Great Basin Naturalist - BYU ScholarsArchive

Great Basin Naturalist Great Basin Naturalist

Volume 52 Number 1 Article 14

5-11-1992

Full Issue, Vol. 52 No. 1 Full Issue, Vol. 52 No. 1

Follow this and additional works at: https://scholarsarchive.byu.edu/gbn

Recommended Citation Recommended Citation (1992) "Full Issue, Vol. 52 No. 1," Great Basin Naturalist: Vol. 52 : No. 1 , Article 14. Available at: https://scholarsarchive.byu.edu/gbn/vol52/iss1/14

This Full Issue is brought to you for free and open access by the Western North American Naturalist Publications at BYU ScholarsArchive. It has been accepted for inclusion in Great Basin Naturalist by an authorized editor of BYU ScholarsArchive. For more information, please contact [email protected], [email protected].

http://home.byu.edu/home/

http://home.byu.edu/home/

https://scholarsarchive.byu.edu/gbn

https://scholarsarchive.byu.edu/gbn/vol52

https://scholarsarchive.byu.edu/gbn/vol52/iss1

https://scholarsarchive.byu.edu/gbn/vol52/iss1/14

https://scholarsarchive.byu.edu/gbn?utm_source=scholarsarchive.byu.edu%2Fgbn%2Fvol52%2Fiss1%2F14&utm_medium=PDF&utm_campaign=PDFCoverPages

https://scholarsarchive.byu.edu/gbn/vol52/iss1/14?utm_source=scholarsarchive.byu.edu%2Fgbn%2Fvol52%2Fiss1%2F14&utm_medium=PDF&utm_campaign=PDFCoverPages

mailto:[email protected],%[email protected]

T H E

GREATRE A BASINB A S I1 N

naturalistmoe

A

VOLUME 52 NSN V1 MARCH 1992

BRIGHAM YOUNG university

GREAT BASIN naturalisteditor

JAMES R BARNES

290 MLMLBMBMbrigham young university

provo utah 84602

associate editors

MICHAEL A BOWERS JEANNE C CHAMBERS JEFFREY R JOHANSENblandy experimental farm USDA forest service research department ofbioloiyof biologyuniversity of virginia 860 north 12th east john carroll universityuniversiuniverseUniversi tybox 175 logan utah 84322800084322 8000 cleveland ohio 441144118A

boyce virginia 22620

PAULCPAUL C MARSH BRIAN A MAURER JIMMIERJIMMIER PARRISH

center for environmental studies department of zoology BIOWESTBIOWESTIBIOblo WESTWESTI incarizona state university brigham young university 1063 west 1400 northtempe arizona 85287 provo utah 84602 logan utah 84321

editorial board richard W baumann chairman zoology H duane smith zoologyclayton M white zoology jerranberran T flinders botany and range science william hesspessbotany and range science all are at brigham young university ex officio editorial moardoardmembers include clayton S huber dean college of biological and agricultural Scsciencesincesnorman A darais university editor university publications james R barnes editor creatgreatbasinnaturalistbasin naturalist

the great basin naturalist founded in 1939 is published quarterly by brigham younguniversity unpublished manuscripts that further our biological understanding of the greatbasin and surrounding areas in western north america are accepted for publication

subscriptions annual subscriptions to the great basin naturalist for 1991 are gag55 forindividual subscribers 15 for student andemeritusand emeritus subscriptions and 40 for institutionsoutside the united states 30 20 and 45 respectively the price of single issues is 122 all

back issues are in print and available for sale all matters pertaining to subscriptionsbacksubscriptions backbaekissues or other business should be directed to the editor great basin naturalist 290 MMLBMLBMbrigham young university provo UT 84602

scholarly exchanges libraries or other organizations interested in obtaining the featgreatreatbasin naturalist through a continuing exchange of scholarly publications should contatcontafctcontkt theexchange librarian harold B lee library brigham young university provo UT 84602

EDITORIAL production STAFF

joanne abel technical editorcarolyn backman

I1

AsassistantsistantdistantI1

to the editornatalie miles production assistant

copyright 1992 by brighamBrigharn young university ISSN 00t7oul7oula 3614official publication date 22 may 1992 5925 92 pap050 55407

the great basin naturalistPUBLISHED ATPROVOATPROVO UTAH BY

BRIGHAM YOUNG university

ISSN 001736140017 3614

VOLUME 52 MARCH 1992 no I1

great basin naturalist 521521 1992 ppap 1 10

IN MEMORIAM A PERRY PLUMMER 1911 1991TEACHER naturalist RANGE SCIENTIST

E durant mcarthur 1

A perry plummer died in the gunnison valley great basin experimental range ephraimhospital gunnison utah on october 3 1991 canyon and conducted many field tours at outafter several years of ill health his passing planting common garden range rehabilitationdeserves comment because he was a man who and other research sites throughout utah and themade a difference in natural resource manage-ment

intermountain area under these circumstancesand research in the intermountainintel mountain area he he was a master teacherwhose points made lasting

spent his professional career 1936 1979 with the impressions on whoever was there agency landintermountain research station INT formerly manager private landowner public schoolthe intermountain forest and range experiment teacher washington office forest servicestation of the forest service US department research administrator politician junior col-

leagueof agriculture at duty stations in utah near mil-ford

or university professorfordandferdandand in ogden ephraim and provo perry had a rare gift of integrating in his mind

the potential vegetative states ofdegraded landsTEACHER AND MENTOR because he knew soil types compatible plant

associations plant adaptations planting equip-mentperry was a caring effective mentor and and seedbed requirements because of

teacher his assignment with the forest service this gift and his willingness to share it he waswas research and research administration often called on to consult those responsible forwhich he did well but his professional love was rehabilitating degraded lands typically heteaching especially small groups and individu-als

would visit potential rehabilitation sites andhis formal teaching was limited to a couple follow up by providing detailed written recom-

mendationssemesters at brigham young university BYU mendat ions he completed well over one hun-dredshortly after the 1975 establishment of INTsINTs careful thoughtful consultations for the

shrub sciences laboratory on that campus he good of the land for those who manageI1

it andestablished a wildlandwindlandwildland shrub biology class that for its human and other occupants he was aremains a part of the BYU curriculum in addi-tion

mentor to others who continue on in this tradi-tionhe instructed numerous workshops at the I1 think especially of steve monsen of our

shrubsin abnb sciences laboiatorylabmftrylaboratoryLaboi atory interniountainintel mountain research station forest service US department otof agricultitreagriculture provo utah 84606

2 GREAT BASIN naturalist volume

laboratory and richard stevens of the utah of a hoe for several hours a day but then I1 didndian tdivision of wildlife resources DWR in expect my boss to be in that situation either heephraim would show up anywhere a work crew was

I1 illustrate perry s teaching style with a per-sonal

ready to help with vigor and energy and heexample in may 1972119721 had been working expected anyone working to do the same it

for INT for four months when perry took me on wasngasn t uncommon for perry to show up at thesea field trip to the brown s park area of northeast-ern

sites at 1130 am or 430 pm seeminglyutah to evaluate the results of some earlier unaware of the impending lunch hour or quit-

tingwork he took or sent me on monthly field trips timethose first two or three years at one stop I1 saw perry s record of accomplishment was noteda patch of green in the distance at a spring I1 by several organizations in 1965 INT recog-

nizedsuspected monkey flowers mimuluswimulus sp the him with a certificate of merit and a sub-stantialsubject ofmy phd degree research a few years cash award for outstanding performance

earlier would be growing there I1 hustled over in wildlife habitat research and application ofand confirmed my suspicion perry ambled up that research also in 1965 the utah wildlifeand said ititss nice to appreciate these monkey federation honored him as conservationist offlowers the way you do but look back toward the the year in 1973 the utah chapter of the soiltruck what else do you see there are lots of conservation society of america gave him theirother plant species and plant communities chapter recognition award he received abetween here and there you can leamlearn a lot by USDA superior service award in 1969 forlooking at the whole plant community he implementing and making successful the coop-

erativelaughed in his characteristic way and we dis-cussed

work between INT and DWR perry athe various plant species present and 1949 charter member of the society for range

their habitat requirements A lasting lesson to management SRM was president of the utahme it is similar to other perry teaching section and received SRM s outstandingmoments shared by my colleagues achievement award 1974 the premier fred-

eric G renner award 1976 and the fellowbackground EDUCATION WORK award 1977 he was president of the utah

ETHIC AND HONORS chapter of the soil conservation society duringthe early 1970s

arthur perry plummer fig 1 was bomborn on afarm in daniel wasatch county utah on april scientific contributions10 1911 his mother died when he was younghe and his siblings had a resourceful indepen-dent

in this section I1 comment not only on perry s

upbringing with their widower father he direct contributions but also on work that hewas educated in the wasatch county public stimulated and inspired perry s contributionsschools at east high school in salt lake city were not limited to those he personally madeand at the university of utah perry received a but like those of many great teachers hisBS degree 1935 in botany from the U began achievements have been enhanced andhis INT career 1936 married blanche swin-dle

expanded by those who came after and builtof monroe 1938 and completed his MS upon the foundation lie laid

degree also in botany at the U 1939 in a busy considering perry s later contributions tofour years he enjoyed his university days and shrub biology it is of interest that his first pub-

licationcalled on that background and experience lication was on developing a technique for prep-arationthroughout

0 his career notable among0 hisI1pro of microscopic sections of stems and

fessors were kim newby walter cottam ralph roots of shrubs newbynewbyandnewbrandand plummer 1936 hischamberlainchamberlain fayette stephens and angus mastermasterss degree thesis 1939 published inwoodbury he and doc cottam continued a 1943 dealt with germination and seedlingproductive interchange of ideas and shared field development of range grasses he continued histrips into the mid 1970s interest in seed germination quality storage

perry was a doer he performed and worked and processing and in seedling developmenthard he didndian t just ask his subordinates to get on a wide range of plants throughout his careersomething done he did it with them As a new and his successors have continued this workphd I1 didndian t expect to be on the business end rudolf et al 1974 stein et al 1974 plummer

199219921 IN MEMORIAM A PERRY PLUMMER 3

11

aa7a

V

mogmoomig6

A41INNIPPPaf4f

OF

low

siaa0004

fig 1 A perry plummer inin his office about 1975

and jorgensen 1978 stevens etetalal 1981 meyer opmentoiment of procedures for revegetating degradedet al 1989 stevens and meyer 1990 meyer and lands including plant materials and operationalmonsen 1991 equipment information and answers to how

perry s greatest contributions involved devel when why and where he was primary author


of three how to publications that have been and intraspecific variation stebbins 1950broadly accepted and applied plummer et al 1959 he was particularly interested in apply-

ing1955 1968 plummer 1977 the 1968 publica-tion

these concepts to western shrub speciesrestoring big game range in utah which had received littlepriorlittlelittie prior attention despite

became a classic it has been used extensively in their obvious ecological importancethe classroom and in the field and is now out of he spelled out his dream of a regionalprint after several press runs it is serving as the common garden testing scheme legrandefoundation of a new compendium for western oregon boise idaho ephraim utah andwildlandwindlandwildland rehabilitation techniques monsen reno nevada in a 1972 document plummerPIummerand stevens inin press 1972a although this dream was not fully

other publications of note for general and implemented because of funding problemsspecific revegetation applications include several useful and interesting studies resultedplummer et al 1943 stewart and plummer eg van epps 1975 mcarthur and plummer1947 plummer and fenley 1950 plummer 1978 mcarthur et al 1978c 1979 19811959195919701970 plummer and stapleystapley19601960 ste-

venswelch and mcarthur 1979 1981 welch and

et al 1974 harner and harper 1976 monsen 1981 mcarthur and welch 1982giunta et al 1978a1978a mcarthur et al 1978b edgertonedgertonetaletetalal 1983 welch etetalal 1983 geistmonsen and plummer 1978 stevens et al and edgerton 1984 hegerhorst et al 19871981 monsen and shaw 1983 monsen and his specific interests in hybridization breed-

ingmcarthur 1985 davis 1987 and blauer systems and genetic variation and selectionet al in press have been addressed in a series of publications

his early revegetation work led to a coopera-tive

specific to certain shrub taxa plummerPIummer et alresearch and application venture between 1966 nord et al 1969 hanks et al 197119731971 1973

INT and the utah division ofwildlifeofwildlife resoucesresources 1975 plummer 1974b blauerblaueretBlaueretet al 1975197519761976known then as the utah department of fish mcarthur 1977 stevens et al 1977 giunta et

and game under perry s direction this effort al 1978b mcarthur et al 1978a 1978c 1979was stimulated by big game winter range prob-lems

1988 in press welch et al 1981 1987 1991brought on by the partial urbanization of mcarthur and freeman 1982 davis 1983

those ranges large deer populations and the freeman et al 1984 1991 davis and welchheavy snowfallssnowballssnow falls of the late 1940s and early 1985 welch and mcarthur 1986 pendleton et al1950s the program began in 1954 at the behest 1988 welch and jacobsen 1988 wagstaff andof the directors of INT and DWR it is the most welch 1991 andinand in more generaltermsgeneral terms drobnickextensive and longest running such arrange-ment

and plummer 1966 plummer 1972b 1974ain the country he and his colleagues from monsen 1975 monsen and christensen 1975

DWR produced I111I1 substantive reports between carlson and mcarthur 1985 mcarthur 19891956 and 1971 detailing their findings and rec-ommendations

he had a keen eye for recognizing unusualin revegetation science plum-

merandor superior plant populations occurring nat-urallyet al 1956 1971 these reports published and in test plantings and in enhancing

by DWR were sought out and used widely by those materials for improved productivity andland management professionals esthetics of degraded and badly disturbed lands

perry had a particular interest in and impact several of these collections have been givenon plant materials development including distinctive cultivar or source identified namesexploration collection evaluation adaptation and released for commercial propagation andculture genetic variation hybridization and use by his associates since his retirement thesebreeding systems in this area he read carefully include apparalpar lewis flax linum perenneand followed the works of luther burbank cedar palmer penstemonpentstemonpenstemon penstemonpenstenwnpentstemonPenstemon pal-

meriwide and unusual hybridizations see kraft and rincon fourwingfourvongfourlingfourwingvOngsong saltbush atriplexkraft 1973 N 1I vavilov and E V wulff ori-gins

canescentcanescenscanescens hatch winterfatwinter fat ceratoidesCeratoides lanataand development of related plant groups hobble creek mountain big sagebrush atreATteartemesiaartemisiamisiamisla

wulff 1943 vavilov 1951 jens clausen david tridentata sspasp vastyanavaseyanavaseyana immigrant foragekeck and william hieseygiesey accessional or pop-ulational

kochia kochia prostrataprostrateprostrata lassen antelopeulat ional comparisons in common gardens and bitterbrushbitterbrush purshia tridentata ephraimreciprocal transplantationstransplantations clausen et al crested wheatgrasswheatgrass agropyron cristatumctistatumchicristatum and1940 and G L stebbins natural hybridization paiute orchardgrassorchardgrass dactylis glomerataglonwrataglomerateglomflomenataerata


mcarthur et al 1984 monsen and stevens ciplinesipline of shrub science 3 hundreds of thou-sands1985 stevens and monsen 19851988a19851988a 1988b of acres of successfully rehabilitated

stevens et al 1985 shaw and monsen 1986 wildlandswild lands that retain sufficient plant diversity towelch et al 1986 mcarthur 1988 other spe-cies

support a rich native fauna and 4 a nativeand populations were not released but have wildlandwindlandwildland plant industry several seed companies

had their usefulness documented and have in sanpete county alone owe their existence atbecome available in the revegetation species least in part to perry and his team for back-

groundrepertoire information collecting and processingperry plummer served for many years as the techniques and development of a market for

forest service technical representative to the products I1 will address only item 2western regional plant introduction commit-tee

perry began his career with the seeding eval-uationW 6 his plant materials expertise was put and development of range grasses

to use as a member of 1976 and 1977 plant plummer 1944 1946 plummer and stewartcollection and exploration teams in the soviet 1944 plummer and frischknecht 1952union dewey and plummer 1980 and in 1980 frischknecht and plummer 1955 he wasas an on site consultant in a new zealand range simultaneously involved in range managementrehabilitation program he also stimulated research roth and plummer 1942 plummer etinterest in shrub disease and microbial and al 1943 bleak and plummer 1954 and sagebrushentomological relationships tiernan 1978 control work behanecpehanecPehanec et al 1944 1954 1965nelson and krebill 1981 moore et al 1982 later he managed the great basin experimentalnelson 1983 nelson and tiernan 1983 nelson range in ephraim canyon keck 1972and schuttler 1984 haws et al 1988 nelson when his assignment changed to restorationand lopez 1989 of wildlife habitat in 1954 he quickly became

aspects of perry s love of plants can be high-lighted

converted to the value of shrubs on wildlandswildlandsby two that were named after him 1 perry liked to recount his subsequent attempts

apparalpar lewis flax was the first of several plant to convert others to the value of shrubs even thereleases effected by INT DWR USDA soil heretofore weed sagebrush by recalling anconservation service and several state agricul-tural

anecdote in the late 1950s he was with a crewexperiment stations the app in apparalpar is on a vegetative rehabilitation project above a

for his initials and 2 grayiagrabia brandegeibrandegeebrandegei sspasp central utah town the local forest servicepalummeriplummeriplummefiplummehnmerimefimenhmenimenn is a wide leaved tetraploid variety of district ranger came by to see what they werespineless hopsagehousage that howard stutz named in doing perry pointed out the various seeds in thehonor of its discoverer stutz et al 1987 these seed mix crested wheatgrasswheatgrass orchard grasstwo plants illustrate the poles of perry s work alfalfa fourwingfourlingfourwing saltbush lewis flax small bur-

nettone is a showy revegetation and horticultural etc the ranger wanted to know what onecultivar the other a restricted edaphic endemic particular small black seed was when perrynew to science answered that it was sagebrush the ranger took

perry helped develop and refine equipment him to task for planting a weed perry acknowl-edgedand techniques including anchor chaining seed that he himself had spent much of his

dribblersdribb lers scalpers seed collection and process-ing

career trying to rid western lands of that plantrangeland drills and transplantation and but pointed out that it was needed for wildlife

interseedinginterseeding equipment plummer et al 1956 food and habitat they were on a bench above1971 1968 a valley below them was recently cleared land

that had been choked with a thick stand ofLEGACY sagebrush perry pointed out that there were

good reasons to do both thin sagebrush standsmany of perry s 80 publications are listed in and plant sagebrush

the literature cited section aside from these perry had the vision to understand the useful-nessI1 see the following components of his legacy 1 of all plants within a community he sought

with blanche a fine family ofseven children 2 to include the use of less common but importantan expanded scientific foundation that he and taxa including buckwheat globemallowglobemallow andhis disciples have laid for wildlandwindlandwildland reclamation smooth aster he understood that plants servesee recent examples documented in the liter-

aturemany important functions in addition to forage

cited section and for the incipient dis he strongly supported management and resto


ration efforts needed to improve disturbed sites literature CITEDhis standing knowledge and ability to workwith different people were extremely helpful to BLAUEBLAUFRii A CCEE D mcaluilurmcainijuii R STEVENSSTFVFNS and S D

NELSONNFLSON in evaluation of roadside stabilizationpressfederal and state land management agencies asand beautification plantings inin south central utahthey attempted to balance livestock grazing USDA forest service research paper intermountain

pressure with carrying capacity of rangelands research station ogden utahhe was particularly interested in preservation BLAUEBLAUFR13 A C A P plummerPLUMMFRplummfji E D MCARHIUR R

and study of natural plant communities he srslevensSIFVFNSEVE N S andandbandaB C giGIUNIAU NTA 1975 characteristics and

worked to maintain the exclosure facilities ofthe hybridization of important intermountain shrubs 1Irose family USDA forest service research papergreat basin experimental and providedrange INT 169 intermountain forest and range experi-mentnumerous plant vouchers for herbaria station ogden utah 36 ppap

his work with shrub management and values 1976 characteristics and hybridization of impor-tantwas important in garnering support for conconstruestruc intermountain shrubs 11II chenopod family

of shrub USDA forest service research paper INT 177 inter-mountain

thetion sciences laboratory V Lforest and stationrange experimentretired de chief for researchharper deputyputy ogden utah 42 ppap

forest service sent me a letter in 1985 BLEAKBLFAK A Ttandaand A P PLUMMERPLUMMFR 1954 grazing crestedI1 was doing a research inspection of the inter-

mountainwheatgrasswheatgrass by sheep journal ofrangeorrangeof range management 7

mounmonn tain station about 1960 one of the cen-ters

63 68

Directdirectoroi joe pechanec and I1 visited was the CARLSON J R and E D MMARIIIURAIITIIUII EDSFDS 1985 sympo-siumwork on shrub research after listening to the project siumslum on range plant improvement pages 107 220 inm

leader s perrypeiry s presentationpiesen tation and viewing some of proceedings selected papers presented at the 38ththetiie field experiments I1 turned to joe and said annual meeting of the society for range manage-

mentmaybe we ought to amend the ten year research society for range management denver colo-radoprogram to include a new laboratory at provo

featuring shrub research including genetics etc CLAUSENCLAUSFNglausen JJDD D KECKKFCK andandwanawW M hilseyhif&fyhifsey 1940 exper-imentaljoe grinned broadlyandbroadly and said 1 I hoped you would see studies on the nature of species 1I effect of

this need liehelleile then produced a memo outlining the varied environments on western north americanjustification for such a laboratorylaboilabor atory to be localoealocatedtedonon the plants carnegie institution of ofwashingtonwashington publicationgrounds of brigham young university he further 520 washington DCD C 452 ppapremarked 1 I have outlined which I1a speech can now DAVDAVISIS J N 1983 performance comparison among popula-

tionsshort for the labcut giving a big pitch of bitterbrushbitterbrusbbitterbrush cliffrosecliffrose and bitterbrush cliffrose

the laboratory was completed in 1975 stutz hybrid crosses on study sites throughout utah pages1975 perry and his colleagues saw great oppor 38381444 in A R tiedemann and K L johnson compil-

erstunitiestuni ties and benefits in wildlandwindlandwildland shrub research proceedings research and management ofbitterbrushbitterbrusbbitterbrush and cliffrosecliffrose northin western americainvan Eppeppseppsetalsetalet al 1971 mckellmekelimckelletaletetalal 1972 someUSDA forest service general technical report INT

of their vision has been realized mckell 1989 152 intermountain forestandflorestandForforestestandand range experiment sta-tionone piece of evidence being a viabledable shrub ogden utah

research consortium tiedeman 1984 head-quartered

1987 seedling establishment biology and patternsat the shrub sciences laboratory and of interspecific association among established seeded

and nonseedednonseeded species on a chained juniper pinyoninvolvedadthinvolved with vital ongoing activities mcarthur woodland inin central utah unpublished doctoral dis-sertation1990 ser Brigbnghambrigharnbanghamhainharn young university provo utah 80 ppap

I1 was fortunate to visit perry about two weeks DAVIS J N and B L WELCHWFU n 1985 winter preferencebefore he died he was at home between hospital nutritive value and other range use characteristics ofstays it was pleasant to update him on lab kochia prostrataprostrateprostrata L schrad great basin naturalist

4577845 778 783activities he talked about his friends and col

DEWEYDFWFY D Rrandaand A P PLUplummerPLUMMFRM M E 11 1980 new collectionsleagues who had gone on before and expressed ofrangeorrangeof range plants from the soviet union journal of rangethe view that his time was near later as I1 drove management 33 89 94home I1 reflected through misty eyes the good DROBNK K R and A P PLUMMERPLUMMFR 1966 progress inin

fortune I1 had of knowing and being mentoredmen tored browse hybridization inin utah proceedings annualconference ofofwesternwestern state game and fish commis-sioners

by the man many share this view sionerssconers 46 203 211EDGERTONEDGFRION PeljPJJJ J M GEISTGFISIceist andandwgW G WILLIAMS 1983

acknowledgments sources of antelope bitterbrushbitterbrush inin northeast oregonpages 45 54 in A R tiedemann and K L johnson

I1 thank clyde blauer kim harper steve compilers proceedings research and management ofbitterbrushbitterbrush and cliffrosecliffrose inin western north americamonsen blanche plummer and rich stevens USDA forest service general technical report INT

for useful comments on an earlier version of this 152 intermountain forest and range experiment sta-tionmemoriam ogden utah


FREEMANFRFFMAN D C E D MCARTHUR and K T HARPER KRAFT K and P KRAFTKRAFI 1973 secrets of the great plant1984 the adaptive significance of sexual lability inin wizard natural history 828 10 26plants using Attiatriplexatnplexattiplexplex canescentcanescenscanescens as the principal exam-ple

ARlHURmcarthurMc E D 1977 environmentally induced changesannals of the missouri botanical garden 71 265 of sex expression inin atriplex canescentcanescenscanescens heredity 38

277 97 103FREEMAN D C W A TURNERTURNFR E D MCARTHUR and 1988 new plant development inin range manage-

mentJ H GRAHAM 1991 characterization of a narrow pages 81 112 in P T tueller ed vegetationhybrid zone between two subspecies of big sagebrush science applications for rangeland analysis and man-

agementartemisia tntridentata asteraceae american journal kluwer academic publishers dordrechtDordrechtof botany 78 805 815 netherlands

frischknecht N C and A P PLUMMERPLUMMFR 1955 A com-parison

1989 breeding systems inin shrubs pages 341 361of seeded under andgrasses grazing protection in C M mckell ed the biology and utilization of

on a mountain brush bum journal of range manage-ment

shrubs academic press inc san diego california8 170 175

1990 introduction cheatgrasscheatgrass invasion and shrubGEIST J Mmandujmandpjand P J EDGERIONEDGERTON 1984 performance tests

dieoffdiboff pages 1 2 in E D mcarthur E M romneyof founfourwmgfounvingfoundingving saltbush trailstraitstransplantsplants inin eastern oregon

and tueller proceed-

ings

S D smith P T compilerspages 244 250 in A R tiedemann E D mcarthurH C stutz R stevens and K L johnson compilers symposium on cheatgrasscheatgrass invasion shrub die

the of off and other aspects of shrub biology andproceedings symposium on biology atriplexcanescentcanescenscanescens and related chenopodschenopods USDA forest ser-vice

management USDAUS DA forest service general technicalgeneral technical report INT 172 intermoun-

tainreport INT 276 intermountain research station

forest and range experiment station ogden ogden utahUutahtah MCARTHUR E DDAA C BLAUER A P PLUMMER and R

GIUNTA B C D R christensen and S B MONSEN STEVENS 1979 characteristics and hybridization of1978a Interinterseedinginterseedmgseeding shrubs inin cheatgrasscheat grass with a browse important intermountain shrubs III111 sunflowerseeder scalper journal of range management 28 family USDA forest service research papelpaper INT 220398 402 intermountain forest and range experiment station

GIUNTA B C R STEVENS K R JORGENSENJORGFNSEN and A P ogden utah 82 ppapPLUMMER 1978b antelope bitterbrushbitterbrush an impor-tant

MCARTHUR E D andanddanadD C FREEMANFRFFMAN 1982 sex expres-sionwildlandwindlandwildland shrub publication 781278 12 utah state in AtTi and environmentin atnplexattiplexatriplexplexpiek canescentcanescenscanescens genetics

division of wildlife resources salt lake city 48 ppap botanical gazette 143 476 482HANKS D L J R BRUNNER D R christensen and MCARTHUR E D D C FREEMAN L S luckinbillLU KINBILL

A P PLUMMER 1971 paper chromatography for S C SANDERSON and G L NOLLER in press aredetermining palatability differences in various strainsstrams

trioecytnoecy and sexual lability in atnplexaftlplex canescentcanescenscanes cens genet-ically

of big sagebrush USDA forestF orest service research based evidence from clonal studies evolutionINT 101 intermountain forest and rangepaper

MCARTHUR E DDD D L HANKS A PPLUMMFRP PLUM ME R andaand A Cstation ogden utah 9experiment ppap

BLAUER 1978a contributions to the taxonomy ofHANKS D L E D MCARTHUR R STEVENSSTEVFNS and A P

chrysothamnus viscidiflorusviscidiflorus compositae astereaeAstereaePLUMMER 1973 chromatographic characteristics andphylogenetic relationships of artemisia section and other chrysothaninuschrysothamnus species using paper chroma-

tographytridentataetndentataeTridentatae USDA forest service research paper to journal of range management 31 216 223

INT 141 intermountain forest and range experi-ment

MCARTHUR E Ddandaand A P PLUMMER 1978 biogeogra-phystation ogden utah 24 ppap and management of native western shrubs a case

HANKS D L E D MCARTIIURmcarthur A P PLUMMER B C study section tridentataetndentataeTridentatae of artemisia great basinGIUNTA and A C BLAUER 1975 chromatographic naturalist memoirs 2 229 243

recognition of some palatable and unpalatable subspe-cies

MCARTHUR E DDAA P PLUMMER andl N DAVIS 1978bof rubber rabbitbrushrabbitbrush inin and around utah journal rehabilitation of game ranges inin the salt desert pages

of range management 28 144 148 23 50 in K L johnson ed wyoming shrublandsshrub landsHARNER R Ffandkfanckand K I1 HARPER 1976 the role of area proceedings of the seventh annual wyoming shrub

heterogeneity and favorabilityfavorability inin plant species diver-sity

ecology workshop university of wyoming laramieof pmyonpinyonpryon juniper ecosystems ecology 57 1254 MCARTHUR E DDAA P PLUMMERPLUMMFR G A VAN EPPS D C

1263 FREEMAN and K R JORGENSENJORGFNSEN 1978 producingHARPER V L 1985 march 17 1985 letter to E D fourwingfourlingfourwing saltbush in seed orchards pages 406 410 in

mcarthur on file at the shrub sciences laboratory D N hyder ed proceedings of the first interna-tional

provo utah rangeland congress society for range manage-ment

HAWS B A A H ROROEboeE andanddanadD L NEnelsonNFLSONLS 0 N 1988 index to denver coloradoinformation on insects associated with western wild

I1 MCARTHUR E DCD C L POPE anddanadand D C FREEMANFREFMAN 1981land shrubs USDA forest service general technical

chromosome studies inin subgenus tndentataetridentataeTridentatae ofarteolarteof artereport INT 248 intermountain research stationmisia evidence for autopolyploidypolyploidyauto americanamerlean journalogden utah 296 ppapof 68 589 605hegerhorst D FFDD J WEBERWEBFR andandeE D MCARTHUR botany

mcarthurMcarthurARlHURanthur E DDSS E stranathan andandgandaG L NOLLERNOLLFR1987 resin and rubber content inin chrysothamnussouthwestern naturalist 32 475475182482182 1984 rincon fourwingfourlingfourwing saltbush proven for better

KECK W M 1972 great basin station sixty years of forage and reclamation rangelands 6 62 64

progress in range and watershed research USDA MCARTHUR E D and B L WELCH 1982 growth rate

forest service research paper INT 118 intermoun-tain

differences among big sagebrush artemisiaforest and range experiment station ogden tritntrltridentatadentatatridentate subspecies and accessions journal of

utah 48 ppap range management 35 396101396 401


McmcarthurarthurAnTHUR E D B L weloWFLCWFLCHwelch n and S C SANDERSONSANDFRSON NELSONNFLSON D Llandclandaand C F LOPEZ 1989 variation inin nitrogen1988 natural and artificial hybridization between big fixation among populations of frankia sp andsagebrush artemisia tntridentata subspecies journal of ceanothus sp inin actinorhizal association biology andheredityheiedity7979 268 276 fertility of soils 7 269 274

memc KFkellKFLLgellLL C M 1989 the biology and utilization of shrubs NELSON D L and P L SCHUTTLERSCHUIILFR 1984 histology ofacademic press inc san diego california 656 ppap cowaniacowamacorama stansburianastansbunanastansburstansbunanaiana actinorhizae northwest sci-

encemckell C MMJJ P BLAISDELLBLAISDFLL andandlJ R GOODIN TFCII-NIC

58 49 56NICALAL EDSroseos 1972 wildlandwindlandWildland shrubs their biology and NELSONNFLSON D Llandclandaand C F TIERNANTIFRNAN 1983 winter injury ofutilization USDA forest service general technical sagebrush and other wildlandwindlandwildland shrubs inin the westernreport INT 1 intermountain forest and range united states USDA forest service research paperexperiment station ogden utah 494 ppap INT 314 intermountain forest and range experi-

mentmeylmrylMEYERmeyi R S EEEE D me mcarthurARTHUR and G L JORGENSENJORGFNSFN station ogden utah 17 ppap1989 variation inin germination response to tempera-ture

NEWBY W W and A P PLUMMER 1936 technique forin rubber rabbitbrushrabbitbrush chrysothamnus nauseosus preparing microscopic sections of woody stems and

asteraceae and its ecological implications american roots botanical gazette 98 198 199journal of botany 76 981 991 NORDNOHD E C D R christensen and A P PLUMMER

MEYER S E andandsS B MONSENMONSFN 1991 habitat correlated 1969 AtTiatriplexatnplexattiplexplex species or taxa that spread by rootvariation inin mountain big sagebrush artemisia sprouts stem layers and by seed ecology 59 324324326324396326396tritntrldentata sspasp vastyanavaseyanavaseyana seed germination patterns PECIIANECPECHANEC J FFAA P PLUMMER J H ROBERTSONROBERFSON andecology 72 739 742 A C HULL JR 1944 eradication of big sagebrush

MONSENMONSFN S B 1975 selecting plants to rehabilitate dis-turbed

artemisia tritntrldentata USDA forest service researchareas pages 76 90 inin R S campbell and C H paper I1 INTNT 10 intermountain forest and range

herbal eds improved range plants society for range experiment station ogden utah 23 ppapmanagement denver colorado 1965 sagebrush control on rangelands USDA

MONSENMONSFN S bandB and D R christensen 1975 the use of handbook 277 USU S government printing officeshrubs inin rehabilitation of range lands inin the inter-mountain

washington DC 40 ppapregion pages 72 119 in H C stutz ed PECHANEC J FFGG STEWARISTEWART A P PLUMMER J H ROB

wildlandwindlandWildland shrubs symposium and workshop at the ded-ication

ERTSONFRTSON and A C HULL JR 1954 controlling sage-brushof the USU S forest service shrub sciences lab-

oratoryon rangelands USDA farmers bulletin 2072 USU S

brigham young university provo utah government printing office washington DC 36 ppapMONSFN S Bbandeand E D MCARTHURMCARIIIUR 1985 factors influ-

encingPENDLETON R LLEE D mcarthur D C FREEMAN and

establishment of seeded broadleaf herbs and A C BLAUERBLAUFR 1988 heterodichogamyHeterodichogamy inin grabiacrayiagrayiashrubs following fire pages 112 124 inkin K sanders and brandegeebrandegeibrandegei chenopodiaceae report from a newJ durham eds rangeland fire effects a symposium family american journal of botany 75 267 274USDA bureau of land management idaho state PLUMMERPLUMMFR A P 1939 variability rate of germination andoffice boise early development of twelve range grasses unpub-

lishedMONSENMONSFN S B and A P PLUMMERPLUMMFR 1978 plants and master s thesis university of utah salt laketreatment from revegetationvegetationle of disturbed sites inin the city 75 ppapintermountain area pages 155 173 in R A wright 1943 the germination and early seedling devel-

opmented the reclamation of disturbed aridandarld lands university of 12 important range grasses american soci-etyof new mexico press albuquerque of agronomy journal 35 19 34

MONSEN S B and N SHAW COMPILERSCOMPILFRS 1983 managing 1944 experiment shows value ofcrested wheatgrasswheat grassintermountain rangelands improvement of range and rye for spring and fall pasturage USDA forestand wildlife habitats USDA forest service general service research paper INT 9 intermountain foresttechnical report INT 157 intermountain forest and and range experiment station ogden utah 6 ppaprange experiment station ogden utah 194 ppap 1946 mountain bromegrassbromegrass good for seeding

MONSENMONSFN S B and R STEVENSSIFVFNS 1985 paiute mountain ranges national woolgrower 365 14orchardgrassorchard grass forage species for semiandsemiaridsemiana range and 1959 restoration of juniperjumperlumper pinyon ranges ininwildlandwindlandWildland sites rangelands 7 114 115 utah society of american foresters proceedings

MONSENMONSFN S B and R STEVENSSIFVFNS COMPILERS in press 19582071958 207 211rehabilitation ofwestern ranges andandwildlandswildlandswild lands USDA 1970 plants for revegetation of roadreadoutscuts and otherforest service general technical report intermoun-tain

disturbed or eroded areas USDA forest service inter-mountainresearch station ogden utah region range improvement notes 15l11511511isilisolisilsi 1 8

MOOREMOORF T BBRR STEVENSSIFVFNS andandeE D MCARIIIURMCARTHUR 1982 1972a regional selection and breeding areas andpreliminary study on some insects of kochia prostrataprostrateprostrata outplantings for improvement of shrubs unpublishedwith emphasis on the lygusdygus bug nygus desertinusdesettinusdeserdesett inustinus manuscript on file at shrub sciences laboratoryjournal of range management 35 128 130 provo utah 20 ppap

NELSON D L 1983 occurrence and nature ofactmorhizaeactinorhizae 1972b selection pages 121 126 inin C M mckellon dowaniacowania stansburianastansbunanastansburstansbunanaianalana and other rosaceae pages J P blaisdell and J R goodin technical eds wild225 239 in A R tiedemann and K L johnson com-pilers

land shrubs their biology and utilization USDAproceedings research and management of forest service general technical report INT 1 inter-

mountainbitterbrushbitterbrush and cliffrosecliffrose inin western north america forest and range experiment stationUSDA forest service general technical report INT ogden utah152 intermountain forest and range experiment sta-tion

1974a morphogenesis and management ofogden utah woody perennials inin the united states pages 72 80

NELSON D L and R G KREBILLKRFBILL 1981 A sagebrush wilt in K W kreitlow and R H hart coordinators plantdisease of unknown origin great basin naturalist 41 morphogenesis as the basis for scientific manage-

ment184 191 of range resources USDA agricultural


research service miscellaneous publication 1271 A P PLUMMERPLUMMFR D R cmustfnsencllklsifnsfn and S B

USU S government printing office washington DCD C MONSENMONSFN 1961 job completion report for gamegaine1974b oldman wormwood to stabilize disturbed forage revegetation project W 82 11 6 utah depart-

mentareas utah science 35 28 33 of fish and game salt lake city 360 ppap1977 revegetation of disturbed intermountain 1962 job completion report for game forage

area sites pages 302 339 in J L thames ed recla-mation

revegetation project W 82 11 7 utah department ofand use of disturbed land in the southwest fish and game salt lake city 46 ppap

university of arizona press tucson 1963 job completion report for game foragePLUMMERPLUMMFR A P D R christensen and S B MONSFN revegetation project W 82 R11 8 bulletin 631163 11 utah

1968 restoring big game range in utah publication department of fish and game salt lake city 2668368 3 utah department of fish and game salt lake PPcity 183 ppap 1964 job completion report for game forage

plummerPLUMMFRPLUM MER A pandjpandaP and J M fenleyFFNLFYFENLFY 1950 seasonal periods revegetation project W 82 R11 9 bulletin 641464 14 utahfor planting grasses inin the subalpine zone of central department of fish and game salt lake city 60utah USDA forest service research paper INT 18 PPintermountain forest and range experiment station 1967 highlights results and accomplish-

mentsogden utah 12 ppap of game restoration studies 1966 publicationPLUMMFR A Ppandnpananand N C frisciikneciitFRISC hknfcm 1952 increas-

ing67467 4 utah department of fish andlindkind game salt lake

field stands of indian ricegrassriencricegrass agronomy journal city 45 ppap4428544 285 289 A P PLUMMERPLUMMFR D R ciiristfnsenchrlsCHRIS lensenIFNSFN andandrR STEVENS

PLUMMERPLUMMFH A P A C HULL JR G STEWARTSTFWART and J H 1970 highlights results and accomplishments ofROBERTSONROBERISON 1955 seeding rangelands inin utah game restoration studies 1970 publication 70370 3

nevada southern idaho and western wyoming utah division of fish andlindfindkind game salt lake city 94USDA handbook 71 US government printing PPoffice washington DC 73 ppap ROTH A H JR and A P PLUMMERPLUMMFR 1942 increasing

PLUMmPLUMMFHplummerFRAera A PR M HURD andcanac K pearsePFARSFKPEARSF 1943 how livestock production and profits by developing goodto reseed utah range lands USDA forest service spring range USDA forest service technical noteresearch paper INT 1 intermountain forest and INT 2 intermountain forest and range experimentrange experiment station ogden utah 22 ppap station ogden utah 10 ppap

PLUMMERPLUMMFR A pandkpanakP and K R JORGENSFNJORGFNSFN 1978 harvesting RUDOLF P 0 K W DORMAN R G HITThill and A P

cleaning and storing seed of western shrubs pages PLUMMERPLUMMFR 1974 production of genetically improvedd65 1375 in conference and workshop proceedings seed pages 53 74 inm C S schopmeyer technical coor-

dinatorwestern forest nursery council and intermountain dinator seeds of woody plants inin the united statesnurseryman s association combined nurseryman s USDA forest service agricultureAgn culture handbook 450 USU S

conference and seed processing workshop western government printing office washington DCD C

forestryFoifol estry nursery council eureka california SHAWsnaw N and S B MONSENMONSFN 1986 lassen antelopePLUMMER A PSP S B MONSFN anddanadand D R christensen bitterbrushbitterbrush a browse plant for game and livestock

1966 fourwingfouradngfourlingFourwing saltbush a shrub for future game ranges rangelands 8 122 123

ranges publication 66466 4 utah department of fish and STEBBINSSIFBBINS G L 1950 variation and evolution in plantsgame salt lake city 12 ppap columbia university press new yorkyolkyori 643 ppap

PLUMMFR A P and H D stapleySIAPLFYSTAPLFY 1960 research inin 1959 the role ofhybridization inin evolution proceed-ingsgame forage restoration inin utah western association of the american philosophical society 103231103 231 251

of state game and fish commissioners proceedings STEINsrein W I1 P E SLABAUGILSLABAUCII and A P PLUMMERPLUMMFR 1974

19591591959 159 166 harvesting processing and storage of fruits and seedsPLUMMERPLUMMFR A pandgpanagP and G STEWARTSTFWARF 1944 seeding grass on pages 98 125 in C S schopmeyer technical coordina-

tordeteriorated aspen range USDA forest service seeds of woody plants in the united states USDAresearch paper INT 11 intermountain forest and forest service agricultureAgn culture handbook 450 USU S gov-

ernmentrange experiment station ogden utah 6 ppap printing office washington DCD CPLUplummerPLUMMFRM M E R A Ppetalet a 1956 1971 sevensSFVFNSSTFVFNSstevens RRBB C giunta K R JORGENSENJORGFNSFN and A P

applummerandrljfnsfnA P plummerPLUMMFR andr L jensenJFNSFN 1956 job completion PLUMPLUMMFRME 11 1977 Winterwinterfatwmterfatfat ceratoidesCeratoides lanata publi-cationreport for artificial revegetation studies on big game 77277 2 utah division of wildlife resources salt

ranges in utah W 82 11 1 utah department of fish lake city 41 ppapand game salt lake city 23 ppap STEVENSSIFVFNSslevens RRKK R jorgensenJORGFNSFNJORCFNSEN and J N DAVIS 1981

A P PLUMMERPLUMMFR R L JENSENJFNSFN andhanahand H D STAPLEYSIAPLFY 1957 viability of seed from thirty two shrub and forb speciesjob completion report for game forage revegetation through fifteen years of warehouse storage greatproject W 82 11 2 utah department of fish and basin naturalist 41 274 277game salt lake city 128 ppap STEVENSSIFVFNS RRKK R JORGENSENJORGFNSFN E D mcainilurMCARTIIUR and

1958 job completion report for game forage J N DAVIS 1985 immigrant forage kochiarevegetation project W 82 11 3 utah department of rangelands 7 22 23

fish and game salt lake city 175 ppap STEVENSSIFVENSsievensslevens R and S E MEYERMFYFR 1990 seed quality testingA P PLUMMERPLUMMFR H D STAPLFY and D R for range and wildlandwindlandwildland species rangelands 12 341

ciiiiistfnsfnchristfnsfn 1959 job completion report for 346game forage revegetation project W 82 R 4 utah STFVFNS R W L MODENMODFN JR and D W MKFNZIFM kenieKFNIFkenledepartment of fish and game salt lake city 25 1981 Interinterseedinginterseedmgseeding and transplanting shrubs and forbs

PP into grass communities rangelands 3 555558581960 job completion report for game forage STEVENSSTFVFNS R and S B MONSENMONSFN 1985 ephraim crested

revegetation project W 82 11 5 utah department of wheatgrasswbeatgrasswheatgrass a rhizomatous grass for western langesrangesfish and game salt lake city 51 ppap and disturbed sites rangelands 7 163 164


1988a cedar palmerpaimer pensterpenstemonpensternonpentstemonpen stemonnon aselectedpena selected pen WELCHWFLCII B Llandeand E D mcaiuilurmcartiiur 1979 variation instemon for semiarid ranlresranges rangelands 10 163 164 winterminter levels of crude protein among artemisia

1988bhatch1988b hatch winterfatwinter fat a quality shrub for ranges tritndentata subspecies journal of range managementand wildlandswild lands rangelands 10 104 105 324673946732 467 469

STEVENSSIIVFNSSIIsli VFNS R A P PLUMMERPLUMMFR C E lensenJFNSFNJENSEN and B C 1981 variation of monoterpenoid content amongGIUNIAGIUNTA 1974 site productivity classification for subspecies and accessions of artemisia tndentatedentataselected species on winter big game ranges of utah grown inin a uniform garden journal of range manage-

mentUSDA forest service research paper INT 158 inter-mountain

34 380 384forest and range experiment station 1986 wintering mule deer preferenceprepieference for 21

ogden utah 24 ppap accessions of big sagebrush great basin naturalist 46STEWASIFWARIiu G and A P PLUplummerPLUMMFRM M E R 1947 reseedingseedingRe range 281 286

lands by airplane inin utah proceedings of the utah welchWFLCII B L E D mcartiiurmcaimiur and J N DAVIS 1981academy of science arts and letters 24 35 39 differential preference of wintering mule deer for

sluistulz H C IDED 1975 wildlandwindlandWild land shrubs symposium and of and blackaccessionsaccessions big sagebrush sagebrush jour-nalworkshop at the dedication of the USU S forest service of range management 34 409 411

shrub sciences laboratoryLaboi atory brigham young university 1983 mule deer preference and monoterpenoidsprovo utah 168 ppap essential oils journal of range management 3648536 485Sisluiurz H CCSS C SANDERSONSANDFRSON E D mcarthur and

487GLG L cliuciiuciau 1987 chromosome races of grabiagrayiagrayzacrayza welchWFLLIIwelgh B L E D MCARTHUR D L NELSON J Cbrande madrono 34 142 149brandegeihranclegeibrandegee chenopodiaceaegeigel PEDERSON andl N DAVIS 1986 hobble creek a

TIEDEMANN A R 1984 shrub research consortiumselection of low elevation mountain bigsuperior sage-

brushformed greatgleat basin naturalistnatuiahst 44 182

USDA forest service research INT 370tiltii RNAN C F 1978 the role of entomology in rangepaper

intermountain research station utah 10management pages 477477178478 in D N hyder ed ogden ppapWFLCH B LLEE D mcarthur and R L RODRIGUEZproceedings of the first international rangeland con-

gress 1987 variation inin utilization of big sagebrush acces-sions

society for range management denver colo-rado by wintering sheep journal of range manage-

mentVAN elisellsens G A 1975 winter injury to fourwingfourlingfourwing saltbush 40 113 115

journal ofrangeorrangeof raneerange management 28 157 159 WFLCHwelch B L and S B MONSEN 1981 winter crude

VAN eilsellsens G A A P PLUPLUMMFRM M E 11 andandcanacC M mckeM kellKFLLLL 1971 protein among accessions of fourwingfourlingfourwing saltbush grown

the future potential of shrubs on utah ranges utah in a uniform garden great basin naturalist 41 343 346

science 32 21 23 WFLCII B LLFJF J WAGSTAFF andandjandaJ A ROBERSON 1991

VAVILOV N 1I 1951 the origin variation immunity and preference of wintering sage grouse for big sagebrushbreeding of cultivated plants chronicacaronicaCh ronica botanica 13 journal of range management 44 462 4651 364 translated from the russian by K S chester WULFF E V 1943 an introduction to historical plant

WAGSIAITWAGSTAFF FFJJ andandbandaB L WEweloWFLCLCIIn 1991 seedstalk produc-tion

geography Chchromearonica botanica 10 1 223 translatedof mountain big sagebrush enhanced through from the russian by E BrisbrissendensendenseDden

short term protection from heavy browsing journal of44 72 74range management

received 24 1992februaryWELCHWFLCIIwelgh B L andandtT L C JACOBSONJACjao OBSON 1988 root growthofartemisia trltntrityldentata journal of range management accepted 3 march 1992

4133241 33234332 33434

greatcreat basin naturalist 521521 1992 ppap 11 24

SECONDARY production ESTIMATES OF BENTHIC INSECTSIN THREE COLD DESERT STREAMS

W L gamesgainescaines 121 2 C E CushingGushing 3 and S D smithsmithl

ABSTRACTABSIRALT we studied aquatic insect production inin three cold desert streams inin southeastern washington thesize frequency SF and PB methods were used to assess production which isis expressed by taxon functional group andtrophic level

dipteransDipterans midges and black flies were the most productive taxa accounting for 40 70 of the total insect productionproduction by collectors andmd detntivoresdetritivores was the greatest of all functional groups and trophic levels respectively in all studystreams

insects with rapid development times and multiple cohorts are very important inm cold desert streams they were majorcontributors to the total insect production total insect production rates inin our study streams 14142323 g DW in

2yr

1 weregreater than those found inin deep creek idaho 121 2 g DWMDW m

2 yr1 the only other cold desert stream for which production

data are available our values also were generallygenei allyaily greater than published data for most coldmesiccold mesic 3 27 g dvvmDW m2

yrand humidmesicbumidmesichumidmesiemeslemesic 3 25 g DW m

2yr

1streams but lower than inin sonoran desert streams 120 g DW m

2yr

1or new

2 1zealand streams 40 g DW m yr

our data support the contention of others that production rather than density or biomass isis the most accurate andmeaningful way to assess the role of these organisms inin lotic ecosystems

key words productivity benthos spring streams cold desert functional groups trophic lelehlevehlevels diptera tnchopteradichopteracoleoptera ephemeroptera odonata plecoptera

community level production of insects has mass analysis and overestimated by numericalbeen assessed in relatively few stream types and analysis in a southeastern stream benke et al

of all macroinvertebratesmacro invertebrates in even fewer partic-ularly

1984 waters 1977 states that production is

little is known about secondary produc-tion

important to understanding ecosystem dynam-icsin aridandarld region streams the only studies of because it is the means by which energy is

secondary production in aridandarld region streams made available to higher trophic levelsthat we are aware of are those of minshall et al while most secondary production studies1973 in deep creek idaho in the cold desert have focused on one or a few species in a stream

province and fisher and gray 1983 and jack-son

benke and wallace 1980 waters andand fisher 1986 in sycamore creek ari-

zonahokenstrom 1980 ohop et al 1984 more

in the hot desert region recent studies have estimated secondary pro-ductionsecondary production is the rate of animal of the entire macrobenthicmacrobenthic fauna

tissue elaboration over time regardless of the krueger and waters 1983 benke et al 1984fate eg carnearncamivorycarnivorymivorycarnivoreca ivory emergence of that produc-tion

smock et al 1985 huryn and wallace 1987benke and wallace 1980 estimating sec-

ondaryyet to be integrated into community level anal-ysesproduction in a stream provides one are the hyporheichypo rheic fauna protozoa and

assessment of the role of animals in the ecosys-tem

other microinvertebratesmicroinvertebrates the community levelbenke and wallace 1980 as well as insight approach provides a more integrated insight

into ecosystem dynamics estimating only den-sity

into the ecology of stream ecosystemsand biomass regardless of time may not the purpose of this study was to measure the

accurately describe the role of organisms in the secondary production of insects in three streamsstream for instance the role of gathering col located in the cold desert physiographic prov-

incelector invertebrates was underestimated by bio of southeastern washington we emphasize

idepartmdepartmentnt of biological sciences central washington university Ellenseilensellensbuigellensburgellensbergburg washington 989262presentpresent address US forest service leavenworth ranger district leavenworth washington 988263 environmental sciences department pacificP icinoicinc northwest LahlablaboratoryL ihoratory richland washington 99352

11

12 GREAT BASIN naturalist volume 52

TABLETABU 1 physical and chemical characteristics of study reaches inin douglas creek snively springs and rattlesnakesprings july 1985 to june 1986

average average averagewidth depth discharge dissolved 02

stream m m m3sass eglmgl

douglas creek 40 031 06 96 14

snively springs 13 010 004 86 12

rattlesnake springs 17 0050 05 0050 05 8.282828 2 10

TABLITAMA 2 percentpeipel cent substratum types inin study reaches of douglas creek snively springs and rattlesnake springs july1985 to june 1986

substratum type

boulder cobble pebble gravel sandsiltSand silt

stieamstreamstidam 256256mmminmmmiu 64 225 mm 16 64 mm 2 16 mm 2 mm

douglas creek 21 29 24 16 10

snively springs 7 20 25 11 37rattlesnake springs 0 1 7 11 81

that the estimates published here are in several the upper reaches where flow is permanent andcases based on assumptions that we have not affected by irrigation withdrawal riparianexplained see methods given the choices to vegetation is dominated by water birch betulawhich we could devote the available resources occidentoccidentalisoccidentalistalis and peachleafpeach leaf willow salixwe chose to produce an estimate of total insect amygdaloidesamygdal oidesproduction in these spring streams rather than

snively springsdetailed data on a few taxa we hope futurestudies will provide data on growth CPIs etc SS is a small spring stream located on the USfor all taxa in these spring streams which we can department of energy s hanford site wash-

ingtonthen use to refine the initial estimates presented it drains an area of approximately 40here km2 the lower reaches of the spring stream dry

up during the summer leaving about 3.63636 km ofSTUDY SITES perennial flow cushinggushing 1988 riparian vege-

tation is dominated by coattailscattailscattails typha latifolialatifoliathis shrub steppe region is characterized by along the upper and lower reaches and willow

a climax community consisting of big sage arte-misia

salix sp and wild rose rosa sp along thetridentata and bluebunchbluebunch wheatgrasswheatgrass mid reaches where it flows through a canyon

agropyron spicatumspicatum mean annual precipita-tion

watercress nasturtium officinaofficinalele rorippain the area is about 14 cm the study nasturtium aquaticum grows extensively

streams were douglas creek DC snively within the spring streamsprings SS and rattlesnake springs RS fig rattlesnake1 the average width depth discharge and springs

dissolved oxygen concentration for each study RS is a small spring stream also located on thereach are shown in table 1 and the substratum hanford site it drains an area of 350 km2

composition is given in table 2 figure 2 shows cushing et al 1980 portions of the lowerthe daily and seasonal temperature ranges reaches dry up during the summer leaving

about 2.52525 km of perennial flow mean annualcreekdouglas total alkalinity as cacos is 127 ppm and the

DC is a spring fed stream located in douglas spring stream is subject to periodic severecounty washington it is the largest of the three spates in winter cushinggushingcushing and wolf 1982 Cgush-

ingush

streams studied the stream itself draining an and gaines 19891089 riparian vegetation is

area of530 km2 our study sites were located in dominated by peachleafpeachleaf willow and cattailscoattailscattails

19921 INSECT productivity IN SPRING STREAMS 13

NN

x

y

hk

al

t

xax4

B

fig 1 study reaches A douglas creek B snively springs C rattlesnake springs


20douglas creek 0 dailydallydaliy high

dailydally low15

10

5

020

snively springs

0 150

10

CL

E5

025

rattlesnakeraftlesnake springs

20

15

10

5 I1 I1 1 1

J A S 0 N D J F M A M J1985 1986

fig 2 annual water temperature regimes douglas creek snively springs and rattlesnake springs july 1985 to june 1986

watercress is presently the dominant in stream METHODSautotroph although periphytonperiphyton primary pro-duction exceeded that of watercress in 1969 70 we sampled segments of each stream repre-

sentingcushinggushingcushing and wolf 1984 the various habitats that were present


one study reach was sampled in SS and one in sources of information to estimate CPIs for eachRS and three reaches were sampled in the taxon in our study streams first we surveyedlarger DC samples were taken to calculate an the available life history data gathered from lit-

eratureaverage standing stock for each stream to be reviews and extrapolated the results toused to calculate production estimates the apply to our situations second we made fieldsampling scheme was not designed to allow observations to determine presenceabsencepresence absence ofintrastreamintrastream comparisons of production esti-mates

taxa and collected size frequency informationbetween different habitats but rather to for each taxon to estimate larval development

provide representative production estimates of times and CPIs lastly we conducted in situthe entire stream growth studies for babtisbaetis sp cheunwtopsychecheumatopsyche

samples were collected monthly from july sp and simulium sp to allow further refine-ment1985 through june 1986 we collected three of our CPI estimates these growth stud-iessamples during each visit A portable inverte-

brateinvolved placing insects within growth

box sampler PIBS 01oi0.101 m2 mesh size chambers in RS chambers were constructed350 pmlm was used in DC A surber sampler with mesh netting on each end to allow water0090.09009 m mesh size 350 lmm was used in SS and and food material to pass through measure-

mentsRS because these spring streams are too shal-low

were taken and development timesfor a PIBS samples were taken to a depth recorded to estimate CPIs using the combina-

tionof 10 cm and preserved in 70 ethyl alcohol of all these data sources we feel confidentinsects were separated from organic debris by that our CPI estimates are reasonable approxi-

mationssugar flotation anderson 1959 and sorted by mat ionstaxa insects were identified to the lowest taxo-nomic

productionbiomassProduction Biomass PB ratios waterslevel possible and counted and body 1977 were used to estimate secondary produc-

tionlength was measured to the nearest I11 mm using for less abundant taxa these PB ratiosa microscope and ocular micrometer the tro-phic

were either taxon specific values derived fromstatus of each taxon was determined by the study streams or an assumed cohort PB

examining gut contents gaines et al 1989 or value of 5 waters 1977 benke et al 1984by reference to merritt and cummins 1984 these taxa were not present in sufficient num-

bersbiomass was determined as dry weight DW to provide an accurate SF distributionfor all size classes after drying at 60 C for 24 h curve that is necessary to compute SF produc-

tionand weighing to the nearest 00.101oi01 1 mg estimatesthe size frequency SF method hynes and

coleman 1968 hamilton 1969 hynes 1980 RESULTSwaters and hokenstrom 1980 was used toestimate secondary production of the most production calculations for DC SS and RScommon taxa an average SF distribution was are given in tables 3 4 and 5 respectively thedetermined from monthly sample sets these following text describes some of the assump-

tionsrepresented the survivorship curve of an aver-age

we used in our calculations data support-ingcohort hamilton 1969 benke and waide these assumptions and other information

1977 zero values were included when calcu-lating

relevant to the production calculations all pro-ductiondensities production was estimated by estimates unless noted otherwise are

92 11

calculating the loss between successive size given in units of mg dwmcwm yrclasses and then multiplying the loss by the douglas creeknumber of size classes using the equation givenby hamilton 1969 production estimates were ephemeroptera mayfliesMayflies typically exhibitrefined by multiplying by 365cpi cohort pro-duction

widely varied larval development times clif-fordinterval benke 1979 1982 clifford 1982 examined life cycle

we found that conducting growth studies for data of 85 species of heptageniidae and foundall taxa present within each of the streams was that 90 had at least one univoltine cyclenot practicable to establish reasonable esti-mates

field data for baetisbabtis sp in DC provided littleof larval development times and CPIs we clarification of the CPI based upon field data

followed the example of benke et al 1984 of babtisbaetis sp from RS and SS and a growth studywho used available life history data and field in RS we estimated a CPI of 60 d similardata to estimate CPIs we used three major temperature regimes in DC and RS support this


TATABLE13 LE 3 annual productionpioploduction of insects inin douglas creek july 1985 to june 1986

annualannu al

calculationC ilculatio n B productionproductionlon annual365cpp36 5cpil methodethodttliTi nm 2 SE CV rmgdwmmgdw m

2 SE CV mgmgdwDWMm2 PB

ephemeropteraephermeropteramecopteramerop teratevaievabaet is sp gc D

1

6 SF 2416 041 924 2637 041 919 8320 315paraleptophlebia sp gcge D P1 SF 225 035 785 481 038 854 249 52leucrocutaleucmocutarocuta sp g II11 ia11i0 SF 160 047 1040 514 051 1040 238 46tricot7fthodestnconthodes sp gc D 9 pbdabd 6 080 1592 17 067 1510 77 450e45 oe

TOIALtotal 2807 3649 884

odonataargiaargiayaiaayalaa titibttibibialisallaliail p C 1 PBpil 30 046 1039 89 049 1103 44 5.05050so506

plecopteraisoperlahoperlaeriaerie sp p C F1 SF 77 058 1294 428 058 1139 183 43

trichopteraHydrohydropsychehijdropjchepsyche sp fc D 11JO SF 445 057 1271 4135 065 1458 1700 41chetcheicheumatopsychenncitopyche sp fcfe D 2 SFSITsir 156 053 1183 841 060 1350 818 97leucotrichiaLeucoleuc trichia pictippictipepictipe s g H I110 SSFF 95 063 1397 77 068 1532 32 42

gurmTOIAIturmgorm 696 5053 2550

coleopteraoptiosemtsoptiowrvns sp g fII11I1 I11 SSFF 4322 037 835 6067 036 800 2160 36

dipterachironoinusclnronomu sp gc D 15 PB 753 071 1523 607 069 1538 4920 811f81 ifsimulium sp fcfe D 12 PB 41 075 1686 312 072 1361 1680 540f54 0paranietnocnemuparametriocnemus sp gc D 15 SF 196 044 980 104 046 1019 875 841chaetocladius sp gcge D 15 SF 115 057 1278 35 066 1294 426 1217heleniellaheieheleniella sp gc D 15 SF 141 052 1164 45 054 1165 423 940tipulidae s D lo101 PB 37 037 825 821 048 1031 411 soesoe506phaenospectraphaenopectra sp g H 9 PB 60 007 155 49 007 150 221 450polypedilumPolypedpoly peachlumpechlumilumlium sp s H 18018iso SF 33 069 1545 22 078 1291 161 731tabanidaetabanidaenadae p C 1 PB 51 048 1066 278 048 1075 130 50thienemannimyiarhthnemanmmyia sp p C 15015 PB 11 081 1805 09 083 1854 75 836f836brilhaflavifronsbrillia flavifronsflavifrons s D 15 PB 12 025 550 09 026 574 68 75075 08

empididae p C 15 PB 1 022 500 01 018 400 8 75075 06

TOIALtotal 1451 2292 9358GRAWgi andtoialtorral 9383 17578 23219

soursibilesilSiistisiiilelleleeiLe of CPIPI used dedde d bionfion groth studies fieldtuldditidata andindsfdistnbutioniSF distribuiionsdistributions 0 literatureliteikitei iture bbasedisedased upon cp1cpaPI foiforfol si inilnsfinihirinion cited insects used whenwilen

othotiothronsrousyousronssolsoi actsicts wl notnoi availableIV ll11 likilkalkllk1

s shredderiaciidci gcge gatheringitlmmg collcolic etoitoretoltoy tcfc filtering c collcttor11cctoi g grazerscrapergrazergi aersiersscraperci iper p predatorpred aitoritor 11II herbivorelieghilieihi re D dehitivoredetntivoie C carnivorecumvoresrSF prodnetionpi diictioii calculatedc lyby thetileiliellie simsieglegim frejoencyficqiiency lriITIthodethod

ibb1pbPB 1odctioopi idiiction caicocalcocalculatedc ilcnllatedit d lyby anin assiwssiissinneded PBpil rotiorltior itloptpinnednned1 shoftcohortwhoft PB of5ofaot 5

alstnastnassume d 1 annkudiiiniigini ll11 PBpil isis ththe saines line iusitsis dedvcddc ave d by srSF forfoiloilor thistins taxont ixonevon inn one of the othestudyotheotlieiotlien siudystudy streantsstrestie antsuns

estimate pdraleptophlebiaparaleptophlebia sp is generally uni-voltine

could not be made from field data several stud-iesvoltine having either summer or winter cycles mackay 1969 harper 1973 barton 1980

clifford 1982 in DC however seasonal cycles ofisoperlaoflsoperla sp showed seasonal variation in growthcould not be distinguished paraleptophlebia rate but generally their development time waswere present in DC throughout the study year about I11 yr therefore we assumed a CPI of I11 yrand we assumed a CPIC PI of I11 yr because of low trichoptera leucotrichiaLeucotrichia pictipespictipes wasnumbers of tricorythodes sp field data pro-vided

univoltine and as SF distributions and field datalittle indication of their CPI mccullough indicated the larvae overwinteredoverwintered as late instars

et al 1979 reported a 34 d larval development and emerged in spring this observation is sup-portedtime for T minutusminutes grown in the field at 18 C by studies on L pictipespictipes in owl creek

therefore we estimated a CPI of 40 d for montana mcauliffe 1982tricorythodestticorythodes sp because of lower stream tem-peratures

coleoptera an accurate CPI estimate forperatures in DC the riffle beetle optioservus sp was difficult to

ODONATA the damselfly argia tibialis is estimate because few data are available con-cerningunivoltine their development times we thus

plecoptera A CPI estimate for isoperla sp assumed a CPI of 1 yr


TABLE 4 annual production of insects from snively springs july 1985 to june 1986

annualCcalculationin B production annual

36365cpi5cpp1 method nm2 SE CV ing dwmcwm2 SE CV mg cwmdwm2 PB

ephemeropterabaetisbabtis sp gc db 61go sacsfc 1388 062 1047 1854 055 963 7010 37.8378378

paraleptophlebiaparaleptophlehia sp gc D rI1 SF 54 027 475 155 028 482 67 43TOTAL 1442 2009 7077

odonataargia tibialis p QC r PBpb1pbs 22 061 1066 278 068 1186 139 50

trichopteracheumatopsyche sp fc D 2 SF 433 041 830 2009 051 869 1300 65

dipterasimulium sp fcfe D 12 SF 276 070 1213 343 082 1426 1880 548chironomus sp gc D 15 SF 412 054 932 171 058 998 1390 811tipulidae s D lo101 PB 25 060 1038 2192 050 874 1100 5oe50eaoeheleniellaHeleniella sp gc D 15 SF 381 040 692 92 037 647 550 603polypedilumPolypedilum sp s H 18 SF 123 056 96.2962962 32 052 891 220 686chaetocladius sp gcge D 15 SF 92 063 108.31083 27 069 1202 210 778dixidaedididae gc D 15-

1515-150

PB 21 055 959 13 065 1115 98 750e750thienemanmmyiathieneinannimyia sp p CQ PB 18 042 72.3723723 11 033 573 92 836836ftabanidae p QC 1 PBpis 52 047 815 105 050 864 53 50empididae p QC 15 PB 4 015 266 06 0.12012012 321 45 75075 01

toralTOTAL 1404 2992 5638grannGKANDGRANDcranocrann TOTALTTFALtyral 3301 7288 14154

source eftioftiof CPI used derived froinploin growth studies RAIheldheidreidbal datidata andnd SF ditribntionodistnbiitions 0 litliteiatmeatneeatnre based uponpon cpacp1 forsiloltoiiol sinnlaiilarliar citedi ted iinsectsnats nndusedd Aaliciwlici

other soisotsoteses weieweirwele not availableihibieihibieiblehs sbieddeied&rggc gatigatbenngingofletorcollectorcollectoi fec filtering collect11 toroi g graecraprgiaeisciapei I1II11I1 1rbiorehcibivoie D dctntivoiedchitivre C cauclucaniivoiecluivoivo

SF prodiitionpiodnction calculated by lleilethelie siesimsiw frequency method11113PB pioplopioductionproductionpi ductionluction calculated by an assumed PBpli latior&ioraio

assumed cohortanthnt PB otof 5Asassumedsinned annual PBpis isis tilethetlle samesaniesanle as deiiveddenvcdderived by SF toltoiforfollorlur tinsthis taxon inin one oftheodtheot the other study streamssti earmsearns

DIPTERA simulium sp were not present in empididae grew to a maximum size similar tosufficient numbers in DC to calculate an SF many of the midges therefore a CPI of 25 ddwasawaswasproduction estimate the PB ratio was calcu-lated

usedby averaging the PB ratios obtained for snively springs

simulium sp in SS and RS by the SF methodaccurate CPI estimates for chironomidae ephemeroptera gray 1981 reported a

could not be obtained from field observations or larval development time of 20 d for babtisbaetisSF distribution therefore we derived CPI esti-mates

quilgullguliquilletleri in sycamore creek arizona because ofas did benke et al 1984 and used lower stream temperatures however baetisbabtis sp

growth data from mackey 1977 mackey developed more slowly in all streams in this

1977 reported larval development times of 21 study we assumed a CPI of60 d paraleptophle

d for chironomus sp 13 d for polypedilumpolypedijumPolypedilumlium bia sp was present only during the summer

convictumconvictum and 36 d for phaenospectraflavipes thus we used only summer data to calculate

at 15 C CPIs were compensated for slightly production because annual P was essentially

lower average temperatures in DC 13 CQ and equal to summer P

environmental stress eg food availability ODONATA argia tibialis was not present in

competition etc these PB ratios seem high sufficient numbers to make an SF productionbut are comparable to other data where short estimateCPIscp1scpus were used to estimate PB ratios benke et trichoptera field data and SF data indi-

catedal 1984 jackson and fisher 1986 tabanidae a bivoltine life cycle and a CPI of 6 mo for

and tipulidae were assumed to be univoltine cheumatopsyche sp the only caddishlycaddisflycaddis fly in SS

with a development time of I11 yr krueger and DIPTERA becker 1973 reported a larvalcook 1984 this is consistent with the estimate development time of 13 d for S vittatumvittatum grownof a 1 yr development time for tabanus dorsiferdorsifer in the laboratory at 17 C A 30 d CPI was esti-

matedin sycamore creek arizona gray 1981 considering lower stream temperatures


tableTABLFtaille 5 annual production of insects from rattlesnake springs july 1985 to june 1986

annualcalculation B production annual

365cpla365cpf method nm2 SE CV mgmgdwm2dwmcwm2 SE CV mg dwm2 PB

ephemeropterabaetisbactibabtis sp gcgel D b

6go sfcsac 1336 061 1072 473 058 1040 2540 538triconjthodestncorythodcs sp gc D 909 pilpb11d 1 005 83 03 007 122 14 45045 06

totalTOIAL 1337 476 2554

odonataargia tibialis p QC 1r PBpis 67 072 1241 743 078 1349 372 soe506

trichopteracheumatopsychechcwwitopsychc sp fcfe D 2200goo SF 140 069 1189 486 078 1345 486 100Paraparapsycheparapychcpsyche sp fcfe D 1 PBpil 10 024 417 268 025 434 134 soe506500limnephiluslimncphiluf sp s D F1 PB 52 045 769 220 038 663 115 50506

TOIALtotaltolah 202 974 735

coleopterahydaticusHydaticus sp p C F1 PBpis 4 050 874 12 035 601 6 550oe

hydrophilidae p C F1 PBpis 1 027 476 03 025 431 2 5506ae0e

totalTOIAL 5 8

dipterasimulium sp fcfe D 12 0 SF 1777 073 1258 2123 073 1275 11180 526chironomus sp gcge D 15 SF 192 050 873 7070 058 1008 489 699Heleheieheleniellahclcmcuaniella sp gcge D 15 SF 352 051 890 54 051 884 480 889thienemannimyiarhicncmanmmyia sp p QC 15015iso SF 114 055 949 33 055 952 279 836tabanidae p QC lo101 PB 34 051 856 159 064 1110 80 soemise chironomidae gcge D 15 PBpis 18 029 501 08 038 663 60 75 oe06

Polypedpolypedilumpolypcdilumilum sp s H 18 PBpis 13 062 1082 06 046 789 41 68668 af6ff

chaetocladiuschactocladtus sp gcge D 15 SF 59 073 1264 04 056 977973 30 750empididae p C 15 PBpil 8 039 683 04 023 398 30 75075 0-

6506tipulidae s D lo101 PB 3 021 359 20 026 443 10 5 ae0e

dixidaedididae gcge D 15 PBpis 2 028 647 01 029 500 8 75 oe06

totalTOIAL 2572 2482 12687GRANDgnandgkandtoiaitaraftyraf 4183 4690 16356

sourmsource oftiuedot PI used derived flomtronifromfroni groth studies field dataandd it i ind SF distributions 0 literature based upon CPI for shnilarsheilarannilsnnil ir cited insects used whenotinaliersoircesi soiiicc s werewe re not availableiv liltil iakibks sliicddcihreahre iderlder gc gathering collector tcfc filteringfilteingtilteiin collectcollector oi g grazery ieiscnpergrazerscraperscraper p predator 11II herbivore D detritivoredetntivore CC carnivoreslSF production calculatedc ilciil it d by the sizesicsieslyesiye frequency methodIPPB13 productionpi duction calculatedc ilcul itceitcd by anassurnedin assumedissumed PBpli ratioi itloassumed cohort PB ofof3ofa5

lassfAssfassumedassumedumed annualannuinnu 1 PB1313 isis thetiletike sames im asis derived by SF forto this taxont ixon inin one of the other study streamsstre ims

and environmental stress CPIs of chironom-idae

TRICHOtrichopteraFTERA we isolated several cheumatoin SS were estimated as they were in DC psyche sp larvae in growth chambers in RS to

we used graysgrays 1981 estimate of a 1 yr CPI estimate larval development time these dataand univoltinismvoltinismuni for tabanidae and tipulidae indicated a bivoltine life cycle and a CPI of 6dixidaedididae and empididae reached maximum mo because of low densities field data gave nosizes similar to many of the midges and a CPI indication of the CPIs of limnephilus sp orof 25 d was assumed parapsycheParapsyche sp

rattlesnake springs coleoptera field data provided littleindication of the cplsCPIscals of beetles because of low

ephemeroptera we isolated several numbersbaetisbabtis sp larvae in growth chambers in RS to diptera several simulium sp larvae wereestimate larval development time these data

isolated in growth chambers in RS to estimateand field data indicated a CPI of 60 dlarval development time As in SS we usedtricorythodes sp were not present in sufficient

1981 estimate of 1 CPI and unigraysgraycrays a yrnumbers for an SF production estimatevoltinism for tabanidae and dixidaedididaeODONATA field data for argia tibialis indi-

cated

tipulidaeand empididae grew to maximum sizes similara CPI of I11 yrto many of the midges and CPIs of 25 d wereassumed


tableTABLFgaille 6 annual production P mg DW m 2yryri 1 and percent production of insect functional groups inin douglas creek

snively springs and rattlesnake springs july 1985 to june 1986

douglasdouglidoughi is creek snively springs rattlesnakeRattlesnake springsfunctional

group P P P

grazerscraperGrazer scraper 2651 114 0 00 0 00collector

gatherer 15282 658 9332 659 3621 222filterer 4198 181 3177 225 11800 721total 19480 839 1250912 509 884 15421 943

shredder 639 28 1316 93 166 10predator 449 19 329 23 769 47

grandrotalGRAND roTALloial 23219 1000 14154 1000 16356 1000

tableTABLFtaille 7 annual production P mg dwmcwmDW m2

yryri 1 and percent production of insect trophic levels in douglas creeksnively springs and rattlesnake springs july 1985 to june 1986

douglasis creek snively springs rattlesnakeRatt lesna ke springstrophic

level P P P

herbivore 2812 121 220 16 41 03detntivoredetritivore 19967 860 13605 961 15546 950

carnivore 440 19 329 23 769 47TOIALTOTAL 23219 1000 14154 1000 16356 1000

functional group production discussionproduction by collectors was greatest ofall func-

tionalinterstream comparisons

groups inin all study streams collector2 artprtpro-

duction was highest in DC 195 gm yr I1 DC was clearly the most productive of theaccounting for 83983.983983 9 of the total annual produc-tion

three streams studied table 6 and this is prob-ablyof insects in SS and RS collector production related to the variety of substratum table

was 12512.512512 5 ggandand 15415.415415 4 g representing 88488.488488 4 and 94394.394394 3 2 and resulting increase in microhabitatmicrohabitat diver-sityof the total annual production respectively the minshall 1984 thoroughly reviewed the

annual production of all functional groups inin each importance of substratum heterogeneity and itsstudy stream is shown inin table 6 influence on insect abundance and distribution

SS and RS were similar in size and had similartrophic level production

total productivity estimates table 6 althoughherbivoresHerbivores and detritivoresdetntivores are both second-

aryimportant differences existed among the biotic

producers at the same trophic level carniearnicarniearni componentsvores are tertiary producers for this discussion in terms of functional group productivity col-

lectorswe address them separately detritivoredetntivore pro-duction

dominated in each of the streams gath-ererswas greatest of all trophic levels inin each were more important in DC and SS and

study stream in2DC

Adetntivoredetritivore production was filterersfilterers in RS the greater filterergathererfilterer gatherer

about 20020.020020 0 gmg m yr accounting for 86086.086086 0 of ratio in RS is probably related to the shiftingthe total annual insect production in SS and RS nature of the sandy substratum table 2 anddetntivoredetritivore production was 13613.613613 6 g and 15515.515iss 5 g resulting absence of areas for detritus to collectrepresenting 96196.196 1 and 95095.095095 0 of the total annual and be harvested the filtering simuliidsinsect production herbivoresHerbivores contributed occurred on the abundant watercress plants12112.112112 1 of the productivity inin DC but no other the scarcity of solid substratum for periphytonperiphytontrophic level inin any of the three streams was an development in RS also explains the absence ofimportant contributor to secondary production grazersglazers in this stream however substratumthe annual production of all trophic levels inin composition does not explain a lack of grazersglazers ineach stream isis given inin table 7 SS where solid substratum is present table 2


2

in SS the dense riparian canopy almost com-pletely

tablesTABLFStaille8 comparative annual production mg DW m yr1 of taxatha common to douglas creek snively springs andshaded and obscured the stream this rattlesnake springs july 1985 to june 1986

probably prevented the development of a sub-stantial peripenperlperiphyticpenphyticphytic food base for grazersglazers in DC douglas snively rattlesnakewhich had both solid substratum and unshaded taxon creek springs springs

stream bottom a significant grazer communitytable 6 ephemeropterawas present babtisbaetis sp 8317 7012 2542

comparing the productivity of taxa common odonatato all three streams shows some differences that argia tibialis 44 139 372are difficult to explain table 8 for example trichopterasimulium sp production was similar inin DC and cheumatopsychecheiimatopsyche sp 818 1298 486

SS but was an order of magnitude greater inm RS dipterathis may indicate a richer source of suspended simulium sp 1680 1879 11175

chironomus 4920 1386 489food inin RS however comparative measure-ments

sppolypedilumPolyped ilum sp 161 220 41

of this resource were not made cushing tabanidae 130 53 80and wolf 1982 report a value of 1513 tipulidae 411 1096 10

kcalkealmkeaimkealkeaikcalnyrm 2 yr1 I1 of suspended POM inin RS butcomparable data are not available for DC andSS this value isis much less than that reported severely limit the potential productivity of RSby minshall 1978 for deep creek a small cold

it is notable that the dominant secondary pro-ducersdesert stream in southeastern idaho since

in RS the black flies thatin are organismssimulium sp production far exceeded that ofare found in abundance soon after discharge

any other insect inm RS table 5 competitive diminishes cushinggushing and gaines 1989exclusion hemphill and cooper 1983 maymake it more successful inin competing for the intrastreamIntrastream comparisonslimited attachment sites cheumatopsyche sp

DOUGLAS CREEK inand Paraparapsycheparapsichepsyche sp two filtering tnchopterathchoptera insecondary production

wider offunctionalDC was spread over a varietyRS had a combined production of 620 mg astable 6 and levels table 7groups trophiccompared with simulium production ofsp

even though it was dominated by detritus feed11000 mg this is a 20 fold difference foring collector gatherers chironomus sp and

organisms of the same functional group exceptbaetisbabtis sp were the dominant secondary produc-ers

for simulium sp dipteran production was high-est inin DC for chironomus sp and tabanidae in the stream

while of ilum and SNIVELY SPRINGS in SS about 50 of theSSinin production polypedilumPolyped spsecondary production was due to babtisbaetis sp atipulidae was highest tipulidae production

increased by an order of magnitude from RS to detritus feeding collector gatherer and as

DC to SS this may be related to the relatively mentioned above the grazing component was

high amounts of particulate organic matter absent total dipteran production was of thePOM found inin the study section of SS cush-

ing

same order of magnitude as that for baetisbabtis sp

1988 production of babtisbaetis sp isis three to but was spread out among several organismsfour times lower inin RS than in the other two notably simulium sp chironomus sp and

streams table 8 tipulidae table 4

A likely explanation for some of the differ-ences

rattlesnake SPRINGS secondary pro-ductionshown in table 8 isis the winter spates that in RS was less diverse than in the other

occur inin RS but not inm SS or DC these spates study streams with over 68 of the productiondescribed by cushing and gainesgamescaines 1989 scour due to the filtering detritivore simulium sp thethe entire streambedstream bed flushing out accumulated second highest producer was babtisbaetis sp butPOM and much of the fauna they occur about production was far lower than the black fliesevery three years and act as a reset mecha-nism

table 5 the high production of simuliids inbecause they occur in winter when there RS can be attributed to the presence of multiple

are no ovipositingpositingovi adults and because they cohorts with short development times grayscour and eliminate sources for both upstream 1981 suggested that rapid development maymigration and downstream drift they must be advantageous in streams subject to spates


TABLF 9 comparative whole stream secondary production of insects P g DW m2

yryri 1 except as indicated in five

geogeochmaticgeoclimaticclimatic regions streamsstrsti earmsearns grouped by geographical region not by temperature regimes

stream P S fc gc gascgrsc pred source

coldmesicCold mesicunnamed quebec 58b58 haihatharperper 1978

factory br maine 122 neves 1979sandsandrR albertaalbelta 08108 soluk 1985caribou R minnesota 354 083 062 136 0.140140140 14 0590 59 krueger and waters 1983blackhoofblackhoopBlackhoof R minnesota 7137 13 100 3533 53 1151 15 0370.370370 37 1081.081 08 krueger and waters 1983no branch cicr minnesota 1323 073 533 943 100loo1 00 2072 07 krueger and waters 1983

fort R massachusetts 33 fisher 1977

bear br massachusetts 48 fisher and likens 1973

lance du nord france 12512 5 total detnnvoiedetrifivore P P pred 20 maslinmaskin and pattee 1981bisballe baekback denmark 267 13 mortensen and simonsen 1983

HumidhumidrnesichumidmesicmesicmeslemesiesatillabatillaSatillaRR georgia

11

252 29 180 43 benkebenkeetaletetalal 1984snag substrate e 648 493 81 75sandy substrate 6 210 0 179 31mud substrate 6 179 02 86 92

cedar R so carolina 30 01 10 13 002 06 smock etetalal 1985lower shope fk no carolina 14 georgian and wallace 1983upper ball cr no carolina huryn and wallace 1987

bedrock outcrop 61 06 21 21 06 07riffle 56 14 03 18 10 11pool 76 24 003 30 03 19

hot desertsycamore cr arizona 1209 jackson and fisher 1986

new zealandhinau R 382 hopkins 1976horokiwiHorokiwi R 415 hopkins 1976

cold desertdeep cr sta 1 idaho 12 minshallmmshalletalet al 1973douglas cicr washington 232 06 42 153 27 04 this studysnively sprcpr washington 142 13 32 93 0 03 this studyrattlesnake sprcpr washington 164 02 36 118 0 08 this study

S shredder ftfe filtering collector gcc gatheringithcnn collector gascgrscC iselseISL gragi teseibesciiescir aperipeiepel predpieeplee predatorspredpied itoiitol1 emerqnsfmeieis onlyonly two species otof chiehlehiclmonomidsronornidsexpressed per unit arean e off totthstreinntot 1 stre nn bottomFxpressedexpressed per unit areaue i ofliabitatof h abitibit it

comparisons with other streams total insect production rates inm this study

annual PB ratios ranged from 3.63636 to 121.71217 for ranged from 14 to 23 g dwmcwm 2yr

I1 and arewith values for otherinsects from the study streams the high annual compared streams

PB ratios are attributed to insects with rapid grouped by geographical region table 9 pro-ductioncohorts rates inin cold desert streams are welldevelopment and multiple eg many

chironomidae the annual PB ratios found in below the higher values found inin new zealand

these cold desert spring streams are generally streams the richer areas snags ofhumidmesicofhumidmesichumid mesic

lower than those reported by jackson and fisher streams inm the southeastern united states and

1986 for sonoran desert stream insects and by sonoran hot desert streams however produc-tionbenke et al 1984 for southeastern blackwater rates in cold desert streams are higher than

stream insects the sonoran and blackwater those inin streams inm coldmesiccold mesic areas of thestreams are warmer and insect development is united states these rankings relate to thefaster resulting in a greater number of cohorts interaction among stream water temperatureour annual PB ratios were generally higher insect development cohort production inter-

valsthan reported for northern temperate streams and other factors however it should bekrueger and waters 1983 where cooler kept inin mind that other factors ege g geochem-

istrystreams result in insect development at slower maybe influential in governing productionrates with fewer cohorts as well as temperature production values inin


rattlesnake springs which has a sandy substra-tum

to stream communities in terms of productionare comparable to the sandy areas of the in many streams they contribute a large per-

centagesatillabatilla river inin georgia 164 vs 131 g of the total community productiondwmcwmDW m 2 yr

1respectively production of col because of their rapid development and high

lector gatherers was identical turnover rates we found high PB ratios forbenke et al 1984 stated that measurement simuliids and chironomids but other investiga-

torsof secondary productivity of benthic organisms have reported similar results fisher andprovides a truer indication of their importance gray 1983 benke et al 1984 stites and benkeinin lotic ecosystems than does measurement of 1989 this life history strategy is particularlyeither density or biomass this isis intuitively advantageous for insects inhabiting the streamsreasonable since measurement of P a rate that are subjected to severe spatesincludes consideration of both biomass and den-sity

detritus is the major food resource in theseour results support the validity of benke et small streams collector gatherers predominate

al s 1984 contention clearly our data reveal where there is more substratum diversity DCthat collectors are the dominant functional and SS and filterersfilterers in systems more prone togroup and detntivoresdetritivores the dominant trophic the effects of spates RS grazerscrapersGrazer scrapers arelevel inin terms of the secondary productivity of present whenever suitable substratum and suf-

ficientinsects inin these three streams tabietablestables 6 and 7 sunlight are available for development ofif only biomass or density data are evaluated a periphytonperiphyton crop shredders surprisingly arefrom these streams tables 3 4 and 5 gamesgaines not well represented in these small headwateretetalal 1989 anomalies become evident density streams this may be related to the flushing ofdata inin DC reveal that herbivoresherbivores are equally as the systems by the spates andor the lownumerous as detntivoresdetritivores but biomass data amounts of allochthonous detritus reaching thereveal that detntivoresdetritivores are about two times streams cushinggushingcushing 1988 secondary productiv-

itygreatergreatel than herbivoresherb ivores conversely when the of these cold desert spring streams was lessinsects are separated into functional groups the than that ofstreams in hot deserts but generallybiomass ofgrazerscrapersof grazerscrapei s herbivoresherb ivores exceeds higher than that in most coldmesiccold mesic andthat of collectors inin DC by a factor of two humidmesichumid mesic streams finally our resultsfurther collector filterers inin DC represent underscore the contentions of benke et al 198418 of the production and 30 of the biomass that measuring the secondary production ofbut only 7 of the density in SS trophic level insects in streams provides a better assessment ofcomparisonscomp ansons reveal that detntivoresdetritivores dominate their role than density or biomass but the anom-

aliesproduction biomass and density but if func-tional

described above argue for care in applyinggroups are compared biomass data would this generalization to all streams

overemphasize the importance of shredders30 which form only 5 of the density and acknowledgments

9 oftotalof total production in RS the largest anom-aly appears when comparingcompan ng functional groups this paper represents a portion of the thesisalthough collector filterers represent 72 of submitted bybywlgWLG to central washington uni-

versitythe total production and 61 of the biomass for the MS degree the research wastheir density isis similar to the collector gatherers performed at pacific northwest laboratory

in conclusion we have found that taxa with short during a northwest college and universitydevelopment times and multiple cohorts such as association for science NORCUS fellowshipmidges and black flies are important to cold university of washington to WLG it wasdesert spring stream production previous studies funded under contract DE amog 76have addressed the difficulties inin obtaining accu-rate

rl02225 and was supported by the USfield estimates of simuliidae black fly and department of energy DOE under contract

chironomidae midge larvae CPIs and thus pro-duction

DE ac06 76rlo 1830 between DOE andestimates benke et al 1984 behmerbehmerandBehmerandand battelle memorial institute

hawkins 1986 stites and benke 1989 their we would like to thank dr william coffmansmall size rapid turnover rate high density and for identifying the chironomids and dr patdiversity inakemake accurate species specific CPI esti-mates

schefter for identifying the caddisfliescaddisflies thedifficult these same characteristics how-

evermanuscript was improved by comments from

make midges and black flies very important three anonymous reviewers our thanks to them


literature CITED GEORGIANGFORGIAN Ttdndjand J B WALLACEWALLACFwallage 1983 seasonalSeasoncil produc-tion dynamics in ela guild of periphytonpenphyton grazing insects

ANDERSONANDFRSON R 0 1959 A modified flotation technique for in a southern appalachian stream ecology 64 1236

sorting bottom fauna samples limnology and ocean-ography

1248

4 223 225 GRAY L J 1981 species composition and life histories ofBARTON D R 1980 observations on the lifefifeilfeiloehife histories and aquatic insects inin a lowland sonoran desert stream

biology of ephemeroptera and plecoptera inin north-eastern

american midland naturalist 106 229 242alberta aquatic insects 2 97 111 HAMILTON A L 1969 on estimating annual production

BECKERBECKFK C D 1973 development of simulium mttatumvittatumuitvitdittatum limnology and oceanography 14 771 782zett diptera simuliidae from larvae to adults at HARPERHARPFR PPPP 1973 emergence reproduction and growththermal increments from 17017 0 to 27027 0 C american of setipalpian plecoptera inin southern ontario oikosbikosmidland naturalist 89 246 251 24 94 107

bellmerBFIIMFR D J andandcanacC P HAWKINS 1986 effects of over-head

1978 variations in the production of emergingcanopy on maeromacromacromvertebratemacroinvertebrateinvertebrate production in a insects from a quebec stream verhandlungen der

utah stream freshwater biology 16 287287300300 Internationintemationaleninternationalenalenaien vereimgunvereinigun furfuir limnologielimnologicLimnologie 20 1317BFNKF A C 1979 A modification of the hynes method for 1323

estimating secondary production with particular signif-icance

HEMPIIILLHEMPHILL N and S D COOOPFR 1983 the effect offor multivoltine populations limnology and physical disturbance on the relative abundances of two

oceanography 24 168 171 filter feeding insects in a small stream Occooecologiaoccologialogia 58benkeBFNKFBENKF A Ccandacandjand J B WAIDF 1977 in defense of average 378 382

cohorts freshwater biology 7 61 63 HOPKINS C L 1976 estimate of biological production inBENKEBFNKE A C and J B WALLACE 1980 trophic basis some stream invertebrates new zealand journal of

production among net spinning caddisfliescaddis flies inin a south-ern

marine and freshwater research 10 629 640appalachian stream ecology 61 108 118 HURYN A D andjandaand B WALLACE 1987 local geomorphol-

ogyBFNKF A C T C VAN ARSDALL and D M GILLESPIEGILLESPIF as a determinant of macrofaunalmacrofaunal production in a1984 invertebrate productivity inin a subtropical black-water

mountain stream ecology 68 1932 1942river importance of habitat and lifebreilfe history HYNES H B N 1980 A name change inin the secondary

ecological monographs 54 25 63 production business limnology and oceanographyCLIFFORD H F 1982 life cycles of mayfliesmayflies 25 778

ephemeroptera with special reference to voltinism HYNESHYNFS H B N and M J COLEMANCOLFMANcolewan 1968 A simplequaestiones entomologicaeEntomologicentomologicalae 18 15 90 method of assessing the annual production of stream

CUSHINGGUSHING C E 1988 allochthonous detritus toinput a benthos limnology and oceanography 13 569 573small cold desert spring stream verhandlungen der

JACKSON J Kkandsbandsand S G FISHERFISHFR 1986 secondary produc-tionInternationintemationaleninternationalenalenaien vereinigunveremigunVere migun fur limnologielimnologicLimnologie 23 1107 emergence and export of aquatic insects of a

1113 sonoran desert stream ecology 67 629 638CUSHINGGUSHING C E and W L GAINESGAINFS 1989 thoughts on KRUEGERKRUFGFRkrufger C C andandeE F COOK 1984 life cycles standing

recolonization ofofendorheicendorheicendorheic cold desert spring streams stocks and drift of some megaloptera ephemerop-tera

of the north Benthjournal american benthologicalological society and diptera from streams in minnesota USA8 277 287

aquatic insects 6 101 108CUSHINGGUSHING C E and E G WOLF 1982 organic energy

KRUEGERKRUFGER C Ccandtgandtbandtand T F WATERSWAIERSwalerswafers 1983 annual produc-tion

budget of rattlesnake springs washington american ofmacroinvertebratesofmacromvertebratesmaeromacroinvertebrates inin three streams ofdifferentmidland naturalist 107 404 407water quality ecology 64 840 8501984 primary production inin rattlesnake springs

MACKAY R J 1969 aquatic insect communities of a smalla cold desert spring stream hydrobiologia 114 229236 stream on mont st hilaire quebec journal of the

fisheries research board of canada 26 1157 1183CUSHINGGUSHING C EECC D MCINTIRE J R SEDELL K WMACKEY A P 1977 growth and of larvalCUMMINS G W MINSHALL R C PETERSEN andandrR development

chironomidae oikosbikos 28 270 275L VANNOTE 1980 comparative study of physicalMASLINMAS L and E PATTFE 1981 la duLI N JLJ productionchemical variables of streams using multivariate analy-

sis Ppeuplementeuplementexplementeuplement benthiquebenth ique d une petite rivierenviereniviere son evalu-ation

archevarchiv fur hydrobiologie 89 343343352352FISHERFISHFR S G 1977 organic matter processing by a stream par la methode de hynes coleman et hamilton

segment ecosystem fort river massachusetts USA archevarchiv furfir hydrobiologie 92 321 345

internationaleInternationinternationalsale revue gesamten hydrobiologie 62 MCAULIFFEMCAULIFFF J R 1982 behavior and life history of

701 727 Leucoleucotrichialeucotnchiatrichia pictipespictipes banks trichoptera hydroptilhydroptic

FISHER S G andandlL G GRAY 1983 secondary production idae with special emphasis on case reoccupancy cana-dianand organic matter processing by collector macro journal of zoology 60 1557 1561

invertebrates in a desert stream ecology 64 1217 mcculloughMCCULLOUmccullouchOII D A G W MINSIIALLMINSHALL and C E CUSH-

ING1224 1979 bioenergeticsenergeticsBioblobioenergeticsofastreamof a stream collector organ-ismFISHERFISHFR S Ggandggandaand G E LIKENS 1973 energyflowinenergy olowflow in bear tricorythodes minutesminutus insecta ephemeroptera

brook new hampshire an integrative approachappiappl oach to limnology and oceanography 24 45 58

stream ecosystem metabolism ecological monographs MERRITTMFRRITT R W and K W CUMMINS EDSFDS 1984 an intro-duction4342143 421139421 439139 to the aquatic insects of north america 2ndand

GAINES W L C E CUSHINGGUSHING and S D SMITH 1989 ed kendallhuntKendall Hunt publishing company dubuquetrophic relations and functional group composition of iowabenthic insects in three cold desert streams south-western

MINSHALL G W 1978 autotrophy in stream ecosystemsnaturalist 34 478 482 bioscience28bioscience28 767 771


1984 aquatic insect substratum relationships SOLUK D A 1985 macroinvertebrateMacroinvertebrate abundance and pro-ductionpages 358358400400 in V 11II resh and D M rosenberg of psammophilous chironomidae inin shifting

eds the ecology of aquatic insects praeger publish-ers

sand areas of a lowland rivernver canadian journal ofnew yorkyolk fisheries and aquatic sciences 42 1296 1302

MINSMINSIIAIH alialli GWG WDDAA ANDANUIWSREWS F L ROSErosirovibovi D W SIIAVV strressrilfssarres D Llandaand A C BFNKF 1989 rapid growth ratesand 11 L niiwfllnl wr LI 1973 validationvahdationvabVah dation studies at deep of chironomids inin three habitats of a subtropical black-

watercreek curlew valvaivalleyvaileyley idaho state university research river and their implications for PBP B ratios lim-nologymemorandum no 734873 48 and oceanography 34 1278 1289

MORTENSENMOKIINSIN E and J L SIMONSSIMONSFNsimonsenrN 1983 production WmwalersWAIFRSeilsellsriis TFTE 1977 secondary production inin inland watersestimates of the benthic invertebrate community inin a advances inin ecological research 10 91 164small danish stream iiydrobiologiahydrobiologia 102155102 155 162 warelisWAIFKSwalens T Ffandland J C hokenstrom 1980 annual pro-

ductionnewsniwsnl vi s 11 J 1979 secondarySecon daiydaly production of epihthic fauna and drift of the stream amphipod cambaruscammarusgammarusCamgammanusmarusinin a woodland stream american midland naturalist pseudolimnaeuspseudohmnaeus inin valley creek minnesota limnol-

ogy102209102 209 224 and oceanography 25 700 710molloioiiorolloi J J B WALLACE and J D HAITNIRHAEFNER 1984

pi productioneduction of a stream shredder peltoperlaPeltoperla nananwnanezria received I11 june 1991plecoptera peltoperlidaepeltopeiPeltoperlidaepeipel lidaelidah inin disturbed and undis revised I11 december 1991

turbedtuibed hardwood catchmentscatchments freshwater biology 14

13 21accepted 10 january 1992

SMOCKswoSMO K LAL AEE giianskyandlCIIINSKY anddanad lstoneburnerL SIONIgloni burnek 1985Macromaciomveitebratemacroinvertebrateinvertebrate productionpioploduction in a southeasternunited states blackwater stieamstrearnstiehm ecology 66 14911503


EFFECT OF REARING METHOD ON CHUKAR SURVIVAL

bartel T slaughslaughlslaught jerranjerrcinferran T flinders 2jay A roberson 3 and N paul johnston4

ABSIRACABSTRACT 1 survival of adult chukar imprinted game farm siblmghumansiblinghuman imprinted and wild chukarschudars was comparedinin three releasesleasesle two sites combined results indicate similar P 05 survival for adult impnntedhuprinted and wild chudarschukarschukars butlower rates P 05 for game farm chudarschukars with early behavioral conditioning some potential exists for using captivereared chukarschudars to establish new populations

key wordswordworas chukar chtikarcliukar rearing partridge imprinting behavior propagation survival

captive reared game birds released in the temsternsterms and chukar habitat was mimicked by cov-eringwild generally have poor survival csermely et the floor with gravel small shrubs grass

al 1983 krauss et al 1987 A probable reason and rocksis behavioral deficiency hessler et al 1970 chicks were removed from the incubatorroseberry et al 1987 hess 1973 reported within 5 h after hatching and transferred to thethat imprinting is indispensable for survival of brooding facility without allowing exposure toan animal under natural conditions thaler humans six adult chudarschukars were released so that1986 and dowell 1989 observed improved the chicks could visually imprint on them

predator avoidance behavior of properlyproperty when four weeks old the chicks were allowedimprinted game birds postnatal visual imprint-ing

to access a 5.65656sg5 6 x 22922.922922299 9 x 2 m outdoor pen theas well as embryonic auditory imprinting outdoor pen was visually isolated because of its

bailey and ralph 1975 appearappeartoappeartoto be important solid walls and the netting covered top coverour objective was to evaluate survival of cap was provided by grass small shrubs and twotive reared adult chukar imprintedimprintedvsvs conven-tional

deciduous treesgame farm reared and wild chudarschukars A hawk model was passed ropepulleyrope pulley

alectoris chukar system over the pen and a dog introduced twiceweekly so chicks could associate adults alarm

METHODS AND STUDY AREAS calls with predator presencegame farm chukarschudarsadult imprinted chukarschudars

chukarschudars beneticuenetic stock the adultsame geneticgenetie aschukar eggs were exposed during the final bbirds raised at the utah divi-

sionimpnntedimprinted wereweek of incubation to recorded adult chukarsionslon of wildlife resources DWR game farmvocalizations the recordings from the cornell

ville utah under conventional meth-odsin Springspringvillespnngvillelaboratory of ornithology library of natural

broodedbloodedbrooded inin box type broodersbroadersbrooders fed andsounds appeared to fit the description of thewatered with human contact11rally call described by stokes iggi19611961 recorded siblinghumansibhnghuman

and moved into atlittit fourimprintedimpnnted flight pensvocalizations of incubating or brooding hen chuweeks of agekars were not available

the brooding facility was a 6.16161gi X 15.2152152 X 2.12121 m wild chukarschudarsroom at the brigham young university BYU

wild chukarschudars thewere trapped inin dugwaypoultry research unit provo utah feed andand thomas ranges utah 3 5 august 1989water were provided through automatic sys

depaheritofbotanydepartment ot botany andami range seenscience Brigbrighainbngliimhaiohainhalo young universityuniveisity provoprove utah 846022anthortautlioi to whomho corcoieor i elpondenceespordnehon1dslionlcl lehe addredaddreaddi essedd3 utahtah division of wildlife Heresouiceshesourcesresourcessources 1596 west north 1 empleteinpleempie salt lake city utah 84116ml 164departrnentdepartment of animalofanfinal science Brigbrighainbnghainhain young university provo utah 84602

25


release site I1 RESULTS

antelope island located in the great salt release I1lake in davis county utah varies in elevationfrom 1282 inm to 2010 in in size it is 24 X 8 km all adult imprinted and game farm chudarschukarsand covers 10409 ha rocky slopes and grass-land

both radio and patagial tagged died withinare the dominant ecological types average three weeks of release fig 1 with no differ-

encesyearly high and low temperatures are 38.9389389 and between groups P 0505.05 wild birds12212.2122 C respectively jones 1985 antelope decreased in number shortly thereafter but

island had self perpetuating and self sustaining experienced higher survival rates P 05.0505 thanchukar populations until the severe winter of captive reared groups coyote predation was

1983 84 after which no chukarschudarschukarswerewere observed the principal cause of mortalityon 8 august 1989 release 1I 80 chukarschudars from release 11II

each group were released 13 of which wereequipped with backpack mount radio transmit-ters

there were no significant FP 05.0505 differ-encesslaugh et al 1989 1990 on 2 may 1990 fig 1

release III111 65 adult imprinted 65 game farm release III111iliand 4vild4 wild chukarschudars were released 9 chukarschudars ineach captive reared group and all 4 of the wild mortality was similar P 05os.0505 for the adult

imprinted and wild groups but higher P 05.0505group were fitted with radio transmittersfor game farm chukarschudars fig 1radios were attached to every fifth bird cap-

tured from the captive reared groups to reduce all releasesbias from ease of capture all birds were fitted

combined data for releases 1I 11II and III111ili indi-cate

with patagial tags and legbandslegbandtlegbands captive rearedsimilar P 05.0505 survival for wild and adultchudarschukars were 14 weeks old in release I1 and 22

weeks old in release III111lil wild chudarschukars in all imprinted groups both having higher P 05.0505values than farm birds fig 1gamereleases were trapped 3 5 august 1989

eighteen coyotes canis latranslatranolatrans were discussionremoved from site I1 preceding the 1990 releasemortality data were recorded daily during the during release 1I wild birds moved quickly tofirst weeks then thereaftertwo weekly high rocky areas whereas captive reared birds

release site 11II remained at lower elevations and sought cover inthe sparse vegetation where they suffered high

the second study site was the sterling mortality immediately following demise of caphollowwindHollow Wind rock ridge area of spanish fork killedtive reared birds wild birds began to becanyon this area ranges in elevation from adult imprinted and wild birds demonstrated1470 in to 3057 in and the dominant ecological the greatest fear response to human presencetype is mountain brush annual precipitation whereas game farm birds tolerated approachaverages between 38.8388388 cm and 52 cm average these findings correspond with those ofyearly high and low temperatures are 40 C and csermely et al 1983 who found that red

30 C respectively legged partridges alectoris rufa displayedon 25 september 1989 release 11II 11 birds greater fear response toward humans when iso-

latedfrom each group were radio marked and from them during imprinting the flightreleased at site 11II captive reared groups were ier behavior of the adult imprinted chudarschukars21 weeks old mortality was recorded daily for would likely provide more hunting sport thantwo weeks then weekly thereafter game farm birds but did not offer sufficient

statistical analysissurvival advantage under the existing predatorpressure

data were analyzed using a product limit adult imprinted birds apparently had akaplan meier estimator a log rank test was behavioral advantage over the game farm birds

used to compare survival curves pollock et al that was not expressed in release I1 but was1989 only radio marked birds were compared demonstrated at release 11II apparently due tosince their observation was not biased by ease of lower predator pressure wild chukar mortalityapproach and proximity to release site was similar for releases I1 and 11II

199211992 CHUKAR REARING 27

RELEASE 1 RELEASE II11

m adustaduft impdnted1.010loio

0 game farm

0.80808 wild

0.60606og

A A A A

0.40404

cf 0.20202

0

RELEASE III111illlil ALL RELEASES

1.010iolo A A A A

0.80808

0.60606og

3 0.40404 zcf 02-

0

02

2 4 6 8 10 12 14 2 4 6 8 10 12 14

week week

fig 1 chukar survival probability curves 1 release I1 antelope island 8 august 15 november 1989 no differenceP 050 5 between game farm and adult imprinted chukarschudars but both groups are lower than wild chukarschudarschukars 2 release 11IIspanish fork canyon 5 september 12 december 1989 no differences P 05 between groups 3 release III111iliantelope island 2 may 8 august 1989 no differences P 05 between adult imprinted and wild but both groups are

higher than game farm chudarschukars 4 all releases no differences P 05 between adult imprinted and wild but lower forgame farm chukarschudars

results from release 111IIIlii indicated that sur-vival

acknowledgmentson antelope island for all groups was

greater than in the previous year especially for we express appreciation to the utah divisionthe adult imprinted group the improvement of wildlife resources for project funding also

was attributed to predator removal which may to M A larsson and J fillpot utah divisionbe beneficial even in establishing transplanted of parks and recreation antelope island statewild birds in good habitat season of the year park and BYU and DWR personnel whomay have affected survival as alternative prey assisted with the project and to G C pixtonabundance and predator location on the island BYU statistics department for statisticalmay have varied jonkel 1954 however assistanceobserved little difference in chukar survivalrelated to season of release literature CITED

combined data from all releases suggest thatcaptive reared chukarschudars can be used to establish baileyBAILFYballey E D and K M RALPILRALPH 1975 the effects of

embryonic exposure to pheasant vocalizations in laterwild if behavioralpopulations given proper early call identification by chicks canadian journal of zool-ogyconditioning this study however does not pro-

vide53 1028 1038

information on reproductive success


csermelyCSEHMELYasicsi HMIIY DDD1 mainard1andMAINARDI and S SPANOsianoslano 1983 escape POLLOCK K HHSS R winterstein C M BUNCK andreaction of captive young red legged partridges P D CUcurnsGURUSHTIS 1989 survival analysis inin telemetry stud-

iesalectorisAlectin rufanufani reared with or without visual contact the staggered entry design journal of wildlifewith man applied animal ethology 11 177 182 management 53 7 15

dowDOWJ11. 11 LL S 1989 rearing and predation the game con-servancy

roseberryROSFBFRRYROSEBERHY J LLDD L ELLSWORTH andwandwdandedanawD KLIMSTRAKLIMSIRA

oerservaneyvancy annual review 20 85 88 1987 comparative post release behavior and survival

iifssiirssbirss E 11II 1973 imprinting early experience and the of wild semiwildsemi wild and game farm bobwhites wildlife

developmental psychobiology of attachment van society bulletin 15 449 455

york SLAUCII B TTJJ T FLINDERS J A rooRomromersonROBFRSONromrsonRSON andandnananN PnostrandNosti and reinholdreinhoid company new 472 ppaplifIIFiirssilkssliasli ii E J R TESTEtisler ii D B SINIFF and M M JOHNSTONJOHNS 1 ON 1990 effect of backpack radio transmitter

attachment chukar great basin naturalistNELSONnr 1 SON 1970 A biotelemetrytelemetrybio study of survival of on mating

5037950 379380380reared pheasants released inin selected habitatspenSLAUGIISLAUGH B T J T FLINDERSFLINDFHS J A ROBERSONROBFRSON M R

journal of wildlife management 34 267 274OLSON andandnananN P JOIINSIONJOHNSTON 1989 radio transmitter

JONESJONIJONEloni s C 1D 1985 A manual of the vascular flora of ante-lope

attachment for chukarschudars great basin naturalist 49island state park davis co utah unpublished 632 636

mastermasterss thesis brigham young university provoSTOKESSIOKFSsiokes A W 1961 voice and social behaviour of the

utah 101 ppap chukar partridge condor 63 111 127JOJONKIN K E L C M 1954 A comparative study of fall and spring TIIALFR E 1986 studies on the behavior of some

releireletreleasedreletsedsed chukar partridgespaitndges aiealectorisAlectorn graeca chukar phasianidae chicks at the alpenzooalperizooAlpenAlperi zoo innsbruckInnsbruck pro-ceedingsunpublished masters thesis montana state univer-

sityceececeeece of the iiidibidIII111lii international symposium on

boemanbozeman pheasants inin asia 1 12KRAUSSKHAUSS G DDIIdilH B gravesGRAVEL and S M ZFzervanosZFRVANOSRVANOS 1987

survival of wild and game farm cock pheasantsreleasedleasedle inin pennsylvania journal of wildlife manage-ment

received 12 june 199151 555 559 accepted 14 january 1992


DNA extraction FROM PRESERVED TROUT TISSUES

D K shiozawa I11J kudokudor1

R P evans 1S R woodwardwoodward2woodwards2 and R N williams 3

a13srtiacABSI racihacir we have adapted techniques developed for the extraction of DNA from formalin fixed paraffin imbeddedhuman tissues for use on preserved fish tissues DNA was successfully extracted and the d loop region of mitochondrialDNA was amplified with the polymerase chain reaction PCR the sequences of the amplified DNA from preserved andmodern samples were identical these techniques were also applied to fin tissue treated with a variety of preservativesextraction of DNA from ethyl alcohol and air dried fin tissues gave yields equivalent to those from frozen tissues extractionof DNA from preserved museum specimens of rare or extinct taxa could significantly increase the scope of systematic andphylogenetic studies similarly extraction of DNA from fin tissues provides a nonlethalnon lethal sampling strategy allowing

biochemical systematic analyses of rare or endangered taxa

key words DNA sequencing polymerasepolyi nerase chain reaction sequencing cutthroat trout oncorhynchus

As apartapart of our ongoing studies of the system-atics

preserved birds was significantly degradedof western salmonidssalmonids mainly cutthroat maximum size 200 base pairs while that from

trout oncorhynchus clarki we were inter the dried tissues contained fragments 9 20 kbested in extracting DNA from preserved fish in length but even if the DNA obtained withtissues museum collections contain many pre-served

these procedures was degraded the recentspecimens usually stored in alcohol but development of the polymerase chain reaction

originally fixed in formalin these could repre-sent

procedure PCPCRR saikisalilsaikietaletetalal 1985198519881988 mullisa significant reserve of information for sys et al 1986 mullis and faloona 1987 wong et

tematics research if the DNA could be al 1987 white et al 1989 provides a techniquesuccessfully extracted in addition many popu-lations

to amplify specific fragments of DNA as small

ofwestern trout are in such low numbers as 200 base pairs these amplified fragmentsthat collecting fish for systematic studies could can then be sequenced to decipher genetic rela-

tionshipsseriously jeopardize their survival for this tionships saiki et al 1985 wrischnik et al

1987 kocher et al 1989 thomas andreason we also wanted to evaluate the applica-bility of preserved tissue DNA extraction tech-niques

beckenbach 1989

to samples of fin tissue fin samplescould be takentak6ntakin rapidly in the field with minimal MATERIALS AND METHODS

stress to the fish these samples could then bepreserved for later DNA extraction archived specimens

medical researchers have developed tech cutthroat trout collected between 1926 andniqueshiques for the extraction of DNA from forma-lin

1982 and archived in the fish range at the montefixed paraffin imbeddedembedded tissues goetz et L bean life science museum brigham young

al 1985 debeau et al 1986 the DNA university were used to determine the useful-nessextracted from these tissues was of sufficient of the formalin extraction technique when

quality that restriction cutting and southern blot applied to museum specimens samples of liveranalysis were possible debeau et al 1986 muscle or gut were taken from specimens rep-

resentingDNA has also been successfully extracted from a range of preservation times tablebirds held in museum collections both dried 1 tissues were removed from the specimensand preserved in 70 ethyl alcohol houde and and placed in 20 volumes ofofte9oftelteg buffer soom500m500mm M

braun 1988 the DNA extracted from alcohol tris 20 mm EDTA 10 mm nacl ph 9.090go90 goetz

departidecartidepartmentt of oologyzoology bnghambjighambigham young university provo utiliutalibutali

depadepartmenttiienttrientof microbiology mighbngliamamigh young uiiiversityumveisity provo utah

3depadepartmentt nent otof biology boise state university boiseboistbolst idaho

29


TABLETABLtabi r 1 DNA yields from formalin fixed museum specimens of cutthroat trout oncorhynchus clarki DNA yields weredetermined using UV spectrometer absorbanceabsorb ance readings at 260 nm

sample total DNAtissue weight DNA yield

subspecies year location museum no type g algvugpugvlgg qmgjgmgjg mg tissue

0 c housienhouvienbouviatbouulatviatulet 1926 snake R ID BYU 26792 liver 013 775 05960 c utah 1927 utah L UT BYU 26755 liver 064 5675 08870 c utah 1940 utahutahlstahlL UT BYU 26756 liver 065 3100 04770 C utah 1982 deaf smith UT BYU 176896 muscle 024 1475 06150 c utah 1982 deaf smith UT BYU 176890 gut 042 9650 22980 c utah 1928 trout cr UT BYU 26858 liver 007 510 07280 c utah 1981 deepdeepcrdeepercr UT BYU 176793 muscle 011 575 0523

et al 1985 the buffer was changed twice over of phenol chloroform was added to each the24 hours tubes were inverted several times to mix and

then centrifuged in an SS 34 rotor at 10000 rpmfin tissues for 10 minutes the aqueous phase from each

fin tissues were taken from anesthetized sample was removed with an inverted glasshatchery rainbow trout oncorhynchus mykiss pipette and placed into clean 30 ml tubes andthat ranged in length from 15 to 25 cmem samples the procedure repeated A final extraction of thewere taken from all fins but were restricted to aqueous phase was made with one volume ofthe outer edges of the fins to more accurately chloroform and centrifuged as before therepresent the region that would be sampled in aqueous phase from each sample was trans-

ferredthe field approximately I11 cm2 of fin was to a new tube and I1.11 volume of 3 M

removed for each sample these were placed in sodium acetate solution added the mixtureslabeled 18 ml polyethylene tubes with gas were precipitated with one volume of 95

ketedfeted screw caps four samples were taken for etohcetoh and stored at 20 C overnight 12 hourseach of six treatments applied to the fins these minimum each sample was centrifuged at

were a 10 formalin b 40 isopropyl alco 10000 rpm for 10 minutes and the supernatanthol c storage in a standard freezer at 2020 c carefully poured off leaving a DNA pellet thed storage in an ultracoldultracold freezer set at 80 C pellets were washed with 70 ethyl alcohol ande 70 ethyl alcohol etohcetoh and f air drying centrifuged again for 10 minutes at 10000 rpm

the samples were held in the tubes for 45 days the alcohol was poured off and the samplesafter which the preservatives were decanted and allowed to air dry the pellets were resuspendedthe tissues soaked in teg for 24 hours with no in a 3 mm tris 0.20202og mm edtasolutionEDTA solution phchange in the buffer the frozen and air dried 7.27272 rnaseanase was added to a final concentrationsamples were not soaked in buffer prior to ofof20jlgml20 jimmijigmiextraction one sample stored at 20 C was lost

RESULTS AND discussionduring storage

extraction procedure archived specimens

tissue samples were minced with a clean muscle and liver tissues yielded comparablerazor blade to 2 mm or less in cross section and amounts of DNA and exceptionally high yieldsplaced in 15 ml centrifuge tubes with 10 ml of were obtained from the sample of gut tissueteg and 0.101oi01 g of SDS five mg of proteinase K table 1 because the gut tissue was washed inwas added to each sample and the tubes were buffer immediately after removal from the pre-

servedcapped and incubated in a shaking water bath specimen contamination from items infor 24 hours at 55 C an additional 5 mg of the alimentary canal should have been minimalproteinase K and 0.10101oi mg SDS were added to gut tissue was easily digested indicating a rel-

ativelyeach sample and the tubes returned to the shak-ing

rapid release of DNA dubeau et al

water bath for 50 hours at 55 C to remove 1986 and this could have been associated withresidual undigested tissue the samples were the high yields DNA samples 20 laijil1 from thetransferred to 30 ml tubes and an equal volume museum specimens were electrophoresedelectrophoresed on a

199211992 DNA FROM PRESERVED TROUT 31

A B1 2 3 4 5 6

fig 1 DNA electrophoreelectrophoresedsed on 1 agaroseadarose gels after being extracted fig IA from formalin preserved museumspecimens and followingpcrfollowing PCR amplification fig IB the dnafromDNA from the trout collected in 1926 liver is only faintly visiblelane 1 fig IA the DNA from 1927 liver 1940 liver 1982 muscle and 1982 gut are in lanes 2 5 respectively the

DNA in lane 6 was extracted from a contemporary frozen liver sample the PCR products are shown in figure IB lanes1 6 in figure IB correspond to the DNA templates shown in lanes 1 6 in figure IA

TABLE 2 A comparison of the nucleotide sequence 120 base pairs from the SDISD I1 region of the mitochondrial DNAd loop the DNA was amplified with the polymerase chain reaction the top row represents the base sequence fromfrozen tissue DNA and the lower row represents the sequence from a formalin preserved specimen the frozen tissuespecimen BYU 90621 is 0 c utah from mckinzie creek UT collected 817888 17 88 the preserved tissue specimen BYU

26755 is 0 c utah from utah L UT collected in 1927 both vouchers are archived in the fish range at the monte L

bean life science museum

frozen aaggctatcc ttaagaaacc agcccctgaa 30preserved aaggctatcc ttaagaaacc agcccctgaa

agccgaagta aagcatctgg ttaatggtgt 60agccgaagta aagcatctgg ttaatggtgtcaatcttatt gcccgttacc caccaagccg 90

caatcttatt gcccgttacc caccaagccgggcttctctt atatgactag ggcctctccc 120ggcttctctt atatgactag ggcctctccc

1 agaroseadarose gel containing ethidium bromide contemporary sequence data from cutthroatfig 1aaa to verify extraction the DNA samples trout table 2 the sequence data were identi-

calextracted from fresh and preserved tissue sam-ples

indicating thatwithin the amplified segmentwere used in a PCR reaction 25 pjLI total no base modifications had occurred in the for

volume using primers for the d loop region of malin preserved sampletrout mitochondrial DNA developed by K

fin clipsthomas university of california berkeleywith standard conditions perkinperlin elmer cetus we obtained DNA from all fin clips regardlessnorwalk connecticut cycle times and tem-peratures

of preservation method mean yields rangedperatures were I11 minute at 92 C I11 minute at 53 from a low of 0.40040040 pgmggmgJ gag of tissue from forma-

linC and 2 minutes at 72 C for 35 cycles PCR preserved fin clips to a high of 1.1041104 lomglgmgjlgmgproducts are shown in figure IB DNA extrac-tion

in air dried samples table 3 the treatmentcontrols containing no fish tissue did not effects were examined with analysis of variance

yield PCR products under identical conditions table 4 and a highly significant difference wasdata not shown subsamples of the PCR prod-

uctsfound between the treatments fishersfishers least

from preserved and fresh tissue samples significant difference multiple comparison pro-cedurewere sequenced fig 2 and compared with was applied to separate those treatment


fig 2 at left sequence gel from a portion of the mito-chondrial

1 B chondnalchondrialchondraliallai DNA d loop column A isis the sequence foiforroirol aYWut contemporary sample of trout DNA BYU 90621 and

A n column B isis the sequence from a preselpreservedved trout specimenBYU 26755 collected inin 1927 the sequence gel isis read

from the bottom up and the cohncolumnsnnsanns represent guanine Gadenine A thymine T and cytosine C respectively

4

Q0CLc 0 Q0 00s cn uj a

CZ

E o jo000 0 0C c 0r CZ

0 0 0

a0 0.25025 0.50050 0.75075 1.00100loo 1.25125125

0 mean DNA yieldwgW I1 mg

gcjg V

fig 3 multiple comparisons of the means of the sixsix fintissue treatments using fishersfishers least significant differencetest aalphaipha 001ooi0 01 lines connect means that do not differsignificantly from one another

TABLETABLF 3 DNA yields from fin tissue preserved with dif-ferent methods the fin clips approximatapproximalapproximatelyely 1 cm

2 eachwere taken frolfromn hatchery reared rrainbow troutoncorhynchus mykiss DNA yields were determined

using UV spectrometer absorbanceabsorbance readings at 260 nmninnln

preservation N mean standardmethod yield deviation

4gmggaggmg

formalin 4 0402 0157434040isopropylisopropyl 4 0569 019111

20 C 3 0644 01001680socC 4 0740 006295

7070etohetohcetoh 4 0822 007964airailall dried 4 11041 104 013443

groups that differed significantly from oneanother these comparisons fig 3 indicatethat the air dried treatment gave yields signifi-cantly higher than the other treatmentsbecause the weights used in calculating theDNA yields were the preextractionpreextraction values and

A not the pretreatment weights the initial weightspredryingpredrying of the air dried samples are not

knownnown however based on the initial size of thefifinn clips they are assumed to have been similarwhile air drying yields are much better than

1992 DNA FROM PRESERVED TROUT 33

TABLItaille 4 one way analysis of variance of the fin clip treatment effect on DNA yield

source degrees of slimsumsiimsilm of mean square F probpi oh Ffreedom squares

treatment 5 1 11451214512 0 02290222902 134713 47 0 000000000ooooerroren oi 17 028911 0 01700001700

total adaadj 22 143424

those resulting from other preservation meth-ods

literature CITEDthe lack of preservatives could allow

secondary contamination of samples through DEBEAUdeblaudebi AU L LEAA CIIANDLICHANDLER n J 11 groGRMcroaialonv0 P 11 niciiniccini nOLS and P A JONlonisJONISFS 1986 souSonsouthernthern blothotbiothiotmotnot analysis ofbacterial or fungal colonization and air drying DNA extracted fromflom foimahnf6rinalin fixed pathology speelprobably should not be used in collecting sam-

plesmens caneelcancelcancercaneer research 46 2964 2969

in humid areas or where adequate storstorageage goeGOMgoerzgoerycoerz S E S R HANihanlHAMILIONfUlON andandbanda13 vogelsteinvogelsthinVOGELSvo 1 cisnisnfeinTHINfelnIN 1985

is not possible the yields obtained from etethylhyl purification of DNA fromfroin folfoi maldehydeformaldehydemaldemaide hydebyde fixed and par-affin embedded human tissue biochemical and biobloalcohol preservation are equal to those fromphysical researchResealchseaich Ccommunicationsom munications 130 118 126

frozen tissues and superior to both isopropyl houdeHOUDFhoudy Ppandapandmand M J BRAUNBKAUN 1988 museum collectionscollectionsasasalcohol and formalin preservation of the pre a source of DNA foiforfol studies of avian phylogeny aukservativesservatives examined in this study ethyl alcohol 105773105 773 776

kocikockookocl urrurnherI1 eilell T D W K tituomasTHOMASIOMAslomas A byibylmi YI ii S V EDWAEDVVAKPSK DSwould to be the preservative of choice ininappear S PAABO F X villablancaVILIAvilla BIANCAblanca andaud A C WILSONwn SONmost field situations this eliminates the neces-sity

1989 dynamics of mitochondrial DNA evolution ininof carrying dry ice or liquid nitrogen into the animals amplification and sequencing with conservedconse ived

field to preserve tissues other preservative solu primers proceeding of the national academy ofseiofsciof seiscisel

tionseions should be considered for instance seutinbeutin ence 86 619662006196gigg 6200MULIMULmullmullislisilstisis K B audiaaudfaand F A FAIfalFALOONAOONA 1987 specific synthesis

white and boag 1991 reported successful DNA of DNA in vitro vlaviavlavia a polymerasepolymer ase catalyzercatalyedcatalyzed chain ireac-tionextraction from avian tissues preserved in a mix-

turemethods inin enzymology 155 335350

ofofedtaEDTA nacl and DMSO MULLIS K BBFF A faioonafaloonafalFAI OONA S SCHARFS IIAKI 11 SAIKISAWsalkisah GHORN and H A eiutciiem K ll11 1986 specific enzymaticenymaticamplification of DNA inui vitro the polyipolyinerasepolymeipolymernerasease chain

conclusions reactionactionle cold springs harborharbol symposium on quanti-tative biologybiologbialogy 51 262 273

the ability to extract amplify and sequence SAIKISAMsalki R KDK D 11 clGELANDLAND S STOFFE S J SSCHARFIIAKI RhiouHICUhiuctitHI G T HOKNHORN K 13 Mumumslitslilsitts and 11II ADNA from formalin preserved museum speci-

mensERLICHERLK II11 1988 primer directed enymaticenzyniaticonymaticenymatic amplifica-tionincreases the information value of museum of DNA with thermostable DNA polyipolymeiasepolyinerasepolymerasenerase sci-enceholdings in addition to being0 a record of morpho-

logical239 487 491

and meristic information the specimens SAIKI R K S schaiuschaguS iiaiu F FALOONA K 13 MULLISmullMULImuil is GHORN H A ERLICHEKLK ll11 and N aiinhein1ARNIII IM 1985 enzy-maticcan be used in biochemical studies because amplification of 13 globin genomic sequences

museum collections include type specimens rare and restriction site analysis ofofsicklesickle cell aneiniaantiniaanemia scispecies and representatives of now extinct forms ence 230 1350 1354

be SEUTINSHJIIN G B N WHITwill IF andandptandrtP T boagbeagBOA 1991 preserva-tion

many key phylogenetic relationships can reex-amined tionofavianofavianofalian blood and tissue samples for DNA analysissthe extraction techniques can be applied canadian journal of zoology 69 82 90to contemporary preserved tissues as well fin THOMAS W K and A T 13tckfn13ac11bro kl NBA ll11 1989 variation inintissues give adequate yields with this technique for salmomdsalmonidsalmond rnitochondrialmitochondnal DNA evolutionary constraintsconaticonsti aintsailtsboth restriction enzyme digestion and PCR ampli-fication

and mechanisms of substitution journal Molecularolmolecularofolevolution 29 233 245fi fin samples which can be taken nonlethconleth wllliewlllirwiinr TTJJ N ARNIIIIM and H A eiiiiciiERIerl 1 tl 1989 the

ally present opportunities to examine fish polymerase chain reactionleaction trends in genetics 5 185populations that would otherwise be inaccessi-ble

189

to tissue collection because of management WONG CCC C E dowlinDOVVLINC R K salkiSAIKISAM R G ifiuciiihi U tililltii 11IIA eiiticiierlERI ac1c ll11 and H H KAAIANKZAZIANkaalan 1987 characteriza-tion

considerations of B thalassaemiathalassa emiaemla mutations using direct genomicsequencing of amplified single copy DNA nature 330384 386


whisciinik L AARR G hiHIGUCHIucalucnl M STONFKING H A received 27june27 lunejunetune 1991ERLICHERUCII N ARNIIFIM and A C WILSON 1987 revised 10 february 1992length mutations inin human mitochondrial DNA accepted 20 february 1992direct sequencing of enzymatically amplified DNAnucleic acids research 15 529 542

great basin naturalist 521521 1992 ppap 35354040

RELATING SOIL CHEMISTRY AND PLANT relationships INWOODED DRAWS OF THE NORTHERN GREAT PLAINS

marguerite E voorhees I1 and daniel W uresk 2

ABSabstimr1 RACrao 1 soils of the green chokecherryashchokecherryash habitat type in northwestern south dakota were evaluated forfoifol 22

properties to determine whether any could be correlated with density of chokecherry primusPrunits virginianavirgimanavirginiajavirgivirgnianaimana and snowberrysnowherrysymphoricarpos occidentoccidentalisoccidentahsoccidentalistalis surface soils wereweiewele moderately fertile with high levels ofallcfallof allaliail elements except phosphorusphosphoiuslus

and nitrogen soils were fine textured with moderately high cation exchange capacity and saturation percentages howeversoils were nonsaline nonalkalinenon alkaline with low amounts of exchangeable sodium none of the soil properties showed good

correlation with chokecherry and snowberry densities greatest coicoleol relationscorrelations were found between each of the shrubshishl abub speciesand glassgrass

key words wooded draws green ash shrubs prunus virginianavirginiajavirginiana symphoricarpos occidentalistoccidentahsoccidentalisoccidentalisallsails grazgrazingwingzing

wooded draws constitute a valuable habitat STUDY AREA

type in the northern great plains they provideshelter from wind and weather and contain the study area is approximately 5 mileslulles north-

westgreater moisture than surrounding areas result-ing

of bison south dakota in perkins county

in an abundance of plant life and forage an on lands administered by the USDAUS DA forestservice custer national forest geology of theunderstanding of soil plant relationships of

has been described hansen 1985 thearea bythese wooded draws has become more criticaltopography is rolling to steep plains dissected by

since these areas have been observed to be instreams and drainagewaysdrainageways the climate of the

decline boldt et al 1978 for a variety of rea-sons

areaisareasarea is characterized by warm summers andveryand veryGirargirardcirardgirardetaldetalet al 1987 cold winters annual precipitation averages 36

studies that correlate habitat type with soil cm with most received in the spring andproperties are particularly useful in efforts to summermanage these systems knowledge gained from the habitat types of the area have beensuch studies might help managers determine described by peterson 1987 the greenthe potential habitat type of a site after vegeta-tion

ashchokecherryashchokeeherrychokecherryash habitat type was found on shal-lowdecimation efforts and limited resources to moderately deep well drained cabba

could then be concentrated on sites with the lantry loam soils of upland ridges and the sidesgreatest potential for rehabilitation of steep drainagewaysdrainageways with slopes of 15 to

this study was conducted to characterize the 40surface soil chemistry of the green ashchokecherry fraxinus pennsylvanicaprunuspennsylvanicalprunus virgini METHODS

ana habitat type in northwestern south dakotaand to relate these soil properties as well as grass collection of samples

cover to density of chokecherry and snowberry soil samples were collected during thesymphoricarpos occidentalisoccidentoccidentalistalis this habitat summer of 1986 from 24 green ashchokecherrychokecherryash

type is considered a topographic climax draws spaced over a 2769 ha pasture the veg-etationhansen hoffman and steinauer 1984 ofthe 24 wooded draws ranged from few

hansen and hoffman 1988 and is one of the trees and shrubs to a dense overstory and undermost important in the northern great plains story oftrees and shrubs samplingwassamplingwas conducted

I1

USDA forestfoiestkorest service lamkykockylimky mountainmountMountaintaiDun forcestfoicstforcst andind rangebangeR inge expedmeiitfxpc ninliit statist itionaition Ssoftlisontlith dakotat school of minesminev andtcdincl itchnoloyology 50150 E1 st jowpyjowpljoscplistst Krapidipitl

citC icvitv outhsontlibouth nakotadakotaD cikotikot i 57701oricsponcling intlioi

35


TABLE 1 chemical properties of soilsoli samples collectedfromcollected from green ash chokecherry habitat type near bison south dakotan 72

soil mean range standard deviation

pilpli 73 637863 78 03EC nnnhosunnunhoscin 06 04 26 03organic matteimattel 91 424 2 19819 8 33n03nch Nngg009609 31 101 0 17017 0 26P agglgg 25 01 105losios10 5 22K elggpuggWSvlgg 321 202 491 67z11znan elggpuggluggvlgggg 34 09 92 20fe bigglaggtggjigg 212 696 92689 2680268 0 315milmnmii aggaggpggrgg 76 323 2 24124 1 34cuc psp s 21 08 56 08cad ineqlineq1ineal 45 202 0 20820 8 23mg lneineckineclineqdinecl 21 101 0 12512 5 14nanitniu nieqlnicqdniell 02 01 09 01SARSAP 01 01 02 01saturationsatin aaionation M 729 48848.848848 8 1065106 5 112CEceineq100kginelneinc1100inc 1100 kg 452 29929 9 62462 4 76ext caC d ingkeingkging kg 4311 2580 6830 937ext mg ingkeingkgngkgingng kg 684 90 987 171ext na ingkeingkging kg 152 181 8 57557 5 77sand M 329 20 67 91silt M 408 21 51 54llyblyclayliy 263 11 40 62I1 etractabfc tio

at three locations inin each draw at each location 1981 half as much phosphorus is extractedapproximately 250 in

2 inin area three frames using AB DTPA as in the sodium bicarbonate20 X 5050cmwereiandomlylocatedcinelnelu were randomly located stem den-

sitiesextract olsen et al 1954 and slightly less zinc

of chokecherry at these locations ranged is extracted than in the standard DTPA testfrom low 0 2 stemsframestems frame to medium 3 6 havlin and soltanpourSoltan pour 1981 AB DTPAstemsframesteinsframestemssteins frame and high greater than 8 extractable copper and manganese are highlystemsframestemsfraniestems framefranie all stems were counted within a correlated with DTPA extractable levels offramefraine and the three values averaged for each these elements r2

75.7575 and 86sg.8686 respectivelylocation canopy cover of grass was estimated inin soltanpourSoltanpour and schwab 19771077each framefraine daubenmire 1959 one soil the ph was measured with a ph meter thatsample was collected within each frame to a used a combination electrode on a saturated

of 10 the three soil fromdepth cmcincluelu samples paste sodium adsorption ratio SAR was esti-matedeach location were combined for chemical anal from levels of soluble calcium magne-siumysis yielding a total of 72 samples and sodium measured in a saturation

soil analyses extract by means oficpofickof1cptcp AES total soluble saltswere measured on the filtered extract with a

amounts of soil elements P K znan fe mncu wereweiewele determined by using the ammoniumammonium solubsolusoiusolubridgebridgeridge

matter determined by wet oxida-tion

organic wasbicarbonate diethylenetnaminediethylenetriainine pentaaceticpentaaceticacid Soltan and with spontaneous heat of reaction potas-

siumAB DTPA extract soltanpourpour

schwab 1977 and inductively coupled plasma dichromate and concentrated sulfuric acid

atomic emissionemission spectrometry ICPAESICP AES were used for organic matter and results were

jones 1977 the ABDTPAAB DTPA procedure was determined calorimetrically nitrate nitrogendeveloped and isis used by the colorado state was determined by the chromotropic acid

university soil testing laboratory an equal method levels of extractable ca mg and naamount of potassium isis extracted as with the were measured by using ICPAESICP AES on an ammo-

niumammonium acetate test knudsen et al 1982 acetate extract cation exchange capacityand the samesarne amount of iron isis extracted as with was determined by the sodium saturationthe standard DTPA test havlin and soltanpourSoltan pour method page 1982

199211992 SOIL CHEMISTRY AND PLANT relationships 37

statistical analyses rather high at 45245.245245 2 meq100 kg table 1 claysinin these soils are likely to have high adsorptive

simple linear regression was used to relate soilmatter content and claycapacities since organicchemistry variables to chokecherry and snow

content did not fully account for the high CECberry densities the points were plotted to checkbrady 1974 the sodium adsorption ratiofor nonlinear relationships stepwise regressionSAR indicated minimal saturation of the

was used to test relationships between soilexchange complex by sodium electrical con-ductivity

chemistry canopy cover of grass and density oflow at 0.606060og 6 mmhoscm these soilsc waseach shrub the regression model yabxyaba

would be classed nonsaline nonalkalmenonalkaline withprovided the best fit in relating chokecherry and aslow electrical andconductivity exchangeablesnowberry densities with canopy cover of grass

soil variables and densities of both shrubs were sodium percentage the saturation percentageat 72972.972972 9 was somewhat higher than other nonsabonsasubjected to a nonhierarchicalhierarchicalnon cluster analysislinehneahne nonalkaline soils inin this classification rich-ards

ISODATA to group the sites ball and hall1954 the soil moisture percentage at 151967 stepwise discriminant analyses were

used to estimate compactness of clusters and mpa which isis approximately equivalent to the

identify the key variables that accounted for wilting percentage was 18 these soils are

their differences however cluster analyses and thus relatively fine textured on average sanddiscriminant analyses and simple correlation silt and clay averaged 33 41 and 26

plots did not provide any meaningful results respectivelysoluble ca mg and na were 4524.524524 52 1 and 0.202020 2

meq1 respectively table 1 extractable caRESULTS AND discussion mg and na averaged about 4311 684 and 15

mgkg respectively these corresponded to 10810.8ios10los 8nitrate nitrogen levels averaged 303.030 agglggjigg andranged from 1.01010io to 17.0170ito aggjiggtgg table 1 soil 5.757575 7 and 00650.0650 065 meq100 g soil and exchangeable

organic matter ranged from about 4 to nearly percentages of 23823.823823 8 12612.612 6 and 0.101010oi 1 respectively

20 these values compare well with values thus of these elements ca was predominant on

from surface soil samples from hardwood forest the exchange complex and exchangeable Nnawaskawasa was

on fine textured soils charley 1977 organic very low however calcium was low relative to

matter levels ranged substantially higher than comparable sites of vegetation and landscapes

those from soils from similar sites in north hansen hoffman and bjugstad 1984 hansendakota hansen hoffman and bjugstad 1984 and hoffman 1988

montana and south dakota hansen and hoff simple correlation coefficients for density ofman 1988 nitrate levels appeared adequate either chokecherry r 26 to 18 or snowfor growth of rangeland plants soltanpourSoltanpour et al berry r 36 to 20 with variousvanous soil proper-

ties1979 were low table 2 twelve soil propertiessoils were near neutral in ph table 1 and were negatively associated with chokecherry

similar to other sites in montana north dakota density phosphorus showed the greatest posi-tiveand south dakota hansen hoffman and relationship with chokecherry density r

bjugstad 1984 hansen and hoffman 1988 26 only four soil variablesnablesnabiesva ph P extractableextrestractableavailability of nutrients at this ph is near maxi-mum

ca and CEC were negatively correlated withexcept for fe mn znan and cu which snowberry density magnesium showed the

become less available above ph 7.07070to brady highest correlation with snowberry density r1974 plants usually grow well between ph 5 36 soil properties variedvaned some for both spe-

ciesand 8.58585ss donahue et al 1977 if no other growth cieseles at the microlitemicrositemic rosite level but were not statisti-callyfactor is limiting phosphorus and potassium different p 10 for example when

content averaged 252.525 aggbiggjiggkgg and 321 laggp gg respecrespect density of chokecherry was high no snowberrytivelydively thus phosphorus levels were low phosphorus was somewhat greater than phos-

phoruswhereas potassium zinc copper and manga-nese

on sites with high snowberry densitieslevels were high both generally and rela-

tiveno chokecherry and thus a positive correla-

tionto similar sites in the northern high plainshansen hoffman and bjugstad 1984 hansen stepwise multiple regression using all soil

and hoffman 1988 iron levels averaged 21.2212 properties with either chokecherry or snow-berryaggkggp gg and were fairly high stem density did not provide meaningful

the cation exchange capacity CEC was results however a good relationship was found


TABItabil I1 2 simple correlation coefficients for densities of 18chokecherry and snowberry with chemical properties of soil FITTEDof greenlieenlleen ashchokecherrychokecherryash habitat type near bison south ACTUAL

dakota n 72 15

CO

soil chokecherry snowberry Z 12

pilpli 01910196 0200.20ogo016 0280289 9EECC cc

organic matter 017 015 LU

nounnchnou N 003 010 3 6P 026 006 0K 014 018 Z

Uz11znan 013 023 3

fcfe oil011oii 003mn 003 02302ycn01 007 009caa 018 0250256 0 3 6 9 12 15

MRmg 017 036 chokecherry DENSITYna 009 030SARSAP 008 008saturation ojo010oloodo 010 15

FITTEDI1

extext caa 002 016 ACTUAL

ext mg 001 023COCQ 12

ext na 013 017 ZCECEC ineq100meq100 kg 004 002 ULJ

Q9

Signisignificantbhutfiutbiet at1 aot 05

signiasignifslpill iwi Wtilltiltlilt atliaiiact 01 a1 W

I allxll 111111 1111011

6

Sfor predicting chokecherry density using snow 0berry density and canopy cover of grass table 3

3 predicting snowberry stem density usingchokecherry density and grass cover similarly 0

showed a good relationship r250.5050 when

0 20 40 60 80 100snowberry stem density was high chokecherrylow and vice 1 GRASS COVERstem density was versa fig

chokecherry density showed a good relation-ship

fig 1 snowberry stem density stems01stems0stems 010 1 m2is greatestisgreatest

2 with of when chokecherry stem density isis the least but decreasesr 48.4848 canopy cover grass figas chokecherry density increases chokecherry stem density

1 stem densities of chokecherry werewere greatest isis greatest when grass cover isis the least and densitywhen canopy cover of grass was low decreases as grass cover increases

overall soil properties were not highly corre-lated with either chokecherry or snowberry fairly high levels of nutrients except phospho-

russteinstem density each shrub was more influenced which was low and nitrogen which wasby the density ofthe other or the amount ofgrass moderately low organic matter ranged fromcover factors such as other shrubs trees dis-

easeabout 4 to 20 these soils were fine textured

fire soil compaction and grazing may also with moderately high cation exchange capacityinfluence stem density of both chokecherry and and saturation percentages they were classedsnowberry boldt et al 1978 severson and as nonsaline nonalkaline with low amounts ofboldt 1978 uresk and paintner 1985 uresk exchangeable sodiumand boldt 1986 uresk 1987 but these factors soil properties showed low correlation rela-

tionshipswere not considered in the present study tionships with chokecherry or snowberry stemdensity A good relationship was found between

SUMMARY the two species of shrubs and grass additionalfactors such as density of other shrubs or trees

surface soils of the green ashchokecherrychokecherryash disease fire soil compaction and grazing maywoodland in northwestern south dakota near also influence densities of chokecherry or snow-

berrybison were found to be moderately fertile with and interact with soil surface properties

199211992 SOIL CHEMISTRY AND PLANT relationships 39

TABLETABLF 3 coefficients a b and c standard error of the estimate SE and correlation r2 describing relationships ofchokecherry C snowberry S and grass G in green ashchokecherryashchokeeberrychokecherryash habitat typee n 72

density Y a b b c SE r2 type 11

chokecherry 9651 0 488s0488s 008260 082g0082g 184 072072 S

snowberry 11694 1076c 0 076600766 266 050 S

snowberry 11758 6266c 0197 251 055 Echokecherry 9323 0 555605556 0620 253 048 E

S stepwise regression Y abxlbxlbxlax axbx2E exponentialexponent il regression Y abxdbxaba 1

acknowledgments HANSEN P L G R HOFFMAN and G A STEINAUERSTFINAUFR1984 upland forest and woodland habitat types of the

thanks are extended to custer national missouri plateau great plains province in greatplains agricultural council wildlife resources com-mitteeforest for providing partial funding and study wooded draws characteristics and values for

areas appreciation is extended to robert the northern great plains proceedings of sympo-siumhordorffbordorffHordorff and steve demsondenison for assisting with south dakota school of mines and technology

data collection rapid city 12 13 june 1984 great plains agriculturalcouncil publication no 111 52 ppap biology depart-ment south dakota school of mines and technologyliterature CITED rapid city

HAVLIN J L and P N soltanpourSOLTAN POUR 1981 evaluation ofBALL G H and D J HALL 1967 A clustering technique the nh4hco3nh4hc03 DTPA soil test for ironiron and zinc soil

for summarizing multivariate data behavioral science science society of american journal 45 70 751215312 153 155 JONES J Bbjrajrjr 1977 elemental analysis of soil extracts and

BOLDT C E D W URESK and K E SEVERSON 1978 plant tissue ash by plasma emissionemission spectroscopy com-municationsriparian woodlands inin jeopardyjeopaidypaldy on northern high inin soil science and plant analysis 8 349

plains pages 184 189 in strategies for protection and 365management of floodplainfloodplain wetlands and other riparian KNUDSENKNUDSFN D G A PETERSONPETFRSON and P F PRATTpran 1982

USDA forest service general technicalecosystems lithium sodium and potassium pages 225 246 inWO 12 DCD Creport washington A L page ed methods of soil analysis part 2 chemi-

calBRADY N C 1974 the nature and properties of soils 8thath and microbiological properties 2ndand ed mono-

graphed macmillan publication co inc new york 639 ppap no 9 pt 2 inin the agronomy seriessenesserles americanCHARLEY J L 1977 mineral cycling inin rangeland ecosys-tems of madison wisconsinsociety agronomypages 215 256 in R E sosebee ed rangeland OLSEN S RRCC VVCOLFCOLE F S WATANABE andandlL A DEANDFANplant physiology society for range managementdenver colorado

1954 estimation of available phosphorus inin soil byextraction with nahc03nahcos USDA circular 939 USU Sdaubenmire R 1959 A canopy coverage method of veg-

etation analysis northwest science 33 43 66 printing office washington DC 19 ppapPAGE A LLEDED 1982 methods of soil analysis part 2 2ndandDONAHUE R L R W MILLER and J C SHICKLUNA

1977 an introduction to soils and plant growth 4thath ed ed american society of ofagronomyagronomy madison wiscon-sinprentice hall cliffs S 1159 ppapinc englewood new jersey 626

PPPETERSON K R 1987 forage quality of key species inin

GIRARD M M H GOETZGOFTZ and A J BJUGSTAD 1987 northwestern south dakota unpublished thesis

factors influencing woodlands of southwestern north south dakota state university brookings 97 ppapdakota prairieframeprame naturalist 19 189 198 RICHARDS L A ED 1954 diagnosis and improvement of

HANSEN P L 1985 an ecological study of the vegetation salinesahne and alkali soils USDA agricultural handbookof the grand rivercedarRiver Cedar river sioux and ashland no 60 USU S government printing office washingtondistricts of the custer national forest a habitat clas-sification

DC 159 ppapsifi cation unpublished dissertation south dakota SEVERSONSFVFHSON K E and C E BOLDT 1978 cattle wildlife

state university brookings 249 ppap and ripariannpanan habitats in the western dakotas pagesHANSEN P L and G R HOFFMAN 1988 the vegetation 90 103 in J C shaver ed management and use of

of the grand rivercedarRiver Cedar river sioux and ashland northern plains rangeland regional rangelanddistricts of the custer national forest a habitat type symposium bismarck north dakota north dakotaclassification USDA forest service general technical state university fargoreport RM 157 rocky mountain forest and range soltanpourSOLTAN POUR PenaPNAN A E LUDWICK andandjandaJ 0 REUSSRFUSS 1979

experiment station fort collins colorado 68 ppap guide to fertilizer recommendations inin colorado 2ndandHANSENHANSFN P LLGG R HOFFMAN and A J BJUGSTAD 1984 ed cooperative extension service colorado state

the vegetation of theodore roosevelt national park university fort collins 45 ppapnorth dakota a habitat type classification USDA soltanpourSOLTANPOUSOLTAN POURR P N andandaA P SCHWAB 1977 A new soil testforest service general technical report RM 113 for simultaneous extraction of macro and micronutrimicronutnrocky mountain forest and range experiment sta-tion

entsants in alkaline soils communications in soil sciencefort colhnscollinscolens colorado 35 ppap and plant analysis 8 195 207


ureskUEESKum SK 1I W 1987 eflectsoflivestockgrkizingiiidtliiniiingeffectsohivestockgiamg and thinning uresk D W andcindccinacC E BOLDTBOLD 1986 effect of culturalofoverstoryof overstoryovel story trees on understory woody plants pages treatments on regeneration of native woodlands on the168 171 inin F D provenzapi ovena J T flinders E D northern great plains prairieframeprame naturalist 18 193 202mcartliurmeal thuithul compilers proceedings symposium on URESKURISKurlURI SK 1D W andandwwandewW W PAINTNERPAININFR 1985 cattle diets in aplantpiantipiant herbivore1 interactions 7 9 august 1985 snow ponderosa pine forest inin the northern black hillsbirdliiill d utah USDAUS DA forest serviceselvlee general technical journal of range management 38 440 442report I1 INTNT 222 intermountain forestfoiest and rangeexperiment station ogden utah 179 ppap received I11 november 1991

accepted 1616januanjanuai7j 1992


THE GENUS ARISTIDA GRAMINEAE IN californiakellykeilykellywkellawW allredaliredailredallred1allreda

ABSTRACTABSFRAC 1 the taxonomy of aristida gramineae inin california is revised the genus isis represented inin the state by sixsix

species and 11 taxa identification keys descriptions selected synonymy distribution records and illustrations areai e provided

key words Aristidaaristidafloristicsawhddflonsticsfloristics california

As part of the current revision of willis lynn the tip of the lemma often bears a column orjepson s A manual of the flowering plants of beaklike structure in species ofaristida and twocalifornia 1923 sponsored by the jepson her-barium

terms describe this condition an awn column isof the university of california at berke formed by the connivent or coalescent often

ley an examination of the taxonomy twisted bases of the awnsagns above the lemma thisnomenclature and distribution of the california is a relatively uncommon arrangement but is

species of aristida was undertaken jepson seen in aristida califcalieailcalifomicacalifornicafornicaomica thurber A beak of1923 originally listed 10 species of aristida for the lemma however is sometimes formed by

california and subsequent floristic endeavors the lemma apex it is often narrow and twistedincreased this number to 12 reported by munz as in A divaricatedivaricatadivaricata and A purpureapurpurpurpureanea the termand keck 1968 this work treats six species awn as used herein refers to the free portionapportioned to 11 total taxa only and is measured from the summit of the

annsAfisahnsaristidatida are peculiar in the development of the beak or awn column to the tip of the awnfusiformfusifonn indurate floret the lemma in north north american ATIsaristidatida have been classifiedamerican species is convolute and completely in three different sections of the genusencloses the palea and flower forming a rather arthratherumat&ratherum streptachne and aristidafirm anthoecium or flower casing this configu-ration

chaetariaChaet aria henrard 1929 clayton andcustomarily prevents the exsertion of renvoizeRenvoize 1986 in section arthratherum the

anthers and stigmas resulting in cleistogamous lemma body is terminated by an awn columnand self pollinated reproduction however in that articulatesdisarticulatesdisarticulateddis from the rest of the floret

some spikeletsspikelets of A purpurpurpureapurpureanea nuttall A this section is represented in california by Adivaricatedivaricatadivaticatadivaricata humbbumb & bonplbonal ex willenowWillenow and calicallcailcalifornicacalifomicafornicacalifomica the section streptachne is charac-

terizedother species swelling of the lodiculeslodicules will often by the extreme reduction of the lateralspread the lemma and palea and the anthers and awnsagns illustrated consistently in A tertipesternipesternipes cavcaastigmas are commonly exserted from the anthoecanthonc anillesanilleo but also found in other species that arelum during and after anthesis evidence ofpossible not usually placed in this section such ascross pollination in A dichotomadichotornadichotomydichodichotomatornaforna michaux of A adscensionis linnaeus in a study ofaristidaofaristidacentral and eastern united states two kinds of species affiliated with A divaricatedivaricatadivaricata trentflowers are developed one with three anthers 1985 found that some degree of reduction ofeach 2 3 mm long presumably adapted for the lateral awnsagns was a common occurrence inchasmogamous reproduction and the othera4thother with numerous species and concluded that this fea-

turea single anther less than 0.30303 mm long personal was often not a good indicator of biologicobservation the smaller anther is always found relationship the validity of the sectionretainedwithin the floret and apparently functions streptachne based on this criterion is doubtfulin cleistogamous reproduction this condition is section aristida comprises the remaining cali-

forniaalso reported for A oliganthaoligantha michaux henrard species without articulation in the lemma1929 or consistent reduction of lateral awnsagns

dpartndepiitnic lit twahnalolannntl indI1 blanpkuigellanp sdsciences 13box 313 I1 newnm Mmexicomicoleoicoieo statestat uiuniveimtyrsityrosity lasla cnCIIILC Nnew meximexico 88003

41


because the sectional classification of the reduced or obsolete palea 2 nerved thingenus remains largely unexamined and unsatis-factory

shorter than the lemma lodiculesLodicules 2 stamens I11for this report the california species are or 3 caryopsis enclosed in the anthoecium

sorted into informal groups these groups do fusiform the hilum scar linear the embryonot necessarily correspond to any formal rank small X 11but those used hitchcock and chaseparallel by key to the genus Afisaristidaanstidaafistidatida1951 and allred 1986

1 culm internodesinternodes and nodes conspicuously hairyGROUP adscensiones aristida adscen A califomicacalifomica var califomicacalifomica

slonis characterized by the annual habit culm internodesintemodesinterintenodesmodes and nodes glabrous 2branching at the upper nodes and erect awnsagns

21 plants annual generally much branched aboveGROUP DiCHOdlchotomaedichotomaedichotomalTOMAE aristida oliganthaoligantha the base 3

characterized by the annual habit branching at plants perennial simple or only weakly branchedthe nodes and for the centralupper a tendency above the base 4awn to coil

32 central awnsagns mostly 3 7 cm long A oligohganthaoliganthaanthaGROUP divaricatae ATisaristidatida divaricatedivaricatadivaricata

central awnsagns mostly 070 7 2 cm long A adscensionisadscensiomsandaandA ternipestertipesternipes characterized by the stiffly spreading primary and often secondary branches with 42 primary panicle branches erect to spreading or

drooping but at least the bases of the branchesaxillary pulvinipulcinipulvini these two species are usually appressed to the main axisaxis without pulvmipulvinipulcini in theplaced in different sections of the genus aristida branch axilsaeils A purpurpurpureapurpureaneaand streptachne respectively primary panicleparticle branches abruptlyabru tlyaly spreading from

GROUP PURPUREAE aristida purpureapurpurpurpureanea the main axis with pulvinipulcini inin tethe branch axilsaeils 5

including seven varieties characterized by gen-erally

54 lower panicle branches ascending the upperunequal glumesblumes a narrowed beak of the branches appressed A purpurpurpureapurpureanea var parishiipanshnpansenparishii

lemma and generally erect branches merges lower and upper pariparrpairpanicleicleleleiele branches spreading 6with the divaricatae through A ea varpurpureapurpurpurpurean 65 anthers 080 8 1 mm long summit of lemma twistedparishiiparishii hitchcock allred as well as A pansa at maturity base ofblade glabrous abovetheabovethe ligulewooton & standley of the chihuahuan desert A didaridwandivaridivaricatadwancatadivaricatecata

GROUP tuberculosae aristida califor anthers 121 2 3 mm long summit of lemma not ornica characterized by the disarticulation of the only slightly twisted at lturitymaturity base ofofbladewithbladea4thawnsagns and awn column from the body of the scattered pilose hairs above the ligule A temipes

lemma aristida adscensionis linnaeus sp piA 82following are identification keys to all taxa 1753 SIX WEEKS THREEAWN fig 1 A

descriptions based on california specimens adscensionis var abortiveabortivaabortiva beetle A adscencounties of occurrence in california lists of slonis var decoloratadecoloratedecolorata fournierFoumier beetle Aselected specimens examined and an illustra-tion

adscensionis var modesta hackellhackel tufted andof each taxon herbaria are abbreviated generally annual but extremely variable in size

according to holmgren et al 1981 updated growth habit and longevity culmscalms erect toinformation on the distribution of aristida in geniculate simple to much branched 310california will be welcomed by the author 5080 cm tall internodesinternodes glabrous sheaths

generally shorter than the internodesinternodes ligulesaristida linnaeus sp piA 82 17530.40404 1 mm long blades flat to involute 2 14 cm

tufted annuals or perennials culmscalms generally long 1 2.52525 mm wide panicle narrow and con-tractederect the internodesinternodes mostly semisolid sheaths tr 5 1520 cm long often interrupted

open ligules a ring of hairs blades flat to invo-lute

below the spikeletsspikelets aggregated on shortlacking auricleseuriclesauricles inflorescence generally a branches glumesblumes unequal 1 nerved the first

panicle occasionally racemose or spicate 4 8 mm long the second 6 11 mm longspikeletsSpike lets 1 flowered articulatingdisarticulatingdis above the lemmas 6 9 mm long slightly flattened sca-

brousglumesblumes glumesglurtwsblumes equal to very unequal thin on the midnervemidnerve awnsagns flattened at themembranous I11 to 7 nerved often as long as base spreading the central awn 7 1823 mmthe floret or longer lemma 3 nerved terete long the lateral awnsagns somewhat shorter rarelyindurate at maturity and enveloping the palea 0 2 mm long palea 0.50505os 1 mm long hyalineand flower callus oblique usually sharp blunt fan shaped anthers 0.30303 0.70707ot mm longpointed and bearded awnsagns 3 in number termi-nal

caryopsis somewhat shorter than the lemmaon the lemma the lateral awnsagns sometimes 2nan 22 dry open places and rocky hills below

199211992 GENUS ARISTIDA IN california 43

inyo co panamint mts death valley 18 apraar1978 dedecker 4541 UC 11 mi W of deathvalley 28 mar 1947 keck D 5847 UC losangeles co pasadena 27 feb 1882 jonesM E sn CM san clemente island 8 may1962 raven PR H 17609 UC riverside co9.49494 mi N ofofblytheblythe 19 feb 1958 bacigalupi R6188 JEPS marshall canyon 10 mi W ofcoachellaCoachella 16 apraar 1905 hall H M 5797 UCnear mecca 28 jun 1902 parish S B 8122UCIUC S end of coxcomb mts 27 mar 1941

wiggins 1I L 966 ugiUCIUC san bernardino coNW side of copper basin 6 may 1939 alexan-der 710 UC sheep hole mts 25 apraar 1932ferris R S 8020 UC needles 12 mar 1919tidestromwidestromTidestrom 1I 8556 UC san diego co sandiego 29 apraar 1902 brandegee 832 UC 6 miNW of agua caliente 5 apraar 1960 everett24075 ugiUCIUC 1.51515 mi E ofvallecitosofvallecitos 28 jan 1940munz P A 15856 UCIUC borrego springs 18mar 1976 schroeder 51 UC san luisCM

obispo co san luis obispo 9 may 1882jones M E 3245 UC santa barbara cosanta ynez mts 9 may 1954 pollard UC

aristida californicacalifornica thurber in S watsonbot calif 2289 1880 tufted slightly bushyperennial culmscalms erect much branched gener-allyfig 1 aristida adscensionisadscensioms inflorescence and spikelet 10 40 cm tall internodesinternodes glabrous or pubes-cent sheaths much shorter than the internodesinternodespubescent at the throat and on the collar aiglig1000 m COUNTIES imperial inyo los angeles ules about 0.50505 mm long blades mostly folded to

riverside san bernardino san diego san luis involute occasionally flat stiffly spreading 2 5obispo santa barbara cm long mostly less than I11 mm wide scabrous

aristida adscensionis ranges in habit from to hispid puberulent ininflorescenceoresofesorescencegrescencecence few flowsmall unbranched plants scarcely 3 cm tall with ered 2 6 cm long the terminal ones paniculateonly one or two spikeletsspikelets to large much the axillary ones racemose glumesblumes unequalbranched clumps 80 cm tall with numerous I1 nerved lemma with a narrow column at thebranches and spikeletsspikelets several varieties have tip formed by the twisting and fusing of the awnbeen named based on differences in plant and bases agnsawns nearly equal breaking from thepanicle size degree ofbranching and the devel-opment

lemma the zone of articulation at the base ofof the awnsagns variation in size and the awn column 2nan 22

robustness seems related to precipitation and var californicacalifornica california THREEAWNpopulations at the same site may vary drastically fig 2 internodesInternodes pubescent the hairs pilosefrom year to year the validity ofreduced lateral to sublanosesublanose glumesblumes very unequal the first 4 8awnsagns as a taxonomic character is also question-able

mm long and the second 9 12 mm long lemmamost species of aristida have forms withvith body 5 7 mm long when mature the awn

the lateral awnsagns reduced and this seems to column 8 26 mm long agnsawns 2 4.54545 cm longoccur almost indiscriminately and without any dry sandy desert areas COUNTIES imperialcorrelation with other features riverside san bernardino san diego

SELECTED SPECIMENS imperial co rd the other variety of this species is varfrom ogilbytoogilbyto blythe 17feb17 feb 1958 bacigalupi glabrataglabrateglabrata vasey known principally at the speciesR 6136 JEPS carrisocarpiso mts painted gorge 17 level as aristida glabrataglabrateglabrata vasey hitchcockmay 1938 ferris R S 9622 UC near dixie-land

this variety differs from var californicacalifornica primarily13 oct 1912 parish S B 8239 JEPS in having glabrous rather than pubescent


intermternodesinternodesnodes and occurs inin the slightly higher ele-vations of the deserts to the east of the range ofvar californicacalifornica both taxa are diploidsdiploidydiploids an2n 22and they overlap considerably inin spikeletdimensions reeder and felger 1989 varietyglaalaaiaglabrataglabratelabratabrafa isis not known from california

SEEECTEDSELECTED SPECSPECIMENSI1 MEN S imperial cosignal mt 2 apraar 1903 abrams G D ssnn DS1866641186664 dsads1DS 8 mimi E of el centro amonglarreaamong larreabushes 22 apraar 1942 beetle A A 3172AHUC bard near arizona line 22 sep 1912

thornber J J sns n ARIZ a few mi E ofofholtotholtholthoitville junfun 1951 tofsrud R sns n ahuc1AHUC riv-erside co near thousand palms rocky desertslopes 27 apraar 1943 beetle A A 1938AHUC pinto basin 16 mi from cottonwood

springs 15 may 1938 fernsferris R S 9522 DScanyons along colorado river I11 may 1905hall H M 5963 ARIZ POM UCJUC coachellaCoachellavalley 6 mimi SE of garnet station sand dunesca 500 ft 11 mar 1928 howell J T 3443 DSCAS AHUC san bernardinomardinoBe co joshuatree national monument 1700 ft north ledge 2TIS rioe 18 may 1941 cole J E 734 UCbaxter S of mojave river 23 may 1915 parishS B 9886 UC DS dale lake valley W oflake 13 mimi E of 29 palms sundrysun dry sand flats fig 2 aristida califomicacalifomica inflorescence spikelet and

detail of branebrancbranchinghingbingabundant 29 may 1941 wolf C B 10876RSA DS CAS san diego co san felipe

narrows ca 350 ft 20 apraar 1935 jepson W L slopes below 150 in elevation COUNTIES san17101 lepsjepsbeps canyon W of borrego spring diego1500 ft 19 apraar 1906 jones M E sns n POM it is doubtful that aristida divaricatedivaricatadivaricata cur-

rently1170011170011 POMIPOM colorado desert clay hills 25 occurs in california most reports arejun 1888 orcutt C R 1486 DS based on collections ofofcofaC R orcutt in 1884 and

aristida divaricatadivaricatedivaricata humbbumb & bonplbonal ex nodokdownknown specimens have been collected fromwilldenowWilldenow enumanum pipl 199 1809 POVERTY the state since that time in addition it is possi-

bleTIIREEAWN fig 3 tufted perennials culmscalms that orcutt s labels are in error because onerect mostly unbranched 25 70 cm tall inter at least one specimen ofA divaricatedivaricatadivaricata he locatednodes glabrous sheaths longer than the inter hansen s ranch which is in baja california innodes ligules 050os0.5055 1 mm long blades loosely san diego countyinvolute glabrous 5 20 cm long 1 2 mm wide A similar species aristida orcuttianaorcuttiana vaseypanicle open 10 30 cm long 6 25 cm wide also supposedly was collected from southernprimary branches stiffly spreading from the california in 1884 by C R orcutt and twomainmalnin ainaln axisaxis axillary pulvimpulvinipulcini present 2 12 cm long specimens are housed at US the labelsgenerally naked on the lower portion branch describe san diego as the collection localitylets and spikeletsspike lets generally appressed along the and these specimens are apparently the basis forbranches but sometimes spreading glumesblumes reports of either A orcuttianaorcuttiana or A schiedeanaschiedeananearly equal 1 nerved 8 12 mm long acumiacumaacumiacuma briniustrinius & ruprectruprecht from california abramsnate aristate lemma 8 13 mm long to base of 1923 jepson 1923 hitchcock 1924 munz &awnsagns the terminal 2 3 mm narrowed and gen-erally

keck 1968 coincidentally the type locality oftwisted four or more turns agnsawns subequal A orcuttianaorcuttiana is again hansen s ranch in baja

to unequal 710 22 mm long the lateral awnsagns california mentioned above it is possible thatat least slightly shorter than the central anthers neither A divaricatedivaricatadivaricata nor A orcuttianaorcut tiana was ever0.80808os0 8 1 mm long 2nan 22 to be looked for on dry collected from california by orcutt but from


CM

3CM

fig 3 aristida divandivaHdivahcatachvancatachvancatacata inflorescence spikelet andbase of plant C

baja california aristida orcuttianaorcuttiana resemblesA divaridivaricatadivancatadivaricatedivancatacata inin the stiffly spreading panicle fig 4 aristida chanthaohanthaoh antha infloiescenceinflorescence spikelet andbranches but the lateral awnsagns are very short or detail of branchingabsent and the blades are generally flat andsomewhat curling inin orcuttianaorcuttiana upwards inflorescence few flowered race-

moseSPECIMENS EXAMEXAMINEDINED without definite

the lets sessile glumesblumes sub-equal

spikeletsspike nearlylocality but recorded as california santa cataor the second longer awn tipped mostlylina mts santa catalina island inin 1884

1218 34 the first 3 57 nervedmm long toorcutt C R 2 US santa clara mountainsand short awned the second i- to 3 nervednervedwithnervedwithwitharizonapossibly inin 1884 orcutt C R 2

US san diego co san diego orcutt C R an awn 8 13 minmm long lemma 1013 20 mm

sns n NY US long to base of awnsagns central awn 23523.5235 7 cm

aristida oliganthaoligantha michaux fl bor amer long the lateral agnsawns generally soinesomewhatwhat1411 41 1803 OLDFIELD THREEAWN fig 4 A shorter 2nan 22 dry hills and fields bareoliganthaoligantha var nervatenervata beal tufted annuals ground scrub land 90 1000 in elevationculmscalms wiry 30 70 cm tall much branched the COUNTIES amador butte el dorado hum-

boldtinnovations extravaginal internodesinternodes glabrous imperial lake madera mendocinopithy sheaths mostly shorter than the inter merced modoc nevada placer redding sac-

ramentonodes ligules 010oi0.1011 0.505050 5 mm longiongionlon blades flat to san joaquin shasta siskiyousiskiyoulSiskiyouyoul solanoinvolute 3 22 cm longiongionlon 1 2 mm wideaide reduced sonoma stanislaus tehama tuolumne yuba


some specimens of aristida oliganthaoligantha from second 13 nerved acuminate awnsagns aboutnorthern california lake and modoc counties equal or the central slightly longer because ofand adjacent areas of southern oregon exhibit intergradation among forms allred 1984 thesmaller glumesblumes lemmas and awnsagns than are typ-ical

taxa of this complex are recognized as varietiesand have been segregated as either A within aristida purpurpurpureapurpureanea

ranwsissimaramosissima Engelengelmannmarm var chaseanachaseana henrardor A oliganthaoligantha var nervatenervata beal in addition I11 primary particlepanicle branches at least the lower with

the central awn in these plants in sometimes axillary pulvinipulcini and usually stiffly spreading toascending from the main axis var parishiipanshziparishiiacutely reflexed and the floreasflorets darkened this

configuration is intermediate between A primary panicle branches lacking axillary pulvinipulcinipulvinithe spikeletsspike lets variously disposed but at least theoliganthaoligantha and A ramosissima bases of the branches appressed to the axis 2

SELECTED SPECIMENS butte co chico 272121 awnsagns 4 10 3cm longjul 1903 copeland 3488 US WIS volcanic

uplands between pentz and dry creek 15 jul awnsagns 1133.535353 5 cm long 4

1914 heller A 11576 UCIugiUC 252.595gs mi S ofofwyanwyan 32 summit of lemma 010 1 030 3 mm wide awnsagns ratherdotte 28 nov 1933 jensen 367 UC hum-boldt

delicate mostly 020 2 mm or less wide at the base4 6 cm long second glume mostly shorter thanco cottrell ranch 17 sep 1955 mallory 16 mm var purpurpurpureapurpureanea

122 UC trinity river near mouth of willowsummit of lemma 030 3 0088 mmaudemma4demm wide awnsagns usuallycreek 15 1919 5222 UCIUCsep tracy vicinity stout more than 020 2 mm wide at the base 4 10 cm

ofofgarbervillegarbervilleGarberville 27 aug 1933 tracy 13000 UCIUC long second glume 16 25 mm long var longisetalongi setadobbyn creek 9 jul 1934 tracy 13341 UC 42 summit of lemma mostly less than 020 2 mm widelake co dry hills between upper lake and awnsagns delicate mostly less than 020 2 mm wide at thescott valley 17 aug 1905 tracy J P 2365 ugiUCIUC base 5

var nervatenervatanervata madera co minturn I11 oct summit of lemma mostly more than 0022 mmvidemm widevide1936 hoover R F 1618 JEPS ugiUC merced awnsagns stout mostly 020 2 mm or more wide at the

co tuttle 17 jul 1936 hoover R F 1580 base 6

JEPS UQUC modoc co 19 aug 1935 whitney 54 panicleparticle branches and pedicelspedicels erect stiff occa-sionallyL 3627 UCIUC fletcher creek 6 sep 1935 sionally spreading or flexuous var nealleyinealleyi

wheeler L C 3959 US var nervatenervatanervata particlepanicle branches and pedicelspedicels drooping to flexuous

nevada co tahoe nati forest S of grass var purpurpurpureapurpureanea

valley aug 1931 smith 2638 JEPS UQUC sac-ramento

64 panicledpaniclesPanicles mostly 3 14 cm long blades mostly basal

co 5 mi SE ofoffolsomfolsom yates H S and less than 10 cm long var varfendlerianafencqenana

5953 uc1ucaUC shasta co redding 21 jun 1909 particlesPanicles mostly 15 30 cm long blades mostly

blankinship JEPS I11 mi N of anderson 21 jul caulineeauline and more than 10 cm long var wrightiiiwnghtizwrightiiwrightiitil

1932 long 190a uc1ucaUC stanislaus co vicinity varfendlerianavsirfendleriana steudel vasey contr USof lagrangela grange 30 sep 1961 alienallenailen JEPS nati herb 346 1892 FENDLER THREEAWNbetween knight s ferry and warnervilleWarnerville 1 sep fig 5 A fendlfendlependlpendifendlellanafendlerianaelianarianaellanatiana steudel syn pi glum1941 hoover R FE 5582 UC I11 mi NW of 142018551420.18551420185511420.18551 culmscalms 10 40 cm tall blades invo-

lutewaterford yates H S 6858 uc1ucaUC tehama mostly less than 10 cm long usually basalco 9.79797 mi N of red bluff 14 aug 1954 bac-igalupi

but occasionally cauline panicle 3 14 cm longR 4808 JEPS volcanic plateau NE of narrow glumesblumes unequal the first 5 8 mm long

red bluff 22 sep 1940 hoover R F 4617 the second 10 15 mm long lemma 8 14 mmuc1ucaUC tuolumne co near keystone yates long agnsawns generally 1841.841.818184lsis 4 cm long 0.20202 0.30303 mm

H S 6148 ucauc1UC wide at the base 2nan 22 44 dry often rockyaristida purpureapurpurpurpureanea nuttall trans amer slopes and hills 1000 2000 m elevation COUN-

TIESphilos soc 5145 1837 tufted perennials inyo riverside san bernardino sanculmscalms erect and generally unbranched 10 80 diegocm tall internodesinternodes glabrous sheaths longer SELECTED SPECIMENS inyo co devilsdevilsthan the internodesinternodes ligules 0.101oloi 0.50505os mm long kitchen cynayn SE 14 sec 7 t22s r39e 21 mayblades mostly involute panicle variable con-tracted

1978 zembal R L 531 RSAPOM river-sideand spikelike to open and flexuous the co 20 jul 1905 griffiths D 8008 MO

branches without pulvinipulcini in the axilsaeils except var san jacinto mts pinyon flats 18 may 1958parishiiparishii glumesblumes mostly unequal except var raven P H 13003 RSAPOM san bernar-

dinoparishiiparishii the first about half the length of the co near jupiter mine kingston range


1 CM

cm

5 fig 6 aristida purpurpurpureapurpureanea var longisetalongi seta inflorescence andspikelet

fig 5 aristida purpurpurpureapurpureanea var varfendlerianafendlerianafendlependlerbanariana inflorescenceand base ofspikelet plant glumesblumes unequal the first 8 12 mm long the

second 16 25 mm long sometimes shorter30 may 1980 de nevers G 348 RSAPOM lemma 12 16 mm long 0.40404 0.80808os mm wide justSW new york mts 5.55555ss mi E ofofcimaolcimacimaclma in cotton-wood

below the awnsagns agnsawns stout 4 10 cm long 0.20202

canyon near cottonwood spring 2 jun 0.50505 mm wide at the base 2nan 22 44 66 881973 henrickson J 10339 RSAPOMRSAPOMI dry desert hills and plains 300 1500 m eleva-

tionivanpahivanpal mts kessler peak 2 jun 1931 jepson COUNTIES mono riverside san bernar-dinoW L 15825 JEPS san bernardino mts 15 san diego

jun 1895 parish S B UCIUC budweiser wash the varieties longisetalongiseta and fendfendlependlejendfendlehanafendlerianaleHanarianafiana arenear 35d 46m N 115d 44m W granite mts 28 often confused but are most easily distin-

guishedoct 1977 prigge B A et al 2320 RSAPOMRSAPOMI by the width of the awnsagns and lemmacaruthers cynayn new york mts 30 may 1973 apices and not by whether the leaves are basalthorne R F 43639 RSAPOM san diego or caulineco 3 mi WNW ofjacumbaofjacumbamacumbaJacumba yates H S 6805 SELECTED SPECIMENS riverside coUC 5 mi ENE ofofjacumbajacumbamacumbaJacumba yates H S 6808 joshua tree national monument I11 may 1942uc1ucaUC roos 1153 US deep canyon t7sts r5erae 27var longisetalongiseta steudel vasey in rothrock jun 1937 yates H S 6722 RSAPOM san

US survey W looth merld rptapt 6286.185562861855 bernardino co E new york mts W of castleRED THREEAWN fig 6 A longisetalongiseta steudel buttes between corral and dove spring 12

syn pipl Gglumclumlum 1420 1855 A longisetalongiseta var may 1974 henrickson J 13933 RSAPOMlobustarobusta merrill culmscalms 10 40 cm tall delicate rock springs palmer E 537 UCIUC plains nearor stout blades 4 16 cm long mostly involute leastalkleafstalkLeastalk 3 jun 1915 parish S B 10329 UCbasal or cauline panicle 5 15 cm long the 2.22222 mi ESE of brant on N side range of newbranches stout and erect to delicate and droop-ing

york mts 8 may 1978 prigge B A et al 2905but usually not very flexuous or tangled RSAPOM san bernardino nati forest


above cactus flat W of hwybwy 18 N of baldwinlake 2 3 jun 1980 thorne R F 54375RSAPOM san diego co head of box

canyon near mason valley 12 may 1932duran V 3208 WIS

var nealleyinealleyi vasey in coulter allredbrittaniabrittoniaBrittonia 36391 1984 NEALLEY THREEAWN

fig 7 A glaucaglanca nees walperstalpersWalpers A strictasttictastrickamichaux var nealleyinealleyi vasey in coulter contrUS nati herb 155 1890 culmscalms 2020545 cmtall tightly clustered blades generally basalinvolute curving in age 5 15 cm long paniclenarrow spikelike light brown 8 18 cm longthe branches mostly erect appressed glumesblumesmostly unequal the first 4 7 mm long thesecond 8 14 mm long lemma 7 13 mm long0.10101oi 0.20202 mm wide just below the awnsagns agnsawnsdelicate 1.51515 252.525 cm long mostly oi0010.1011 mm wideat the base 2nan 22 44 dry desert plains andslopes 200 1200 m elevation COUNTIES

imperial inyo riverside san bernardinomardinoBe sanCM

diegovariety nealleyinealleyi grades into var purpurpurpureapurpureanea with

flexuous branches and into var wrighwrightiiwrightiiitii withmore robust panicledpaniclespanicles and broader lemma apicesand awnsagns 7

SELECTED SPECIMENS imperial copainted gorge canissocarisso mts 17 may 1938 fig 7 aristida purpureapurpurpurpureanea var nealleneatneahnealienealleyiyi inflorescence andferris R S 9623 UC inyo co johnson spikelet

creek death valley 28 apraar 1940 gilmanM F 4190 RSAPOMRSAPOMI cave springs wash 25

ishii A S hitchcock invar parishiipar jepsonapraar 1930 hoffman R US funeral mts 2allred brittaniabrittoniaBrittonia 36392 1984 PARISHSmay 1917 jepson W L 6907 jepsbeps

8 A ishii A S hitchcockTHREEAWN parishiifig partitanothere cynayn grapevine mts E side ofin fl calif 1101 1912 A tiitildeath valley 26 mar 1947 wiggins 1I L 11566 jepson wrightewrightnwrightiiwrighnash var patishiiparishiipanparpaypaTishii hitchcock in jepson gouldRSAPOM UQUC riverside co cottonwood

spring 30 mar 1940 hitchcock C L 5871 calmsculms thick stout erect blades mostly flat

cottonwood longer than 10 cm panicle narrow spikelike orMO RSAPOM UCJUC eagle mtssprings 25 apraar 1928 jepson W L 12585 the lower branches with axillary pulvinipulcini and

lepsjepsbeps mouth of andreas canyon 4 6 april spreading at about a 45 degree angle 15 24 cm1917 johnston 1I M 1010 RSAPOM E of long reddish when young glumesblumes unequal to

hemet along san jacinto river 7 aug 1938 equal the first 7 11 mm long the second 10 15

roos J C 582 RSAPOM san mardinobernardinoBe mm long lemma 10 13 mm long 0.20202 0.30303 mmco providence mts fountain canyon 15 may wide just below the awnsagns awnsagns 2 3 cm long1937 beal 301 JEPS route 95 18 mi N of 0.20202 0.30303 mm wide at the base chromosometravis 23 apraar 1942 beetle A A 3193 WIS number not reported dry hills and plains 30039 mi from needles on parker road 24 apraar 1000 m elevation COUNTIES imperial inyo1928 ferris R S 7226 RSAPOM san los angeles riverside san bernardinomardinoBe sallsansaildiego co san felipe 16 apraar 1895 brandegee diegoUC san felipe gap 6 apraar 1901 brandegee variety parishiipar ishii is very similar to var ilrilifiiwrioliffiUCIUC head of fox canyon near mason valley but differs most strikingly in the sometimes

12 may 1932 duran V 3208 MICH MO spreading primary branches the reddish colorRSAPOM ugiUCIUC yaqui well 22 apraar 1928 of the panicle when young and the more clus-

teredjepson WWLL 12516 JEPS arrangement of the spikeletsspike lets it alsoaiso


yay1

A

8 fig 9 atstidaanstidapurpurpurpureapwpwreapurpureanea var pnipureapnrfxirea inflorescenceandinflorescence andspikelet

fig 8 aristida purpureapnrpureapurpurpurpureanea var parishiipari&hnparpapishii inflorescence andspikelet

46m N 115d 44m W granite mts 28 oct 1977prigge B A et al 2320 RSAPOMRSAPOMI san diego

flowers earlier mostly march through may co 0.50505os mi N ofofmiramarmiramar reservoir clay soil 4 marwhile var wrighwrightiiwrightiiitii flowers mostly may through 1981 reveal J sn AHUC anza canyon E ofoctober parish s threeawnthreeawn also resembles some julian 3 apraar 1940 wilson E sn AHUCmembers of the divaricatae group because of var purpureapurpurpurpureanea PURPLE TIIREEAWN fig 9its spreading primary branches and generally A purpurpurpureapurpureanea var californicacalifornica vasey collmcubnscullm 25subequal blumesglumes 60 cm tall blades flat to involute mostly cau-

lineSELECTED SPECIMENS imperial co 9.29292 3 17 cm long 1 2 mm wide paniclemiles NE of glamisalamis 18 mar 1962 hitchcock purplish often nodding 10 25 cm long theC L 2225 F palo verde mts 8 apraar 1949 branches usually delicate drooping or flexuousroos J C 4198 US inyo co specimen with-out

blumesglumes unequal the first 4 9 mm long thelocality at RSAPOM riverside co second 7 16 mm long lemina 6 12 mm 0.10101oi

chuckawallaChuckawalla springs 15 mi SE of guiladayGuiladay 9 0.30303 mm wide just below the awnsagns agnsawns 2 34jul 1957 crampton B sn AHUC palm cm long 0.20202 0.30303 mm wideaideadde at the base 2nan 22canyon 4 apraar 1917 johnston 1I M 1008 US 4444668866 88 Ddryry grassy

7hills scrub lands 250 800

MICH riverside and vicinity of upper fork of in elevation COUNTIES mono riverside sansalt creek wash 19 mar 1927 reed F M bernardino san diego5440 AHUC RSAPOMIRSAPOM between march this is a beautiful grass with its drooping red-

dishAFB and lakeviewLakeview 29 apraar 1966 roos J C sn plumelike paparpatpaniclesparriclespanichesniclesriclesnieles it commonly intergradesintergradesRSAPOM san bernardino co 2 mi NE of with the varietesparietesvarietes nealleyinealleyi lonilongiionilongisetalonisetalouisetasefaseta and wrihtiiwtghffi

fifteenmileFifteenmile point 3000 ft 28 apraar 1935 SELECTED SPECIMENS mono co mcafeeaxelrod D 321 AHUC UC between bullion creek white mts fishlakefishlikeFishlake valley drainageand sheep hole mts 7 apraar 1940 munz P A 6 aug 1984 morefield J D JDM 2480e16568 RSAPOM budweiser wash nearnear35d35d RSAPOMRSAPOMI riverside co I11 mile E of banning


A

z

10fig 11 aristida temipes var hamulosehamulosahamulosa inflorescence

fig 10 aristidapurpurpurpureapurpureanea var wrightiiwrightnwrighwrightetiitn inflorescence and spikelet and detail of ligular region

spikelet

10 16 mmmin long lemma 8 14 mm long 0.20202 0.30303

20 jul 1905 griffiths D 8007 MOImolMO palm mm wide just below the awnsagns owns mostlycanyon 4 apraar 1917 johnston 1I M 1008 US 2 3.53535 cm long 02 0.30303 mm wide at the base 2nanMICH base of san jacinto mountain june 22 44 66 sandy or rocky hills and plains1882 parish S B etetalal 1549 F MICH lower 500 1500 in elevation COUNTIES riversidesan jacinto river canyon yates H S 6711 san bernardino san diegoUC san bernardino co road from high-

landwright s threeawnthreeawn interintergradesmtergradesgrades with the varie-

tiesto running springs I11 mi from valley floor purpureapurpurpurpureanea fendlerianafendle riana and panparpailpallpalfpailshiiparishiiishiishiishil26 jun 1942 beetle B A 3644 F WIS near SELECTED SPECIMENS san bernardinoupland 7 nov 1916 johnston 1I M 1120 co slover mts 14 aug 1907 reed F M 1307MICH san bernardino valley 2 jun 1906 WIS 2.52525 mi SE of kingston peak t19n

parish S B 5783 NMCR clark mts 5 aug rioe sec 342734 27 23 oct 1977 henrickson J1950 roos J C et al 4906 RSAPOM UQUC 16321 RSAPOM 1 rocky canyon between bul-

lionsan diego co 6 mi N of ocean side ranch and sheep holt mts 7 apraar 1940 munzcoast hills in chaparral 21 apraar 1942 beetle P A 16568 UC san diego co 3 mi WNWA A 3145 TAES near vallecitos station ofjacumbaofjacumbamacumbaJacumba tiss r8erae 3 sep 1937 yates H S

2 apraar 1939 gander F 7142 MICH harbison 6805 RSAPOMcanyon 19 jun 1938 gander F F 5999 aristida temipesternipestertipesternipeslpes cavanillescavanillasCavanilles icon pi 546RSAPOMRSAPOMI 1799 tufted perennials culmscalms few erect tovar wrighwrightiiwrightiiitii nash in small allred sprawling simple or only weakly branched 25

brittaniabrittoniaBrittonia 36393 1984 WRIGHTSWEIGHTS THREEAWN 80 cm tall intemodesintemodes glabrous sheaths mostlyfig 10 A wrighwrightiiwrightiiitii nash in small fl south-

eastlonger than the intemodesinternodesinteinter nodesmodes ligules 0.20202 0.50505os mm

US 116ilg1161903116.19031903 1 culmscalms erect to 80 cm tall long blades flat to involute 5 40 cm long 1 2blades involute to flat cauline 10 25 cm long mmmin wide with scattered long hairs above the1 3 mm wide panicle narrow spikelike 14 30 ligule panicle 15 40 cm long open thecm long the branches erect appressed glumesblumes branches widely spreading from the main axis

unequal the first 5 10 mm long the second and naked at the base axillary pulvinipulcini present


spikeletsSpike lets appressedoppressed or spreading from the bernardino co near upland 7 nov 1916branches glumesblumes about equal I1 nerved 9 15 johnston 1I 1121 ARIZ mesa near rialto 20mm long lemma 10 15 mm long usually not may 1888 parish S B UC granite moun-

tainstwisted at the apex agnsawns equal to very unequal budweiser wash 28 oct 1977 priggeanthers 1.21212 3 mm long B A et al 2321 RSAPOM san diego co

var hamulosahamulosehamulosa henrard trent sida rolando 14 jan 1938 gander F F 4936 SD142260.19901422601990 HOOKhookthreeawnTHREEAWN fig 11 A sansanjamento4jull890hassehjamentodamentojamento 4 juljui 1890 hasse H E sn NYhamulosahamulosehamulosa henrard med rijksricks herb leiden escondidocondidoesconbidoEs 10 aug 1928 meyer 652 lepsJEPS54219 1926 central awn 10 25 mm long santa barbara co santa cruz island N oflateral awnsagns mostly 6 23 mm long sometimes biological station inin central valley 23 apraar 1979shorter 2nan 44 dry hills and slopes 100 800 thorne R F et al 52466 RSAPOMIRSAPOMin elevation COUNTIES butte colusacalusa fresno sonoma co little geysers I11 mimi E of bigglenn kern los angeles madera riverside sulphur creek 10 aug 1984 leitner UCIUCsan bernardino san diego santa barbara stanislaus co vicinity of la grange 30 sepsonoma stanislaus sutlersutter tehama tulare 1961 alienallenailen P sns n AHUC JEPS suttersutler coventura yolo sutter buttes 10 sep 1981 ahart L 3129 NY

trent and allred 1990 documented the tehama co about 5 kmkinkiuklu N of black buttemorphologic variation and similarity ofaristida reservoir and about 17 km NW of orland 26ternipestertipesternipes and A hamulosahamulosehamulosa concluding that the mar 1990 buck R 1469 JEPS jelly s ferryhamulosahamulosehamulosa taxon should be treated as a variety of rd 0.505050 5 mimi from 151 5 exit 16 aug 1991 allredtertipesternipesternipes variety ternipestemipestertipesterntennipeslpes does not occur in cal-ifornia

K W 5467 NMCR tulare co three riversand differs only in the length of the 24 aug 1905 brandegee sns n UC 10 mimi SE of

lateral awnsagns variety hamulosehamulosahamulosa also resembles A portervillePoitpolterville on tule indian reservation rd 28divaricatedivaricatadivaricata which differs most consistently in dec 1964 guthrie L 66 AHUC fountainhaving shorter anthers and lacking pilose hairs springs rd 6.363636 3 mimi W of california hot springsabove the ligule based on numbers of speci-mens

25 jun 1966 twisselmann E C 12537in california herbaria var hamulosahamulosehamulosa is AHUCIAHUC ventura co upper santa ana

unusually common creek santa ynez foothills 13 jun 1957 pol-lardSELECTED SPECIMENS butte co south H M sn taes1taesuTAES yolo co foothills open

butte 10 sep 1981 ahart 1535 ugiUCIUC along slope 2 mi W of winters 24 aug 1953 cramp-tonhwybwy 32 1 mi E ofofchicochleochico 16 aug 1983 ahart B 1600 AHUCAHUCI

L 4277 TAES colusacalusa co 10 mi W of williams 5 jul 1955 burcham L T 317 AHUC acknowledgmentsTAES UCIUC 10.7107107 mi SE of leesville 19 may1958 crampton B 4789 AHUC fresno co I1 am grateful to the friends of the jepsoncitrus grove 11 may 1940 hoover R F 4385 herbarium who provided travel funds for studyUC 8 mi N of orange cove 8 jun 1960 in california to an anonymous reviewerreviewer for a

howell J T 35481 ISC glenn co 5.55555 mi S meticulous critique and to the curators of theof orlandoriand 29 may 1942 beetle A A et al 3353 following herbaria for their helpful cooperationAHUC 5 mi W of orland on the newville and use of plant materials AHUC ARIZ DAV

road 27 may 1914 heller A A 11432 US JEPS RSAPOM TAES UC and US geoffreykern co lowest slopes of the tehachapi mts levin of the san diego natural history15 mi S of bakersfield 14 apraar 1942 beetle museum provided valuable assistance by track-

ingA A 3017 AHUCAHUCI 15 mi S of bakersfield down pertinent collection information paul7 jun 1946 beetle A A 4679 UCIUC los ange-les

peterson of the smithsonianSmithsoman institution andco alta dena 2 apraar 1905 grant 66645966 6459 james P smith of humboldt state university

ARIZ RSAPOM ugiUCIUC pomona I11 jul 1937 took time to locate specimens and informationhorton 448 UCUCI liveoak canyon san gabriel and john R reeder and richard felger of themts 15 apraar 1934 wheeler L C 2525 AHUC university of arizona generously shared withmadera co near raymond on sheep ranch me before publication their observations on11 may 1934 wilson E sn AHUC river-side

aristida calicailcalifornicacahformcafornica the illustrations wereco 10 mi N ofofpalaokpalapalapaia 17 mar 1964 hitch-

cockexpertly rendered by robert dewitt ivey this

C L et al 23113 NY lower san jacinto isis journal article no 1583 new mexico agri-culturalriver canyon yates H S 6710 UC san experiment station


literature CITED HOLMGRENHOLMCKFN P KKWW KEUKENKFUKFN AND E K sc110fieldsc horifld1981 index herbariorumheibanorumHeiba norum pt 1I bohn scheltema and

ABKAMS L 1923 illustrated florafloi a of the pacific states vol holkema utrecht netherlands1I stanfoldstanfordStan foidfold university press stanford california lepsonJFPSONJEPSON W L 1923 A manual of the flowering plants of

alai I1 ii i1 ll11 K W 1984 morphologic variation and classifica-tion

california university of california press berkeleyodtheoftheof the north american aristida purpurpurpureapurpureanea complex musMUNMUNZ PPAA and D D KECKkeggKF K 1968 A california flora

gramGcrammeaeCramrainibainimeae Britbnttonia36brittoniabrittaniatonia 36 382 395 university of california press berkeley 1681 ppap1986 studies inin the annsAfisahnsamttdaafistidaaristidatida grainineaegrammeaeGram meae of the REEDER J R and R S FFLGFR 1989 the aristida

southeastern united states IV key and conspectus californica labradaglabrataglabratelabrata complex gramineaeGrammeae madrofiomadronoMadromadroniofioflo

rhodora 88855 367387367 387 3618736 187 197CLAYTONCIAYIONclaylon W D and S A RENVOIZErl NVOII 1986 genera treniTKFNITHENTtrent J S 1985 A study of morphological variability inin

graininumgrammum grassesglasses of the world kew bulletin addi-tional

divaricate ATIsaristidaanstidaatistidatida of the southwestern united statesseisersel XIII unpublished masters thesis new mexico state uni-

versityI1111IIIilliliI1 ENNKAKOHA H 1 J T 1929 A monograph of the genus aristida versity las cruces 90 ppap

1I mededeelmgenmededeelingen vansvan s bilks herbarium leiden no treniTRFNITHENTtreny J S and K WALLREDWALLKFD 1990 A taxonomic com-

parison58 ofaristida temipesternipestertipesternipeslpes cavcaa andandamftrzffaristidaaristidwAristi dW hamnhamuhemnhamulosehamulosahainulosatoselosatoga

HITCHCOCKllin ll11 K A S 1924 the north american species ofhennhenr sida 14 251 261aristida contributions of the united states national

herbarium 22 517 586HITCHCOCKllin ll11 K A S and A CHASE 1951 manual of the

received 15 1991grassesglasses of the united states united states depart-ment

may

of agriculture miscellaneous publication no revised 21 january 1992

200 accepted I11 february 1992

great basin naturalist 52152j 1992 ppap 53 58

temperature MEDIATED CHANGES IN SEED DORMANCY AND LIGHTrequirement FOR PENSTEMON PALMERI scrophulariaceae

stanley G kitchen I1 and susan E meyer 1

ABSIRAC r1 pentstemonpenstemonPenstemon palmenpalmeri isis a short lived perennial herbheibhelb colonizing disturbed sites inm semiarid habitats inin thewestern USA in this study seed was harvested from sixsix native and four seeded populations during two consecutive yearsin laboratory germination trials at constant 15 C considerable between lot variation inin primary dormancy andlindkind lightrequirement was observed fourweeksfour weeks of moist chilling 1acI1cC induced secondary dormancy at 15 C cold induced secondarydormancy was reversed by one week of dark incubation at 30 C this warm incubation treatment also reduced the lightrequirement of unchilled after ripened seed fluctuations inin dormancy andlindtind light requirement of buriedburled seeds have beenlinked to seasonal changes inin soil temperature penstemonpenstenumpentstemonPen stemonstenum palmen germination responses to temperature appear to besimilar to those of facultative winter annuals

key words seed germination palmerpaimerpahner penstemonpentstemonpenstemon seed hankbank induced dormancy beardtongue penstemonpentstemonPenstemon palmenpalmed

seed dormancy mechanisms function to age stevens et al 1981 numerous popula-tionsensure that germination is postponed until con-

ditionshave been successfully established

are favorable for seedling survival through artificial seeding on a variety of sitesfenner 1985 the level of dormancy of an outside its native range stevens and monsen

imbibed seed is dependent upon its dormancy 1988 this versatility raises questions about thelevel prior to imbibition and on the environmen-tal

establishment strategy of this species in thisconditions to which it has been exposed in study the effects of moist chilling and warm

the imbibed state bewley and black 1982 incubation on seed germinability were deter-minedchilling essential for breaking dormancy in under controlled laboratory conditions

seeds of many temperate species induces vary-ing

the results are sufficiently clear to permit spec-ulationdegrees of secondary dormancy in others about seedbed ecology and have led to

baskin and baskin 1985 conversely warm the fieldwork necessary to confirm the conclu-sionstemperatures increase and diminish dormancy drawn herein

in other species these tetemperaturempeamperaturegrature mediated in laboratory trials on P palmeri young andchanges in seed dormancy are related to the evans unpublished data great basin experi-

mentalseason in which seeds undergo germination and range ephraim utah demonstratedemergence thus spring and fall germinatorsterminatorsgerminators that germination at a constant 15 C was nottend to have opposite responses to chilling and significantly lower than at any other constant orwarm temperatures regimes alternating temperature regime germination

pentstemonpenstemonPenstemon palmeri gray is a short lived over a 28 day period was suppressed at meanperennial herb native to the southern half of the temperatures below 10 and above 25 C alienallenailengreat basin and adjoining regions of the west-ern

and meyer 1990 reported similar results in aunited states cronquist et al 1984 it study of three pentstemonpenstemonPenstemon species and suggested

occurs across a fairly broad range in elevation the possibility of cold induced secondary dor800 2750 m colonizing relatively open early mancy in P palmetpalmeri field sowing of this species

successional sites such as roadreadoutscuts and washes is usually carried out in late fall and is based onindividual plants produce large quantities of the assumption that a cold treatment is requiredseed that remain viable for several years in stor to break dormancy stevens and monsen 1988

US dpartapartdepiitmentotagiimltiiietofagr iture foforestfott siSservicei intintel mountain 11llarchkeseucliarch station sinnishridchrid sclescieselescienceses laboratorylaboi itoizitoiy provo utah 84606

53


METHODS 100 X 15 mm petri dish blottersbloatersBlotters were moist-ened to saturation with deionized water

seed acquisition experimental units assigned the same pretreat-ment and light regime were randomized in stacksripened seeds were harvested from ninenine pop-

ulationsulat ions inin 1986 collections were made from of 10 A blank dish blottersbloatersblotters but no seeds was

eight oftheodtheof the original and one new population in placed on top of each stack that would receive1987 table 1 four of the populations were light ensuring that all seeds would receive lightfrom roadside seedings outside the native range of through the sides of the dish only light intensiintenseintensitythis species the genetic origin of the artificially inside the dishes was 25 microeinsteins m 2

secseeded populations isis unknown each collection PAR each stack was enclosed in a plastic bag andwas cleaned using standard techniques and stored loosely sealeda4thsealed with a rubber band to retain mois-

tureinin envelopes at 20 C room temperature and facilitate handling

viability determination during pretreatment stacks were placed incardboard boxes each of which was enclosed inan estimate of viability for each 1986 collec-

tionan additional plastic bag after pretreatmentwas obtained using a tetrazolium chloride

TZ test four replications of 25 seeds from stacks assigned the light regime were removed

each collection were imbibed overnight each from their boxes and randomly arranged in the

seed was pierced and placed inin a I11 TZ solution growth chamber directly beneath fluorescentat room temperature for 24 hours embryos lights the remaining boxes were placed in thewere then evaluated for viability using estab-lished

growth chamber and were not opened until theprocedures grabe 1970 end of their germination period

gibberellicgibberellinGibberellic acid GAs effectively breaks dor-mancy

seeds with radicle extension 1 mm wereinin P paipalpalmeriineri seeds young and evans counted as germinated experience with this

unpublished data great basin experimental and other penstemonpentstemonpenstemon species has shown this torange ephraim utah four replications of 25 be a clear indicator of the initiation of seedlingseeds for each 1986 collection were imbibed inin

I1 development A germination percentage was250 L ga3gaa germinationmg temperature was determined for each replicate dish germina-

tiona constant 15 C germination percentages

arcsine transformed forweredetermined after 21 days showed no significant percentagesstatistical resultsdifferences between TZ estimates of viability analysis experimental weresubjected to analysis of variance proceduresand germination percentages inin GAs hence

in the of appropriate to the completely randomizedgermination m casGAs was only measureviability employed with 1987 seed design because of the collection X treatment

interaction in the analysis of variance each col-lectionexperiment I1 and treatment was analyzed indepen-dentlyexperiment I1 was started on I11 june 1987 significant differences among treatment

mean time after harvest date was approximately and collection means were determined usingninenine months table 1 the experiment was the student neuman keul SNK methoddesigned to determine the effect of three tem-peratureperaturetuie pretreatmentspretreatments on germination of seed experiment 11IIfromflom the ninenine 1986 collections under two light A second experiment was started on 14 octo-

berregimes pretreatmentspietreatmentsPrePie treatments included 1 chilling 1987 using nine fresh 1987 collectionsfforr 28 days atlittitbit I11 C 2 incubation for 7 days at 30 table 1 mean time from harvest was approx-

imatelyC 3 chilling for 28 days at I11 C followed by one month the objective was to deter-mine

incubation for 7 days at 30 C and 4 no pre the effect of 30 C imbibed on primarytreatment germination temperature and dura-tion

and of fresh seeddormancy light requirementfollofollowingfollowinywinowinY pretreatment was a constant 15 Cfor the 12 hr the methods were the same as those used in the21 days light regimes were aphotoperiod and constant darkness first experiment with three exceptions only one

each pretreatmentpretreatmentlightpretieatmentlightlight regime combination pretreatment was used 30 QC the length of thewas replicated four times for each of the nine pretreatment was 14 days and the length ofcollections replicates consisted of 25 seeds germination was 28 days light and dark con-

trolsplaced on top of two germination blottersbloatersblotters inin a no warm incubation were again included

199219921 PENSTEMON PALMERI SEED germination 55

TABLE 1 location and harvest dates for 10 populations 18 collections during two years ofP palmeripalmen all populations areinin utah except the mountain home population inin idaho

harvestharve st date

collection lat N long W elevation m 1986 1987

snow s canyon 3712 11339 1080 814

browse 3721 11315 1350 822 814

leeds 3714 11321 1050 88 814

zion 3714 11254 1740 822 914

kolobdolob road 3716 11306 1440 88 913

utah hill 3708 11347 1380 88

mountain home a1 4257 11505 930 813 827

mercur canyon a1 4025 11210 1650 1215 922

salt creek canyon a1 3942 11145 1740 910 1010

nebo loopa1 3952 11140 2100 1026 1010

artificially seeded populations from outside the naturalnatur il range

RESULTS experiment 11II

I1 in the first experiment there was a slight trendexperiment

in the more dormant lots for germination to behigher after warm incubation relative to thefour weeks of chilling reduced germinationcontrol the second conductedin light significantly below the level of controls experiment wasto determine if warm incubation could break

for six of the nine collections table 2 incuba-tion

the primary dormancy of fresh seedsat 30 C caused no significant change for

contrary to what was expected for fresh seedgermination in light when compared to the con-trol

0onlyniy two of the nine 1987 collections showedwhen the four week chill followedwas by table thesignificant primary dormancy 4

one week at 30 C mean germination percentage increase in germination percentage followingwas only slightly lower than that of the control warm incubation was significant when com-

paredthis indicates that incubation at 30 C effectively to the nonincubatedincubatednon light control for onereversed the secondary dormancy induced by of these collections in the remaining collec-

tionschilling in addition incubation at 30 C substan-tially

neither the light control nor the lightincreased the dark germination percent-

agewarm incubated germination percentages were

over the dark control table 3 the 30 C significantly different from total viability esti-mateswarm incubation was much less effective in determined by germination in GAs

removing the light requirement when preceded the variation in dark germination was similar

by chilling to that observed in the first experiment withafter seed table 4 the effect of15 C ripened warmgermination rate at was only slightlyincubation on dark germination was not as clearincubationandaccelerated by chilling warmas inin the initial experiment germination of thepretreatmentspretreatments data not shown mean germi-

nation warm incubated seeds resulted in a mean netfor the light control treatment after sevenincrease over nonincubatedincubatednon dark controls of

days was 15 indicating that most essentially only 11 four of the nine collections showednondormantdormant seeds considerablenon required a significant increases while one showed aperiod of imbibition before germination was decreasepossible four weeks of chilling and one weekof warm incubation increased the proportion of discussionseeds that germinated by day 7 to 24 and 28respectively however a major fraction of the moist chilling for four weeks caused varyingseeds still required more than one week of con-stant

degrees of secondary dormancy in P palmeriimbibition at 15 C to germinate seed collections incubation at 30 C clearly


TAISI I1 2 germinationcelceigel initiation i responseespouse ofnineof nine aftcrripencdaftel npenedopened collections ofeof P palmeri seed to moist chilling 1 I1 C for 28 daysclays andwarinwaiwar in incubation 30 C foifol

1

7 days the germinationgenni nation period was motfotfor 21 days at a constant 15 C withvathmath a 12 hr photopenodphotoperiodgerminationgeigel ininationnationinvinationini inin 250 ing 11 gaicai was used as an estimate of total viability for each collection

s 1mean germination percentagepeipel centage

pretreatment

collection control I1ac1cC 30 C I11c30cc30 C GAs

13biowsebrowserowse goa 41b 92a 86a gialeedslceds 89a 38c 92a 73b 93a

zion 72a 73a soa 71a siakolobroadKolobRoadroadnoad gsa 63b goa 86a 97a

utah hill 89a 39b ssa 78a 82a

mountain home 88ab 651 89ab stab 92a

mclMCImelmeiciumeichucur canyon 86b 21c 87b sib 99a

salt creekcleek canyon 58b 55b soab 72b 92a

nebonebolooploop 75a 38b 84a soa 89a

means 82b 48d 87b 79c gia

withinWll lilii ai nil011niiounoll1 tion IIK bansiiislollowctlbyllk101lo d by th s nikUIKniu itur1tursturit hi i mvin not significantlysignititsigni fietitfle mtlyatly difdlfditfcflreiittent atil the p1 0551cvtlsnk1 d SNK

broke11 oke cold induced secondary dormancy inin subsequently light sensitivity is strongly influ-encedafter ripened seed and there isis some indication by conditions during ripening cresswell

that it can reduce levels of primary dormancy as and grime 1981 gutterman 1982 and maywell the warmwarrn induced reduction inm light vary considerably among the seeds of a singlerequirement was less pronounced for fresh plant silvertownSilvertown 1984 the PF palmeri seeds incompared to after ripened collections these experiments demonstrated three levels of

the response of P palmen seeds to moist response to light suggesting variable levels ofchilling and warmwarin incubation parallels those total or active phytochromephycochrome in the seeds someobserved for fall germinagerminatorsgermmatorsterminatorstors winter annuals seeds germinated in the dark while othersbaskin and baskin 1985 this isis supported by required light and a few remained dormant

the lack of primary dormancy in freshly har even with light the proportion of seeds thatvested seeds nevertheless a significant portion could germinate in the dark was increased byof the seeds was not induced into secondary incubation at 30 C table 3doidoldormancymancymaney during chilling this suggests that late light sensitivity can be altered by temperawinterearlywinter early spring germination of some seeds ture shifts during seed imbibition toole 1973is likely it isis of little surprise that recently franklin and taylorson 1983 this may be dueemerged seedlings were found inm P palmeripalmen to temperature effects on the productionpopulations in both spring and fall such destruction or dark reversion of phytochromephycochromebimodal germination patterns are typical of fac-ultative

temperature shifts may also alter other factorsultative winter annuals baskin and baskin associated with phytochromephycochrome action thus1985 and would be selected for inin unpredict resulting in an increase or decrease in lightable habitats where the best season for seedling sensitivity hendricks and taylorson 1978 sug-

gestedsurvival may differ from year to year silvertownSilvertown that temperature effects on phytopayto1984 such germination patterns would also be chrome action in seeds may be due to changesadaptive for species that colonize different kinds in membrane fluidity it is likely that the effectsof habitatsofhabitats with varying degrees of threat from of temperature on light sensitivity in seeds are afrost and drought both situations occur within result of more than one process acting in concertthe range of P palmenpaitpalTnerinerlnefi A light requirement may help determine

given its small seed size plummer et al season of germination for buried P palmeri1968 a light requirement for germination ofpofaof P seeds habitats with adequate winter snows propabbenpabnenpabrieri isis not surprising fenner 1985 the vide enough moisture for spring germination oflevel of active phytochromephycochrome inin dry seeds and surface seed long periods 8 16 weeks of

199211992 PENSTEMON PALMERI SEED germination 57

tailleTABLF 3 the effect of chilling 1 C for 28 days warm incubation 30 C for 7 days and chilling followed by warmwannincubation on the light requirement of ninenine after ripened collections of P palpaipalmenineri the germination temperaturetemperatuietule was 15 C

germinationgermi nation percentagek i

light darkdar k

collection control control 1ac1cC 30 C I11 c30 C

browse goa 56c 32d 75175b 17e

leeds 89a 45c 16d 68168b 13d

zions 72a 37c 35c 55b 24c

kolobdolob road 95a 49c 3ic31cbic 771 34c

utah hill 89a 41b 23b 70a 331

mountain homehorne ssa 54b 59b 87a 65ab

mercur canyon 86a 42b 6cac 83a 38b38h

salt creek canyon ssa 26b 34b 76a 46ab

nebo loop 75a 12c 8cac glagia 35b

means 82a 40c 27e 72b 34d

within ai waw1collection1itlotio nlme z ins f11followsfollowc d1 lyby ththotheiho sasimcletteiitt r wvlielretre notootot sigmficsignifisignify intlychffeodydoyfly diff lentt atatliettliettthllelieile 1 05 levo111 1 SSNKN K

TABLETABLF 4 primary dormancy light requirement and the effect ofwarinof warm incubation 14 days at 30 C on the germinationof nine fresh collections ofofeP palmeripalmen seed the germination period was 28 days at 15 C light treatments received a 12 hrphotopenodpbotoperiodphotoperiod germination inin GA 250 ingmg 11

1

was used as a measure of viability fortorlor each collection

germinationgerrrberrrenationunation percentagek

controlcontgont rolroi 30 C pretreatmentpretipretl eatmentestmenteatment

collection light dark light dark galgaicalsnowssnows canyon 94a64a 31b 85a 341 97a

browse 86a 25c 80a 53b 93a

leeds gia 35b gia 51b 92a

zions toa 38b 72a 24c 74a

kolobdolob road 83a 30b ssa 171 87a

mountain home 96a 56b 87a 66b 94a

mercur canyon 87a 58b 87a 76a 94a

salt creek canyon 77be77bc 45d 861 67c gsa

nebo loop 55b 16c 74a 40b siameans 82b 37d 83b 48c goa

witlnnVANwnmwitlin a collectionf tio inemsineasea follfolifollowedd by thetiietile saime letterietteritte mne notot ligniticsigniticsignipifiantlyitic intlyantly ditteientdfffnt atettlietttliethe 1 05 ielleelleeilellei SNK

moist chilling reduce the time needed for ger buried seeds with a light requirement are func-tionallyminationnationaminationmi to occur thus increasing the chances tionally dormant and would contribute to the

of spring germination and seedling establish-ment

seed bank apparently chilling does not reducefrom seeds not induced into secondary the light requirement in P palmeri seeds while

dormancy kitchen and meyer unpublished warm incubation eliminates it in a significantdata on file at the shrub sciences laboratory fraction ofthe seeds table 3 this suggests thatprovo utah rapid drying of the soil surface buried seeds may be more likely to germinate inwould make the germination of surface seeds the fall after experiencing sufficient warm incu-

bationfollowing summer or autumn rains less likely to eliminate their light requirement


whether current year P palmeri seeds germi-nate

literature CITEDin the fall or spring may depend as much

ALLENALLFN P S and S E MEYERMFYFR 1990on time of seed dispersal as temperature and temperaturerequirmentsrequirements for seed germination of three penstenwnpenstemonpentstemonbenPenstemonmoisture conditions that follow the collectionS hortscienceHortScience 25 191 193

dates for each table 1 and field speciespopulation BASKBASKININ J M and C C BASKIN 1985 the annual dor-mancyobservations regarding the timing of fruit dehis-

cencecycle inin buriedburled weed seeds a continuum bio-

sciencesuggest that populations from areas with 35 4924929849898

milder winters lower elevations tend to ripen BEWLEYBEWLFY J D and M BLACKBLAC K 1982 physiology and bio-chemistryand disperse seed during late summer at higher

of seeds vol 2 springer verlag berlinberhnCRgresswellCRFSSWFLLSSWELL E G and J P GRIME 1981 induction of a

elevations where cold weather would occur ear-lier

lightfighthightdight requirement during seed development and itsseed ripening and dispersal are delayed ecological consequences nature 291 583 585

habitats with mild winters and unpredictable CRONQUIST A A H HOLMGRENHOLMGRFN N H HOLMGRENHOLMGRFN J LREVEALRFVFAL and P K HOLMGRFN 1984 intermountainspring moisture seem to favor early dispersalflora vol 4 the new york botanical garden newand fall germination such sites select for the york

maintenance of a seed bank because extended FFNNFR M 1985 seed ecology chapman and hallperiods of drought are typical and conditions for londonsuccessful establishment may not be met for FRANKLIN B and R TAYLORSON 1983 light control of

many years cold induced secondary dormancy seed germination pages 428 456 in W shropshire andH mohr eds Photo ofand burial of light requiring seeds should facil-

itate

photomorphogenesismorphogenesis encyclopediaplant physiology new series vol iga springerspnngerspanger

the buildup of this soil seed reserve in verlag berlinhabitats with more severe winter conditions dis-persal

GRABF D FpedFFDED 1970 tetrazoliumTetrazohum testing handbook for

is retarded and spring germination of a agricultural seeds handbook on seed testing contri-butionportion of the seeds is both probable and less 29 association of official seed analysts

GUTTERMANGUTIFRMAN Y 1982 phenotypic maternal effect ofphoto-periodrisky the of a seed reserve throughpreservation on seed germination pages 67 7979wain A A khan

cold induced dormancy may also be important ed the physiology and biochemistry of seed develop-mentin these more mesic habitats dormancy and germination elsevier biomedi-calpenstemonpentstemonPenstemon palmeri appears to be adapted for press new york

HFNDRICKS S B and R B TAYLORSON 1978 depen-dence

establishment in a variety of habitats two phe-nomena

of seeds membranephytochromephycochrome action in onare important in this success first organization plant physiology 61 17 19

individual seeds seem to be capable of respond-ing

PLUMMERPLUMMFR A PPDD R christensen AND S B MONSFN

appropriately to different environmental 1968 restoring big game range inin utah utah statestimuli second variability in germination department of fish and game publication 68368 3

SILVERsilvertownsilvfriownTOWN J W 1984 phenotypic variety inin seed germi-nation

response among seeds within a population isbehavior the ontogeny and evolution of somaticindicative of a bet hedging strategy increasing polymorphism in seeds american naturalist 124 1 16

the chances for successful establishment across STEVENSSIFVFNSsievensslevens R K R JORGENSFNJORGFNSFN and J N DAVIS 1981

a range of variabevariable and unpredictable environ-ments

viability of seed from thirty two shrub and forb specieshabitat related between population through fifteen years of warehouse storage great

basin naturalist 41 274 277variation in germination timing mechanismsSTEVENSSTFVFNS R and S B MONSEN 1988 cedar palmer

appears to be relatively unimportant penstemonpentstemonpenstemon a selected penstemonpentstemonpenstemon for semiarid rangesrangelandslorangelandsRangelandslOsio10 163 164

acknowledgments TOOLF V K 1973 effects of light and temperature andtheir interactions on the germination of seeds seed

this research funded science and technology 1 339 396was in part by grantsfrom the pittmpittmanan robertson federal aid towildlife project w82 R and the utah depart-ment

received 25 october 1991of agriculture accepted 23 november 1991


LATE quaternary arthropods FROMTHE COLORADO PLATEAU ARIZONA AND UTAH

scott A elias1jim 1I mead2 and larry D agenbroad 2

abstbactabstractabstABSI RA late quaternary age arthropods were recovered from dry cave deposits and pankratpackrat middensbiddens located inin thegrand canyon canyonlandsCanyonlands and glen canyon region of the colorado plateau this quaternary data resource has notbeen analyzed before from the colorado plateau national parks radiocarbon dates on the variousvarious deposits containingarthropods range fromhornhoin 1510 to 30660 yr BPB P the fossil assemblages yielded 57 identified taxa of insects arachnids andmillipedes including 15 taxa taken to the species level the information from the fossil insect i ecordrecord of the colorado plateauisis not yet sufficiently detailed to permit precise paleopaleoenvnonmentalpaleoenvironmentalenvironmental reconstructions however preliminary conclusionssuggest a cooler moister climatic regime during the late wisconsin glacial and a mosaic ofvegetation types such as grasslandand shrubby communities unlike the present vegetation at the localities

key words quaternary colorado plateau arthropods wisconsin glacial grand canyon caves

this paper discusses the results of a prelimi-nary

rampart cave western grand canyon ari-zonastudy of late quaternary arthropod fossils were the scenes of the first paleoecologipaleoecology

from cave deposits and pankratpackrat middensbiddens from cal studies utilizing dry preserved dung of ansouthern utah and northern arizona this qua-ternary

extinct animal laudermilk and munz 1934data source has not been analyzed 1938 found a wealth of information preserved

before from the colorado plateau although the in the dung of extinct shasta ground slotharid southwest has been the focus of pale nothrotheriopsnothrothenops shastensis later studies con-

cernedoenvironmental studies for approximately half a with dietary reconstructions expoundedcentury antevs 1939 arid climate coupled on the data available from dung of extinct herwith episodic fluctuating water tables has bivoresbinoresbivores including shasta ground sloth mam-

mothproven detrimental to the preservation of most mammuthusMammuthus harringtonhamngtonss mountainexposed fossil remains however the same xeric goat preamoreamnosnos harringtonihamngtomharringtonnharring toni and bisonconditions when coupled with a stable rock bison among others martin et al 1961shelter provide a unique situation dry preser-vation

hansen 1980 davis et al 1984 meadsuch xeric locations provide the preser-

vationorourke and foppe 1986 mead agenbroad

of not only pollen and plant macrofossilsmicrofossilsmacro fossils et al 1986 mead et al 1987 mead andbut also soft tissues and other usually degrad-able

agenbroad 1989remains of animals such as skin hair kera-

tinouspackratspankratsPackrats neotoma rodentia cricetidae

tissues and dung wilson 1942 the build nests surrounded by construction materi-alsstudy of packratpankrat middensbiddens in the southwest has collected from within 30 to 100 m of the

provided a reconstruction of the wisconsin gla-cial

house the construction components are pre-dominantlybiological communities never before plant materials but the pankratpackrat also

observable in such detail see various chapters collects small stones skeletal remainsremains andin betancourt et al 1990 thus an entirely new dung adding to the materials procured by thefield of research has been opened and it should packratpankrat are variousvarious vertebrates and inverte-

bratesprove valuable in understanding the latest who live in the nest and waste pile aspleistocene commensalscommensals periodic house cleaning produces

dry cave deposits were quickly discovered to a waste pile of debris urination on the wastebe a warehouse of late pleistocene information pile a midden ultimately may cement thegypsum cave near las vegas nevada and remains into a rock hard deposit encapsulating

I1

2institute of alpine researchReseuch box 450 university of C coloradooloracloolor atloacloarlo boulder coloradoC aloioloi ado 80309045080309 0450quaternary studies program unciandincl department of geology box 5644 northern arizonaanzona university flagstaff anonarizona j 86011564486011 5644

59


115 1100 105

N V UT

lokelake WYcity

400

grondgrand junction

Sno

E4 cac0

jug17N M

V

BKB K350

flagstaff

albuquerque

CA JAZdazL BKB K bidobida 81 kaetan coves

Zli E escalante riverriven localities

S soltsalt creek conyoncanyon

kmk

r0 loo150

figfi 1 map oftheodtheof the colorado plateau with sites discussed inin text

the contents ofthatof that time when these induratedindurated 1987 ellaseliaseilas and van devender 1990 1991cementedcernented middensbiddens are located in a dry alcove ellaseliaseilas 1990 also recently published the results

rock shelter or cave the contents may be pre-served

of a taphonomictaphonomlc study designed to reveal thefor as long as the shelter exists radiocar-

bonsources and possible biases of insect exoskele-tonsdating of induratedindurated midden layers provides in pankratpackrat middensbiddensmiddens

a chronological framework for the associatedplant and animal remains middensbiddensMiddens then pro-vide

METHODS

a unique examination of local past bioticlocalitiescommunities

the investigation of insect fossils from ancient matrices from pankratpackrat middensbiddens and cave sed-imentspankratpackrat middensbiddens and cave deposits is a new were washed or hand picked for arthro-podapproach that is just beginning to show substan-

tialand other animal and plant remains

results one of the authors SAE recently packratpankrat midden and cave deposits from twoperformed more extensive research on a series cave sites were analyzed from grand canyonofinsectof insect fossil assemblages from packratpankrat mid national park GRCA coconino county ari-

zonadens in the chihuahuan desert regions of west-ern

three pankratpackrat middensbiddens from salt creektexas and south central new mexico elias canyonlandsCanyon lands national park CANY san juan

199211992 quaternary arthropods COLORADO PLATEAU 61

county utah and three packratpankrat middensbiddens and tableTABLFtaille 1 late quaternary deposits and radiocarboni adioadlocarbon dates

one cave deposit from the escalante river from sites on the colorado plateau containing arthropods

region of glen canyon national recreation 14locality C lab numberarea GLCA kane county utah fig 1age

bida cave is a large limestone cave located in grand canyon national park arizonapinyon juniper woodland at 1430 m elevation in bida caveGRCA cole 1990 reported on the pankratpackrat layer 2 296020029609960 200 A 2836

middensbiddens recovered from the cave test pit exea layer 4 1615016 150 600 RL 1135

vationslations produced a multitude of faunal and layerlayel 5 nonelayer 8 2424190190igo 4300 A 2373

floral remains mead 1983orourke1983 orourke and mead 28001985 mead orourke and foppe 1986 kaetan cave

mcvickar and mead ms radiocarbon dates layer 1 1422014 220 320 A 2835layer 3 1750017 500 300 A 2723

spanning from 2960 to 24190 yr BP on varivarlsarivari-ous

layer 5 noneremains are presented in mead 1983 and layerlayel 6 3060030 600goo 1800 A 2722

mead martin et al 1986 those ages from layer 8 none

units listed pankratpackrat midden lb 1710017 100loo 500 A 2719containing arthropod remains are inowl roosttable 1 r2ra 21430 1500 A 3082

kaetan cave is a medium sized limestone 2 none

cave at 1430 m elevation in GRCA mead 1983 canyonlandsCanyonlands national park utahexcavated portions of the deposit in the salt creekcleekgleekgreek canyon packratpankratpac krat middensiniddensbiddensmidiniddensentrance room for the remains of extinct moun-tain

dead owl 1aaa 3830 70 beta 18267

goat oreamnos harringtoniharringtonnharringtoni orourke woodenshoeWooden shoe 1 6980 120 beta 27214hoodoo 1 2766027 660 340 beta 27213and mead 1985 mead orourke and foppe

1986 paleoenvironmentalpaleoen4ronmentalenvironmentalPaleo reconstruction glen canyon national recreation area utahbased on the macrobotanicalmacrobotanical remains recovered escalanteEcalanteiante river regionlegion packratpankratpackrat middensmiddcnsbiddensmiddens

from pankratpackrat middensbiddens and stratified sediments bechan cave 3 1510 t 60 beta 23706cow perfect 1 1820 100 beta 23711

is in mcvickar and mead radio-carbon

manuscript bowns 1 8640 140 beta 23704ages span the period from 14220 to bechan cave 15s 1160011 600goo 1350513 505

30600 yr BP table 1A seriesserlesseriesserles ofdatesof 1I ite s arelie analyzedin ilyllyliyilyedonedon afaitimatimsmanumitliii 0in iinmotlioth adunactunlctel jikiratlitlE erath

three pankratpackrat middensbiddens selected from a series liunlinn shnibsbnibshaib ox lungdurig seesn amvisdmvisdivisctet alil 1985 meadM id agenbroadagenli hicloicl etc t alil 1986 meadmt ulindd agenbrodagenbroadAgenagenbibrodbiod0 id msrscollected from salt creek canyon CANY 1505

to 1755 m elevation have radiocarbon agesspanning 3830 to 27660 yr BPBY today the tragacanth a water soluble glue fragile speci-

mens and duplicates were stored inin vials ofregion is pinyon juniper woodland with sage-brush flats the analysis of the macrobotanicalmacrobotanical alcohol fossils were identified chiefly through

remains and paleoenvironpaleoenvironmentalpaleo environenvironmentalmental reconstruc-tions

comparisons with modemmodern identified specimensofthe middensbiddens is in manuscript mead and inin the USU S national museum of natural history

ageagenbroadabnb road smithsonianSmithsoman institution washington DCD C

bechan cave contains copious remains of some specimens were referred to taxonomicextinct herbivore dung davis etalet al 1985 mead specialists as noted inin the acknowledgmentsagenbroad et al 1986 mead and agenbroad modern ecologicalb requirements and distribu-

tions1989 recovered from floor sediments dating for species identified inin the fossil assem-blages11600 to 1350513505yryr BBPP arthropods were recobrecov were compiled from the literature and

ered from the dung layer and from an isolated from specimen labels in the UUSS nationalholocene age packratpankrat midden in the cave museum all specimentsspecimenspecimensts will be auratedcurated inin thetable 1 other nearby pankratpackrat middensbiddens con national park service repository laboratory of

tainedbained additional arthropod remains dating quaternary paleontology quaternary studiesfrom 1510 to 8640 yr BP program northern arizona university

insects results

fossil insect sclerities were sorted from the fossil assemblages yielded 57 identifiedwashed pankratpackrat middensbiddens and cave sediment taxa of insects arachnids and millipedesmatrices robust specimens were mounted on including 15 taxa taken to the species levelmodified paleontologicalmicropaleontologicalmicro cards with gum table 2 shows the taxa identified from the


tablf2ta13lf2 fossil arthropods identified from bida and kaetan eavescaves GRCA arizona inin minimum number of individualsper sample

bida cave kaetan cave

taxon 2 4 5 8 ibily 5 8 orraorr2 0112dor2aoraa ibibe

coleopteraCARAcarabidaeBIDAr

calosomaCalosoina cf scrutator fab I11agonumagonium chadinerhadineRhadine perlegisperlevisperlevis csycasy 2agonumagonium RhrhadinerhachnechadineRhaadinechneohne sp 1 1

scaraimeidaesakabafioafaphodius nr ruficlarusruficlarus fall 1

aphodius sp 1

onthophagus sp 1

sencaserica sp I11 1 2 1

phyllophaga sp I11 1

diplotaxis sp I11 1

genus indeterminate I11 1 1

s11p111darsllsilsii PIIIDAFthanatophilusrhanatophilus truncatestruncatustruncatus say I11

prinidaeptinidaePrINpi INIDAFIDAEptinisptimsphinis ap I11niptusniptunintu cf ventriculus lec 10 1 9 4

nnidulidaenilnii idulidalgenus indeterminate 1

dehmestidaedermestidaedl KMFS IDAldagenus indeterminate 1 1 1

histeridaeHISTERhist fkiuarIDAEgenus indeterminate 1

ELATelateridaeFRIDAEgenus indeterminate 1

TENEBRIONIDtrnrbrlonidaftenebrionidaftenebrionidaeAFelcocleeleodeseliodesElcocle cf nigrinamgnnanigrana lec 1 4eleodeseliodeseleodessppsppapp 1 1 1 1 4 2 4 1 1

ConiconlconiontiscomontibomontiComonttmontiontis sp 1

meloidaeMFLOIDAFgenus indeterminate 1

melandryidaeMELANDRYmr landhyLANDRYlandryiuarIDAEIUAr

anastisanaspisAnaspis ruparufafa say I11chrysomplidaeclihysomflidafchrysomelidae

lemlilema mlineatnlineaalinea white 1

chaetocnema sp 1

genus indeterminate 1

CURIDAEacanthoscelides sp 1

curculionidaeCURcun ULIONIUAFsapotessapates sp I11ophnjastesophryastes sp 2 1

scyphophorusscyphophorous acupunctatus gyll 2 1 1

onmodeimtorimodenwi protractaprotracta horn 1

cleonidiusCleonidius trivittatustnvittatustrivittatus orC quadnhneatusquadrilineatus 1 1

apieApleapicaplewrusapleurusurus angularisgulans lec I11genus indeterminate I11 1 1

SCscolyiiuaf0 LYTI D A E


nrukopinunruwpreramyrmflontidaemykmrionlidar


homopteraHOMOPI nuCICADIDAE


HEMIPTERAgenus indeterminate 1


TABLE 2 CONTINUED

bida cave kaetan cave

taxon 211 4 5 8 11 5 8 orricorr21orr2c or2oraor211 ibetheib

orthopteraACRIDIUAE


lepidopteralfpidoptfragenus indeterminate 1

hymenopteraAPOIDEA


DIPTERAgenus indeterminate 2 2 8

ARACHNIDAACARI

IXODIDAE

dermacentor andersoniandereoniandersoni stiles 2 1

dermacentorDerinadefinacentor spscorpionida

BUTIIIDAFBUTIHDAEcenturoides sp 1

DIPLOPODAgenus indeterminate 1 1

Nunumbersibers referreberrerer to layer numbers at bida cave1

Nuinnumbersbers lefelrefelrefertoreferioto layernumbersatlayer numbers at kaetan caveowl roost 112

owl roost 2wacTacpackrattackratpankratkrat midden ib

grand canyon region and table 3 lists taxa united states southernsouthem canada and noinornorthemnorthernthemthebidentified from glen canyon the assemblages mexico gidaspow 1959 it has been collectedare dominated by taxa still found today in the from the floor ofofhavasuofHahavasuhamasuvasu canyon GRCA eliasamerican southwest but many of the unpublished data the cave beetle agonumagoniumpleistocene assemblages contain species that perlegisperlevisperlevis fig 2aaa preys on other arthropods itlive today at elevations higher than the fossil is relatively common in caves and near thelocalities As in other pankratpackrat midden and cave mouths of mammal burrows it is found todayassemblages from the american southwest the from the state of chihuahua mexico northwestfossil faunasfaunal are dominated by a few families of to southern arizona barr 1982 this speciesinsects and arachnids the beetle coleoptera found in late holocene assemblages in both thefamilies carabidae ground beetles curculi-onidae

GLCA and GRCA regions was identified fromweevilsweevilyweevils ptinidae spider beetles holocene pankratpackrat middensbiddens from sites in the

scarabaeidae dung beetles and chafers and chihuahuan desert region of mexico elias andtenebrionidae darkling beetles were repre-sented

van devender unpublished data anotherin most assemblages A few packratpankrat and ground beetle from the late holocene record at

other mammalian parasites were found includ-ing

GLCA is discoderusDiscoderus impotens which lives ina tick ixodidae and a bloodsuckingblood sucking bug open country it is common throughout the

reduviidae that are known to parasitize american southwest and is found in thepackratspankratspackrats in their nests A number of the identi-fied

chihuahuan sonoran and mojave desertsspecies merit individual discussion the checkered beetle cleridae cymatodera

pallidahallida fig 2eae is a predator of bark beetles indiscussion of selected species coniferous forests in the chiricahua rincon and

the ground beetles from the fossil assem-blages

huachucaHuachuca mountains of arizona as well as ininclude both cave dwellers and open mountainous regions of chihuahua mexico

ground species the caterpillar hunter vaurie 1952 C hallidapallida was found in a latecalosoma scrutator was found in a late pleistocene sample from the grand canyonholocene assemblage from the grand canyon the dung beetle scarabaeidae aphodiustable 2 this beetle is widespread in the nufirufirufrujiruficlarusrufwarusclarusWarusciarusclafuswanus was found in a late pleistocene


talliTAISI 1 3 fossil arthropods identified from the canyonlandsganyonlandsCanyonGanyon lands and glen canyon region utah inin miniminimummurn number ofindividuals perpelpei sample

canyCANV glcabglaabGLCA

taxon DOIA WSI HDI bc31 CPIC PI bl131illili bc15s

coleopteracoigoigol i on i HA

carabidaeCAKABIDAICABABIDAE

Agotagostionaonuinagottiontion Rhrhudinerhddinerhadineadine herleviperleviperlevisperlevislevi csycasy 2amanaamara sp 1

Discodiscodernsdcodcruderusderns impotentintpotens lec I1genuscenus et sp indeterminateindetei inmate 1

scarabaemaesahahai1da1aphodiusactsartsacasac1s sppapp 2Ataataeniusaiaciwienius sp 2

serusericasermi spmelolontha spdiplotaxis spgenus et sp indeterminate 1

PTIpi INIDAIN 11 A E

niplenipluniptits sp 10 1 1 2Itpenniptnniithillshills sppapp I1

Eeli ATEA I1 1111lillilliIUDAIA Fgenuscenus et sp indeterminate 2

birbinbyrliy 1111111id II11 DA F1

genusgennscenusgenusitspet sp indeterminateTENtl nan1EBbhionmal1110liloiklo N 11 A V

eleodeseliodesJ leorleocltleocleoclelt sppapp 1

coniontiscomonucomonsConiconlontis sp I1genus et sp indeterminate I11

111elleilHMIM E STIs 1 IDAIidal1 A F

genus et sp indeterminatemdetei inmate I11C I111hysomi111iiiili Y S 0 M E 1 IDAIidal11 A E

alticaaltufiatticaalturi sp I1pachybrachisafipfi liihraclti sp 1

gennsgenus et sp indeterminatemdetei mmateamate 1

01 F1 itll1111itilKIDAIA F

cyinatoderaC iiiifiiodem hallidapallida sdifiischferschaer110lioiloHOMOM 0 PTEpyePI 1 RHAA

11rlIDDUVIIDAIU V I1 11 A E

triatoinatruitovwTriatoina spll11LE ilpidoFIDObido1 0 PTEI1 I1 RHAA

genus et sp indeterminate 1

I1ihIY MmlE NNOP0 PTE11 BKAA

foFOKMKii m I1 C 11idalIDAIA E

formicaformic i sp 1

ANYCANY cz uiyoiiliiuisnitioinlpukyonyouyoulandeyoulandslands natinndNatin nd park

IA1 A ciencionli 11 canyouiyoii nationalN ilion il rmrationRmneenkeenneerrationinon Aan i

sitssilcsintSilc sintsinoin canyonlandsCanyoniiiiiliiii illands arIK ixiadoi1x1aA dadD iclowlla01 IA ws1wsk nvoodwoodenslxxsh 1 1 IDInuiidl 1100flooiloodoofloodooldool1isitsi s inin glenclencienloiidilot uini mv111 bcdbc3 lkjiin ca v 3 CNC PIN Cdmo ptecjpdftltl1 bl131isilsi 13bowns 1 13c15sB 15s beambedmbcllimccavcaaic 15s

assemblage from GLCA this beetle lives today peck and kaulbars 1987 T truncatestruncatustruncatus wasthroughout much of western north america found only in a late holocene assemblage fromfrom saskatchewan inin the north to new mexico the grand canyonarizona and california inin the south at the the spider beetle ptinidae niptus ventric-

ulussouthern limit of its range it lives inin mountain-ous

is a scavenger that ranges from texas west-wardregions to california and south through mexico to

the carrioncarrloncalcai non beetle silphidae thanatophilus guatemala it probably breeds in rodent neststnincatustmncatus fig 2bab lives inin the southwestern modern specimens have been collected fromUSU S and northern mexico in habitats spanning packratpankrat nests and from the fur of kangaroo ratsaltitudinal gradients from grasslands and and dipodomys sppapp brown 1939 papp 1962 thisscrub desert through oak pinyon juniperjumper wood-lands

beetle species was common in several assem-blagespine forestsfoiloilol ests and montane meadows from GLCA

19921 quaternary arthropods COLORADOULORADO PLATEAU 65

V

fig 2 scanning electron micrographsmicrographymicro graphs of fossil beetles from sitessltes discussed in text A head capsule pronotunfl and elytraclytraof agonumagonium perpefperlegisperlevislevis from the bowns pankratpackrat midden glengien canyon B pronotum of than atophilus truncatestruncatustrun catuscafus from bidacave grand canyon C pronotum of eleoda3 nighnanighta from kaetan cave grand canyonganyon D exoskeleton ofanaspisrufafrornbrorn bida cave grandcrand canyon E left elytron of cyinatodeva hallidapallida froin I1 loodooboodoo packratpankrat midden Canyonganyoncanyonlandslands sealescalebar equals 1 in in

the darkling beetle tenebrionidae eleodeseliodes or C quadrilineatus all from the grand canyonnigrananigrina fig 2cac was found in a late assemblage of these 0 protract a was foundloundpleistocene assemblage from the GLCA this only in the late holocene A ananuanngularislarislaresianes and Cseavenscavenscavengerer is known today from the pacific trivittatustrivittatus or C quadrilineatusquadrifineatus were found onlynorthwest south to the mountains ofarizona it in the late pleistocene and S acupunctatusactipunctatus wasis a cold hardy species found at elevations up to identified from both periods 0 protracta lives3050 m in the colorado rockies blaisdell at elevations from 2250 to 2700 m in the moun-

tains1909 of arizona it is a soil dweller that feeds onthe false darkling beetle melandryidaeMelandryidae roots R S anderson national museum of

anaspisanastis hifanifahipa ilcpigpicficfig031171030 2dad is widespread today natural sciences ottawa written communica-tionbeetles in this family are found under bark in july 1990 A ananugularisianislaris C trivittatustrivit tatus and

fungi and in decaying logs liljebladli1jebladliljeblad 1945 C quadrilineatus are all widespread todaythe leaf beetle chrysomelidae lema throughout western north america while S

tritrlfritrilineatrifineatrilineartriflineainea feeds on datura jimson weed and acupunctatus has been collected from arizonaother plants in the southern half of the united and mexico where it feeds onaaveononAagaveaoeaohave dasylirionstates it was identified from a late pleistocenePleistocene sotol and lophophora peyote R S ander-

sonassemblage in the GRCA other plant feeding national museum of natural sciencesbeetles identified from the fossil assemblages ottawa written communication july 1990include the weevilsweevily curculionidae scyphoscipho finally the tick ixodidae dermacentorphoruschorus acupunctatus modemaorimodemaOri pntractaprotractaprotracta andereoniandersoniandersoni is found today in the western unitedapleurusapleumsApleapieurushrus anguangularislaTis and cleonidiuscleonichusCleonicCleonidiushusbus trivattatus states as far east as montana immature


D andersoniandereoniandersoni parasitize small mammals while acknowledgmentsthe adult stage parasitizes large mammals thistick is a vector for rocky mountain spotted fever the scarab beetle aphodius rujirufinufimficlamsruficlarusciarusclarus wasand colorado tick fever J keirans national identified by robert gordon US departmentinstitutes of health bethesda maryland writ-ten

of agriculture and US national museumcommunication june 1990 washington DC the weevilsweevilyweevils scyphophorusscyphophorous

acupunctatus orimodemaoriffwdemamodemaOriorl protract a cleopaleoenvironmentalPALEO ENVIRONMENTAL nidiusfidius trivittatustrivittatus or C quadrilineatusquadrifineatus and

interpretations apleurusApleurus angularis were identified by robertanderson national museum of natural sci-encethe information from the fossil insect record of ottawa the tick dermacentorandersoni

the colorado plateau region is not yet sufficiently was identified by james keirans national insti-tutesdetailed to allow precise paleoenvironmentalpaleoenvironmental of health bethesda maryland we appre-ciatereconstructions however for both the grand the help of emilee mead paul martin

canyon andlindtind glen canyon regions the available bob euler and bill peachy scanning electroninsect data suggest a cooler moister climatic micrographsmicrographymicrographs of insect fossils were takena4thtaken with theregime during the late pleistocene montane assistance of james nishi and paul carrara U Sadapted species lived at lower elevations the geological survey denver emilee meadinsects document the presence of conifers at the drafted the figures financial support for thissites but also suggest that a mosaic of vegetation study was provided by national science foun-

dationtypes was locally represented including grassland grants EAR 8708287 and 8845217 toand terrain the shift to cli-

matesshrubby postglacial mead and agenbroad and national park ser-

viceoccurred sometime after 14000 BPBE andyr contract CX 1200 4 ao62a062 to agenbroadthe most arid conditions to have developedappear thanks are also extended to the staff at ralphwithin the last 1500 years additional studies of

M bilby research center northern arizonaregional insect assemblages will undoubtedly clar-ify

university for theirif the nature and timing of environmental support

changesliterature CITEDalthough preliminary and incomplete in

nature the arthropod data presented here are antevs E 1939 studies on the past climate inin relation toin agreement with the detailed plant recon-struction

man inin the southwest carnegie institution of wash-ingtonst provided by the macrobotanicalmacrobotanical year book 38 317 319

remains from the pankratpackrat middensbiddensmiddens cole 1990 BARRBAIMbalm T C 1982 the cavernicolous anchomemineanchomemmeanchomemme beetlesof mexico coleoptera carabidae Agoagoniniagonimagonicnini texasconcludes that a comparison of modern and memorial bulletin 2816128 161igiigl 192

full glacial assemblages from the eastern GRCA betancourt J L I1 R VAN DEVENDFR AND P S

packratpankrat middensbiddens demonstrates that individual MARTINMARIINmarlin 1990 packratpankrat middensbiddens the last 40000 years

plant taxa and comparable communities shifted ofofbioticbiotic change university of arizona press tucson

upward approximately 800 in at the close of the 467 ppapBLAISDELLBLAISDFLL F E 1909 A monographic revision of the

wisconsin 11000 BRBP coleglacial ca yr coleoptera belonging to the tenebrionidae tribe ele1990 concludes that the climate at the eleva-

tionsodiini inhabiting the united states lower california

of bida and kaetan caves was more conti-nental

and adjacent islands bulletin of the united states

during the late glacial this result is in national museum 63163 1 524BROWN W 1939 boield and allied inJ niptus genera incontradiction to the equable climates that may north america coleoptera ptinidae canadian

have occurred and lower elevationin western entomologist 91 627 633regions of the GRCA and to the south of the COLECOLF K L 1990 late quaternary vegetation gradientscolorado plateau mead and phillips 1981 through the grand canyon pages 240 258 in J L

betancourt I1 R van devender and P S martin edsvandevender 1990 our arthropod data pre-sented

packratpankrat middensbiddens the last 40000 years of biotichere do little to the continentalclarify vs ofchange university arizona press tucson 467 ppap

equable climatic reconstruction contradiction DAVIS 0 K L D agenbroadAGFNBROADAFNBIIOAD P S MARIINMARTINmablin AND J 1I

our 11cooler moister climatic regime recon-struction

MEADMFAD 1984 the pleistocene dung blanket of bechan

st could be interpreted as a continental cave utah pages 267 282 in H H genoways andM R dawson eds contributions in quaternary ver-tebrateclimate however it could also represent a regime paleontology a volume inin memorial of john E

with slightly cooler winters and cool summers guilday carnegie museum of natural history specialand therefore more available moisture publication 538 ppap


ELIAS S A 1987 Paleopaleoenvironmentalpdleoenvironmentalenvironmental significance of late MEAD J I1 L D ACFNBROAD 0 K DAVIS AND P S

quaternary insect fossils from pankratpackrat middensbiddens inin MARTIN 1986 dungofdungogdung of mammuthusmaininuthusMammuthus inin the and southsouth central new mexico southwestern naturalist west north america quaternary research 25 121

3238332 383390390 127

1990 observations on the taphonomy of late MEADMFAD J LI1 L D agen1311oadAC FNBROAD A M plfllipsPHIL LIPS AND L Tquaternary insect fossil remainsremains inin pankratpackrat middensbiddens of MIDDLETONmlddlr i ON 1987 extinct mountain goat oreamnosi

the chihuahuan desert palaiospalaioslalos 53565 356 363 harringtoniharnngtoniharringtonnharring toni inin southeastern utah quaternaryELIAS A T 1990 fossil research 27 323323333333S AANUTAND R VAN DFVENDFR insect

MEADMFAD J I1 P S MARTINmabiMAPI IN R C eulerEULFReuleil A lomlowlknlanirn A J Tevidence for late quaternary climate change inin the bigJULL L G TOOLIN D1 J DONAHUE AND T Wbend chihuahuan desert texas quaternaryregion LINICK 1986 extinction of Harringharringtonsharnngtonsharringtonatons mountainresearch 34 249 261goat proceedings of the national academy of science

1991 insect fossil evidence of late quaternary 8383683 836 839environments in the northern chihuahuan desert ofin MIADMEADMI AD J I1 M K orourkeOROURKF ANDANDTT M foppe 1986 dungtexas and new mexico comparisons with the paleobo-tanical

and diet of the extinct harringtonharnngtonss mountain goatrecord southwestern naturalist in press oreamnos harringbarringbarvingharringtonihamngtomharringtonntoni journal of Manimamammalogylogytogy 67

GIDASPOW T 1959 north american caterpillar hunters of 284 293the genera calosoma and Calliscallisthenescalhsthenesthenes bulletin of the MEAD J I1 AND A M PIIILLIPSPHILLIPSphilllps 1981 the late pleistoceneamerican museum of natural history 116 227227343343 and holocene fauna and flora of vulture cave grand

HANSENHANSFN R M 1980 late pleistocene plant fragments in canyon arizona southwesternSouthwestei n naturalist 26 257the dungs of herbivoresherbivores at cowboy cave pages 179 288189 inin J D lenningsjennings ed cowboy cave vol 104 orourkeOROURKF M K AND J 1I MEADMFAD 1985 late pleistocene

university of utah anthropological papers and holocene pollen records from two eavescaves inin thelaudermilk J D AND P A MUNMUNZ 1934 plants inin the grand canyon of arizonaanzon i USA pages 169 185 in B

dung of nothrothenumnothrothetium from gypsum cave nevada jacobs PR fall and 0 davis eds pleistocene and

carnegie institution of washington publication 453 holocene vegetation and climate of the southwestern

31313737 united states american associate of stratigraphic pa

1938 plants inin the dung of nothrothenumnothrotherium from lynologists foundation special contribution seriesserlesseisel iesles 16PAPPpmj C S 1962 an illustrated and descriptive catalogue oframpart and muavjuav caves arizona carnegie institu-

tionthe ptinidae of north america deutsche Entomoloof washington publication 487 271 281gische Zeitzeltzeitschnftzeitschriftschrift 9 367 423123

LILJFBLAD E 1945 monograph of the family mordellidaePECKPFCK S B AND M M KAKAULHAKSU lii111 A RS 1987 A synopsis of the

of north america north of mexico mis-cellaneouscoleoptera distribution and bionomics of the earrioncarrioncarrloncarrionearrion beetles col

cel laneous publications of of mlehmichzoology universityuniversityofmich eopeopteiaeopteratera silphidae of the conterminous united statesigan 6220562 205203 219 proceedings of the entomological society of ontario

MARTIN P S B E SABFLS AND D SIIULTER 1961 11847118lis 47 81rampart cave coprolite and ecology of the shasta VAN DEVENDFRDFVFNDFR T R 1990 late quaternary vegetationground sloth american journal of science 259 102 and climate of the sonoran desert united states and127 mexico pages 134 165 inin J L betancourt T R van

MCVICKARM vi KARkah J L AND J 1I MEADMFAD late quaternary floras devender and P S martin eds packratpankrat middensbiddens thefrom bida cave and kaetan cave grand canyon last 4000040 000ooo years ofbioticbiotieotic change universityuniveisityofof arizonaarizona unpublished manuscript press tucson 467 ppap

MEADMFAD J 1I 1983 harrington s extinct mountain goat VAURIEVAURIF P 1952 the checkered beetles of north centraloreamnos harringharringtonihamngtomharringtonntoni and its environment inin the mexico coleoptera cleridaeClenciendae american museum

grand canyon arizona unpublished doctoral disser novitatesnovitiatesNovi tates 1597 1 37

tation university of arizona tucson 215 ppap WILSON R W 1942 preliminaryPiehminary study of the fauna of

MEADMFAD J I1 AND L D AGFNBROAD late quaternary rampartrampaitcavecave arizonaanzona contributions to paleontology

packratpankrat midden floras from the central colorado pla carnegie institution of washington publication 530169 185teau southeastern utah unpublished manuscript

1989 pleistocene dung and the extinct herbivoresherb ivoresof the colorado plateau southwestern USA cranium received 20june20 lunejuneiune 19916296 291429 1444 accepted 14 14januanjjanuary 1992

greatcicatgleatcreat basilbasinbasli naturalistnatuiahst 521521321 1992 ppap 68 74

microhabitatMICROHABITAT SELECTION BY THE JOHNNY DARTERetheostoma NIGRUMNICRUM rafinesqueRAFIN ESQUE IN A WYOMING STREAM

robert A leidy

a13siiiaAHSIKA 1 i Micimictmiciohabiolabitttohabi tat selection by the johnny darter Etheoetheostomastorna nigrummgrumnigrim was examined in the north laramie riverplatte county wyoming where it does not occur vithwith other darter species in the samesarne stream reach electivity indicesbased on micromicrohabitatiniciohahitathabitat observations indicate that E mnimnignimavoidsanim avoids rifflesfiffles and selects certain microhabitatsrnicrohabitatsmicromiero habitats characterized byintermcdiateintermediatemteiitei mediate waterwatel depths inin pools and slow moving runs with a substrate composed primarily of silt and sand nichebreadth and electivity values forfoifol total depth bottom water velocity and substrate measurements from this study indicatethat hE nigruntmnimanim isis a habitat generalistgeneigenel alist except at the extreme ends of the habitat gradient habitat use here isis generally similarto otherothel studies wheree EP bignonnignonmniin occurred with one or more other darter species this study found little evidence forcompetitive release inin the absence ofotherof other dannels

keykeif mordwordwordsnordnords inicrohabitatiiulroluihitfit meuseusc percidaePerc iJac niche breadth competitive release electivities morphological specializationsetheostoma nigrumnigiumnigrim

the johnny darter exhibits the largest geo river the laramie river and several of its trib-utarygraphic distribution among the north american streams but have not been recorded as

dartersbarters etheostomatiniEtheostomatini percidae with the co occurring there baxter and simon 1970possible exception of percina caprodes it page 1983occurs farther west than any other darter except the purpose of this paper isis to examineexamine theetheostonetheostomata exile page 1983 the ecology ofE microhabitatmicrohabitat use of E nigrimnigrum at the westernnignnigmmnigntinnigamtin has received considerable study often extreme of its range where it does not coexistin conjunction with other darter species eg with other darter species inin the same reach ofwinn 1958 smart and gee 1979 paine et al stream two basic questions are addressed 1

1982 englert and seghers 1983 mundahl and are the microhabitatmicrohabitat requirements significantlyingersoll 1983 martin 1984 the ability of E different for E nigrummgrumnigrim min the study streamnigmmnigntinnigam to colonize such a large geographic area compared to other streams inin north americamay be explained in part by its tolerance of a where it isis found 2 does E mgrumnigrumnigrim showvariety of ofenvironmentalenvironmental conditions scott and signs of competitive release inin the absence ofcrossman 1973 trautman 1981 becker 1983 other dartersbarters

throughout most of its range E nigrumnigrim coexboexistsests with one or more darter species in streams STUDY AREAMcmccormickConnick andandaspinwallaspinwall 1983 schlosserschlosserandSchlosserandand

toth 1984 todd and stewart 1985 E nigrumnigrim the north laramie river platte countyis also commonly found in lakes with weedy or wyoming drains the central medicine bowsandy shorelines page 1983 coexisting dart mountains and isis a tributary of the laramieers typically show resource partitioning along river which inin turn joins the north platte riverfood and habitat axes smart and gee 1979 near the town of wheatland the study waspaine et al 1982 matthews et al 1982 white confined to a 100loom m reach ofnverof liverilver approximatelyand aspinwall 1984 todd and stewart 1985 in 10 km upstream from interstate highway 25 ele-

vationaddition to E nigrumnigntmnigrim the iowa darter E exile 1426 m at this location the livernver traversesand the orangethroatorangethroat darter etheostoma a broad floodplainfloodplain averaging 0750.750 75 1.010loio1 0 km in widthspectibilespectihile occur in the upper platte river drain-age

dominant overstory riparian vegetation includesof eastern wyoming both E nigrimnigrum and E cottonwood populus deltoidesdeltoides and various tree

exile occur in a tributary of the north platte and shrub willows salix sppapp the study area isis

USU S I1 knvirommtalnviioniiiciitil protcakprotcokProtpi outdoiicohcok aguyagency wedawetlands1 sdioseosecSdseioseloadio llonliontionio MW 7 2 75 1hiwtliomcla thorne sheet sailsansallsali franFianfraneiscoelslocisLo california 94105

68

199211992 etheostoma NICRUM rafinesqueRAFINESQUE IN A WYOMING STREAM 69

sparsely populated with large cattle ranches and 5 surface velocity 6 substrate compositionalfalfa farms bordering the lower to middle and 7 cover type velocity measurements werereaches the most noticeable result of these made with a mini flow meter scientific instru-

mentsland use practices has been removal of riparian inc model 1205 mean water columnvegetation and consequent associated sedimen-tation

velocity was measured as the velocity at 0.60606og ofhowever fencing has effectively the total depth when the total depth was less

excluded cattle from the north laramie river than 0.75075 m or the mean velocities at 0.20202 andalong the study reach 0.80808os of the total depth when greater than 0.75075 m

the study reach chosen as representative of bovee and milhouse 1978 relative depth athe lower portions of the north laramie river measurement of the location of the fish in theis generally characterized by large relatively water column was calculated by subtractinguniform shallow pools connected by short rif focal point elevation from total depth and divid-

ingfles and runs ofvarying water velocities wetted by total depth all observed individuals werestream channel width within the study reach greater than 25 mm standard length howeveraverages 65 m with a gradient of 4.74747 mkmmam this no effort was made to distinguish between juvejuvecontrasts with gradients within the middle nile and adult fishreaches of the north laramie river of 15.1151isi nine codes were used to characterize submkmmam stream discharge at the study site aver-ages

strate composition percentage in an area 00150.151500170.1701717 in3sass although short term fluctuations in on a side measured from beneath each fish

in flow may occur from summer thunderstorms 1 fines sand and smaller 2 small gravel 4 25and irrigation diversions the substrate ranges mm 3 medium gravel 25 50 mmminmiu 4 largefrom a dominance of small gravel and sand silt gravel 50 75 mm 5 small cobble 75 150and detritus in pools to medium to large gravel mmmin 6 medium cobble 150 225 mm 7and cobble in fifflesriffles and runs diel water tem large cobble 225 300 mm 8 small boulderperaturesperatures in summer typically range from 13.5135135 300 900 mm and 9 large boulderbedrockboulder bedrockto 21 C minimum underwater visibility in the 900 minmm A cover rating 0 2 as measuredriver was 2.52525 in or greater during the study by the relative degree of protection of fish fromrooted aquatic vegetation within the study stream velocity visual isolation and light reduc-

tionreach includes waterweed elodea canadensis ie shading was assigned to each obserperfoliate pennycress thlaspi perfoliatum vation A rating ofofo0 denoted no protection 1

and ranunculus longirostrislongiro stris moderate protection and 2 major protectionthe general type and location of cover in rela-tionMETHODS to fish also were noted

habitat availability was determined randomlymicrohabitatMicrohabitat observations of E nigrumnigrim were each day immediately following the collection

made 7 12 september 1988 undisturbed fish of microhabitat use data moyle and baltzwere located by a single observer snorkeling in 1985 the following availability measurementsan upstream direction because of the high were made along 10 randomly selected tran-

sectswater clarity relatively close spacing of individ-ual

within the study reach total depthfish and their observed habit of remaining bottom mean water column and surface velicveloc

in direct contact with the substrate marking the itiesaties substrate composition and cover typelocation ofoffishhishfishbish was not a problem typically the between 15 and 30 equally spaced measure-

mentslocations of 4 7 individuals were noted and were made along each transect to ade-quatelymarked by placing a white golf ball on the sub-

stratecharacterize habitat availability within

this approach allowed the snorklersnorkelersnorkler to the comparatively short study reach an effortmaximize the number of undisturbed individual was made to collect approximately twice asobservations and minimize disturbance to many measurements of habitat availability asupstream fish microhabitatmicrohabitat observations

for each individual observation the following an electivity index was used to determinemicrohabitatmicrohabitat data werewere recorded 1 total depth selectivity by E nigrumnigrim for total depth bottomof the water column 2 focal point elevation water velocity and substrate composition elecvertical distance of the fish from the bottom tivitiestivities were calculated from the formula3 focal point velocity water velocity at the Ddrr prparp arp2rp where r is the proportion of

fish s snout 4 mean water column velocity the resource used and p is the proportion available


0.50505

d N habitat useeae3 habitat availability

040.404

00 0.30303

C

rr 0.20202

LL

0.10101oica 0

0

0100 10 102010.201020 203020 30 304030 40 4050405040 SO50 5060sogo506050 60 07040706060700700.7070 708070 80

A total depth cm

fig IA relative frequency distributions of rnicrohabitatmicrohabitatmicrohabitat use and availability for total water column depths for E nigrummgrumnigriminin thetlletile north laramieLa rantierannie river electivitieselectivitics are indicated 0500 50 strong preference 025 but 050 moderatepreferencepiefereneeference 0 0250250.250 25 no preference 0050 05 but 0250 25 moderate avoidance and 0050 05 strong avoidance

1.010loio

CD 0 habitat use0C el habitat availability

090809-

006og06-0

0.40404crX

LL

DZ0210.21021

04 eylellayn050 5 5105 10 101510 15 152015 20

B bottom water velocity cuseccmseccm sec

fig lis1131 B relative frequencyfi euuency distributions of microhabitatmicro habitat use and availability for bottom water velocities for E nigrimnigrum ininthe northnor tiitil Larlararnielaiamielaramiearniearnle river electivities are indicated 0500 50 strong preference 0250 25 but 0500 50 moderatepreference 0 0250250.250 25 nonreferencenopreferencepreferenceno 005but0 05 but 0250 25 moderate avoidance and 0050 05 strong avoidance

inin the stream environment this index isis based test for goodness of fit was applied to frequencyon the formula by jacobs 1974 as modified by distributions for habitat use and availability tomoyle and baltz 1985 for determining determine whether maximum differencesmicrohabitatmicrohabitat selectivity from variables similar to between the observed and expected distribu-

tionsthose used inin this study A kolmogorov smirnov were significant sokal and rohlf 1981

199211992 etheostoma nigrummcrumnigrim rafinesqueRAFIN ESQUE IN A WYOMING STREAM 71

0.80808

0 habitat useeae3 habitat availability

06og06-00

CCD

cr0410.41041

0U

D 0210210.21

00

0 icc

7

0

1 2 3 4 5 6 7

c substrate codes

fig IC relative frequency distributions of microhabitatmicrohabitat use and availability for substrate codes for E magrummgrumnigrunt inin thenorth laramie river electivities are indicated 0500 50 strong preference 0250250.250 25 but 0500 50 moderate preference0 0250 25 no preference 0050 05 but 0250 25 moderate avoidance and 0050 05 strong avoidance

an additional measure of microhabitatmicrohabitat utiliza-tion

RESULTSniche breadth was calculated for E

nigrumnigrim two measures of niche breadth were eight species of fish were observed with Ecalculated to adequately characterize the effect nigrimnigrum at the study site these were sand shiner

that the selectivity of rare and common hybognathus hankinsonihankinsoni kermouthsuckermouthpuckermouthsuc minnow

resources might have on niche breadth values phenacobius mirabilis creek chub semotilussenwtilusSemotilus

hurlbertsHurlberts measure ofniche breadth B which atromoculatusatronwculatus common shiner notropisNotrodisrovis corautusnutus red shiner N lutrensislutrensis bigmouth shineris sensitive to the selection of rare resources wasN dorsalis white sucker catostomuscalculated as follows B IYlspjpj2jajajajj aj Ssmithsmith s comnwrcomrnercominer

and rainbowsoni trout oncorhynchus mykissmeasure of niche breadth FT which is less

sensitive to the selectivity of rare resources was microhabitatMicro habitat observations andcalculated as follows habitat availability

microhabitat use datadala indicated that EFT svpjaj1 plajpjajjj nigrumnigrim always occurred in continuous contact

with the substrate where water velocities werewhere the of individualspj equals proportion low table 1 etheostonetheostomata nigrimnigrum was almostfound in resourceresourcejipjjsajspj 1.010iolo and aj is the pro-portion

exclusively found over a substrate of sand orof total available resources consisting of small gravel usually in pools and slow moving

resource jhajhajsaj 1.010iolo krebs 1989 B values runs of intermediate depth table 1 figs IA QCwere standardized to a scale of 0 1 using the in contrast surface velocities often were rela-

tivelyequation BAB ammlamin1ammiaminiamina aminamm where B highequals hulbert s niche breadth and amin equals in this study observations indicated that indi-

vidualthe smallest observed proportion of all fish were positioned 1 on the surface ofresources minimum aj the larger the B and the exposed substrate with no apparent coverFT values the less individuals discriminate 2 immediately below the front edge of a slightbetween resource states minimum specializa-tion

depression in the sand that served to protect fishthe smaller the B and FT values the from the current or 3 rarely on the down-

streamgreater the resource discrimination maximum slope of a small cobble also protectedspecialization from the current in all cases E nigrumnigrim


TABIFtabieFABIrakitable i 1 means t SDS 13 from mierohabitatinicrobabitatmicromiero habitat use and sainesame substrate types 79 K S test 28availabilityav u lability memeasurementsasme me ntsants foiforfollorlur Ef mnniinigrianniitntihi inin tilethetiietlle north lara-mie

p 01 fig aq1qac1cinie riverrive i Wyonwyomingling

habitat selection and niche breadthilabitatII11 ibitat ilseuseugeiiselise I1habitat

variable observations availability electivity indices indicate that E nigrumnigrim wasselecting certain microhabitatsmicrohabitats while avoiding

lotaltotalcotal depth einelnnncin 405- 8840 5 8 8 271- 16827 1 16 8others E selected intermediate waterfocal point evaluationvaluation eincincmeln 010 1 001ooi0 01 nigruninigrumpigrum

relative depthdcptlicmcin 09- 0020 9 0 02 depths and avoided high mean water columnmcallme an waterwatel column velocity velocities figs 1aaa B there was a strong

cansclnscms 26- 452 6 4 5 37- 643764 selectivity for a substrate composed of sand andI1 focalocaloeal pointbottompointbottolnpoint bottom velocityvc docitylocity an avoidance of medium to large cobbles figeinsends 02020707 18183131s11114cesinslustu lacolaceiaco velocityve docitylocity einsainscins 52- 735 2 7 3 54- 825 4 8 2 1cac fish generally avoided areas that 1 exhib-

itedslbstratesnlstiatcsubstrate typostypcstnestypcs high surface water velocities 2 were iso-lated11fiiusfines 621 33835835 8 341 36336 3 visually or 3 were well shaded by

2 small gravelff ave I1 165- 19616 5 19 6 216- 25621 6 25 6 physical cover table 1 rather fish utilized33 medium gravel 76- 14776147 64641331334 large gravelgi ivel 4747135t 135 58- 14958149 relatively barren substrates exposed to full sun-

light5 small cobble 6363157t 157 97- 21597215 but close to cover microhabitatMicrohabitat niche6 UKinediulndmm cobble 2121113113 155- 287155287 breadths BAB A and FTvalues for depth velocity7 laigelarge cobble 070 7 0200 20 656 5 21521321 5 and substrate indicate little resource specializa-

tion8 small bonadeibonldeibonldcr9 large boulder by E nigrumnigrim table 2

coveomcovc ir code1

0 2streamsti eamcam velocity 15 06 discussionvisual isolation 050506030606

reduction 01 03light the results of the electivity indices and thesamplesizesampiesample sizesic 91 168KSK S test indicate that E nigrimnigrum isis highly selec

cufrbelrrufrH I1 towthodsomdlixls tive inin the microhabitatsmicrohabitats it occupies howeverniche breadth values suggest that E nigrimnigrum

tableIAIMI 2 nieheniche breadth values BA and FTJ atoirtoifor E nigruntnifrum does not discriminate between availableforfoiloliollor total depth bottom watelwater velocity and substrate inin tiletiietlle microhabitatsmicrohabitats iei e minimal habitat specializa-

tionnorthnol tiitil laiamielarandelabrande riverrivel wyoming applapproximateappi oximate 95 confi-dencedc necncc intervalint ival shown inin parentheses the apparent inconsistency between

niche breadth values and electivity indices maybottom be explained by two factors 1 the relative

total depth velocity substrate the of cobble rifflescarcity inin study area gravelcobblegravelhabitats and their avoidance danners and 2ifinlberthilinili UK lisitssya73 4 4541 49 7676727980728080 707066667474 by

smithss FT 727265653878 89898484 93 93938989 96 the preference by danners for low velocity poolhabitats characterized by sand and small gravela habitat that was abundant inin the study area

positioned itself inin close proximity with other values for Hurhurlbertlbertss measure of niche breadthWABA were consistently lower than values fortypes of instream cover ege g stones cobbles

brabranchesriches or01 smallsmail depressions in the sand the smiths measure FT for depth velocity andsubstrate this isis expected because BAB A isis sensisensi-tive

average distance to such cover was less than 6to the selection of rare resources that are

CITIcmeitlelti for 89 of the observationsmore heavily weighted inin the calculation of

Mmeasurementseasaas liretire inheritsinerits of microhabitatmicrohabitat availabilityniche breadth while FT isis less sensitive to the

indicated that average water depths available to selection of rare resources krebs 1989E nigmnniganmmmamm were shallower than the depths at darter species typically are restricted to awinchwhich it was typically observed kolmogorov narrow range of microhabitatsmicrohabitats this isis especiallysmirnov test 23 p 01oi.01of01 and available mean evident inin their use ofcertainof certain substrates pagebottom water velocities were greatergi eater than 1983 E nigrimnigrum has an unusually broad toler-

ancewhere fish weiewerewele observed KSK S test 25 p 01oi.01of01 among danners for variable environmentalfiesflesfigsfios7

I11 A B in addition available substrate was conditions and has been observed over widelydominated by fines and small gravel 55 but varying velocities depths and substratesthis was disproportionately low when compared between drainages and within a particularwith microhabitatmicrohabitat use observations for these stream reach smart and gee 1979 angermeierb

199219921 etheostoma NICRUM rafinesqueRAFINESQUE IN A WYOMING STREAM 73

1987 this study and others eg becker 1959 were observed were negligible when comparedpaine et al 1982 englert and seghers 1983 to velocities at the same location a few centime-

tersgenerally show that E nigrumnigrim occurs most fre higher in the water column or at the surfacequently in pools and sluggish reaches of stream also subtle depressions inin the sand substrateover sand or silt substrates although this darter often were occupied by individual fish presum-

ablyalso regularly occurs in fifflesriffles lachner et al for protection from stream velocity one1950 smart and gee 1979 trautman 1981 in might expect that the small size and observedother streams pool and riffle habitats are often patterns of habitat utilization by E niruminhabitedcoinhabitedco by one or more darter species if would increase its risks to predation howevercompetition with other darter species restricts small size drab coloration speckling W marksE nigrimnigrum to microhabitatmicrohabitat types in which they and partial translucence combined with expo-

sureare commonly found then in the absence of to full sunlight made detection of individ-ualother darter species one might expect E nigrumnigrim fish on the speckled sand substrate difficult

to experience competitive release etheostoma the increased risks of exposure to predationnigrumnigrim when alone should occupy a wider range from small size alone would appear to be comof habitat in a particular stream reach without pensatedpennatedpensated by the combination of various mor-

phologicalas much specialization for a particular ranrange9e or ph features the same morphologicalbresource type observed patterns of features that act as camouflage in quiet poolsmicrohabitatmicrohabitat use from this study found little likely may not serve the samesaine function inin riffleevidence of competitive release suggesting that habitats page and swoffordswol ford 1984other dartersbarters are probably not restrictingE nigrumnigmmnigam to a particular habitat type in streams acknowledgmentswhere they coexist

electivity and niche breadth values for depth I1 am especially indebted to barbara fiedlervelocity and substrate measurements from this and rand fancher for assistance in the fieldstudy support the conclusion of coon 1982 and to the owners of the HR ranch for gener-

ouslyand others winn 1958 karr 1963 that E providing access to the study site I1 amnigrumnigmmnigam is a habitat generalist except at the sincerely grateful to peter B moyle pelypegypepeggyL v leeextreme ends of the habitat gradient ie shal-low

fiedler and two anonymous reviewers for crit-icalcobble riffle and very shallow pool habitats comments on the manuscript thanks also

however in contrast to the studies of coon to george R leidy of BEAK consultants sac-ramento1982 and smart and gee 1979 that recorded california for lending the flow meter

E nigrumnigrim in riffle and runpoolrun pool habitats withone or more darter species in this study E literature CITEDnigrumnigrim while it was common in pools did notoccur in rifflesfiffles even in the absence of other angermeier P L 1987 spatioternporalspahotempoial variation inin hab-

itat selection by fishes inin small illinois streamssti earmsearns in W Jdardannersters matthews and D C heins eds community andschlosser and toth 1984 suggested that dif evolutionary ecology of northnoi th american stream fishes

ferencekferencesferen ces in microhabitatmicrohabitat use in two sympatric university of Oklaokiaoklahomahorna press norman

danners appear to be constrained by morpholog-ical

BAXTEBAXIFKii G T and J R SIMON 1970 Wywyomingorning fisheswyoming game and fislifishpish department cheyenne 168specializations of each species rather thanPP

by interspecific competition As with most small BECIEBFCKTKii G C 1959 distribution of central wisconsindardannersters E nigrumnigrim is characterized by morpho-logical

fishes wisconsin academy of science arts and lett-ersspecializations best suited to the benthic 48 65 102

11 1983 fishes of wisconsin universityuniveiuniver sity ofwisoffisof wis-consinstratum of pools and other sluggish stream hab-

itatspress madison

often with a sand or silt substrate page bovee K D and R T MILHOUSE 1978 hydraulic simu-lation1983 page and swofford 1984 support for the inin instream flow studies theory and technique

role of morphology in driving habitat utilization USU S fishFWSOBS

and wildlife7833

selvleeservice biological services pro-gramby E nigrumnigrim in the study area comes from data COON TTGG 1982 coexistence inin a guild of ofbenthicbenthic streain

on cover utilization protection from stream fishes the effects ofdisturbancedisturbanceof unpublished doctoraldocto iallallaivelocities in the absence of any apparent physi-cal

dissertation university of californiacahfoi nia davis 191 ppapinstreaminstream cover may be explained by this ENGLEenglnnenglanRT jandbjandaJ and B H SEGIseclspcnmsI1 F 11 S 1983 habitat segregationseglesegiegationgatlon

by stieamstrearnstiehm danners pisces percidaepercPeicpereidae in the thamessmall size and benthic habits velocitiesspecies river watershed of southwestern ontanoontario canadianimmediately above the substrate where fish field naturalist 97 177 180


JACOBS J 1974 quantitative measurement of food selec-tion

PAINF M D J J DODSON andandgandaG POWER 1982 habitata modification of the forage ratio and ivlev s and food resource partitioning among four species of

electivity index oecologia 14 413413117417 dartersbarters percidae etheostoma inin a southern ontariokaimKAKHkarrkalm J R 1963 age growth and food habits of johnny stream canadian journal of zoology 60 1635 1641

slenderheadslender head and blacksideblackside dartersbarters of boone county sc11lossfrsciilossfr 1I jandlJ and L A TOTH 1984 niche relationshipsiowa of the iowa of science 70proceedings academy and228 236

population ecology of rainbow etheostomacaeruleum and fantail E flabellateflabellareflabellare dartersbarters inin a tem-porally

killkiki BSis C J 1989 ecological methodology harper and variable environment oikosbikos 42 229 238row publishers new york 654 ppap SCOTTscon Wwbandeband E CROSSMAN 1973 freshwater fishesLAlwhneiiIINFK LE A E F westlake andandeP S handwerk 1950 Jof canada bulletin of the fisheries research board ofstudies on the biology of somesorne percid fishes from

western pennsylvania american midland naturalist canada 1984 966 ppap43 92 111 SMART HHJjandajandjand J HHGEEceeGFE 1979 coexistence and resource

MARTINMAKIINmarlinmarilnmantin D J 1984 diets of four sympatricsympatnc species of partitioning inin two species of danners percidaeetheostomaftheostoma pisces percidae from southern indiana etheostoma esrummsrumnigrumnigrim and percina maculata canadianinterspecificanteiintei specific and intraspecific multiple comparisons journal of zoology 57 2061 2071environmental biology of fishes 11 113 120 SOKAL R R and F J ROHLF 1981 biometry W H

MATTHEWSMAIIIIFWS WJJ R bekBFKbekandebenandeBE andeKandE SURAISURATsural 1982 compar-ative

freeman san franciscoecology of the danners etheostoma podostemonepodostemone TODD S C and K W stewartSTFWARISTFWART 1985 food habits and

erlaEflaerfaE eflabellareflabellareflabellateglaflabellare and percina roanokaroanoke inthein the upper roanoke dietary overlap ofnongame insectivorous fishes in flintriver drainage virginia copela 4 805 814 creek oklahoma a western ozark foothills stream

MCCORMICKMCOHMKK F H and N ASPINWALL 1983 habitat great basin naturalist 45 721 733selection inin three species of dartersbarters environmental TRAUTMANTRAUFMAN M B 1981 the fishes of ohio rev ed ohio

of fishes 8 279 282biology state university press columbus 782 ppapMOYIMOYLEmoyl r P B and D M balfyBALIYballybaurybalry 1985 microhabitatMicrohabitat use by whireWHIFFWJHTFwinte M Mmandnmananand N ASPINWALL 1984 habitat partition-

ingan assemblage of california stream fishes developing among five species of danners percidaecriteria for mstreamidstrearnastream flow determinations transactions etheostoma in D G lindquist and L M page edsof the american fisheries society 114 695 704

environmental of dartersbarters W publishersMUNDAIII N D and C G INGERSOLLINGFRSOLL 1983 eaearly netherlands

biology junk

autumn movements and densities of johnny WINWINNN H E 1958 comparative reproductiveproductivele behavior andetheostoma nigrimnigrum and fantail E flabellateflabellareflabellare dannersinin a southwestern ohio stream journal of science 83 ecology of fourteen species of danners pisces per-

cidae103 108 ecological mongraphsmongrapbsmonographsMongraphs 28 155 191

palpaiPAI L M 1983 the handbook of dartersbarters T F Hpublications neptune city new jersey 271 ppap

PAGEpacrpacebacr L M and D L SWOFFORD 1984 morphological received I11 october 1990correlates of ecological specialization inin danners enviedvi revised I11 may 1991ronmentalromnentalnonmentalronmental biology of fishes 11 139 159 accepted I11 october 1991


nomenclatural innovations IN intermountain ROSIDAE

arthur cronquist12

ABSIRACABSTRACT 1 new taxa include lomatium packardiae cronqcrona apiaceae crotoncretancreton texensistexenhis klotzsch muell arg varutahensis cronqcrona euphorbiaceae other nomenclatural innovations include cymopterus longineslongipeslongipes var ibapensisibapensiibapensis M Ejones cronqcrona lomatium roseanumroseanum cronqcrona apiaceae camissoniacamissomaCamis soniasoma boothieboothii douglas raven var decorticansdecorticans hook &arnam cronqcrona camissoniaCamis sonia boothieboothii douglas raven var desertorumdesertorum munz cronqcrona camissoniacamissomaCamissoniasoma clava6formisclavaeformis torr &frempremerem raven var aurantiaca munz cronqcrona camissoniaCamis sonia clavaeformis torr & fremfran raven var cruciformiscruciformis kelloggcronqcrona camissoniaCamissonia clavaeformis torr & frem raven varjunereavarjuvar funereafunerealnerea raven cronqcrona camissoniacamissomaCamis somasonia clavaeformis torr &frem raven var lancifolialancifolia A A heller cronqcrona camissoniaCamis sonia heterochromaheterochromeheterochroma S wats raven var monoensis munzcronqcrona camissoniaCamissonia kemenkemensiskernensisdemensiskernensissossis munz raven var gilmaniigilmanneilmanngilma niinil munz cronqcrona camissoniaCamissonia scapoidea torr & gray raven varmacrocarpamaciocarpamacromacio carpa raven cronqcrona oenothera biennasbiennis L var stristrigosastngosastrigosegosa rydbredb cronqcrona oenothera hallidapallida lindl var nincinatanmcinatanincinataengelm cronqcrona onagraceae

key words nomenclature rosidae taxonomy

my manuscript on a number of families of mm longi mericarpiamericarpia glabragladra vel interduminterdumrosidae for intermountain flora has been com-pleted

patentipacenti hirtella 8 9 X 3 3.53535 mm manifestemanifestamanifesteand awaiting publication for several alata allsalisails usque ad I11 mm latis

years these families should constitute a large HOLOTYPE packard 744674 46 in ash that haspart of volume 3aaa rosidaeRosidae except fabalesbabalesFabales not disintegrated into clay along old succorsince I1 cannot now anticipate when volume 3aaa creek road near sheavilleshervilleShe aville very close to thewill be published the following nomenclatural idaho border t27s r46e malheurmalteur coinnovations are here validated oregon 19 may 1974 NY isotype at CIC

HABITAT AND distribution in volcanicAPIACEAE ash and rhyolite on rocky clay soil in the sage-

brush zone malheurmalteur and lake cos oregon S

cymopterus longipeslongineslongipes S wats var ibapenibaven to washoe and humboldt cos nevada flow-eringsis M E jones cronqcrona comb nov based from april to june

on cynwpterus ibapensisibapensis M E jones zoe 3 commentary lomatium packardiae has30218931302.18931302 1893 sometimes passed in the herbarium as L

lomatium packardiae cronqcrona sp nov triternatumtriternatum pursch coulter & rose whichfig 1 herba perenniaperedniaperennia caespitosa radice however has solitary or few stems or scapes on

crassebrasse et caudice manimanifestofesteoeste ramosodamoso omnino the simple or occasionally few branched crownsubvelutinasubvelutina foliisfohisfodis omnibus basalibusbasa libus ternatobernato or short caudex atop the taproot the ultimatevel denuodenbo segments of the leaves oflkoflof L packardiae are alsoquinatoaquinato pinnatifida et pluspius minusminusveminu sveve

shorter than is typical for L triternatumtriternatum thepinnatifidpinnatifidisis segmentissegmentis ultimisultimus angustiaangustisangustis 1 2 mmlatis imparibusimparibus eis majoribusmajoribus 1 3 cm longis larger ones only 1 3 cm long so that the leaves

scapiscali maturi 1.51515 4 dm alta umbella per have a different aspectanthesinanthesisanthesin compactscompactacomp acta parva ca 2 cm lata radiisraddis lomatium roseanumroseanum cronqcrona nom nov

imparibusimparibus demumdemurndeburn apertaaberta radiisraddis longioribus 4 6 leptotaeniaLeptotaenia leibergleibergiiii coulter & rose contriscontribCon tribUS nati herb 7 202 1900 not lomatiumcm longis bracteisbracteis involucel li pauels lineardlineari

ii coulter & rose 1900leibergattenuatisattenuates vel nullis flores flavi lobis calyciscalycesmidutisminutis vel obsoletisobsoletism pedicelli fructiferi 3 7

1thehe new york botamcalgiibotanical gardencardenden bronx new yorkyolkyori 1045810458512651262 deceased march 22 1992

75


coconino co in arizona are here consideredto form the var utahensis cronqcrona the otherwise

CM fairly widespread var texensis with the uppersurface of the leaves evidently and more or lesspersistently stellatehalryhairy is largely allopatricwith var utahensis barely entering utah in sanjuan co

onagraceae

camissoniaCamissonia boothiiboothie douglas raven vardecorticansdecorticans hook & arn cronqcrona combnov based on gauracaura decorticansdecorticans hook &narnarnbot beecheybeecheysBeecheyss voyage 343 1839

camissoniaCamissonia boothiiboothie douglas raven varVY desertorumdesertorum munz cronqcrona stat nov based

on oenothera decorticansdecorticans var desertorumdesertorumMmunzunz bot gaz 85 246 192811928

camissoniaCamissonia clavaeformis torftomtorr & fremraven var aurantiaca munz cronqcrona statnov based on oenothera scapoidea varaurantiaca S wats proc amer acad arts 8595 613 1873 an illegitimate name which asdefined by watson included the type of theearlier 0 scapoidea var clavaeformis S wats1871 oenothera clavaeformis var aurantiacamunz amer J bot 15 237 192811928

camissoniaCamissonia clavaeformis todtorftomtorr & vremfremframpramraven var cruciformiscruciformis kellogg cronacronqstat based oenothera cruci kelnov on cruciformisformisFfig 1 iovuitiuinlontaffinn packardiaepackanhaepackan haehambamlogg proc calif acad sci 2 227 186311863

camissoniaCamissonia clavaeformis todtorrtom & frempremeupiiorbiaeceaeeupi1011biaeceae raven var funereafunereal raven cronqcrona stat

nov based on oenothera clavaeformis subspcroton texensis klotzsch muell arg funerealfunerea raven univ calif pub bot 34 106

var utahensis cronqcrona var nov A var texensis 1962foliisfohisfoldisfodis supra glabaisglabris differt camissoniaCamissonia clavaeformis todtorrtom & premfrembrem

HOLOTYPEHOLOTYPF cronquist 6 K thorne 11839 raven var lancifolialancifolia A A heller cronqcronasand dunes ca 18 km airline N ofoflynndyllynndylofLynnlynndalLynn dyl juab stat nov based on chylismia lancifolialancifolia A Aco utah t13s r5wraw ca 1500 m elev 28 july heller muhlenbergia 2 226 1906119061983 at NY isotypesisotopesIsotypes at BRY UTC camissoniaCamissonia heterochromaheterochromeheterochroma S wats

COMMcommentaryENTARY croton texensis is variable raven var monoensis munz cronqcrona statin density of pubescence but throughout most nov based on oenothera heterochromeheterochromaheterochroma varofitsoaitsof its range the upper surface of the leaves has monoensis munz aliso 2 84 194911949at least a few stellate hairs though these may camissoniaCamissonia kernensiskemensiskemenkernenkeenendemensissis munz raven vareventually fall off an abundant population on gilmaniigilmanii munz cronqcrona stat nov based onthe sand dunes near lynndyllynndal in juab and mil oenothera dentata var gilmaniigilmanii munz leafaleafllard cos utah represents the least pubescent W bot 2 87 193811938extreme in these plants the upper surface of the camissoniaCamissonia scapoidea tomtorr & grayleaves is wholly glabrous or provided with only raven var macrocarpamacrocarpa raven cronqcrona stata few quickly deciduous stellate scales the nov based on oenothera apoideascapoideasc subsplynndyllynndal plants and somesorne similar ones from macrocarpamacrocarpa raven univ calif pub bot 34kane andlindtindkind san juan cos utah and from northern 95196295.1962951962195.19621

1992 nomenclatural innovations IN ROSIDAE 77

oenothera blennis L var strigosastrigosestrigosa rydbredb acknowledgmentscronqcrona comb nov based on oenotherastrigosastrigosestrigosa rydbredb mem N Y bot gardcard 1 278 the work here reported was subsidized over190011900 a period of years by successive grants from the

oenothera hallidapallida lindl var runcinataruncinateruncinata national science foundation to the new yorkengelm cronqcrona stat nov based on botanical garden in support of the intermoun-

tainoenothera albicaulisalbicaulis var mncinataruncinataruncinateruncinata engelm flora project the drawing of lomatiumamer J sci arts 84 334 186211862 packardiae was done by bobbi angell

received 30 august 1991accepted 26 november 1991

great basin naturalist 521521 1992 pp78appp 78 88

nomenclatural CHANGES AND NEW SPECIES IN platypodidaePLATYPOD IDAEAND scolytidae coleoptera PART 11II

stephen L woodwoodi

ABSIKAC 1 in platypodidaePlatypod idae the new name genyoceruscenyocerusgengoGenyoceruscefus strohmeyestrohmeyenstrohmeyeristrohmeyerstrohmemenmeyenri replaced the junior homonym G albialbipennisalbvpennispennisstrohmeyer 1942 and the new name platypus applanatulus replaced the junior homonym platypus applanatusapplanatus schedl1976 new names are presented inin scolytidae as replacements for junior homonyms as follows cryphalus brownedbrownei forcryphalus aTtoartocarpuscarpus schedl 1958 cyclorhipidion dihingicumdihmgicum for xyleborus dihingensis schedl 1951 hypothenemusatemmulusaterrimulus for lepiceroideslepiceroules now hypothenemus aternmusaterfimus schedlsched 1957 hypothenemus knvolutskayaekrivolutskayae forhypothenemus insularismmsulansinsularisinsu lafislaris knvolutskayakrivolutskayaKrivo lutskaya pityophthoruspityophthoms africanulusafncanulusafricanulusuius for neodryocoetes now pityophthorus africafncanusafricanusafricansanus schedl1962 scolytogenes papuensis for xylocryptus now scolytogenes papuanuspaplanuspapuanus schedl 1975 scolytogenes paradoxusparadoxparadoxesus forscolytogenes paplanuspapuanuspapuanus schedl 1979 xyleborinusxijlebonnus spiniposticus for eidophelusEidophelus now xyleborinusxylebonnus spinispinipennisspimpenmspennis schedl 1979

xylehornsxyleborusfirmosaeformpormformosaeformosanosae for xyleborusformosanusxyleborus tormosformosformosanusanus browne 1981 new combinations for fossil scolytidae include dryocoetesdiluvialistdiluvialisdiluvialis for pityophthoroidea diluvialistdiluvialisdiluvialis wickham 1916 and hylesinusHylesinus hydropicushydropicus for apidocephalus hydropicushydropicuswickham 1916 phloeotnbusphloeotribus zimmermannizimmermanmzimmermazimmermanmozimmermanninm wickham 1916 is transferred to the family curculionidae in scolytidaecryphalophilus schedl 1970 isis a junior generic synonym of scolytogenes eichhoff macrocryphalus nobuchikobuchiNobuchi 1981 is a

junior generic synonym of hypothenemus westwood 1836 nipponopolygraphus nobuchikobuchiNobuchi 1981 isis a junior genericsynonym of Polygraphpolygraphusus erichsonEnch son 1836 pseudocosmoderes nobuchikobuchiNobuchi 1981 is a junior generic synonym of cosmoderesCosmodereseichhoff 1878 taphrocoetestaphrocoete3 pfeffer 1987 is a junior generic synonym of taphrorychus eichhoff trypanophellos bright1982 isis a junior generic synomymsynonym liparthrumofliparthrumof Lip arthrum wollaston new specific synonymy inin scolytidae includes brachyspatusbrachyspartusmontziinotitzihnotinotitzi ferrariferranperrari corthylusCort hylus obtusus schedl carphoborus minimus fabricius carphoboruscarphohorus balgensisbalgensis murayamacoccotrypescoccotnjpes dactylipercladactyhperda fabriciusfabncius coccotrypes tropicstropicustropicus eichhoff cryphalus scabricollisscabncollis eichhoff cryphalusbrevicollisbrevicollis schedl ficicis respectsdespectsclespects walker hylesinusHylesinus samoanussamoanus schedl hylastesHy lastes plumbeusplumbeousplumbeus blandford hylurgopsfiishunensisfushunensis murayama hylurgops interstitialinterstitialisis chapuis hylurgops niponicusniponicus murayama hylurgops spessivtsevieggers hylurgops modestusmockstus murayama ipg stebbingsstebbingistebbingi strohmeyer apszpsips schmutzenhofetischmutzenhofen holzschuh phloeosinus rudisblandford phloeosinus shotoensis murayama Polygraphpolygraphusus kaimochikaimochi nobuchikobuchiNobuchi polygraphusfolygraphusPolygraphus guerciquerci wood polygrachusgraphus proximusproximus blandford Polygraphpolygraphusus magnus murayama scolytogenes braden browne scolytogenes orientaliaorientalisorientalisschedl scolytoplatypus carvusparvus sampson scolytoplatypusscolytop platypuslatypus ruficaudaruftcaudaruppruficauda eggers sphaerotrypes querci stebbingchromechramesuschramewiChramewisus globulusglohulusglobulousglobulushulus stebbingstebbmgStebb mg sphaerotrypes tectusfectushectus beeson sueusjueus niisimaimisimainiisimaisimal eggers sphaerotrypes controversaemurayamaMuimul ayama tominustomicus brevipilosusbrempilosus eggers blastophagus phasianuskhasianuskhasianus murayama blastophagus multisetosus murayamathe european hylastesHy lastes opacousopacus erichson isis reported as an established breeding population in new york USA phloeosinus

areatusarmatus reitter of asia minor isis reported as causing economic damage as a new introduction to los angeles countycalifornia the following species are named as new to science cyclorhipidion subagnatum philippine islandsdendrotrupevdendrotnipes zealandicuszealan dicus new zealand Polygraphpolygraphusus thithithitsi burma tnotemnustriotemnus pilicornispilicormspilipiliccornisorms india and xyleborusmagnificusmagmficusmagnificus peru

key words nomenclature platypodidaePlatypod idae scolytidae taxonomy bark beetles coleoptera

during the compilation of a world catalog of e two new introductions of a european and anplatypodidaePlatypod idae and scolytidae a number of asian scolytid into north america and f fivenomenclatural items were found that require species named as new to sciencevalidation andor publication prior to release ofthe catalog these items include a two new NEW NAMES IN platypodidaePLATYPOD IDAE

replacement names for junior homonyms in genyoceruscenyocerusGenyo cerus strohmeyetistrohmeyeristrohmeyeriti n nplatypodidaePlatypod idae and nine in scolytidae b three

dianusdiapus albialblalbipennisalbipenmspennis strohmeyer 1942 arbeitenarbeiterArb eiten ubernew combinations in fossil scolytidae c sixsixmorphologische und taxonomische entomogieEntomogie 92849 284

cases ofnew generic synonymy in scolytidae d syntypesSyn types insul simaloerSim aloer westweltlichwesthchwestlichilchlich sumatra strohStrobstrohmeyermeyer17 cases of new specific synonymy in scolytidae collection preoccupied by motschulskyMotschulsky 1858

332332liklillif Sciscienceenice museum brighamballi im young university provopiovofiovo utah 84602

78

199211992 nomenclatural CHANGES IN platypodidaePLATYPOD IDAE AND scolytidae 79

the name genyocerusGenyocerus albipennisalbipennis motschul preoccupied by eggers 1930 although bothsky 1858 was considered lost for more than a names were recently transferred to othercentury wood 1969118 in an attempt to genera the primary homonymy remains theassign a species to this name strohmeyer new name dihingicum is proposed as a replace-

mentnamed diapusdianus albipennisalbipennis cited above when for the schedl name as indicated abovethe motschulskyMotschulsky type was rediscovered wood1969118 it was recognized that two distinct hypothenemus atertimulusaterrimulus n n

but congeneric species were represented lepiceroides aternmusaterrimus schedl 1957 annales du museemus6e

because the strohmeyer name is the junior royale du congo belgebeige ser 8 zoologiezoologizeZoologie 565956 59 holotyperuanda ihembedhembe belgian congo museum tervurenTervuren

homonym in this case the new name stroh preoccupied by schedl 1951meyerinwyetimayeri is proposed as a replacement name foralbipennisalbipennis strohmeyer as indicated above the generic name lepiceroides schedl was

placed in synonymy under hypothenemusplatypus applanatulus n n wood 198692 this act transferred its type

platypus applanatusapplanatus schedl 1976 abhandlungen species aterrimus schedl 1957 cited above tostaathches museum fur tierkkundeTierkkunde dresden 41385413 85 Hhypothenemusypothenemusothenemus where it became a junior hom-

onymholotype male manaus amazonasamazons naturhistorischesnaturhistonsches

museum wien preoccupied by wood 1972 ofofhjofhH aterrimus schedl 1951 the newname aterrimulus is here proposed as a replace-mentplatypus applanatusapplanatus schedl 1976 cited name for aterrimus schedl 1957 as indi-catedabove was named five years after the same above

name had been used by wood 1972244 inview of this homonymy the new name hypothenemus krivolutskayae n n

applanatulus is here proposed as a replacement hypothenemus insularuminsularum krivolutskayaknvolutskayaKrivo lutskaya 1968 in kurenzovfor the schedl indi-cated

& konoralovakonovalova the insect fauna of the soviet far east andjunior name applanatusapplanatus asabove its ecology p 56 holotype kunlekunie islands presumably

at vladivostok preoccupied by perkins 1900

NEW NAMES IN scolytidae hypothenemus insularuminsularum krivolutskayaKrivo lutskayacited above was given a neuter specific name in

cryphalus browneibrownedbrownei n n a masculine genus when the gender is cor-rected as required under the code this name

schedl 1958 sarawaksarabak museumcryphalus artocarpus jour-nal becomes of811498811siisll 498 holotype Sarawak semengohSeme ngoh british a junior homonym hypothenemusmuseum natural history preoccupied by schedl insularisminsularisinsularis perkins 1900 and must be replaced1939 the new name ktivolutskayaekrivolutskayae is proposed as a

replacement name as indicated abovethe name cryphalus attoartocarpuscarpus schedl

1958 cited above was established even though pityophthomspityophthorus africanulusafficanulusafricanulusuius n nits author had previously named ericryphalus neodryocoetesnodryocoetes africafricanusafncanusafricansanus schedl 1962 revistadevista deaycoaTtoartocarpuscarpus schedl 1939 and had considered entomologiaentomologic de mocambiquemozambique 52107952 1079 holotypecryphalus and ericryphalus synonymous this congo mayumbe belgian congo museum tervurenTervuren

preoccupied by eggers 1927generic synonymy was confirmed wood198691198691 in view of this oversight schedl s 1958 schedl named neodryocoetes africanusafricansafricanus citedname is a juniorajuniorarjunior homonym ofthe 1939 name and above from five specimens that did not exhibitmust be replaced the new name browneibrowned isis sexual differences because the neotropicalproposed as a replacement as indicated above genus araptusarastus neodryocoetes does not occurin recognition of the late F G browne who in africa and these specimens belong to thecontributed significantly to our knowledge of related genus pityophthorus schedl s namethese insects afTicafncanusafticanusanus must be transferred to that genus

cyclorhipidion dihingicum n n where it becomes a junior homonym and mustbe replaced the new name africanulusafricanulus is pro-posed

schedl 1951xyleborus dihingensisdihingensts tijdschrifttijdschnft voor for the schedlentomologieentomologize 937193 71 syntypesSyn types 2 females I11 male java as a replacement 1962batoerraden G slamet naturhistorischesnaturhistonsches museum name as indicated abovewien preoccupied by eggers 1930

scolytogenes papuensis n nthe name xyleborus dihingensis schedl cited xylocryptus paplanuspapuanuspapu anus schedl 1975 naturhistonschesnaturbistorisches

above was proposed at a time when it was museum wien annales 7935279 352 holotype upper manki


logginglosing areanc i bulolobalolo MKIK district new guinea it must be replaced the new nameforrrwsaensimeformosaenatinnatiiiliistoiiscbeshistorisclies museum wien preoccupied by indicated aboveisis proposed as a replacement asSeseliedlscbtdlliedl 1974

the genus xylocryptusxtlocnfptus schedl 1975 was GENERIC TRANSFERS OF FOSSIL

establishedestablishedmthwithMth X pappapuparpaptanuspapuanuspaplanustanusanus schedl as the type scolytidaespecies when xylocnptusxylocryptus became a junior synonym of scolytogenesscoliascolif togeneigenes wood 1986901986 90 the dryocoetes diluvialistdiluvialisdiluvialis wickhamtransfer of paplanuspapuanuspapuanus to that genus caused pityophthorideapityophthoncjea diluvialischkivialifdiluvialistdiluvialis wickham 1916 state universitypaplanuspapuanuspaptianuspapuanus schedl 1975 to become a junior of iowa laboratory of natural history bulletin 771818

homonym of scolytoenesscolytogenes originally cryphalo holotype fossil in miocene florissant colorado not

inoqhusniorrhus paplanuspapuanuspapuanus schedl 1974 in order to located

colcoieolcorrectreetrect this duplication ofofnamesnames the new name the photograph of the holotype that was pubpapuensis isis here proposed as a replacement for lisheddished with the original description of pityophpaplanuspapuanuspapuanus schedl 1975 as indicated above thoridea diluvialistdiluvialisdiluvialis wickham 1916.18191618 suggests

that this species isis a member of the genusscolytogenesscolytoenes paradoxusparadoxparadoxesus n ndryocoetesdqlocoetes because there appears to be no

olitooicf schedl 1979 Faunistfaunistischefiunistischeischescolytogcna paplanuspapuanuspapuanus whatever forjustification arecognizing separateabliandlungenabliandlunt n 797 holotype papupapua i new guineaN naturhistorischesitnibistonsches museum wien preoccupied by genus the name pityophthoroidespityophtlwroides isis placed inschedl 1974 synonymy under the senior name dryocoetes

and diluvialisdiluvialistdiluvialis is transferred to that genus aswhen scolytogenesscolitoenesscoitScoli schedl 1979toenes paplanuspapuanuspapuanus indicated above

was named schedl regardedlegarded cryphalomorphusaslislustus a distinct genus the placement ctphaloofcryphaloof hylesinusHyle sinus hydropicushydropicashydropicalhydropicuspicas wickhaminorphusnwrfhus inin synonymy under the seniorsenior name apichcephalusapihcephalus hydropicushydropicus wickham 1916 state universityscolytogenesscolitoenesScoli toenes wood 1986901986 90 and the conse-quent

of iowa laboratory of natural history bulletin 7187 18

transfer of C paplanuspapuanuspapuanus schedl 1974 to holotype fossil in miocene florissant colorado not

scoliitoenesscolytogenes caused the name S papuanuspaplanuspapuanus located

schedl 1979 to become a junior homonym for the photograph of the holotype that was pub-lishedthistinstius leasonreason the new name paradoxparadoxusparadoxesus is pro-

posedwith the original description of acidoapido

as a replacement for paplanuspapuanuspapuanus schedl cephalusacephaluscep halus hydropicushydropicus wickham indicates that1979 as indicated above this member of the sinusspecies is a genus hylesinusHyle

the generic namedame apidocephalus is here placedxiflehonnusyleborlnusspiniposticusspimposticus n nin synonymy under hylesinusHyle sinus and the fossil spe

ulovltcjn seliedlsched 1979 new zealand entoentenioinnipcnhi cies hydropicushydro isis transferred to that as11101moloist11101ogistsoloistmoloistogist 71067 106 holotype fernalebernalehinkinferbinnalenaiellelie r ajifjiFI sehedlschedlsehell collee picus genustioninfionintiontinn in natiN itiiihistoiisehesi rh istorisches Mmuseumi i seiset lintin wien preoccipreoccupiedipiedspied by indicated aboveaggerspggersPg1 gers 1930191019.10

phloeotnbusphloeottibus zimmermannizirnmennannizimmermanni wickham tobeaver 199094 transferred eidophelusEidophelus curculionidae

spinispiniperinisspimpenmsperinis schedl 1979 to xyleborinusxileborinus where phloeotribitsphloeotnhtii zinimernuinniimmerimmni wickham 1916 state univer-sityit isis preoccupied by spinipennisspinipennis eggers 1930 of iowa laboratory of natural history bulletin 771919

in order01 deidel to remove the duplication of names the holotype fossil inin miocene florissant colorado not

new name spiniposticusspimposticus isis hereheiehele proposed as a located

placementreplacementle for spinipennisspinipennis schedl 1979 as the photograph of the holotype of phloeotnphloeotriindicatedaboveindicatedindicate abovedabovedabose bus zimmermannizimmermanni wickham 1916.19191619 that was

xiehomsformosaexyiebontsfirmosae n n published with the original description indicatesthat this species is not a member of this family

XIILIOIIIillebontsillebonts fiOrtfiortnosanfonnownunosan tisits browne 1981 kontyiikontyukostyu 49149l131491131 131 1anand must be transferred from scolytidae to theholotype ftfemalem lielleile iiuilienilualienIluliualienailen formosaFoinnosa to yatsushiro

japan imported british museum natural history family curculionidaepiepit occupiedpreoccupied by eggeleggerss 1930

NEW SYNONYMY IN scolytidaewhen browne named xyleborusfinnosanusxulehontsfonnosanus

cited above hebe overlooked previous usage of cosmoderesCosmo deres eichhoffthistinstius namenarne inin the combination xyle-borus

species group cosnulerescowioderes eichhoff 1878 societe entomologique demancus fiormosanusformosanusformosannsanus eggers 19301930186186 liege memoiresmetnoiresMemoires 0849528 495493 type species cosmokmvcwnocer

because the browneB rowne name is a junioramorumor homonym monificollismonilicollimontmonimonificollislicolli eichhoff monobasic


pseudocosmoderespseuctocosmoderes nobuchikobuchiNobuchi 1981 kontyukostyu 49116491 16 type liparthrumLiparthrum wollastonspecies pseudocosmoderes attenuatesattenuatus nobuchikobuchi cosmoleresmoderes monificollismomhcollismonificollis eichhoff original designation new liparthmmlipatthmm wollaston 1854 insecta maderensiaMaderensia p 294

synonymy type species liparthnunliparthmm bituberculatumbituherculatum wollastonoriginal designation

typophellostrypanophellosTYPOphellos bright 1982 studies on neotropical faunathe pseudocosmoderes nobuchikobuchiNobuchi citedgenus and environment 1716617 166 type species trypanophellostnpanophello1above named for pseudocosrrwderespseudocosmodereswas necopinus bright new synonymyattenuatesattenuatus nobuchikobuchiNobuchi 1981191igligi the photograph ofthe type material that accompanied the original trypanophellos copinusnecopinusne bright was baseddescription isis an illustration of cosnwderescosmoderesCosmo defesderes on a unique female collected by schwarz atlittit

monilicollis eichhoff 1878 the nobuchikobuchi genus cayamascalamasCayamas cuba I1 examined this specimen in

is an obvious synonym of cosmoderescosnwderesCosmo defesderes the 1976 at the US national museum and recog-nizedspecific synonymy requires confirmation but is it as a distinctive undescribed species of

almost certainly correct liparthrumlipatlhmmLip arthrum the holotype was recently reexamreetamined and compared to other liparthrumlipatthntmLip arthrum spe-ciesdryocoetes eichhoff because I1 am unable to see any generic

dryocoetes eichhoff 1864 in schrenk riesen und characters that might possibly distinguishforschungenFors chungen inm amur lande 2155 type species trypanophellos from lzparthrumlipatfhtum brightsBostbostnchusbostrichusrichus autographus ratzeburg subsequent designa-tion

generic name is placed in synonymy under theby wood 1974 senior name as indicated above the species L

pityophthofideapttyophthondea wickham 1916 state university of iowalaboratory of natural history bulletin 7187 18 figs 27 28 necopinus isis unique among americanamerlean lipartype species pityophthorideapityophthondea diluvialistdiluvialisdiluvialis wickham orig-

inalthrum species inin having a double row of scales

designation newsynonymynew synonymy on the declivital interstriveinterstriaeinterstriae

the figures of the holotype of pityoph Polygraphpolygraphusus erichsonthoridea that were published with the original polygraphusPolygraphus erichsonEnch son 1836 archivarchev fuiful natnrgeschichtenaturgeschiclitedescription indicate that the type species P 2157915721 57 type species hyiHylHylehyiehylesinushylesmussinusesmus pubescentpubes cens Fabrifabrichisfabncinschis

diluvialistdiluvialisdiluvialis is a member of the genus dryocoetes dermestes poligraphus linneaus monobasicnipponopolygraphnsnipponopolygraphits nobuchikobuchiNobuchi 1981 kontyukostyu 491249 12 type

consequently wickham s name pityophthor species nipponopolygraphusnipponopolygraphii kadrkahrkahrtochikaimochikailochimochitochimockiiochi NonobuchinohuchinoquchinobNoh buchiuchibuchlbuehl ongiorigiangiidea is placed inm synonymy under the senior nal designation new synonymy

name as indicated abovethe holotype and two paratypesparatypes of

hypothenemus westwood nipponopolygraphus kaimochikaimochi kobuchinobuchi werehypothenemus westwood 1836 entomological society of examinedandexaminedexaminedandand found to be normal specimens of

london transactions 1341 34 type species hypothenemus Polygraphpolygraphusus erichson inin which the eye is deeplyerudituseruditus westwood monobasic emarginate but not divided approximately

kobuchinobuchiNobuchi 1981 49l1449114491 14macrocnjphalusmacrocryphalus kontyukostyu type fifth of the in this have theone species m genusspecies macrocryphalus oblongus nobuchikobuchiNobuchi original designation probable synonymy halves of the eye connected the nobuchinobucbikobuchi

genus was based on this one unusable characterthe genus macrocryphalus kobuchinobuchiNobuchi cited and must be placed in synonymy as indicated

above was named for macrocryphalus oblongus abovenobuchikobuchiNobuchi A close examination of the photo-graphs

scolytogenes eichhoffof type material published with the orig-inal descriptions clearly indicates that the scolytogenes eichhoff 1878 preprint ofofsocieteSociete royale des

sciences de liegelidge MemomemoiresmeinonesmainonesMeimernonesires 28475 479 type spespecies oblonguslongusob isis composite the male cies scolytogenes darwinidarwimdarwicdardini eichhoff monobasicillustrated is a female of hypothenemus cryphalophilus schedl 1970 kontyukontynkoltyn 3835838 358 type species

scicollisscicollis eichhoff becomintecomin cnjphalophiluscryphalophilus operajeroierafef schedlsched monobasic correction offfuscicollisfusciu a species rapidly becoming9pantropical in distribution through commerce synonymy

the female female of anotheris a due to a clerical error in wood 1984228hypothenemus species that cannot be identified the name cruphalophilus071phalophilus schedl was ancorincorwith certainty from the illustrations it repre-sents

erectlyrectly placed inin synonymy under the namean obvious introduction from another scolytodes a neotropical genus cryptalcryphal

area the name macrocryphalus is here placed ophilus isis actually a synonym of scolytogenes ain synonymy until the name oblongus can be circumtropical genus the holotype of the typeclarified species C ajerafef was examined


taphrorychus eichhoff proportions as C minimus and falls well within

taphronchustaphrorychus eichhoff 1878 preprint of societe royale the limits of variability and geographical rangedes sciences de liegelidge meinoiresmernoiresMeinoMernoiresires 284920428 49204 type spe for this species because only one species isclescieselesclescies bostrichusbostnchusBostrichus bicolor herbst subsequent designation represented by this material the namebalgensisbalgensisbybyiiopkmshopkins 1914 is in indicated aboveplaced synonymy astaphrocoetes pfeffer 1987 acta entomologicaEntomologicentomologicalabohemoslovaca 822282 22 type species taphrorychus coccotrypes dactyliperda fabriciushirtelloushirtellushir tellus eichhoff original designation new synonymy

bostrichusbostnchusBostrichus dactyliperda fabricius 1801 systemasystems elethe name taphrocoetes pfeffer cited above utheratorumutheratoruniutheratorum 23872 387 syntypesSyn types female date pits inter-

ceptedwas proposed as a means to subdivide the genus in europe copenhagen museumcccotrypescoccotrypes tropicstropicustropicus eichhoff 1878 preprint of soci6t6societetaphrorychus using the size and distribution of royale des sciences de liege memoiresMemoires 983122831228 312 holo-

typeasperitiesasperities on the anterior slope ofthe pronotum female america mendionalismeridionalisMeridionMendio nalisnailsalisails peru hamburgbecause taphronjchustaphrotjchus is much more wide-spread

museum lost new synonymyand diverse wood 198674 than was

known to pfeffer a division of the genus using eichhoff states in the original descriptionthe pronotal characters he proposed is not cited above that his coccotrypes tropicustropicstropicus is

possible or meaningful several examples of all near C dactyliperda because the descriptioneuropean and most asiatic species of this genus fits the pantropical dactyliperda because therewere examined in my review of this problem As are no known endemic coccotrypes in southindicated above taphrocoetes is placed in syn-onymy

america and because the unique holotype andunder the senior name only known specimen of tropicustropicstropicus was lost in the

destruction of the hamburg museum C tropibrachyspattusbrachyspartus moritzi ferrari cus is here placed in synonymy under the senior

13rachyspartusbrachyipartu moritzi ferrari 1867 die forst und name as indicated above as a means of dealingbaumzuchtschadlichenbaumuchtschadlichen borkenkaferBorken kafer p 68 holotype with this unidentifiableoiefieofefemaleniale venezuela naturhistorischesnaturhistonsches museum wien species

coCort eylushylus obtususohtuws schedl 1966 entomologsche arbeitenarbeiterArbeiten cryphalus scabricollis eichhoffaus der museum frey 1712217 122 holotype female veneuelazuela natuihistonschesnaturhistoriscbes museum wien new synonymy cryphalus scalscabncolhsscalnicollisnicollis eichhoff 1878 preprint of societe

royale des sciences de liege memoiresMemoires 283628 36 holo-typethe female holotypesholotypes of brachyspartus hindustan asiaeariae hamburg museum lost

moritzinwritzi ferrari and CortCottcoftcorthyluscotthylushylus obtusus schedl cryphalus brevicollisbrevicollis schedl 1943 entomologische blatter391 2362 36 lectotype female baguiobagmobagao luzonwere compared directly to one another by me philippinenphilippinesPhilipp inen naturhistonschesnaturhistorisches museum wien desig-natedand were found to be identical in all respects by schedl 1979471979 47 new synonymy

they obviously represent one species in whichferrari s name has priority as indicated above the holotype of cryphalus scabricollis

eichhoff was lost in the 1944 destruction of thecarphoboruscarphohorus minimus fabricius hamburg museum my concept of this species

HylahylasinushilesinushiteHilesinnssinussinnssinus minimus fabricius 1801 systemasystems ele is based on a series of specimens in the forestutheratorumutheratoruinutheratorum 13951 395 syntypesSyn types 4 saxomaesaxoniaesaxoniteSaxomae copenhagen research institute dehra dun that was com-

paredMusmuseumeurncurneuln

carphoboruscarphohoni haihalbalbaibalgensishalgensisgensis murayama 1943 annotationesAnnotationes by beeson and eggers to the holotypezoologicaeZoologiczoologicalae japonenses 229922 99 lectotype male district before it was lost my series was comparedof balga manchoukuo china USU S national museum directly by me to this series then these speci-

menspresentpi esentbesent designation new synonymy were later compared to the holotype of C

carphoborus balgensisbalgensis murayama was brevisetosus schedl all represent the samenamed from one male and one female syntypessyntypes common widely distributed species that infestsmounted on separate microcardsmicrocards on one pin various species of ficus from india to the phil-

ippinethe male is in recognizable condition and is islands for this reason schedl s namehere designated as the lectotype for this mura-yama

C brevisetosus is here placed in synonymyname the female has been damaged under the senior name as indicated above

and only the head remains its face is entirely fields des walkerimmersed in glue this lectotype was compared despectuspectus

to males of my series of C minimus fabricius hylesinusHylesinus despectusdespectus walker 1859 annals and magazine of

from europe and northern asia while no two natural history 33261 holotype ceylon britishmuseum natural history

males of this species are ever exactly the same Hylehyiehylesinushyle&inussinus samoanussamoanus schedl 1951 bishop museum occa-sionalthe balgensisbalgen&isbalbaigensis lectotype is of the same size and papers 20101422010 142 syntypesSyn types male upolu


tapatapaoTapatapao british museum natural history and hylurgops modestus mmayamamurayama 1937 tenthredo 13671 367naturhistorischesndturhistonsches museum wien new synonymy syntypesSyn types pic biro du kongosankongosadkongoianKongosanosaD korea murayama col

lection inin USU S national museum new synonymy

the schedl syntypessyntypes of hylesinusHylesinus sansamoanussanwanussamomanuswanusanusschedl in the wien museum were examined by two female specimens inin the murayama colme and were compared directly to my homo lection are labeled as paratypesparatypes of hylurgopshyluropstypes of H despectusdespectus walker only one species modestus murayama their label indicates thatwas recognized on the basis of this comparison they were taken at yalelomiaYale lomia manchuria 25schedl s name is placed in synonymy as indi-cated

VIII 1940 by A takagi a second label givesabove manchoukuo collected 1940 J murayama

hylastesHy lastes plumbeusplumbeousplumbeus blandford hyluropshylurgops modestus murayama paratypebecause this murayama species was named inin

hylastesHy lastes plumbeusplumbeousplumbeus blandford 1894 entomological society 1937 it isis presumed that these paratypesparatypes areof london transactions 189418945757 syntypesSyn types nagasaki eta hiogagioga japan brussels museum actually metatypesmetatypes that were compared by

hylurgops fushunensis murayama 1940 annotationesAnnotationes murayama to his type series murayama told meZoologiczoologicaezoologicalae japonensis 1923519 235 lectotype female

inin 1955 that virtually all of his manchurianMancmanehunan col-lections

fushenbushen manchuria USU S national museum present des-ignation new synonymy had been destroyed during world war

11II consequently the above paratypesparatypes arehylurgopsfushunensishylurgops fushunensis murayama was based probably the only known existing specimens of

on one male and one female syntypessyn types that are modestusnwdestus that are reasonably authentic thesemounted on one pin the callow female isis paratypesparatypes were compared directly to mymounted upright the callow male is mounted homotypeshomotypes of H spessivtsevi eggers and wereupside down with the dorsal surface imbedded found to be normal overacreaveracreaveraverageacre specimens of thisin glue the female is here designated as the b

eggers species for this reason the name mod-estuslectotype for H fushunensis murayama this

isis placed inin synonymy under the seniorlectotype was compared directly to my ussunussurihussunindicated above

specimens of hylastesHy lastes plumbeousplumbeusplumbeus blandford that name as

were identified by kurenzov these specimens apsips stebbstebbingistebbmgistebbingsingi strohmeyerclearly represent one species for this reason

ipsaps stebbstebbingistcbhingistebbingsingi strohmeyer 1908 entoinologischenentomologischcn wochenbochenfushunensis is transferred to hylastesHy lastes and is blatt 2569 syntypesSyn types male female kula himalayaplaced in synonymy under the senior name as occidentoccidentahsoccidentabsabs strohmeyer collection Ebereberswaldebciswaldswaldswaid forestindicated above research institute dehra dun etc

ipsaps schmutzenhoferschmutzenhofen holzschuh 1988 entornologicaentomologicaEntomologicentomologicala

hylurgops interstitialinterstitialisis chapuis basiliensiabasilicnsiaBasiliensia 12481 485 1holotypeI lolo1010type male west bhutanchamgangChamgang 3000 m naturhistorischesnatmhistonschcs museum wien

hylastesHy lastes interstitialinterstitialisis chapuis 1875 societe entomolo new synonymybiquegique belgiqueBelgique annales 1819618 196 syntypesSyn types nagasaki andkiushusiushu brussels museumjapan

1I examined two syntypessyn types of ipsaps stebbstebbingistehhinqistebbingsingihulurphylurgopsapsops niponicusniponicus murayama 1936 tenthredo 11123123149 holotype male kamikochiKami kochi nagano prefecture strohmeyer inin the forest research instituteUUSS national museum new synonymy collection dehra dun as well as approxi-

mately 2000 other specimens of this speciesthe unique male holotype of hilurehulurehylurgops

b OPS from pakistan nepal bhutan and indianiponicusniponicus murayama was examined and com-pared

kashmir punjab uttarattar pradesh from speciesdirectly to long series of H intermy ofabiesof abies cedrus picea and pinusemusemmsfinusrinus griffitgriffithivnffithugriffithiihiibif I1 amstitialis chapuis from japan determined bykobuchinobuchiNobuchi and siberia determined by kuren unable to distinguish my specimens that were

zos the murayama holotype is an average COMPcomparedared to the strohmeyer syntypessyn types from two

japanese specimen of this species the name paratypesparatypes of I1 schmutzenhofer holzschuh or

niponicusniponicus is here placed inin synonymy under the from a series taken inin 1980 inin bhutan from picea

senior name as indicated above spinulosa by P singh it isis apparent from thedescription of 1I schnschmutzenhofentutzenhoferi that speci-menshylurgops spessivtsevi eggers cited as LI1 stebbingsstebbingistebbingi were actually of LI1

hylurgops spessivtsevi eggers 1914 entomologischeentomologischc longifolialongifohalongifolia a distinct but related species inblatter 1010187187 lectotype male ostsibenenostsiberien USSR UUSS of the above I1 is hereview schmutzenhoferischmutzenhofen isanderson andersonnational museum designated by &197119713030 placed inin synonymy as indicated above


phloeosinusphloeomius rudisnulls blandford contaminated by host resin thereby giving bothphloeosirmspliloeowm rsnisnigrudisr7s blandfoidblaudfordblandfordBlandBlaudfordfoidloidoord 1894 entomological society the stout bristles and scales the false impression

oflondonof london transactions 189473 syntypessyiitypesSyn types kashiwagekashiwaseKashi wage that they are all scalelike in reality these setaeand kolbe lapanlipanjapan british museum nainaturalNatuialulalulai history are precisely as in normal specimens of prox

111doeosinitspltloeowiu shotoensishotocnw MurMuimulmuiayamamurayaniamurayamaayamaayania 1955 yamaguti univer-sity

imus in addition the size falls well within thesityfacultyofagriculturefaculty of agiiciiltine bulletm6bulletin68888iiolotypeholotype malemaiejapan onudeknude shodojnnasfiodojima kagawa pref USU S national upper limits of size for proximusproximus the magnusmuseum new syrionyinyynoinmif holotype obviously is a normal large female of

proximusprox imus for this reason the murayama namethe type series of phloeosinus shotoensis is placed in synonymy as indicated above

Murmurayamaayania consisted of one male and sixsixfemales fromfroin the type locality and seven females scolytogenes braderibradera brownefromfroin other named localities murayama clearly cryphalomorphuscryphatoinorphus braderabraderi browne 1965 zoologischestates that the male is the type all 13 specimens mededelmgenmededelingen 40191 holotype ivory coast

in the type series were compared to my homo adiopodoume leiden museumcjphalomorphuscryphalomorphus orientaliaorientalisorien talis schedl 1971 opusculaopusculeOpusculaof P nidis blandford thetypes murayama entomologicaEntomologicentomologicala 11911119 11 holotype ghana bekwai

specimens fall well within the range ofvariabilvariabil naturhistonschesnaturhistorisches museum wien new synonymyity ofnidisof nidis because it is obvious that only onespecies is represented by these specimens the the holotype of cryphalomorphus orientaliaorientalisorientalisname shotoensis isis placed inin synonymy as indi-cated

schedl cited above was compared directly byabove schedl to the holotype of cryphalomorphus

braderibradera browne cited above and as indicatedpolyraphuspolygraphusPolygraphpulyPolypuig raphusus kaimochikaimochi nobuchinobucbikobuchiNobuchibuchlbuehl in a note in his collection he concluded that

nipponopotynippoiiojwltrapliuraphus kahkaiknikahnochikaimochinochimochi nobuchikobuchiNobuchi 1981 kontyukostyu only one species was represented I1 examined491349 13 holotype female shionomisaakashionornisaaka wakayama the schedl boloholotypetype and compared it to speci-

mensnobuchinobucliikobuchi collection lbibarakiaraki identified by schedl as braderibradera brownepolinipluipotjgrapltilsitslis queraanerdnerd wood 1988 greatcleatgleat basin naturalist4819548 195 holotype female mehalkhaliMehal khali burmaBu imalma forestfoiest and reached the same conclusion in view ofresearchRe seaichsealch institntejehrainstitute dehla dun new synonyinyynonyini this the name orientaliaorientalisorientalis is here placed in syn-

onymy as indicated abovethe female holotype and two paratypesparatypes of

nipponopoygraphusnipponopoliraphus kaimochikaimochi nobuchikobuchi were scolytoplatypus pardus sampsoncompared directly to one another and to the scolytoplatypusscoiytoplatypus carvusparvus sampson 1921 annals and maga-

zinetype series of polygraphuspolyraphusPolygraphPolypoin raphusus querci wood by me of natural history 073697 36 holotype malemaie Sarawak

and were found to represent only one species mt matangbatang british museum natural historyscolytoplatypus nificrufirupiruppnificaudaruficaudaaudacauda eggers 1939 arkivarkid for zoologizoologythe is inname placedjunior querciguerci in synonymy 31a43631a4 36 holotype ferfemalenalenaie kambaitiKambaiti nordost birma

asis indicated above 7000 ft stockholm museum new synonymy

polygraphuspolifraphusPolygraphus proximusproximus blandford four specimens of scolytoplatypus porouspoipotpolijraphuW raphitsrapbilshitsblis prolproiproxproypruyproximusproiviuimushinviunln blandfordBland foidfold 1894 entomological sampson thatwerewere compared to the holotype by

society of london transactions 1894751894 75 syntypesSyn types 2 browne were compared directly by me to ninesapporosappoioSapporopoiopoto japan british museum naturalNatuialulalulai historypohfohrohpoltiffdphhA raplats tammslonusionusnianustrmmsdianush MuiMuramulmuiayamamurayarnamurayamaayamayarna 1956 yamaguti university specimens inin the forest research institute

faculty of agriculture bulletin 7279 282 holotype dehra dun that had been identified by eggersfelfeifilfemalenalenaie Nishinislnmatanishiniataniata aki county kochi pref japan USU S as his S ruficaudaruficauda they all represent the samenational museum newsynonyinynew mfnompmf species assuming that eggers correctly identi-

fied his species the name s ruficaudaruficauda must bethe unique female holotype of Polygraphpolygraphusus placed in synonymy under the senior name Smanusmanns Murmurayamaayania was examined and com indicated abovepared to my series MTof P proximusprox imus blandford that carvusparvus as

had been identified by kurenzov nobuchikobuchiNobuchi and sphaerotrypes querci stebbingpfeffer A series of this species received from

sphaerotrypes stebbing 1908 indian forest memquercihad been identified FP obmurayama as longus oirsairs series 5 115ils11 5 syntypesSyn types sex india NWN W himal-ayablandford and is presumed to be incorrectly kumaunkumaus forest research institute dehra dun

placed by himhirn the magnus holotype is 3.23232 mm lost

in length exclusive of the head which isis sub-stantially

chratnesuschrarnesus globutuslobulushulus stebbing 1909 indian forest memoirsairs forest zoology series 122112 21 holotype kathiangathianKathian

stantial ly smaller than stated in the original chakrataChakrata UPU P india foiestforest research institute dehradescription the pronotum of this specimen isis dun preoccupied


sphaerotrypes tedus beeson 1921 indian forester 4751447 514 manza gumma pref japan USU S national museumMn seninholotype sex kathiangathianKathian chakrataChakrata UP india forest new synonymy

research institute dehradehradunDeh raDundun automatic new synonymythe female holotype of blastophagusblastophaus multi

the series of sphaerotrypes querci stebbing setosus murayama my topotypic homotypeshomotypes ofin the forest research institute dehra dun B phasianuskhasianuskhasianus murayama and my homotypeshomo types ofcollected by stebbing and others does not B brevipilosus eggers were all comparedinclude original specimens however steb-bing

directly to one another although the assams identification description and notes specimens are somewhat larger all share the

clearly indicate that this name was correctly very short interstrial setae and are here placedapplied to his series this material was examined in the same species this species isis very closelyand compared directly to the holotype of allied to piniperdapiniperda linnaeus and is distin-

guishedChramechramesussus globulusglobulousglobulus stebbing by me both sets with some difficulty from that speciesofofspecimensspecimens clearly represent the same species by the setal characters it is currently placed ininbeeson recognized that the name S globosusglobosus the genus tomicustominus under the senior namewas preoccupied by blandford and proposed brevipilosus as indicated abovethe replacement name S tectusdectus for stebbingsstebbingsspecies the senior synonym S querci steb NEW introductionsbing has priority and isis used to designate thisspecies as indicated above hylastesHy lastes opacousopacus erichson

hylastesopacushylastestasteslastes erichsonEnch son 1836archivfm1836archivfiirsueusjueus niisimainiisimai eggers Hy opacusopacous natnigeschichtenaturgeschichte915121512l5121 51 syntypesSyn types presumably germanyGeigel many berlinbeilinbellin

hyorrhynchus niisimainnsimainiisimaisimal eggers 1926 entomologischeentomologiscbe museumbilitter22133Blatterblatter2222 133 holotype female japan urakawahokoUrakawa Hokodate USU S national museum A seriesserlesseriesserles of hylastesHy lastes opacousopacus erichson was col-

lectedsphaerotrypes controversae murayama 1950 insecta near the eastern tip of long island onmatsumuranaMatsumurana 176217 62 lectotype female daidommamidaidominarm fishersfishers island suffolk co new york USA 23yama kochi pref shikokiuShik okiu japan USU S nationalmuseum present designation new synonymy may 1989 from an apsips pheromone trap by T

W phillips circumstances ofthe collection sug-gestmurayama named sphaerotrypes con that this species has established a breeding

troversaetroversae from six female specimens mounted population at that site this species is commonon two pins although he refers to a type a throughout the pine belts of europe and north-

ernholotype was not marked or labeled by mura-yama

asia and it has become established in pinethe two specimens mounted on separate plantations in south africa while it breeds pri-

marilypoints on one pin are covered by glue and are in the roots and stumps of pine pinusrecognized with difficulty on the other pin the sppapp and spruce picea sppapp it is known as anthird specimen from the top or the second one economic pest of small seedlings of these treesup from the bottom is in the best condition and phloeosinus areatusarmatus reitteris here designated as the lectotype of con

phloeosinus armatusarrnatusargatusarrnatus reitter 1887 wiener entomologischeentomologislhetroversaetroversae these specimens were compared zeitung6zeitung61926 192 holotype male syriensynenkyrien naturhistorischesnaturhistonschesdirectly to my homotypeshomo types and other series of museum wienjueussueus niisimainiisimai in my collection and are identicalin all respects because only one species isis rep-resented

this species was recently found to be estabbestab

the name controversae is placed in lisheddished in los angeles co california USA in a

under the indicated broad area inin sufficient numbers to cause eco-nomic

synonymy senior name asabove losses in cupressus sppapp it was previously

known from cyprus syria and israel where ittomicustominus brevipilosus eggers is an important pest of cupressus sppapp

blastophagus brevipilosus eggers 1929 entomologischeblatter 2510325 103 syntypesSyn types 2 fukienfucienFukien china eggers col-lection

NEW SPECIES

blastophagus phasianuskhasianuskhas ianus murayama 1959 brooklyn ento-mologicalmo logical society bulletin 547554 75 holotype shillong cyclorhipidion subagnatum n spassam india USU S national museum new synonymy schedl 1957100 cited xyleborus subblastophagusbki&tophagus multisetosus murayama 1963 studies inin thescolytid fauna of the northern half of the far east agnatusygnatus eggers nomen nudumdudum he latershukoshsbukosb press fukuoka p 37 holotype female mt schedl 196194 expressed the opinion that


X subagnatussuhagnatus eggers from the philippine strongly impressed hairlikehairlinehairlike setae shorter lessislands was actually X carvusparvus lea of aus-tralia

conspicuousand he published a complete description elytraclytra 17 times as long as wide outline similar

of the philippine seriesserlesseriesserles inin that article under the to costicepscosticeps striae I11 slightly others notname ofofxofaX carvusparvwparvus later he schedl 19643141964 314 impressed punctures rather small round deepsaw the type ofofxofaX carvusparvus recognized the differ-ences

interstriveinterstriaeinterstriae as wide as striae smooth shininginin the two taxa and presented the new punctures minute confused moderately abun-

dantname S subagnatus schedl for the philippine declivity gradual not steep evenly ratherseriesserlesseriesserles he then schedl 19791979239239 designated a narrowly convex sculpture as on disc exceptlectotype for X subagnatussuhagnatus schedl interstriveinterstriaeinterstriae 1 3 each with a row of about six

because X subagnatussuhanatussubsuhanatus eggers was never val minute granules vestiture much less abundantidatediodated schedl s presentation of a new name for than in costicepscosticeps interstrial rows of erect setaeit did not meet the requirements of the code of rather slender each about as long as distance

nomenclature between rows ground cover recumbent eacheven though a description existsfoiforfol the taxonmaxon this taxon has been transferred to seta about half as long as erect setae

the genus cyclorhipidion where it isis treated FEMALE similar to male except fronshere convex carina less conspicuous

cyclorhipidionciclorhipidion subagnatum isis presented here TYPE MATERIAL the male holotype femaleas a species new to selencesciencescienceselence the validating allotype and two male paratypesparatypes are fromdescription isis published inin schedl 1961941961 94 95 rotoruaRotorua new zealand hopk US 3726 U C Lunder the inisluislulsmisidentifiedidentified name xyleborus pardus massey the holotype allotype and paratypesparatypes

lea the female holotype isis the specimen are in my collection

labeled as the lectotype of xyleborus sub thitsithithiPolygraphpolygraphusus n spamatus schedl inin the naturhistonschesnaturbistorischesfmuseum wien the type locality isis mt indhid the name spongocerus thitsithithi beesonluzon philippine islands other specimens inin 1941387 nomen nudumdudum was used by beesonthis schedl seriesserlesseriesserles from this locality inin the wien without a description or designation of typemuseum material either in the original publication or onare paiaparapalapaiatypesparatypestypes

specimens in his collection browne 1970550dendrotrupes sealanZealancealanzealandicuszealandicusndicus n sp recognized this deficiency and attempted to

correct the problem by designating beesonathis species isis distinguished from costicepscosticepsbroun the only other named species inin this specimen as lectotype and presenting a

of it however in order for lecto-typedescription agenus by the smaller body sizesize by the less

to become a primary type it must be validlystronglystion gly impressedimpi essed male frons that lacks ab code of nomenclature 1985 arti-cle

median epistomal denticle and by the more designated74a in the becausepresent caseevenly rounded elytral declivity thitsithithi beeson nudumdudumspongocerus was a nomen

MALEMALL length 1.515151 5 171 7 mmmin 272 7 times as a type series did not exist and because therelong as wide color brown elytraclytra mostly light were no syntypessyn types a lectotype could be not bebrown validly designated therefore regardless of the

frons broadly moderately concave from action by browne 1970550 beeson s nomenepistoma to slightly above eyes deepest at its nudumdudum remained invalid the namecentercentel upper area subruguloserugulosesub and punctured spongotarsus is currently a synonym of polylower third more nearly shining and subacicu graphusgrachusgraphus consequently the species cited aslate lateral arginsmarginsarainsin subacute only near antennal thitsithithi is here transferred to that genus woodinsertions rounded above a fine median earlnacarinaearmacarma 198656from center ofconcavityof concavity to epistomal margin for the purpose ofvalidating this name polyusually higher on lower third without a denticle grachusgraphus thitsithithi is presented here as new to sci-

encenearneal epistoma as seen inin costicepscosticeps vestiture it is allied to P kaimochiikaimo chii nobuchikobuchiNobuchi fromhairlikehairlinehairhan likeilke latherrather sparse and inconspicuous not burma but it is distinguished by the muchconspicuously longer and more abundant on larger size 474.747 5.85858ss mm by the completelymargins as inin costicepscosticeps divided eye by the larger pronotal punctures

Pronopronotumtuinturntulu 0.909090og 9 times as long as wide similar to by the more slender elytral scales and by thecosticepscosticeps except punctures more sharply more host


browne 1970550 presents a full description dehra dun from the states of karnatakaKarnatakaof P thitsithithi browne s invalid lectotype is here madhya pradesh and maharashtra fromdesignated as the female holotype of P thitsithithi euphorbia sppappexcept that the type locality namma reserveburma is incorrectly spelled brownesbrownes data xyleborus magnificusmagnificus n sp

are correct it is in the british museum natural this species is distinguished from X spathaspathihistory the male allotype has the lower half pennis eichhoff by its larger body size by theof the frons shallowly almost concavely much more broadly less steeply convex elytralimpressed on the median third it bears data declivity by the much less strongly impressedidentical to the holotype and is in my collection elytral striae and by other details describedone female paratype inin my collection and 47 below it is a much stouter species than Xparatypespara types of both sexes in the forest research princeps blandford in a series of spathipennisinstitute bear data identical with that of the from the same locality and date the strial punc-

turesholotype on the disc are mostly confluent in magnificus they are mostly separatetriotemnus pilicomispiliconispilicomis n sp

FEMALE length 5.65656sg mm paratypesparatypes 5.55555

this species is distinguished from zeylanizeylajeylanizeylanicusnicusCUS 55.75757 7 mm 2.323232 3 times as long as wide color verywood below by the slightly larger size by the dark brownlighter color by the coarser pronotal punctures frons about as in spathipennis

the median horn the maleby very large on pronotum similar to spathipennisvertex and by the very small mandibular spines

exceptanterior less

in the male margin strongly producedstraighter serrationsserrations less well developed

MALE length 1.515isls 2.22222 mm female slightly discal area smoother smallersmaller 2.52525 times as long as wide color brown punctures

elytraclytra similar to spathipennis except formfrons strongly transversely excavated feebbeebfeeblyY slightly stouter posterior margin more broadly

if all betweenat concave eyes a very large rounded profile of upper declivity moredorsoventrally flattened median on v4exvertexspine strongly less evenly arched striae much lessthis often than twicespine more as long as

strongly impressed on disc not at all impressedscape surface smooth shining glabrous dorsal

interstriveinterstriaeinterstriae muchon declivity more broadly con-vex

surface of spine strongly pubescent these setaedisc flat smallerlong on on declivity puncturesvery

more numerous more obscure and almostpronotum very slightly longer than wide sub-quadrate surface smooth shining punctures never replaced by minute granules on declivity

declivital interstriaeinterstriveinterstriae 2 and 4 never with setae acoarse deep vestiture sparse rather short veryfew shortlong and conspicuous on lateral and anterior setae present in spathipennis

margins TYPE MATERIAL the female holotype andfive female paratypesparatypes are labeled juninbunin pre-sumably

elytraclytra similar to zeylanicuszeylanicus except punctures peru ol01 IX 79 S poucorpoupor EESC 5-

80slightly smaller setae more slender declivitymore broadly convex the holotype and paratypespara types are in my

collectionFEMALE similar to male except frons

weakly transversely impressed stronger thanfemale zeylanicuszeylanicus moderately punctured literature CITED

without spines on vertex or mandiblesBEAVERBEAVFR R A 1991 new synonymy and taxonomic

TYPE MATERIAL the male holotypeholoecholoe female changes inin pacific Scolytidscolytidaeac coleoptera naturhisallotype and six paratypesparatypes were taken at tontoritorltonschestorischessches museum wien annales serieserlesene B 928792 87 97

chikaldachikallaChikalda malgahatmalgarat CRCP india 16 X 1936 BEESONbreson C F C 1941 the ecology and control of theforest of india and theinsects neighboring countriesRRD 106 RCR 181 cage 660 from published by the author dehladebradehra dun 5 iin 1007 ppapeuphorbia sp by N C chatterjee all are 203 figs 36 pis

mounted on two pins the holotype is the BROWNEBROWN E F G 1970 some scolytidae and platypodidaePlatypodidaeuppermost specimen and the allotypealloe is the coleoptera inin the collection of the british museum

third specimen down on the same pin the journal of natural history 45394 539 583SCIIEDLSCIIFDL K E 1957 Scolytoidscolytoideaea nouveauxnauveauxnouveaux du congo

holotype allotype and are in col-lection

paratypesparatypes my beigebelge 11II mission R mayne K E schedl 1952more than 480 non type specimens annales du musee royale du congo beigebelge tervurenTervuren

were examined at the forest research institute serieserlesene 8 sciences zoologiques 56156 1 162


1961 fauna of the philippines IX philippine 1972 new records and species of americanjournaljouinalouina 0ofscicnceselencescience 90l8790187901 87 96 platypodidaePlatypodidae coleoptera great basin naturalist

1964 zurzuizul synonymic deiderdel Borkenborienboikenkaferborkenkaferkaferkaher XV 3124331 243 253Reichenreidwnbachiareichenbachiabachia 329303329 303 317 1984 new generic synonymy and new generagener i of

1979 die typencypen der sammlungsaininlungSammlung schedl familiecamilie scolytidae coleoptera great basinB ism naturalistscolytidae coleoptera katalogeKata loge der wissenschaft 4422344 223 230lichen sanunhingensaithtiliingen des naturhistorischenndtnrhistonschen museums 1986 A reclassification of the genera ofinmwienkwienwien entomologieentoinologieentomologize 32 286 p scolytidae coleoptera great basin naturalist mem

woolwooi S L 1969 new synonymy and records of oirsairsoirsairs 10 126 ppapplatypodidaeplatypodidaeandPlatypod idae and scolytidae coleoptera great basinnaturalistNat malist 2911329 113 128 received 6january6januan 1992

accepted 24 january 1992

k


nomenclatural CHANGES IN scolytidaeAND platypodidaePLATYPOD IDAE coleoptera

stephen L wood

ABSIRAC 1 new synonymy in scolytidae includes cryphalus picenepiceae ratzeburg 1837 cryphalus subdepressuswbdep resellseggers 1940 gnathotrupescnathotrupesGnatho trupes longiusculus schedl 1951 Gnathognathotrupescnathotrupe&trupes ciliatusciliatukiliatuniitciliatusatuafuafus schedl 1975 hypothenemushypotheneimi Crucrudituscrnditudituswestwood stephanoderesStephanoderes comcommuniscommumscommonismunis schaufuss 1891 in platypodidaePlatypod idae the new namedame platypus abmptiferabruptiferabrupt iperifer isis proposedas a replacement for the junior homonym platypus abruptabruptusus browne 1986 type species designations are proposed forfoifot thegenus group names Scutoscutopygusscutopijguspygus nunberg 1966 pygodolius nunberg 1966 mixopygusmiopygiis nunberg 1966 mesopyglismesopyusnunberg 1966 asetusavetus nunberg 1958 stenoplatypusStenoplatypus strohmeyer 1914 platypinusPlaty pinus schedlsched 1939 plattpiattplatyscapuyscapus schedl1939 treptoplatypusTreptoplatypus schedl 1939 tesseroplatypusTesseroplatypus schedl 1935 previously unpublished specific synonymy isis presentedfor crossotarsusCrosso tarsus externedentatusetemedentatus fairmaireFairmaire 1849 dianusdiapusDiapus talurae stebbing 1906 crossotarsuscwfsotarwCrosso tarsus termintennitarmintarminatustenninatusatusnatus chapuisCliacilapuispuls1865865crossotarsusnicobancuscrossotarsusCrosso tarsus nicobaricusnicobaricus beeson 1937 platypus abditusahditus schedlsched 1936 platypus transitus schedl 1978 platypusrugosifronsrugostfrons schedl 1933 platypus pretiosus schedl 1961 platypus tiriosensistinosensistiriotinosensis reichardt 1965 platypusPlatypulpui schedliscjiedlischedlin wood1966 treptoplatypusTreptoplatypus multiporusmultiporus schedl 1968 platypusfastuosusplatypus fastuosus schedl 1969

key words scolytidae platypodidaePlatypodidae coleoptera nomenclature

the following pages record items affecting specimens of kurenzovikurenzovi west of ussuryussuri and ofnomenclature in scolytidae and platypodidaePlatypod idae that the occurrence of piceaepicene ratzeburg citedare presented here in order to make the changes above throughout europe and northern asia itavailable for the world catalog now in preparation appears prudent to follow reitter and recognizefor these families included are three cases of new the turkish population as picenepiceae for thisspecific synonymy in scolytidae in platypodidaePlatypod idae reason the name subdepressus is placed in syn-

onymyare a one new replacement name for a junior as indicated abovehomonym b 10 type species designations for

Gnathognathotrupescnathotrupestrupes longiusculus schedlgenus group names and c six new cases of spe-cific synonymy gnathotnchusgnathotrichus longiusculus schedl 1951 duseniaausenia 22121121

holotype male tierra del fuego viaviivla monte eggerscollection naturhistorischesnaturhistonsches museum wienNEW SYNONYMY IN scolytidae Gnathognathotrupescnathotrupestrupes ciliatesciliatusciliatus schedl 1975 studies on thetiietileneotropical fauna 104 holotype female argentina

cryphalus picenepiceae ratzeburg nahuelmahuel huapihuape national park naturhistorischesnatuihistonsches museumwien new synonymy

Bostboslbostrichusbostnchusrichus picenepiceae ratzeburg 1837 die forst insektenkafer 11631 163 syntypesSyn types oberschlesien un balem institutinstitute the male holotype of gnathotrichusfur pflinzenschutzpflanzenschutz eberswaldeEberswalde longiusculus schedl cited above and thecryphalus subdepressus eggers 1940 cedtralblattcentralblattCentralgentralblautblatt furfu rgesamte forstwesenForstwesen 663766 37 holotype kleinasienKlein asien

female holotype of gnathotrupescnathotrupesGnathotrupes ciliatesciliatusciliatusAyancik inin northern turkey eggers collection inin schedl cited above were compared directly to

naturhistorischesnaturhistonsches museum wien new synonymy one another and to other males and females ofthis species in the schedl collection and in my

A schedl note in his collection indicates that collection because distinguishing characterscryphalus subdepressus eggers from northern that might be used to separate species areturkey cited above is synonymous with C absent it is apparent that only one species iskurenzovikurenzovi stark C punctulatus eggers from represented by this material the name ciliatusciliatesciliatusthe far east of USSR and with C picenepiceae as is pplacedlaced in synonymy in the genusgenusidentified by reitter in the absence of known gnathotrupescnathotrupesGnathotrupes as indicated above

1332332 liflitelife adensdenscience museum brighbnliun Yyoungg uiumvcisityity poP o utahlituli ill 84602

89


hypothenemus enueruhruemdituseruditusditus westwood this ambiguity from these names a type speciesis above for each of them becausedesignatedhypothenemus eyuerueruditusemchtusemchditusfustusfur westwood 1836 entomological

society of londonoflondon transactions 1341 34 syntypessyntypcsSyn types female doliopygusDoliopygus contains only 142 species and theengland some in british museum natural history diversity within the genus is only moderate it islondon felt that sub in this not neededsubgeneragenera genus areStephanostephanoleresstephanwlerelereslefes comcommumscommuniscommonismunis schaufuss 1891 tijdschrifttijdschnft voorentomologieentomologize 3411 holotype female madagascar at the present time these nunberg names areschedl collection inin naturhistorischesnaturhistonsches museum wien regarded as synonyms of doliopygusDoliopygus as indi-

catednew synonymy above

the female holotype of stephanoderesStephano deres com periommatus chapuismunis schaufuss cited above has the headmissing and most of the body scales have been periommatuspenominatus chapuis 1865 Monogmonographicraphie des platypides

42316 petiommatuspenommatus longicollislongicolhslongi collis chapuisp type speciesrubbed off but there is no doubt whatever that monobasicit represents a normal female of hypothenemus asetusavetus nunberg 1958 acta zoologicaZoologiczoologicala cracoviensia 2102 10

erudituseruditus westwood the holotype of communiscommoniscommunis type species periommatusperiomriwtus severini strohmeyer present

was examined by me and compared directly to designation synonymy by schedl 1972

my homotypeshomotypes of erudituseruditus this is the most the avetusasetus cited abovename nunberg wascommon species of scolytidae in the world

established and then in underalthough it is often recognizeda4threcognized with difficulty as placed synonymyperiommatus as indicated even though it is anin this case the new synonymy is indicated

above essentially unused namenaine in order to removeambiguity from citations of it a type species

NEW NAME IN platypodidaePLATYPOD IDAE must be designated this designation is givenabove

platypus abruptiferabrupt ifer n n platypus herbstplatypus abntptusahniptus browne 1986 kontyokoneyokontyo5454337337 holotype platypus herbst 1793 natursystemNatur systemystem alleralteraileralier bekanntenbekarmten

malemaie new guinea adi island to nagoya japan insekten der kaferkmer 51285 128 type species bostrichusBostrichus cylbritish museum natural londonimported history andrusindrus fabricius monobasic

preoccupied by sampson 1923 stenoplatypusStenoplatypus strohmeyerohmeyerSti 1914 cenerageneraceneralnsectoruminsectorumInsectorum fase16335163 35 type species crossotarsusCrosso tarsus spinulosusspznulosus stroh-meyerthe browne citedname platypus abruptusabruptus present designation synonymy by schedl 1939

above is a junior homonym and must be platypinusPlaty pinus schedl 1939 international congress of ento-mologyreplaced the new name abruptiferabruptifer is pro-

posedproceedings 73977 397 type species platypus curtus

as a replacement as indicated above chapuis present designation synonymy by wood 1979platyscapusPlaty scapus schedl 1939 international congress of ento-

mology proceedings 73977 397 type species platypus carGENERIC CHANGES IN platypodidaePLATYPOD IDAE inflatusinulatusinulatus chapuis present designation preoccupied by

huistachehristacheHui stache 1921 renamed platyscapulus schedl 1957

doliopygusDoliopygus schedl synonymy by browne 1962

doliopygusdohopyffiDoliopygus schedl 1939 international congress of ento-mology

the genus group names stenoplatypusStenoplatypus stroh-meyer

proceedings 774027402403402403402 403 crosstype speciesotardotarwotarsus bohbohemanihohemambohemannemani chapuis designated by schedl 1972 platypinusPlatypinus schedl and platyscapusPlatyscapus

scittopygussliitopyffis nunberg 1966 revue de zoologiezoologizeZoologie et de schedl platyscapulus schedl cited aboveBotbotaniquebotamqueanique Africafricainesafncainesainesalnes 7418718874187 188 type species cross were named without the designation of a typeotarwisotarwsotanotarwis mpa sampson present designation new synonymy to this and thepygodoliuspyodohus nunberg 1966 revue de zoologiezoologizeZoologie et de species remove deficiency con-

sequentBotbotaniquebotamqueanique Africafrieafricainesafncainesainesalnes 741881897418874 188iss188189189 type species cross ambiguity associated with thematanusotarwotanus vegrandisdegrandis sampson present designation new type species are designated as indicated above

mixopygusmiwpyussynonymy

nunbergNun beigbelg 1966 revue de zoologiezoologizeZoologie et de all three names are junior synonyms of platypusbotaniquebotamqueBotanique africainesafncainesAfric ainesalnes 7474188188 type species crossotarsusCrosso tarsus herbstconradtiumrdtlticonradti strohmeyer present designation new synonymy

Mesomesopygusmewpyuspygus nunbergNun bergbeig 1966 revue de zoologiezoologizeZoologie et dede tesserocerustesserocemsTesseroceruscemscefus saundersBotbotaniquebotamqueanique Africafrieafricainesatncainesainesalnes 7418774 18718874187188187 188 type species cross

tesserocerustesserocemsTessero cemscerusocrus saunders 1836 entomological society ofotarsusotarwotard ukereweensis schedl designation newpresent londontransactionsLondon Transactions 11551 155 type species platypus tessynonymy serocerusserocerus insegnisinsegms saunders monobasic

tesseroplatypusTessero platypus schedl 1935 entomologische zachrichndchnchnachrichfor the doliopygusDolio schedl nunberggenus pygus ten 91499 149 type species tesseroplatypusTesseroplatypus ursus schedlnamed the four sub cited above withoutsubgeneragenera tesserocerusTesserocerus insinsignisinsigmsinsigniasignis saunders present designationdesignating a type species for them to remove synonymy by schedl 1972

199211992 nomenclatural CHANGES IN scolytidae AND platypodidaePLATYPOD IDAE 91

the genus group name tesseroplatypusTesseroplatypus nicobar forest research institute dehra dun new

schedl cited above was proposed without the synonymy

designation of a species to remove thistype the male holotype and seven paratypesparatypes ofdeficiency a type species is designated as indi-cated

crossotarsusCrosso tarsus nicobarnicobaricusicus beeson cited aboveabove the name was placed in synonymy were compared by me directly to the beeson

several years ago as indicated series of C venustusvenustus chapuis C terminatesterminatusterminatustreptoplatypusTreptoplatypus schedl chapuis cited above and two of these to my

series ofofcofaC terminatusterminatesterminatus in the absence of distin-guishingtreptoplatypusTreptoplatypus schedl 1939 international congress of characters all consideredguigulshing were to rep-resent

entomology proceedings 7401 type species crossotarsus trepanatustrepanatnstrepanatus chapuis present designation the same species for this reason the

name nicobaricusnicobar icus is placed in synonymy as indi-catedthe generic name treptoplatypusTreptoplatypus schedl above

cited above was nameda4thoutnamed without the designationabditus schedlof a type species to remove this deficiency a platypus

type species isis designated above as indicated platypus abditus schedl 1936 revue frantfranlfrancaiseasedsedentomologie 22462 246 holotype male naturhistorischesmuseum wien

NEW SYNONYMY IN platypodidaePLATYPOD IDAE platypus transitus schedl 1978 entomologischeentornologischeabhandlungen staatlichesStaat liches museum fur tierkundeTierkunde in

crossotarsusCrosso tarsus externedentatus fairmaireFairmaire dresden 4130941 309 holotype male brasilienBrasilien linharesLmhares Esanto naturhistorischesnaturhistonsches museum wien newnewsywnymysynonymy

platypus externedentatus fairmaireFairmaire 1849 revue et mag-asin de zoologiezoologizeZoologie pure et apphqueeappliqu6e ser 2 2782 78 holo-type

the male holotypesholotypes cited above of platypusmale taiti museum national dhistoire naturelleNaturelle abditus schedl and of P transitus schedl were

parispans compared by me directly to one another and totalurae Stebb 1906 notesdianusdiapus stebbingmg departmental on

other of this becauseinsects that affect forestry calcutta no 3 p 418 syn representatives speciestypes india madras presidency N coimbatoreCoimbatore forests distinguishing characters could not be foundforest research institute dehra dun new synonymy the junior name transitus is placed in synon-

ymy as indicated abovethe species diapusdianus talurae stebbing cited

above was described as occurring throughout platypus rugosifrons schedlindia in economically significant numbers platypus rugosifrons schedl 1933 revistadevista de entomologiaentomologicreports from 1906 through 1908 repeat the Ssaoio paulo 31733 173 holotype male brazil S paulo alto da

it last mentioned serra naturhistorischesnaturhistonsches museum wienoriginal report was inin originalschedl 1961 pan pacificplatypus pretiosus entomologistliterature in 1914 indian foreststebbing 37233 holotype male venezuela mt duida califor-

niainsects p 626 where it was transferred to the nia academy of science san francisco new synonymygenus platypusthereplatypus there are no specimens underthis name or host shorea falura in the forest the male holotype of platypus rugosifronsrugosilugosifronsresearch institute dehra dun nor is the type schedl cited above and the male paratype ofofeoffPlocality represented on an indian platypodidplatypodplatypodiaid pretiosus schedl in the schedl collection werethe stebbing 1914 illustration is of a cross compared directly to one another and to myotarsus species probably externedentatus homotypeshomo types of this species because only onesaunderscsaundersisaun dersi because so many of stebbing s species appears to be represented by this mate-

rialplatypodidaePlatypod idae in the FRI collection are misidenmisiken the junior name pretiosus is placed intifications of this species talurae is placed in synonymy as indicated above

under externedentatus indicatedassynonymy platypus tmosensistiriosensistiriotivio sensis reichardtabove based on the stebbing illustration in theabsence of other evidence the fact that it was platypus tiriosensistinosensistiriotinosensis reichardtReicreierelehaidthaidihaldi 1965 papeiscapeis avulsos do

departamentoDepartamento de zoologiazoologicZoologia SecretsecretariasecretanasecretarialseeSecretanaariaarla de agnculturaagriculturaagricultureAgriAgn culturasaid be economicto a common economic species supports saoshio paulo 175317 53 holotype malemaie brasil estado de parathis placement tinos alto riono paru doestediestedOeste departamentoDepartamento de zoologiazoologicZoologia

SecretsecretariasecretanasecretarialSecretanaariaarla da agnculturaagriculturaagricultureAgriAgncultura saosho paulocrossotarsusCrosso tarsus terminatustenninatusterminatestermitenninatus chapuis platypus schedlinschedli wood 1966 great basin naturalist 265126 51

male manaka british guiana britishholotypecrossotarsusCrosso tarsus tenninatustenninatus chapuis 1865 Monogmonographicraphie des museum natural london newplatypides p 83 holotype male Singasingapoursmgapourpour british history synonymy

museum natural history londoncrossotarsusCrosso tarsus nicobaricusnicobancusniconicobarbancusicus beeson 1937 indian forest although direct comparisons of holotypesholoesdoloesholo types

records entomology 3863 86 syntypesSyn types nicobarsNicobars car were not made it is apparent from published


illustrations and from myrny examination of the platypusfastuosusplatypus fastuosus schedlsched 1969 linnean society of newsouth wales proceedings 942969422694 226 holotype male newschedl male of ofplatypusplatypus tiriotinofinotiriosensistinosensissensissensis reichardt guinea marafungdmarafudga 2800 inm CSIRO canberra new

cited above and odtheoftheof the P schedlischedhschedlin type seriesserlesseriesserles that synonymythese names are synonyms both reichardt andI1 sent specimens of this species to schedl inin schedl named treptoplatypusTreptoplatypus multiporusmultiporus

cited above from the female and platypus1964 for comparison to related species we bothfastuosus cited above from the male subse-quent

received encouragement from him to name thecollecting has demonstrated that these

species although subsequent events clearly the of thenames represent opposite sexes sameindicated that he bothwas fully aware we were species A note in his collection indicates thatworking with the same species the name schedl was aware of this problem both holoschedlinschedli isis placed inin as indicatedsynonymy types as well as additional material were exam-

inedabove the junior name fastuosus is placed in

treptoplatypusTreptoplatypus multiporusmultiporus schedl synonymy as indicated above

Treptotreptoplatypusrrcjtmlatpiiplatypus multipontsinultipnimultiponts schedlsched 1968 pacific insects1027010 270 holotype female okapaohapa kasa E highlands received 3 march 1992district new guinea CSIRO canberra accepted 13 march 1992

great basin NaturnaturalistndtuidlistnaturaistdistAistmist 521521 1992 p 93

BOOK REVIEW

plant biology of the basin and range C B but running through the basin in a north southosmond L F pitelka and G M hidy direction edaphic factors and their influencespringer verlag berlin 1990 375 ppap on water and nutrient availability and subse-

quent695069.506950 plant distribution are next consideredthere are islands of very disjunct soils through-outthis intriguing volume will be of interest to the basin

many people for a variety of reasons it was chapter 6 examines what most of us think ofwritten to honor W dwight billings who began in the great basin the lowland plants thehis distinguished career in what is now called emphasis is on ecophysiologyphysiologyeco and broad pat-

ternsphysiological ecology at the university of are the theme martyn caldwell and hisnevada at reno although he moved to duke workerscoworkersco have spent many years studying theuniversity in 1952 his heart and eonconconsiderableconsideraconsiderssidera e root systems of desert plants this summary ofresearch remained in nevada twenty seven their work is well worth careful study however

contributed the of theauthors nine chapters I1 was surprised to find only a cursory mentionbook while that is generally enough to make of the role ofofmycorrhizaeinycorrhizae chapter 8 deals withone move on to something else in this case it soundsisotopes and vegetation changes thatwould be a mistake although the book was not narrow and well focused but the chapter waswhat I1 expected I1 was pleasantly surprised the not it is an overview of the potential use ofchapters are very uneven and range from the carbon isotopes in physiological ecology thebroad and general to the narrow and highly last chapter deals briefly with climatic change intechnical the contributors are first rate and the has beenthe great basin the past very

well written I1 that the readerchapters suggest dynamic and exciting what may we expect infirst whatever and thenbrowse reading appeals the future

perhaps returning to some of the other areas while I1 was disappointed by some of thethe strangest chapter in the book is the ffirstirstarst

thingsthinus the title seemed to promise and did notit is nice introduction but in of itsone a spite deliverdeliverdellver I1 did like the book and recommend it

title is neither about anthropology or botany highly As in many books with contributed chap-tersthe dynamics of climate in the basin is the the lack of continuity or transition between

subject of the next chapter brief but interesting chapters left an overall impression of a dis-jointedit is written for the theclearly nonclimatologistclimatologistnon and uneven approach in spite of this

heart of the book is the 40 page chapter by wwee can be grateful for what was delivered wellhimself mountain forests of northbillings on written text that was fascinating and stimulating

america it extends the greatclearly beyondinin places nice illustrations good index physio-logicalshould be ofbasin but required reading every I1

I1 ecologists interested in the great basinstudent of here is the masterplant ecology should spend some time with this volumegiving us the distilled wisdom of decades ofresearch and thinking we then move on tohigh elevation forests in an excellent chapter on bruce N smith

the difficult problems imposed on living things department of botany and range scienceby the harsh conditions associated with altitude brigham young universitythere are high mountains not only surrounding provo utah 84602

93

information FOR AUTHORS

the great basin naturalist welcomes previously VOUCHER SPECIMENS authors are encouragedunpublished manuscripts pertaining to the biologi-cal

to designate properly prepare label and depositnatural history ofwestern north america pref-

erencehigh quality voucher specimens and cultures docu-mentingwill be given to concise manuscripts of up to their research inin an established perma-nent12000 words collection and to cite the repository inin publi-cationSUBMIT manuscripts to james R barnes editor

great basin naturalist 290 MLBM brigham references IN THE TEXTtofftefateaf are cited by author andyoung university provo utah 84602 A covercovel date e g martin 1989 or martin 1989 multipleletterletteietterlettiiettir accompanying the manuscript must include citations should be separated by commas and listedphone numbers of the author submitting the inin chronological order use et al after name ofmanuscript it must also provide information de first author for citations having more than two au-

thorsscribing the extent to which data text or illustra-tions have been used inin other papers or books that acknowledgments under a centered main head-

ingare published inin press submitted or soon to be include special publication numbers when ap-propriatesubmitted elsewhere authors should adhere to propriate

the following guidelines manuscripts not so pre-pared

literature CITED also under a centered mainmay be returned for revision heading lists references alphabetically inin the fol-lowingmanuscript preparation consult vol 51 no 2 formats

of this journal for specific instructions on style and mack G D and L D flake 1980 habitat rela-tionshipsformat these instructions guidelines IORFORporIlorOR MANU of waterfowl broodstionships on south da-kotaSCRIPTS SUBMITTED TO THE GREAT BASIN naturalist stock ponds journal of wildlife man-agementsupply greater detail than those presented here 44 695 700

inm condensed form the guidelines are printed at sousa W P 1985 disturbance and patch dynam-ics

the back of the issue additional copies are available lesies on rocky intertidal shores pages 101 124from the editor also check theupon request inin S T A pickett and P S white eds themost recent issueissue of the great basin naturalist ecology of natural disturbance and patch dy-namics

for changes and refer to the CBE style manual academic press new york5thath edition council of biology editors one coulson R N and J A witter 1984 forestillinois center suite 200 111 east wacker entomology ecology and johndrive chicago IL 60601429860601 4298 USA PHONF

managementwiley and sons inc new york 669312 6160800616 0800 FAX 312 6160226616 0226 24 ppap

TABLES are double spaced sheets andon separateTYPE AND DOUBLE SPACE all materials includinincludingincincludingludiniudin 9 designed fit the width ofto either columna singleliterature cited table headings and figure legends or a page use lowercase letters to indicate foot-notes

avoid hyphenated words at righthandright hand marginsunderline words to be printed inm italics use stan-dard bond 22 x 28 cm leaving 252 5 cm margins on

photocopies OF FIGURES are submitted initiallyall sides with the manuscript editors may suggest changes

lettering on figures should be large enough toSUBMITSUBMITS3 COPIES of the manuscript and the originalon a 5255 25 or 353 5 inch disk utilizing wordperfectWord Perfect withstand reduction to one or two column width

4.242424 2 or above number all pages and assemble each originals must be no larger than 22 X 28 cm

copy separately title page abstract and key words NOTES if the manuscript would be more amproapproappro-priatetext acknowledgments literature cited appen-

dices

as a short communication or note follow thetables figure legends figures above instructions but do not include an abstract

TITLE PAGE includes an informative title no longer A CHARGE of 45 per page isis made for articlesthan 15 words names and addresses of authors a published the rate for subscribers will be 40 perrunning head of fewer than 40 letters and spaces page however manuscripts with complex tablesfootnotes to indicate change of address and author andor numerous half tones will be assessed anto whom correspondence should be addressed if additional charge reprints may be purchased atother than the first author the time of publication an order form isis sent with

ABSTRACT states the purpose methods results the proproofsoffsofis

and conclusions of the research it isis followed bvby FINAL CHECK

6 12 key words listed inin order of decreasing im-portance

cover letter explains any duplication of infor-mationto be used for indexing and provides phone numbers

TWTEXT has centered mainmalnmainmaln headings printed inin all 3 copies of the manuscript and wordperfectWordPerfectcapital letters second level headings are centered diskinin upper and lowercase letters third level head-ings

conformity with instructionsbegin paragraphs photocopies of illustrations

ISSNissn0017001736140017 3614

GREAT BASIN naturalist voivol 52 no 1 march 1992

CONTENTS

articlesin memoriam A perry plummer 1911 1991 teacher naturalist range

scientist E durant mcarthur 1

secondary production estimates of benthic insects in three cold desert streamsW L gaines C E cushinggushing and S D smith 11

effect of rearing method on chukar survival bartel T slaughjerranberran T flinders jay A roberson and N paul johnston 2526

DNA extraction from preserved trout tissues 1I K shiozawa

J kudo R EP evans S R woodward and R N williams 29

relating soil chemistry and plant relationships in wooded draws of the north-ern great plains marguerite E voorhees and daniel W uresk 3355

the genus aristida gramineae in california kelly W allred 41

temperature mediated changes in seed dormancy and light requirement forpentstemonpenstemonPenstemon palmeri scrophulariaceae

I1 I1 stanley G kitchen and susan E meyer 53

late quaternary arthropods fromthefrom the colorado plateau arizona and utahscott A elias jim 1I mead and larry D agenbroad 59

microhabitatMicro habitat selection by the johnny darter etheostoma nigrumnigrim rafinesqueRafinesque ina wyoming stream robert A leidy 68

nomenclatural innovations in intermountain rosidaeRos idae arthur cronquist 75

nomenclatural changes and new species inin platypodidaePlatypodidae and scolytidaecoleoptera part 11II stephen L wood 78

nomenclatural changes in scolytidae and platypodidaePlatypod idae coleopterastephen L wood 89

book reviewplant biology of the basin and range C B osmond L F pitelka and CG M hidy

bruce N smith 93

Great Basin Naturalist - BYU ScholarsArchive

Documents

Transcript of Great Basin Naturalist - BYU ScholarsArchive