouped with Cyanothece

sequences, suggesting they share a common evolutionary

origin. Whereas the Cyanobium HO sequence was placed

within the Prochlorococcus/Synechococcus subgroup,

Paulinella chromatophora chromatophore HO sequence

was sister to this subgroup. This suggests that the endo-

symbiont of Paulinella is evolutionarily derived from

Synechococcus or Prochlorococcus in accordance with the

published genome of the chromatophore (Nowack et al.

2008). In general, sequences of HOs represented as a single

isoform in a cyanobacterium were most similar to HO1-

like sequences, and pairwise sequence identities within

HO1-like sequences were higher than those of HO2

sequences (data not shown).

The genomic arrangement of HO-encoding genes in

cyanobacteria from Cyanobase (http://genome.kazusa.or.jp/

cyanobase/) and from the databases of the National Center

for Biotechnology Information (http://www.ncbi.nlm.nih.

gov/genomes/lproks.cgi) was searched only for the strains

for which the whole genomes have been sequenced. Of the 16

freshwater cyanobacteria, 10 have two HO genes in their

genomes. Three of these species represent thermophilic

cyanobacteria, one of which has both HO1 and HO2 genes

(Thermosynechococcus elongatus BP-1). All the HO1 or

HO1-like sequences seem to be placed randomly in the

genomes of these organisms except for Synechocystis sp.

PCC 6803, whose HO1 gene is 223 bp upstream of an O2-

dependent coproporphyrinogen III oxidase gene. All the

cyanobacterial HO2 genes are adjacent to O2-independent

coproporphyrinogen III oxidase genes (Fig. 11). The only

marine cyanobacterium that has both HO1 and HO2 genes is

Acaryochloris marina MBIC 11017, whose HO2 gene

(AM1_0466) is also located approximately 100 bp upstream

of an O2-independent coproporphyrinogen III oxidase gene

(AM1_0467). The rest of the marine cyanobacteria are rep-

resented by Prochlorococcus and Synechococcus strains, all

of which have a single HO gene. Interestingly, all Prochlo-

rococcus HO genes are adjacent to genes involved in phy-

coerythrobilin biosynthesis. Prochlorococcus cells are

characterized by lack of phycobilisomes, and they use divi-

nyl chlorophylls a and b, but not phycobilins, as their light-

harvesting pigments. Although Prochlorococcus has

retained the ability to synthesize phycoerythrin and phyco-

bilins, the absence of phycocyanin further indicates that

phycobilin pigments are not used in light harvesting because

phycocyanin is necessary for transfer of phycoerythrin-

trapped light energy to the photosynthetic reaction centers.

However, the function of phycoerythrins is not known in

these organisms (Beale 2008b).

Discussion

In this study, we show that the protein encoded by the ho2

gene of Synechocystis sp. PCC 6803 can be transcribed and

its product is present in the cells growing under low O2

Fig. 10 Maximum-Likelihood tree of HO sequences from cyanobac-

teria and selected sequences from bacteria, mammals, and fish.

Approximate likelihood ratio test (aLRT) values are given next to the

nodes. Values below 50 are omitted for clarity. Branch lengths are

proportional to number of substitutions per site (see scale bar). Log-

likelihood of the tree was -19934.4

c

54 Photosynth Res (2010) 103:47–59

123

Photosynth Res (2010) 103:47–59 55

123

tension, irrespective of the light intensity at which the cells

are grown. Laboratory cultures of cyanobacteria have been

reported to grow under a microaerobic atmosphere (Sch-

rautemeier et al. 1995; Thiel et al. 1995; Stal and

Moezelaar 1997). Natural cyanobacterial communities face

low O2 tension environments at night, and even during

cloudy days, in dense, algal blooms. Cyanobacteria in

sediments or in dense surface scums have also been

reported to be exposed to anoxia because of light limitation

and high bacterial respiration (Stal and Moezelaar 1997).

All of the above indicate the metabolic capacity of these

organisms in low O2 tension environments.

Oxygen-regulated expression of enzymes or differential

tolerance of enzymes to O2 has been reported in cyano-

bacteria. A comparable situation occurs in Anabaena

variabilis strain ATCC 29413, which has two different

nitrogenase clusters, namely nif1 and nif2, that utilize two

different ferredoxins, fdxH1 and fdxH2, respectively. nif1

and fdxH1 are expressed under both aerobic and anaerobic

atmospheres only in heterocysts, whereas nif2 and fdxH2

are expressed solely under an anaerobic atmosphere in both

vegetative cells and heterocysts (Schrautemeier et al. 1995;

Thiel et al. 1995; Thiel et al. 1997). Furthermore, purified

fdxH2 is more sensitive to O2 than fdxH1. It was suggested

that Nif2 provides the organism an increased ability for

rapid induction of N2 fixation under anaerobic or micro-

aerobic environments (e.g., at night), to provide a com-

petitive advantage by not having to wait for the heterocysts

to develop.

Synechocystis sp. PCC 6803 has been reported to contain

several genes that are induced under microaerobic atmo-

spheres. Minamizaki et al. (2008) reported two structurally

different Mg-protoporphyrin IX monomethylester cyclase

systems, encoded by chlA genes, in Synechocystis sp. PCC

6803, one of which was induced under a microaerobic

atmosphere. These enzymes are involved in the E-ring

formation step of chlorophyll biosynthesis. Whereas chlAI

(sll1214) was expressed in both aerobic and microaerobic

atmospheres, chlAII (sll1874) was expressed only under low

O2 tension. This study and another by Summerfield et al.

(2008) also reported increased transcript levels for the ho2

gene of Synechocystis sp. PCC 6803 under low O2 tension,

Fig. 11 Genomic arrangement of HOs in selected cyanobacteria. Proteins with known or estimated functions are mentioned. Similar

arrangements of HOs are found in other cyanobacteria for which whole genomes are sequenced (not shown)

56 Photosynth Res (2010) 103:47–59

123

where it is probably co-transcribed with chlAII. A third

reported low-O2 tension-induced gene in Synechocystis sp.

PCC 6803 is an isoform of psbA1 (slr1181), which encodes

the D1 subunit of PSII, and this gene was shown to be

induced approximately 170-fold when the cells were

exposed to a microaerobic environment. Homologous genes

in three other cyanobacteria, namely psbA0 (alr3742) of

Anabaena sp. PCC 7120, psbA2 (tlr1844) of Thermosyn-

echococcus elongatus BP-1, and psbA-2 (cce_3411) of

Cyanothece sp. ATCC 51142 behaved similarly under the

same conditions (Summerfield et al. 2008; Sicora et al.

2009).

Our results indicate that HO1 is active and functional

under both aerobic and microaerobic atmospheres in

Synechocystis sp. PCC 6803. However, it does not func-

tion efficiently under low O2 tension as evidenced by the

inability of microaerobic Dho2 cells to grow at high light

intensity. This inability can be understood as a conse-

quence of a misregulated tetrapyrrole biosynthetic path-

way. It is known that the early, common portion of the

branched heme and chlorophyll pathway is regulated at

the step of 5-aminolevulinic acid formation, specifically

via feedback inhibition by heme of the rate-limiting

enzyme, which in plants and cyanobacteria is glutamyl-

tRNA reductase. According to a model originally pro-

posed for regulation of heme and bacteriochlorophyll

biosynthesis in Rhodobacter spheroides (although this

organism forms 5-aminolevulinic acid by a different

process), feedback inhibition of the common, prebranch

portion of the pathway is provided by heme, the end

product of one branch, rather than by protoporphyrin IX,

the actual branch-point intermediate (Lascelles and Hatch

1969). The atypical use of one end product for regulation

of the pre-branch portion of this pathway eliminates the

need for significant accumulation of the potentially toxic,

photodynamically active protoporphyrin IX. Under this

model, the steady-state level of heme is a proxy for the

relative rates of protoporphyrin IX synthesis and its

conversion into both heme and chlorophyll. In support of

this model, glutamyl-tRNA reductase from many organ-

isms, including Synechocystis sp. PCC 6803, is inhibited

by heme, and not by protoporphyrin IX in vitro (Rieble

and Beale 1988, 1991; Beale 2008a). Importantly, for this

mechanism to effectively regulate the synthesis of an

amount of protoporphyrin IX just sufficient for heme and

chlorophyll synthesis but not an excess amount, heme

must be constantly turned over, otherwise it could accu-

mulate and inhibit the synthesis of protoporphyrin IX

destined for chlorophyll.

We propose that in an aerobic atmosphere, HO1 alone in

Dho2 cells can fulfill the need for heme turnover, so that

glutamyl-tRNA reductase activity is regulated correctly for

optimal protoporphyrin IX synthesis at both low and high

light intensities. However, in a microaerobic atmosphere,

heme turnover in the Dho2 cells is compromised, and the

unmetabolized heme prevents the activity of glutamyl-

tRNA reductase from increasing sufficiently to supply extra

protoporphyrin IX when there is an increase in the need for

it for more chlorophyll formation. At low light intensity,

where the rate of chlorophyll turnover is low, this defect is

not manifested. However, at high light intensity, where the

rate of chlorophyll turnover is higher due to faster light-

induced degradation of the PSII reaction center core

components (Yamamoto et al. 2008), insufficient chloro-

phyll is synthesized for incorporation into newly synthe-

sized replacement reaction centers. Thus, the Dho2 cells

ultimately lose photosynthetic capacity due to their

inability to replace degraded PSII reaction centers during

continued microaerobic exposure to high light intensity.

Despite the loss of the PSII reaction center core chloro-

phyll, the total amount of chlorophyll per cell would not

change much, because the light-harvesting chlorophyll,

which comprises the major portion of the total chlorophyll,

is not turned over.

A possible alternative explanation of the inability of

Dho2 cells to grow microaerobically at high light intensity

is that disruption of the ho2 gene has a polar silencing

effect on the hemN gene that encodes O2-independent

coproporphyrinogen III oxidase, the coding sequence of

which begins 260 bp downstream from the ho2 stop codon.

We consider this possibility to be unlikely for two reasons.

First, no transcription terminators were detected within the

construct sequence in either direction as analyzed by the

SoftBerry FindTerm software (http://www.softberry.ru).

Second, hemN has its own promoter as detected by Soft-

Berry BPROM and the BDGP Neural Network Promoter

Prediction software (http://www.fruitfly.org/seq_tools/

promoter.html).

It would be informative to examine the phenotype of

cells deficient in HO1. However, we were unable to obtain

homozygous HO1-deficient cells by insertional mutagene-

sis (not shown). Our inactivation attempts were performed

under an aerobic atmosphere and it may be possible to

obtain HO1-deficient cells when selected under a micro-

aerobic atmosphere. It would also be informative to

determine the in vitro enzymic activity of both HOs under

different O2 tensions. In accordance with our results, HO2

would be predicted to function more efficiently than HO1

under low O2 tension.

In addition to being able to function in microaerobic

conditions, another intriguing possible role for HO2, as

well as the other tetrapyrrole biosynthetic enzymes that are

induced at low O2, is that they function during anaerobic

growth in the presence of an electron donor such as H2 or

S2-. Synechocystis sp. PCC 6803 has been reported to be

able to grow and synthesize phycobilins anaerobically in

Photosynth Res (2010) 103:47–59 57

123

the presence of H2 (Serebryakova et al. 2002). Although

HOs have not been reported to function completely anaer-

obically, HO2 might be able to use scavenged O2 that is

produced by residual PSII activity or other reactions under

these conditions. The fact that some HOs are able to func-

tion at very low O2 tension is suggested by the existence of a

functional HO encoded by the hemT gene of the obligate

anaerobe Clostridium tetani, which has been proposed to act

as an O2 scavenger (Bruggemann et al. 2004).

Phylogenetic analysis of HOs in cyanobacteria suggests

that HO2 isoforms share a common evolutionary origin.

The facts that HO2 is expressed in Synechocystis sp. PCC

6803 and the produced enzyme is active in vitro suggest

that it provides an advantage to the species that harbor it.

This advantage seems to be related to the environmental

stress of low O2 tension, and its presence might correlate

with the environment that the organisms live in. Although

the sequenced genomes of marine cyanobacteria are biased

toward Prochlorococcus and Synechococcus groups, the

apparent absence of a second isoform of HO in these species

correlates with the absence of a low O2 tension environment

in open ocean waters where these species are found. It is

notable that the genome sequences of two Prochlorococcus

marinus strains, MIT9313 and MIT9303, have two short

open reading frames designated as probable HOs, which are

85 (PMT1932) and 77 amino acids (P9303_25691) long,

respectively. They both show over 70% identity to each

strain’s own HO over the first 50 nucleotides, and over 80%

identity to each other. They might represent degenerate

forms of an HO isoform. In contrast, the majority of Pro-

chlorococcus/Synechococcus genomes contain both O2-

dependent and -independent isoforms of coproporphyrino-

gen III oxidase. These organisms probably use both of these

enzymes in the biosynthesis of chlorophylls, their major

light-harvesting pigments. Since phycobiliproteins are not

assumed to function in photosynthetic light harvesting in

these organisms, the role of HO might be different than in

other cyanobacteria, and one HO may be sufficient to per-

form this task in both high and low O2 tension environ-

ments. Contrary to marine cyanobacteria, freshwater

cyanobacteria face microaerobic atmospheres more often

(Stal and Moezelaar 1997). It is interesting that some

freshwater cyanobacteria, such as Microcystis aeruginosa

NIES843, possess a single HO. This species is certainly

exposed to low O2 tension in the natural environment. It

would be interesting to compare its HO with the ones from

an organism that has two isoforms in terms of O2 sensitivity.

Nevertheless, our phylogenetic analysis and other reports of

O2-regulated protein expression in cyanobacteria suggest

that HO2 in other cyanobacteria is likely to be induced by

low O2 tension.

We propose that HO2 is the most ancient form of HO in

cyanobacteria. Its expression in the cells cultured under low

O2 tension and the fact that the ancestors of cyanobacteria

are believed to have first thrived in anaerobic or microaer-

obic environments (Battistuzzi et al. 2004; Mulkidjanian

et al. 2006) suggest that HO1 might have evolved from HO2

to accommodate the high O2 tension environment that the

organisms faced during the rise in atmospheric O2 content.

Acknowledgments We thank G. Burleigh for suggestions on phy-

logenetic analysis and comments on the manuscript, and W. Vermaas

for the DPSII strain of Synechocystis sp. PCC 6803. M. Yilmaz was

supported by a fellowship from the Turkish Council of Higher

Education.

References

Anisimova M, Gascuel O (2006) Approximate likelihood-ratio test

for branches: a fast, accurate, and powerful alternative. Syst Biol

55:539–552

Battistuzzi FU, Feijao A, Hedges SB (2004) A genomic timescale of

prokaryote evolution: insights into the origin of methanogenesis,

phototrophy, and the colonization of land. BMC Evol Biol 4:14

Beale SI (1993) Biosynthesis of phycobilins. Chem Rev 93:785–802

Beale SI (2008a) Biosynthesis of chlorophylls and hemes. In: Harris

L, Stern DB, Witman G (eds) The chlamydomonas sourcebook,

vol 2, 2nd edn. Elsevier, Dordrecht, pp 731–798

Beale SI (2008b) Photosynthetic pigments: perplexing persistent

prevalence of ‘Superfluous’ pigment production. Curr Biol

18:R342–R343

Bruggemann H, Bauer R, Raffestin S, Gottschalk G (2004) Charac-

terization of a heme oxygenase of Clostridium tetani and its

possible role in oxygen tolerance. Arch Microbiol 182:259–263

Cornejo J, Beale SI (1997) Phycobilin biosynthetic reactions in

extracts of cyanobacteria. Photosynth Res 51:223–230

Cornejo J, Willows RD, Beale SI (1998) Phytobilin biosynthesis:

cloning and expression of a gene encoding soluble ferredoxin-

dependent heme oxygenase from Synechocystis sp. PCC 6803.

Plant J 15:99–107

Dore S, Takahashi M, Ferris CD, Zakhary R, Hester LD, Guastella D,

Snyder SH (1999) Bilirubin, formed by activation of heme

oxygenase-2, protects neurons against oxidative stress injury.

Proc Natl Acad Sci USA 96:2445–2450

Glazer AN (1988) Phycobiliproteins. Methods Enzymol 167:291–303

Gray MW (1989) The evolutionary origins of organelles. Trends

Genet 5:294–299

Guindon S, Gascuel O (2003) A simple, fast, and accurate algorithm

to estimate large phylogenies by maximum likelihood. Syst Biol

52:696–704

Howitt CA, Cooley JW, Wiskich JT, Vermaas WFJ (2001) A strain of

Synechocystis sp. PCC 6803 without photosynthetic oxygen

evolution and respiratory oxygen consumption: implications for

the study of cyclic photosynthetic electron transport. Planta

214:46–56

Lascelles J, Hatch TP (1969) Bacteriochlorophyll and heme synthesis

in Rhodopseudomonas spheroides—possible role of heme in

regulation of branched biosynthetic pathway. J Bacteriol

98:712–720

Le SQ, Gascuel O (2008) An improved general amino acid

replacement matrix. Mol Biol Evol 25:1307–1320

MacColl R (1998) Cyanobacterial phycobilisomes. J Struct Biol

124:311–334

Migita CT, Zhang X, Yoshida T (2003) Expression and character-

ization of cyanobacterium heme oxygenase, a key enzyme in the

58 Photosynth Res (2010) 103:47–59

123

phycobilin synthesis. Properties of the heme complex of

recombinant active enzyme. Eur J Biochem 270:687–698

Minamizaki K, Mizoguchi T, Goto T, Tamiaki H, Fujita Y (2008)

Identification of two homologous genes, chlAI and chlA(II), that

are differentially involved in isocyclic ring formation of

chlorophyll a in the cyanobacterium Synechocystis sp. PCC

6803. J Biol Chem 283:2684–2692

Montgomery BL, Lagarias JC (2002) Phytochrome ancestry: sensors

of bilins and light. Trends Plant Sci 7:357–366

Mulkidjanian AY, Koonin EV, Makarova KS, Mekhedov SL, Sorokin

A, Wolf YI, Dufresne A, Partensky F, Burd H, Kaznadzey D,

Haselkorn R, Galperin MY (2006) The cyanobacterial genome

core and the origin of photosynthesis. Proc Natl Acad Sci USA

103:13126–13131

Nowack ECM, Melkonian M, Glockner G (2008) Chromatophore

genome sequence of Paulinella sheds light on acquisition of

photosynthesis by eukaryotes. Curr Biol 18:410–418

Puri S, O’Brian MR (2006) The hmuQ and hmuD genes from

Bradyrhizobium japonicum encode heme-degrading enzymes.

J Bacteriol 188:6476–6482

Ratliff M, Zhu W, Deshmukh R, Wilks A, Stojiljkovic I (2001)

Homologues of neisserial heme oxygenase in gram-negative

bacteria: degradation of heme by the product of the pigA gene of

Pseudomonas aeruginosa. J Bacteriol 183:6394–6403

Rieble S, Beale SI (1988) Transformation of glutamate to delta-

aminolevulinic-acid by soluble extracts of Synechocystis sp.

PCC 6803 and other oxygenic prokaryotes. J Biol Chem

263:8864–8871

Rieble S, Beale SI (1991) Purification of glutamyl-tRNA reductase

from Synechocystis sp. PCC 6803. J Biol Chem 266:9740–9745

Sambrook J, Russell DW (2001) Molecular cloning: a laboratory

manual, 3rd edn. Cold Spring Harbor Laboratory Press, NY

Schmitt MP (1997) Utilization of host iron sources by Corynebac-terium diphtheriae: identification of a gene whose product is

homologous to eukaryotic heme oxygenases and is required for

acquisition of iron from heme and hemoglobin. J Bacteriol

179:838–845

Schrautemeier B, Neveling U, Schmitz S (1995) Distinct and

differently regulated Mo-dependent nitrogen-fixing systems

evolved for heterocysts and vegetative cells of Anabaenavariabilis ATCC 29413—characterization of the fdxh1/2 gene

regions as part of the nif1/2 gene clusters. Mol Microbiol

18:357–369

Serebryakova L, Novichkova N, Gogotov I (2002) Facultative H2-

dependent anoxygenic photosynthesis in the unicellular cyano-

bacterium Gloeocapsa alpicola CALU 743. Int J Photoenergy

4:169–173

Sicora CI, Ho FM, Salminen T, Styring S, Aro EM (2009)

Transcription of a ‘‘silent’’ cyanobacterial psbA gene is induced

by microaerobic conditions. Biochim Biophys Acta Bioenerg

1787:105–112

Skaar EP, Gaspar AH, Schneewind O (2004) IsdG and IsdI, heme-

degrading enzymes in the cytoplasm of Staphylococcus aureus.

J Biol Chem 279:436–443

Stal LJ, Moezelaar R (1997) Fermentation in cyanobacteria. FEMS

Microbiol Rev 21:179–211

Stanier RY, Kunisawa R, Mandel M, Cohen-Bazire G (1971)

Purification and properties of unicellular blue-green algae (order

chroococcales). Bacteriol Rev 35:171–205

Sugishima M, Migita CT, Zhang X, Yoshida T, Fukuyama K (2004)

Crystal structure of heme oxygenase-1 from cyanobacterium

Synechocystis sp. PCC 6803 in complex with heme. Eur J

Biochem 271:4517–4525

Sugishima M, Hagiwara Y, Zhang X, Yoshida T, Migita CT,

Fukuyama K (2005) Crystal structure of dimeric heme oxygen-

ase-2 from Synechocystis sp. PCC 6803 in complex with heme.

Biochemistry 44:4257–4266

Summerfield TC, Toepel J Jr, Sherman LA (2008) Low-oxygen

induction of normally cryptic psbA genes in cyanobacteria.

Biochemistry 47:12939–12941

Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4: molecular

evolutionary genetics analysis (MEGA) software version 4.0.

Mol Biol Evol 24:1596–1599

Terry MJ, Linley PJ, Kohchi T (2002) Making light of it: the role of

plant haem oxygenases in phytochrome chromophore synthesis.

Biochem Soc Trans 30:604–609

Thiel T, Lyons EM, Erker JC, Ernst A (1995) A 2nd nitrogenase in

vegetative cells of a heterocyst-forming cyanobacterium. Proc

Natl Acad Sci USA 92:9358–9362

Thiel T, Lyons EM, Erker JC (1997) Characterization of genes for a

second Mo-dependent nitrogenase in the cyanobacterium Ana-baena variabilis. J Bacteriol 179:5222–5225

Unno M, Matsui T, Ikeda-Saito M (2007) Structure and catalytic

mechanism of heme oxygenase. Nat Prod Rep 24:553–570

Verma A, Hirsch DJ, Glatt CE, Ronnett GV, Snyder SH (1993)

Carbon monoxide: a putative neural messenger. Science

259:381–384

Wegele R, Tasler R, Zeng Y, Rivera M, Frankenberg-Dinkel N (2004)

The heme oxygenase(s)-phytochrome system of Pseudomonasaeruginosa. J Biol Chem 279:45791–45802

Wilks A, Schmitt MP (1998) Expression and characterization of a

heme oxygenase (Hmu O) from Corynebacterium diphtheriae.Iron acquisition requires oxidative cleavage of the heme

macrocycle. J Biol Chem 273:837–841

Williams JGK (1988) Construction of specific mutations in photo-

system II photosynthetic reaction center by genetic engineering

methods in Synechocystis 6803. Methods Enzymol 167:766–778

Yamamoto Y, Aminaka R, Yoshioka M, Khatoon M, Komayama K,

Takenaka D, Yamashita A, Nijo N, Inagawa K, Morita N, Sasaki

T, Yamamoto Y (2008) Quality control of photosystem II:

impact of light and heat stresses. Photosynth Res 98:589–608

Zhang X, Migita CT, Sato M, Sasahara M, Yoshida T (2005) Protein

expressed by the ho2 gene of the cyanobacterium Synechocystissp. PCC 6803 is a true heme oxygenase. Properties of the heme

and enzyme complex. FEBS J 272:1012–1022

Zhu W, Wilks A, Stojiljkovic I (2000) Degradation of heme in gram-

negative bacteria: the product of the hemO gene of Neisseriae is

a heme oxygenase. J Bacteriol 182:6783–6790

Photosynth Res (2010) 103:47–59 59

123