ORIGINAL ARTICLE

Glutamatergic and cholinergic pedunculopontine neuronsinnervate the thalamic parafascicular nucleus in rats:changes following experimental parkinsonism

Pedro Barroso-Chinea • Alberto J. Rico • Lorena Conte-Perales •

Virginia Gomez-Bautista • Natasha Luquin • Salvador Sierra •

Elvira Roda • Jose L. Lanciego

Received: 10 February 2011 / Accepted: 31 March 2011 / Published online: 16 April 2011

� Springer-Verlag 2011

Abstract The tegmental pedunculopontine nucleus

(PPN) is a basal ganglia-related structure that has recently

gained renewed interest as a potential surgical target for the

treatment of several aspects of Parkinson’s disease. How-

ever, the underlying anatomical substrates sustaining the

choice of the PPN nucleus as a surgical candidate remain

poorly understood. Here, we characterized the chemical

phenotypes of different subtypes of PPN efferent neurons

innervating the rat parafascicular (PF) nucleus. Emphasis

was placed on elucidating the impact of unilateral nigro-

striatal denervation on the expression patterns of the

mRNA coding the vesicular glutamate transporter type 2

(vGlut2 mRNA). We found a bilateral projection from the

PPN nucleus to the PF nucleus arising from cholinergic and

glutamatergic efferent neurons, with a small fraction of

projection neurons co-expressing both cholinergic and

glutamatergic markers. Furthermore, the unilateral nigro-

striatal depletion induced a bilateral twofold increase in the

expression levels of vGlut2 mRNA within the PPN

nucleus. Our results support the view that heterogeneous

chemical profiles account for PPN efferent neurons inner-

vating thalamic targets. Moreover, a bilateral enhancement

of glutamatergic transmission arising from the PPN nucleus

occurs following unilateral dopaminergic denervation,

therefore sustaining the well-known hyperactivity of the PF

nucleus in parkinsonian-like conditions. In conclusion, our

data suggest that the ascending projections from the PPN

that reach basal ganglia-related targets could play an

important role in the pathophysiology of Parkinson’s

disease.

Keywords Basal ganglia � PPTg � vGlut � ChAT �Glutamate � Parkinson’s disease

Introduction

The tegmental pedunculopontine nucleus (PPN) is a neu-

rochemically heterogeneous structure located in the rostral

brainstem tegmentum and includes the cholinergic cell

group Ch5 (Mesulam et al. 1983) as well as nitrergic

(Geula et al. 1993; Dun et al. 1995), glutamatergic (Cle-

ments and Grant 1990), GABAergic (Ford et al. 1995) and

peptidergic (Vincent 2000) cell types. Although earlier

studies have reported the presence of neurons expressing

two or even more of these neuroactive substances (Vincent

et al. 1983; Lavoie and Parent 1994; Jia et al. 2003), cur-

rently there is a general consensus that the PPN is made up

of three different intermingled cellular subtypes, choliner-

gic, glutamatergic and GABAergic neurons (Wang and

Morales 2009; Mena-Segovia et al. 2009).

The PPN nucleus is tightly linked to the basal ganglia

system. A number of cholinergic and glutamatergic pro-

jections arising from the PPN reaching basal ganglia nuclei

such as the striatum, the substantia nigra pars reticulata

and compacta (SNr and SNc, respectively), the external

and internal divisions of the globus pallidus (GPe and GPi)

and the subthalamic nucleus (STN) have been described

elsewhere (Groenewegen et al. 1993; Moriizumi and

Hattori 1992; Semba and Fibiger 1992; Lavoie and Parent

1994). Besides the basal ganglia-related nuclei, the thala-

mus also represents a major target for PPN efferents

P. Barroso-Chinea � A. J. Rico � L. Conte-Perales �V. Gomez-Bautista � N. Luquin � S. Sierra � E. Roda �J. L. Lanciego (&)

Neurosciences Division, Center for Applied Medical Research

(CIMA and CIBERNED), University of Navarra,

Pio XII Ave 55, Edificio CIMA, 31008 Pamplona, Spain

e-mail: jlanciego@unav.es

123

Brain Struct Funct (2011) 216:319–330

DOI 10.1007/s00429-011-0317-x

(Sofroniew et al. 1985; Hallanger et al. 1987; Cornwall and

Phillipson 1988; Hallanger and Wainer 1988; Jones 1991;

Steininger et al. 1992; Erro et al. 1999; Oakman et al. 1999;

Kobayashi and Nakamura 2003, Kobayashi et al. 2007).

Most of these projections are bilateral and predominantly

cholinergic (Sofroniew et al. 1985; Semba et al. 1990).

Furthermore, PPN efferents reaching the parafascicular

nucleus (PF) in rats, cats and dogs have been previously

reported (Jackson and Crossman 1983; Mesulam et al.

1983; Saper and Loewy 1982; Sugimoto and Hattori 1984;

Isaacson and Tanaka 1986; Cornwall and Phillipson 1988;

Steininger et al. 1992; Erro et al. 1999; Kobayashi and

Nakamura 2003).

In the past few years, a number of studies have sug-

gested a link between the PPN and several motor dis-

turbances observed in Parkinson’s disease (PD) such as

akinesia, gait dysfunction and postural abnormalities.

Unilateral lesions of the PPN resulted in transient hemi-

akinesia in normal monkeys, whereas a severe, long-

lasting akinetic effect was noticed following bilateral PPN

lesions (Kojima et al. 1997; Aziz et al. 1998; Munro-

Davis et al. 1999). Futhermore, bilateral PPN hyperac-

tivity was reported in rats with unilateral nigrostriatal

damage (Carlson et al. 1999; Breit et al. 2001, 2008)

together with an increased number of cholinergic neurons

(Garcıa-Rill et al. 1995) and augmented release of glu-

tamate (Blanco-Lezcano et al. 2005). These data paved

the way for appointing the PPN nucleus as a potential

surgical candidate for functional neurosurgery (Jenkinson

et al. 2005; Plaha and Gill 2005; Breit et al. 2006). Low-

frequency stimulation (20–25 Hz) of the PPN using deep

brain stimulation (DBS) electrodes has proven to be

useful for the treatment of akinesia in parkinsonian

monkeys (Jenkinson et al. 2004). In humans, a significant

improvement in gait dysfunction and postural instability

has been observed both in the ‘‘on’’ and ‘‘off’’ conditions

(Mazzone et al. 2005; Plaha and Gill 2005; Stefani et al.

2007).

It is well known that efferent neurons from the PPN

and the PF nucleus innervating the subthalamic nucleus

(STN) are highly hyperactive following unilateral dopa-

minergic depletion (Orieux et al. 2000) in rodents. Since

the PPN is also a major source of efferent projections

reaching the PF thalamic nucleus (Erro et al. 1999), we

sought to determine whether the observed PF hyperac-

tivity could be driven by excessive glutamatergic outflow

arising from the PPN.

Materials and methods

A total of 30 male Wistar rats weighing 230–280 g were

used in this study. All animals were handled according to

the European Council Directive 86/609/EEC. The experi-

mental procedures conducted were approved by the Ethical

Committee for Animal Testing from the University of

Navarra (Ref.: 037/2000).

Polymerase chain reaction (PCR)

In order to carry out the PCR procedure, we used fresh

tissue samples (unfixed) from six control animals. Briefly, a

brain block containing the PPN was frozen rapidly in iso-

pentane cooled with liquid nitrogen and coronal sections

(20 lm-thick) were obtained using a cryostat. The sections

were mounted on dedicated plastic-coated slides (Leica)

for laser-guided capture microdissection (LCM). Under the

LCM microscope, the boundaries of the PPN were delin-

eated and dissected from the tissue using the laser beam.

The tissue samples obtained from this nucleus were col-

lected in 0.5 mL Eppendorf vials containing lysis buffer for

RNA extraction. Total RNA was extracted using the

Absolutely RNA Nanoprep kit (Stratagene, La Jolla, CA,

USA) according to the manufacturer’s instructions and

including the optional DNase I digestion step. The RNA

eluted in a final volume of 10 lL was used entirely for

reverse transcription. The cDNA template was obtained by

adding 1 lL 10 mM dNTP mix, 1 lL 0.1 M DTT, 50 ng

hexamers, 1 lL RNase inhibitor (40 U/lL; Promega,

Madison, WI, USA), 4 lL 59 First-Stand Buffer, 2 lL

sterile water and 1 lL SuperScript III reverse transcriptase

(200 U/lL; Invitrogen) in a final volume of 20 lL and

incubated at 50�C for 60 min. Subsequently, the reaction

was inactivated by heating at 70�C for 15 min. PCRs were

carried out in a final volume of 50 lL containing 25 mM of

each primer, 0.5 lL of Taq-DNA polymerase (Bioline),

5 lL 109 Taq DNA polymerase PCR buffer, 1.5 lL

MgCl2, 2 lL dNTP and 10 lL per reaction of pure cDNA

for the amplification of the vGlut2 gene and 3 lL of cDNA

GAPDH. After 94�C for 5 min, the thermocycling

parameters were as follows: 35 cycles of 94�C for 30 s,

58�C for 30 s and 72�C for 1 min. The extension reaction

was carried out for 10 min at 72�C, and reaction products

were stored at 4�C. The primers used in PCR were: forward

CATGAAGATGAACTGGATGAAGAAACG and reverse

AGTACGCGTCTTGCGCACTTT for vGlut2 gene, for-

ward ATGGCCATTGACAACCATCTTCTG and reverse

AACAAGGCTCGCTCCCACAGCTTC for choline ace-

tyltransferase (ChAT) gene, forward CTGACTCCCG

AAAGTCATCG and reverse AGGCCGAACACTGAGAA

CCT for the neuronal isoforms of nitric oxide synthase

(nNOS) gene, forward AAGGTCATCCCAGAGCTGAA

and reverse CTGCTTCACCACCTTCTTGA for GAPDH

gene. The cDNA product sizes obtained were 162 bp for

vGlut2, 293 bp for ChAT, 97 bp for nNOS and 138 bp for

GAPDH (Fig. 1).

320 Brain Struct Funct (2011) 216:319–330

123

Stereotaxic surgery, perfusion and tissue processing

Stereotaxic surgery was performed on 24 animals: 12

controls and 12 animals with complete unilateral nigro-

striatal lesion following the injection of the neurotoxin

6-OHDA (total amount of 8 lg, final concentration of

2 lg/lL) in the medial forebrain bundle (mfb). The coor-

dinates for the 6-OHDA injection were as follows:

-2.6 mm from bregma, 1.65 mm lateral to midline and 7.5

ventral to the pial surface. Control animals received an

injection of saline in the mfb. Four weeks after the ste-

reotaxic surgery, all the animals of each group (control and

lesioned animals), received one microiontophoretic injec-

tion of Fluoro-Gold (FG) within the PF nucleus ipsilateral

to the side injected with either 6-OHDA or vehicle. FG was

delivered as a 2% solution in 0.1 M cacodylate buffer pH

7.3, using a glass micropipette (inner tip diameter

25–40 lm) and a positive-pulse direct current (5 lA, 7 s

on/off). In order to deposit only small amounts of FG, the

tracer was injected for 5 min after which the micropipette

was left in place for 10 min before withdrawal. During

removal of the micropipette, the current was reversed to

minimize tracer uptake along the injection tract. An illus-

trative example of the injection site is shown in Fig. 2.

One week post-FG delivery (5 weeks after stereotaxic

surgery), 14 animals (7 controls and 7 lesioned cases) were

killed with an overdose of 10% chloral hydrate in distilled

water and then transcardially perfused with saline Ringer’s

solution followed by 500 mL of a cold fixative containing

4% paraformaldehyde and 0.1% glutaraldehyde in 0.125 M

phosphate buffer (PB), pH 7.4. After perfusion, the brains

were removed and stored in a cryoprotective solution

containing 20% glycerin and 2% dimethylsulphoxide in

0.125 M PB, pH 7.4 (Rosene et al. 1986). All the solutions

used for fixation and cryoprotection were treated with 0.1%

diethylpyrocarbonate (DEPC) and autoclaved prior to their

use. Frozen coronal sections (30 lm-thick) of the entire

rostrocaudal extent of the PPN were obtained with a sliding

microtome and collected in 0.125 M PB (pH 7.4) as series

of ten adjacent sections. These sections were used for: (1)

immunoperoxidase detection of tyrosine hydroxylase (to

further assess the extent of the dopaminergic lesion, since

only animals showing complete unilateral nigrostriatal

damage were considered within this study); (2) single in

situ hybridization (ISH) with an antisense probe for vGlut2;

(3) single ISH with a vGlut2 sense probe; (4) colorimetric

immunoperoxidase detection of transported FG; and (5)

fluorescent ISH for vGlut2 mRNA combined with dual

immunofluorescent detection of FG and ChAT (see below).

The remaining five series of sections were stored at -80�C

for further histological processing.

Synthesis of sense and antisense riboprobes for rat

vGlut2

Sense and antisense riboprobes for rat vGlut2 were tran-

scribed as described previously (Stornetta et al. 2002) from

the vGlut2 plasmid generously provided by R.L. Stornetta

and P. Guyenet (Department of Pharmacology, University

of Virginia, Charlottesville, VA, USA). The plasmid was

linearized and the sense or antisense probes were tran-

scribed with the appropriate RNA polymerases (Boehringer

Mannheim, Germany). The transcription mixture included

1 lg template plasmid, 1 mM each of ATP, CTP and GTP,

0.7 mM UTP and 0.3 mM DIG-UTP or biotin-UTP,

10 mM DTT, 50 U RNase inhibitor and 1 U of either T7 or

SP6 RNA polymerase in a volume of 50 lL. After 2 h at

37�C, the template plasmid was digested with 2 U RNase-

free DNAse for 30 min at 37�C. The sense and antisense

riboprobes were then precipitated by the addition of

100 lL of 4 M ammonium acetate and 500 lL of ethanol,

and they were recovered by centrifugation at 4�C for

Fig. 1 Detection of the

transcripts of interest at the level

of PPN nucleus in control

animals using PCR. Taking

advantage of tissue samples

obtained from the PPN using

LCM, the presence of PCR

products for glutamatergic

(vGlut2), cholinergic (ChAT)

and nitrergic (nNOS) markers is

detected. GAPDH is the control

gene

Brain Struct Funct (2011) 216:319–330 321

123

30 min. The quality of the synthesis was monitored by dot

blot.

Histology (I): immunoperoxidase detection

of transported Fluoro-Gold

One series of sections were used for counting the number of

FG-labeled neurons in the PPN. Sections were first incu-

bated with a 1:2,000 rabbit anti-FG antibody (Chemicon,

Temecula, CA, USA) for 60 h at 4�C, followed by a 1:50

swine anti-rabbit IgG (Dako, Copenhagen, Denmark) for 2 h

at room temperature and finally incubated in a PAP com-

plex raised in rabbit (1:600 rabbit-PAP; Dako; 90 min

at room temperature) and finally reacted with a regular

solution of diaminobenzidine (Merck, Darmstadt, Germany).

Sections were then mounted on gelatine-coated slides and

counterstained with thionin. Every tenth section was used for

counting purposes. Sections were inspected at a final mag-

nification of 2009, and 6–7 different rostrocaudal levels of

the PPN were analyzed per animal. Illustrative examples of

FG-labeled neurons are shown in Fig. 2.

Histology (II): fluorescent in situ hybridization

for vGlut2 mRNA combined with dual

immunofluorescent detection of FG and ChAT

These histological experiments were carried out in 14

animals (7 control and 7 lesioned cases). The sections were

incubated twice in 0.1% active DEPC in PB for 15 min.

The sections were then prehybridized at 58�C for 2 h in a

Fig. 2 Retrograde tracing with

Fluoro-Gold (FG) to identify

PPN neurons innervating the

parafascicular nucleus (PF).

Following the iontophoretical

delivery of FG in the PF nucleus

(a), a large amount of

retrogradely labeled neurons is

observed in the PPN (b).

Labeled neurons are found in

both the contralateral and the

ipsilateral PPNs (c, d), the latter

showing a higher number of

projection neurons. Scale bar is

1,000 lm in a and b, and

120 lm in c and d

322 Brain Struct Funct (2011) 216:319–330

123

hybridization solution containing 50% deionized formam-

ide, 59 SSC and 40 lg/lL of denatured salmon DNA in

H2O-DEPC. First, the sections were processed to detect

biotin-labeled vGlut2 riboprobe. The fluorescent visuali-

zation of the biotin-labeled probe was performed by incu-

bating the sections with peroxidase-conjugated streptavidin

(1:100, NEN) in TNB buffer for 30 min at room temper-

ature. After several washes with TNT buffer, the sections

were incubated for 10 min in biotinyl tyramide (1:50 in

amplification diluent; NEN) and the fluorescent labeling

was visualized using Alexa 633-conjugated streptavidin

(Molecular Probes). Sections were then processed for the

immunofluorescent detection of FG and ChAT. Sections

were incubated in a cocktail of primary antisera comprising

1:2,000 rabbit anti-FG antibody (Chemicon, Temecula,

CA, USA) and 1:100 goat anti-ChAT antibody (Chemicon)

for 60 h at 4�C. Sections were then transferred to a cocktail

of secondary antisera containing 1:200 Alexa 488-conjugated

donkey anti-rabbit IgG (Molecular Probes) and 1:200

Alexa 546-conjugated donkey anti-goat IgG (Molecular

Probes) for 2 h at room temperature. The sections were

finally mounted on glass slides, air-dried at room temper-

ature in the dark, rapidly dehydrated in toluene and cov-

erslipped with DPX (BDH chemicals). Sections were

analyzed under a Zeiss 510 Meta confocal laser-scanning

microscope. In order to ensure the appropriate visualization

of the labeled elements and to avoid false positive results,

the emission from the argon laser at 488 nm was filtered

through a band-pass of 505–530 nm and color-coded in

green (FG-labeled neurons). The emission following exci-

tation with the helium laser at 543 nm was filtered through

a band-pass filter of 560–615 nm and color-coded in light

blue (ChAT-expressing neurons). Finally, a long-pass filter

of 650 nm was used to visualize the emission from the

helium laser at 633 nm, this emission being color-coded in

red (neurons positive for vGlut2 mRNA).

Measuring mRNA levels by quantitative PCR

A group of control animals (n = 5) and a group of animals

subjected to a unilateral lesion with 6-OHDA (n = 5) were

used to measure mRNA levels using quantitative PCR

(qPCR). All these animals received a Fluoro-Gold injection

into the left PF nucleus as described above. Animals were

killed by decapitation (1 week post-FG delivery; 5 weeks

after the injection of 6-OHDA), their brains rapidly

removed and dissected on ice using a brain blocker. Three

coronal brain blocks were prepared that comprised of the

striatum (between -0.1 and 1 mm rostral to bregma), the

PPN (between 7.2 and 8.6 mm caudal to the bregma) and

the substantia nigra (between 4.8 and 6.1 mm caudal to

bregma). The coordinates for the brain blocks were taken

from the stereotaxic atlas of Paxinos and Watson (2007). In

order to properly assess the extent of the dopaminergic

lesion induced by the 6-OHDA injection in the mfb, brain

blocks containing the striatum and the substantia nigra

were fixed by immersion in 4% paraformaldehyde in PB

0.1 M, pH 7.4 for 24 h and then cryoprotected with 20%

glycerin and 2% DMSO in PB 0.1 M, pH 7.4 (48 h).

Coronal sections (30-lm thick) were then obtained with a

sliding microtome and further processed for tyrosine

hydroxylase immunocytochemistry. The brain block con-

taining the PPN was rapidly frozen on isopentane cooled

with liquid nitrogen and coronal cryostat sections (20-lm

thick) through the PPN were obtained. The sections were

mounted on dedicated plastic-coated slides (Leica) for

LCM. Under direct UV epifluorescent illumination, the

PPN territories containing the highest densities of FG-

labeled neurons were delineated and then dissected out

from the tissue using the laser beam. It is worth noting that

our technical setup for LCM does not allow us to perform

this analysis at the single-cell level and therefore other

glutamatergic neurons that do not project to the PF nucleus

may also be present within the microdissected tissue

samples. In an attempt to pool an equivalent number of

neurons, special care was taken in dissecting at least 80

FG-labeled neurons per animal (control and lesioned ani-

mals) as well as per side of the brain (ipsilateral and con-

tralateral to the FG-injected PF nucleus). As described

above, tissue samples obtained from the PPN nucleus were

collected in 0.5 mL Eppendorf vials containing lysis buffer

for RNA extraction and extracted using the Absolutely

RNA� nanoprep kit (Stratagene, La Jolla, CA, USA).

The qPCR reactions were carried out in a final volume

of 24 lL containing 150 nM of each primer (Table 1

illustrates the primers used in qPCR), 12 lL of 29 SYBR

Green PCR Master Mix (Applied Biosystems, Foster City,

CA, USA) and 1 lL per reaction of pure cDNA for the

amplification of the reference gene GAPDH, 1 lL of

cDNA for 18S rRNA (diluted 1:200 in sterile water) and

2 lL per reaction for the amplification of vGlut2. All qPCR

reactions were performed in triplicates using a 7300 real-

time PCR System cycler (Applied Biosystems) for real-

time detection of amplified dsDNA with SYBR Green. The

thermal cycler parameters were as follows: incubation at

95�C for 10 min, 40 cycles at 95�C for 15 s and 60�C for

1 min, followed by a melting curve from 65 to 95�C to

ensure unique product amplification.

The statistical analysis of the data gathered by qPCR

was performed according to the comparative Ct method

(see user’s guide from Applied Biosystems). The data were

analyzed by applying either a student’s t-test or the Mann

Whitney U test depending on whether the data were

parametric or non-parametric. The statistical analysis was

carried out with SPSS version 15.0 software, significance

was accepted at p \ 0.05 and the standard deviation was

Brain Struct Funct (2011) 216:319–330 323

123

represented by error bars. The relative expression of vGlut2

mRNA was normalized to the expression of the 18S rRNA

and GAPDH control genes.

Results

Laser-guided microdissection (LCM) and PCR

PCR amplification, using tissue samples taken from the

PPN by LCM, was used to confirm the presence of tran-

scripts of interest. Amplification of cDNA products related

to ChAT, vGlut2 as well as nNOS confirmed the presence

of these transcripts. The transcript nNOS showed the

weakest expression (Fig. 1).

Chemical phenotypes of PPN efferent neurons

innervating the PF nucleus

Following unilateral deposits of the neuroanatomical tracer

Fluoro-Gold (FG) into the dorsolateral region of the para-

fascicular nucleus (PF), retrogradely labeled neurons were

observed throughout the entire rostrocaudal extent of the

PPN. Similar numbers of FG-containing neurons were

observed in control and lesioned animals. In control ani-

mals (n = 7), neurons showing FG labeling were observed

both in the ipsilateral (372 ± 92 neurons on average) and

in the contralateral PPN (301 ± 98) (Fig. 2). This ipsilat-

eral preponderance was also observed in lesioned animals

(310 ± 27 ipsilateral neurons compared with 249 ± 55

contralateral neurons, n = 7).

The chemical phenotypes of PPN projection neurons

were ascertained unequivocally under the confocal laser-

scanning microscope (CLSM) by combining the fluores-

cent ISH for vGlut2 mRNA (to identify glutamatergic

neurons) together with the dual immunofluorescent detec-

tion of FG and ChAT (cholinergic neurons). Results

obtained are illustrated in Figs. 3 and 4. Briefly, up to four

different chemical subtypes of PPN projection neurons

were identified: (1) cholinergic neurons, (2) glutamatergic

neurons, (3) a small fraction of neurons co-expressing

glutamatergic and cholinergic markers and (4) neurons

with an unknown phenotype. All types of projection neu-

rons were intermingled with each other without any spatial

preference within the PPN boundaries. Cholinergic neurons

innervating the PF nucleus were by far the most abundant

phenotype comprising about half of the total number of

FG-labeled neurons. Glutamatergic neurons were found to

account for one-third of PPN efferent neurons targeting the

PF nucleus. The chemical identity could not be ascertained

in approximately 10% of the projection neurons showing

FG labeling. Finally, in keeping with existing data (Wang

and Morales 2009), only \5% of projection neurons

showed co-expression of vGlut2 mRNA and ChAT. It is

worth noting that the observed distribution of chemical

subtypes of PPN efferent neurons was the same in both

control and lesioned animals. Minimal differences were

observed when comparing the PPN located either ipsilat-

erally or contralaterally to the injected PF nucleus. A

summary of the observed chemical subtypes in all experi-

mental groups is provided in Table 2.

Enhanced expression of vGlut2 mRNA following

dopaminergic depletion

Quantitative PCR was used to quantify the changes in the

patterns of gene expression for the glutamatergic marker

vGlut2 resulting from unilateral nigrostriatal damage.

Tissue samples taken from the ipsilateral and contralateral

PPN were microdissected using LCM and processed fur-

ther using qPCR. First, the relative expression of vGlut2

mRNA was normalized against the expression of two

control genes (18S rRNA and GAPDH) in control animals.

The same procedure was conducted for measuring the

relative expression of vGlut2 mRNA in lesioned animals.

The results showed that the unilateral dopaminergic

depletion resulted in a significant twofold increase of

vGlut2 mRNA expression. It is worth noting that aug-

mented levels of vGlut2 gene expression were found in

both the ipsilateral and contralateral PPN (Fig. 5). More-

over, statistical significance was always reached irrespec-

tive of the control genes used.

Discussion

The present study provides anatomical evidence showing

that the PPN efferent neurons innervating the thalamic PF

Table 1 Primers used

in qPCRGenes Reference

gene

Forward (50–30) Reverse (50–30) cDNA

product

(bp)

vGlut2 AF271235 AAGAAACGGGGGACATCACT GTCTTGCGCACTTTCTTGC 137

18S rRNA V01270 CATGGCCGTTCTTAGTTGGT CGCTGAGCCAGTTCAGTGTA 219

GAPDH XM_579386 AAGGTCATCCCAGAGCTGAA CTGCTTCACCACCTTCTTGA 138

324 Brain Struct Funct (2011) 216:319–330

123

nucleus are characterized by a heterogeneous chemical

identity. This bilateral projection arises mainly from two

different populations of projection neurons, comprising of

cholinergic and glutamatergic phenotypes. Only a small

fraction of projection neurons (5% on average) was found

to co-express both cholinergic and glutamatergic markers.

Accordingly, it is likely that the overall interactions

between acetylcholine and glutamate at the postsynaptic

site are due to neurotransmitter release from different pools

of PPN terminals reaching the same thalamic targets. More

importantly, a bilateral upregulation of vGlut2 mRNA

following unilateral nigrostriatal denervation was demon-

strated here, therefore suggesting enhanced glutamatergic

outflow reaching the PF nucleus arising from the PPN.

Fig. 3 Chemical identities of PPN efferent neurons innervating the

PF nucleus in control animals. The PPN neurons projecting to the PF

nucleus display different neurochemical phenotypes, both in the PPN

ipsilateral to the PF-injected side (a–h) and in the contralateral PPN

(i–p). Projection neurons showing a cholinergic phenotype are

marked with arrows, whereas PPN efferent neurons expressing

vGlut2 transcripts only are labeled with arrowheads. Projection

neurons expressing both cholinergic and glutamatergic markers are

identified with double arrowheads. Scale bar is 40 lm in a–d and i–l and 20 lm in e–h and m–p

Brain Struct Funct (2011) 216:319–330 325

123

Different chemical phenotypes of PPN projection

neurons

The PPN plays multiple roles, ranging from motor to

cognitive functions. Such a functional diversity is reflec-

ted by a wide neuronal heterogeneity inherent in PPN

neurons, including neurochemical and electrophysiological

differences, as well as differences in their patterns of

afferent and efferent connections (for a review, see

Martınez-Gonzalez et al. 2011). Up to three main neuronal

subtypes have been identified in the PPN: cholinergic,

glutamatergic and GABAergic neurons. Although all these

neuronal types are intermingled with each other, a number

of variations in the cellular composition of the PPN have

Fig. 4 Chemical identities of PPN efferent neurons innervating the

PF nucleus in lesioned animals. The PPN neurons projecting to the PF

nucleus display different neurochemical phenotypes, both in the PPN

ipsilateral to the PF-injected side (a–h) and in the contralateral PPN

(i–p). Projection neurons showing a cholinergic phenotype are

marked with arrows, whereas PPN efferent neurons expressing

vGlut2 transcripts only are labeled with arrowheads. Projection

neurons expressing both cholinergic and glutamatergic markers are

identified with double arrowheads. Scale bar is 40 lm in a–d and i–l,15 lm in e–h and 10 lm in m–p

326 Brain Struct Funct (2011) 216:319–330

123

been reported, with a preferential localization of

GABAergic neurons in rostral PPN territories, whereas

caudal levels of the PPN are more enriched with gluta-

matergic neurons (Mena-Segovia et al. 2009; Wang and

Morales 2009). Our results largely confirm these earlier

reports by showing that two main distinct subtypes of PPN

neurons (cholinergic and glutamatergic) innervate the

thalamic PF nucleus, with a minimal amount of projection

neurons simultaneously co-expressing cholinergic and

glutamatergic markers.

In the rat, the PPN projection to the PF nucleus is

composed mainly of cholinergic neurons (Parent and

Descarries 2008). These projections in turn target PF

efferent neurons that give rise to the thalamostriatal pro-

jections (Erro et al. 1999). Thalamic intralaminar nuclei,

other than the PF nucleus, are also known to be innervated

by cholinergic and non-cholinergic PPN afferents (Steriade

et al. 1990; Erro et al. 1999; Krout et al. 2002). Data

reported here showed that cholinergic neurons innervating

the PF nucleus are by far the most abundant phenotype

(half of the projection neurons were identified as cholin-

ergic), followed by glutamatergic neurons representing

about a third of PPN efferent neurons reaching PF targets.

It is also worth noting that differences were not found in

the proportion of identified PPN efferent neurons when

considering neurons located ipsilaterally or contralaterally

to the PF-injected nucleus. Further, no differences were

found between control and lesioned animals.

Upregulation of vGlut2 mRNA following experimental

parkinsonism. Implications in the pathophysiology

of Parkinson’s disease

After a unilateral nigrostriatal lesion with 6-OHDA, PPN

and PF neurons that innervate the STN become hyperactive

(Orieux et al. 2000). This supports the view that these

nuclei could sustain, at least partially, the increased neu-

ronal activity that characterizes the STN in parkinsonian-

Table 2 Chemical profiles of identified PPN neurons projecting to the PF nucleus

Neurochemical phenotypes of PPN neurons

projecting to PF (labeled with Fluoro-Gold)

Control animals Lesioned animals

Ipsilateral PPN Contralateral PPN Ipsilateral PPN Contralateral PPN

Cholinergic (ChAT?) 51% (1,328 neurons) 46% (971 neurons) 53% (1,153 neurons) 48% (836 neurons)

Glutamatergic (vGlut2?) 34% (885 neurons) 40% (844 neurons) 35% (761 neurons) 39% (679 neurons)

ChAT? and vGlut2? 4% (92 neurons) 5% (105 neurons) 5% (107 neurons) 6% (104 neurons)

Unknown 11% (286 neurons) 9% (190 neurons) 7% (152 neurons) 7% (122 neurons)

Fig. 5 Changes in the pattern of vGlut2 mRNA expression following

unilateral nigrostriatal lesion. Unilateral dopaminergic denervation

resulted in a marked up-regulation of vGlut2 mRNA expression. The

increase in expression of vGlut2 mRNA is apparent both in the

ipsilateral and contralateral PPN. These increases in expression levels

are statistically significant irrespective of the control genes used (18S

rRNA or GAPDH). (*) represents p \ 0.05, and (**) represents

p \ 0.01

Brain Struct Funct (2011) 216:319–330 327

123

like conditions. In this regard, the chemical ablation of the

PF nucleus in rodents efficiently reverted the characteristic

increases of metabolic activity in the STN (Bacci et al.

2004). Moreover, the caudal intralaminar nuclei in humans

have been considered as a surgical candidate for DBS,

particularly when dealing with levodopa-induced dyskine-

sia (Caparros-Lefebvre et al. 1994, 1999; Krauss et al.

2002). However, the unilateral lesion of the caudal intra-

laminar nuclei in MPTP-treated primates failed to induce a

long-lasting motor improvement and had no effect on

levodopa-induced dyskinesia (Lanciego et al. 2008). This

led us to conclude that the caudal intralaminar nuclei can

no longer be considered as a feasible surgical candidate.

By contrast, the PPN nucleus has recently emerged as a

potential target for the management of several symptoms

associated with movement disorders of basal ganglia origin

(Jenkinson et al. 2005; Plaha and Gill 2005). Significant

improvements in gait disturbances and postural instability

have been obtained following low-frequency stimulation of

the PPN in patients suffering from PD, both in the ‘‘on’’

and ‘‘off’’ medication states (Mazzone et al. 2005; Plaha

and Gill 2005; Stefani et al. 2007). These clinical benefits

are in keeping with a number of earlier studies that have

suggested a close link between the PPN and PD symptoms

such as gait dysfunction and postural abnormalities (Koj-

ima et al. 1997; Aziz et al. 1998; Munro-Davis et al. 1999;

Pahapill and Lozano 2000; Nandi et al. 2002a, b). Evidence

concerning the effect of PPN surgery on akinesia is less

conclusive. For instance, whereas unilateral or bilateral

PPN lesions in control monkeys caused either transient

hemi-akinesia or a long-lasting akinetic effect, respectively

(Kojima et al. 1997; Aziz et al. 1998; Munro-Davis et al.

1999), DBS of the PPN in MPTP-treated monkeys

improved akinesia (Jenkinson et al. 2004). Nevertheless, it

is worth noting that a number of studies have clearly

demonstrated the presence of bilateral hyperactivity of the

PPN following unilateral nigrostriatal damage in rodents

(Carlson et al. 1999; Breit et al. 2001, 2008), ultimately

leading to enhanced glutamate release arising from the

PPN (Blanco-Lezcano et al. 2005).

Data reported here showed bilateral enhanced expres-

sion of vGlut2 mRNA in PPN nucleus following unilateral

dopaminergic removal. It is tempting to speculate that

enhanced vGlut2 mRNA expression could be directly

related to excessive glutamate outflow reaching the tha-

lamic PF nucleus. This would suggest that the PF hyper-

activity is a secondary phenomenon triggered by increased

glutamatergic transmission arising from the PPN. This

argument is in keeping with available electrophysiolgical

data (Capozzo et al. 2003). At present, it is well established

that PF neurons innervating the STN (Orieux et al. 2000)

and the striatum (Aymerich et al. 2006) are hyperactive.

The same holds true for PPN neurons innervating the STN

(Orieux et al. 2000). In order to better understand the role

that these subcortical glutamatergic loops play in the

pathophysiology of PD, the temporal cascade of events

triggering these increased activities should be elucidated in

detail (Gonzalo et al. 2002). In the parkinsonian state, the

current basal ganglia model predicts that STN hyperactiv-

ity is due to a decrease in inhibition arising from the GPe

(Crossman 1987; Albin et al. 1989; DeLong 1990). How-

ever, a number of experimental findings have challenged

this reasoning by, for example, showing that subthalamic

hyperactivity is a very early phenomenon, appearing well

before any striatal change induced by nigrostriatal damage

has occurred (Vila et al. 2000). Since the STN projects to

the PPN (Semba and Fibiger 1992; reviewed in Martınez-

Gonzalez et al. 2011), it is conceivable that PPN hyper-

activity might be a secondary event to an increase in STN

activity, enhancing PF activity triggered by PPN hyperac-

tivity. In summary, the presence of hyperactive brain

pathways connecting all three nuclei (STN, PF and PPN)

allows enhanced glutamatergic transmission to be self-

perpetuated within basal ganglia circuits following dopa-

minergic depletion.

Acknowledgments This study was supported by Departamento de

Salud Gobierno de Navarra, Ministerio de Ciencia e Innovacion

(BFU2009-08351), CIBERNED (CB06/05/0006), FIS (PI051037) and

by the UTE project/Foundation for Applied Medical Research

(FIMA). Salary for S.S. is partially supported by a grant from Mutual

Medica.

References

Albin RL, Young AB, Penney JB (1989) The functional anatomy of

basal ganglia disorders. Trends Neurosci 12:366–375

Aymerich MS, Barroso-Chinea P, Perez-Manso M, Munoz-Patino

AM, Moreno-Igoa M, Gonzalez-Hernandez T, Lanciego JL

(2006) Consequences of unilateral nigrostriatal denervation on

the thalamostriatal pathway in rats. Eur J Neurosci 23:2009–2108

Aziz TZ, Davies L, Stein J, France S (1998) The role of descending

basal ganglia connections to the brain stem in parkinsonian

akinesia. Br J Neurosurg 12:245–249

Bacci JJ, Kachidian P, Kerkerian-Le Goff L, Salin P (2004)

Intralaminar thalamic nuclei lesions: widespread impact on

dopamine denervation-mediated cellular defects in the rat basal

ganglia. J Neuropathol Exp Neurol 63:20–31

Blanco-Lezcano L, Rocha-Arrieta LL, Alvarez-Gonzalez L, Martı-

nez-Martı L, Pavon-Fuentes N, Gonzalez-Fraguela ME, Bauza-

Calderın Y, Coro-Grave de Peralta Y (2005) The effects of

lesions in the compact parto f the substantia nigra on glutamate

and GABA release in the pedunculopontine nucleus. Rev Neurol

40:23–29

Breit S, Bouali-Benazzouz R, Benabid AL, Benazzouz A (2001)

Unilateral lesion of the nigrostriatal pathway induces an increase

on neuronal activity of the pedunculopontine nucleus, which is

reversed by the lesion of the subthalamic nucleus in the rat. Eur J

Neurosci 14:1833–1842

Breit S, Lessmann L, Unterbrink D, Popa RC, Gasser T, Schulz JB

(2006) Lesion of the pedunculopontine nucleus reverses

328 Brain Struct Funct (2011) 216:319–330

123

hyperactivity of the subthalamic nucleus and substantia nigra

pars reticulata in a 6-hydroxydopamine rat model. Eur J

Neurosci 24:2275–2282

Breit S, Martin A, Lessmann L, Cerkez D, Gasser T, Schulz JB (2008)

Bilateral changes in neuronal activity of the basal ganglia in the

unilateral 6-hydroxydopamine rat model. J Neurosci Res

86:1388–1396

Caparros-Lefebvre D, Ruchoux MM, Blond D, Petit H, Percheron G

(1994) Long-term thalamic stimulation in Parkinson’s disease:

postmortem anatomoclinical study. Neurology 44:1856–1860

Caparros-Lefebvre D, Blond S, Feltin MP, Pollak P, Benabid AL

(1999) Improvement of levodopa induced dyskinesias by

thalamic deep brain stimulation is related to slight variations in

electrode placement: possible involvement of the centre median

parafascicularis complex. J Neurol Neurosurg Pshychiatr

67:308–314

Capozzo A, Florio T, Cellini R, Moriconi U, Scarnati E (2003) The

pedunculopontine nucleus projectin to the parafascicular nucleus

of the thalamus: an electrophysiological investigation in the rat.

J Neural Transm 110:733–747

Carlson JD, Pearlstein RD, Bucholz J, Iacono RP, Maoda G (1999)

Regional metabolic changes in the pedunculopontine nucleus of

unilateral 6-hydroxydopamine Parkinson’s model rats. Brain Res

828:12–19

Clements JR, Grant S (1990) Glutamate-like immunoreactivity in

neurons of the laterodorsal tegmental and pedunculopontine

nuclei in the rat. Neurosci Lett 120:70–73

Cornwall J, Phillipson OT (1988) Afferent projections to the

parafascicular thalamic nucleus of the rat, as shown by the

retrograde transport of wheat germ agglutinin. Brain Res Bull

20:139–150

Crossman AR (1987) Primate models of dyskinesia: the experimental

approach in the study of basal ganglia-related involuntary

movement disorders. Neuroscience 21:1–40

DeLong MR (1990) Primate models of movement disorders of basal

ganglia origin. Trends Neurosci 13:266–271

Dun NJ, Dun SL, Hwang LL, Fostermann U (1995) Infrequent co-

existence of nitric oxide synthase and parvalbumin, calbindin

and calretinin immunoreactivity in rat pontine neurons. Neurosci

Lett 191:165–168

Erro E, Lanciego JL, Gimenez-Amaya JM (1999) Relationships

between thalamostriatal neurons and pedunculopontine projec-

tions to the thalamus: a neuroanatomical tract-tracing study in

the rat. Exp Brain Res 127:162–170

Ford B, Holmes CJ, Mainville L, Jones BE (1995) GABAergic

neurons in the rat pontomesencephalic tegmentum: codistribu-

tion with cholinergic and other tegmental neurons projecting to

the posterior lateral hypothalamus. J Comp Neurol 363:177–196

Garcıa-Rill E, Biedermann JA, Chambers T, Skinner RD, Mrak RE,

Husain M, Karson CN (1995) Mesopontine neurons in schizo-

phrenia. Neuroscience 66:321–335

Geula C, Schatz CR, Mesulam MM (1993) Differential localization of

NADPH-diaphorase and calbindin-D28 k within the cholinergic

neurons in the basal forebrain, striatum and brainstem in the rat,

monkey, baboon and human. Neuroscience 54:461–476

Gonzalo N, Lanciego JL, Castle M, Vazquez A, Erro E, Obeso JA

(2002) The parafascicular thalamic complex and basal ganglia

circuitry: further complexity to the basal ganglia model.

Thalamus Relat Sys 1:341–348

Groenewegen HJ, Berendse HW, Haber SN (1993) Organization of

the output of the ventral striatopallidal system in the rat: ventral

pallidal efferents. Neuroscience 57:113–142

Hallanger AE, Wainer BH (1988) Ascending projections from the

pedunculopontine tegmental nucleus and the adjacent mesopon-

tine tegmentum in the rat. J Comp Neurol 274:483–515

Hallanger AE, Levey AI, Lee HJ, Rye DB, Wainer BH (1987) The

origins of cholinergic and other subcortical afferents to the

thalamus in the rat. J Comp Neurol 262:105–124

Isaacson LG, Tanaka D Jr (1986) Cholinergic and non-cholinergic

projections from the canine pontomesencephalic tegmentum (Ch5

area) to the caudal intralaminar nuclei. Exp Brain Res 62:179–188

Jackson A, Crossman AR (1983) Nucleus tegmenti pedunculopon-

tininus: efferent connections with special referente to the basal

ganglia, studied in the rat by anterograde and retrograde

transporto f horseradish peroxidase. Neuroscience 10:725–765

Jenkinson N, Nandi D, Miall RC, Stein JF, Aziz TZ (2004)

Pedunculopontine nucleus stimulation improves akinesia in a

parkinsonian monkey. NeuroReport 15:2621–2624

Jenkinson N, Nandi D, Aziz TZ, Stein JF (2005) Pedunculopontine

nucleus: a new target for deep brain stimulation for akinesia.

NeuroReport 16:1875–1876

Jia HG, Yamuy J, Sampogna S, Morales FR, Chase MH (2003)

Colocalization of gamma-aminobutyric acid and acetylcholine in

neurons in the laterodorsal and pedunculopontine tegmental

nuclei in the cat: a Light and electron microscopic study. Brain

Res 992:205–219

Jones EG (1991) Paradoxical sleep and its chemical/structural

substrates in the brain. Neuroscience 40:637–656

Kobayashi S, Nakamura Y (2003) Synaptic organization of the rat

parafascicular nucleus, with special reference to its afferents

from the superior colliculus and the pedunculopontine tegmental

nucleus. Brain Res 980:80–91

Kobayashi S, Hoshino K, Homma S, Takagi S, Norita M (2007) A

possible monosynaptic pathways links the pedunculopontine

nucleus to thalamostriatal neurons in the hooded rat. Arch Histol

Cytol 70:207–214

Kojima J, Yamaji Y, Matsumara M, Nambu A, Inase M, Tokuno H,

Takada M, Imai H (1997) Excitotoxic lesions of the peduncu-

lopontine tegmental nucleus produce contralatral hemiparkins-

onism in the monkey. Neurosci Lett 226:111–114

Krauss JK, Pohle T, Weigel R, Burgunder JM (2002) Deep brain

stimulation of the centre median-parafascicular complex in

patients with movement disorders. J Neurol Neurosurg Psychiatr

72:546–548

Krout KE, Belzer RE, Loewy AD (2002) Brainstem projections to

midline and intralaminar thalamic nuclei of the rat. J Comp

Neurol 448:53–101

Lanciego JL, Rodrıguez-Oroz MC, Blesa FJ, Alvarez-Erviti L, Guridi

J, Barroso-Chinea P, Smith Y, Obeso JA (2008) Lesion of the

centromedian thalamic nucleus in MPTP-treated primates. Mov

Disord 23:708–715

Lavoie B, Parent A (1994) Pedunculopontine nucleus in the squirrel

monkey: projections to the basal ganglia as revealed by

anterograde tract-tracing methods. J Comp Neurol 344:210–231

Martınez-Gonzalez C, Bolam JP, Mena-Segovia J (2011) Topograph-

ical organization of the pedunculopontine nucleus. Frontiers

Neuroanat. doi:10.3389/fnana.2011.00022

Mazzone P, Lozano A, Stnzione P, Galati S, Scarnati E, Peppe A,

Stefani A (2005) Implantation of human pedunculopontine

nucleus: a safe and clinically relevant target in Parkinson’s

disease. NeuroReport 16:1877–1881

Mena-Segovia J, Micklem BR, Nair-Roberts RG, Ungless MA,

Bolam JP (2009) GABAergic neuron distribution in the pedun-

culopontine nucleus defines functional subterritories. J Comp

Neurol 515:397–408

Mesulam MM, Mufson EJ, Wainer BH, Levey AI (1983) Central

cholinergic pathways in the rat: an overview based on alternative

nomenclature (Ch1–Ch6). Neuroscience 10:1185–1201

Moriizumi T, Hattori T (1992) Separate neuronal populations of the

rat globus pallidus projecting to the subthalamic nucleus,

Brain Struct Funct (2011) 216:319–330 329

123

auditory cortex and pedunculopontine tegmental area. Neurosci-

ence 46:701–710

Munro-Davis LE, Winter J, Aziz TZ, Stein JF (1999) The role of the

pedunculopontine region in basal-ganglia mechanisms of akine-

sia. Exp Brain Res 129:511–517

Nandi D, Aziz TZ, Giladi N, Winter J, Stein JF (2002a) Reversal of

akinesia in experimental parkinsonism by GABA antagonist

microinjections in the pedunculopontine nucleus. Brain

125:2418–2430

Nandi D, Liu X, Winter JL, Aziz TZ, Stein JF (2002b) Deep brain

stimulation of the pedunculopontine region in the normal non-

human primate. J Clin Neurosci 9:170–174

Oakman SA, Faris PL, Cozzari C, Hartman BK (1999) Characteriza-

tion of the extent of pontomesencephalic cholinergic neurons’

projections to the thalamus: comparison with projections to

midbrain dopaminergic groups. Neuroscience 94:529–547

Orieux G, Francois C, Feger J, Yelnik J, Vila M, Ruberg G, Agid Y,

Hirsch EC (2000) Metabolic activity of excitatory parafascicular

and pedunculopontine inputs to the subthalamic nucleus in a rat

model of Parkinson’s disease. Neuroscience 97:79–88

Pahapill PA, Lozano AM (2000) The pedunculopontine nucleus and

Parkinson’s disease. Brain 123:1767–1783

Parent M, Descarries L (2008) Acetylcholine innervation of the adult

rat thalamus: distribution and ultrastructural features in dorso-

lateral geniculate, parafascicular and reticular thalamic nuclei.

J Comp Neurol 511:678–691

Paxinos G, Watson C (2007) The rat brain in stereotaxic coordinates.

Academic Press, San Diego

Plaha P, Gill SS (2005) Bilateral deep brain stimulation of the

pedunculopontine nucleus for Parkinson’s disease. NeuroReport

16:1883–1887

Rosene DL, Roy NJ, Davis BJ (1986) A cryoprotection method that

facilitates cutting frozen sections of whole monkeys brain for

histological and histochemical processing without freezing

artifact. J Histochem Cytochem 34:1301–1316

Saper CB, Loewy AD (1982) Projections of the pedunculopontine

tegmental nucleus in the rat: evidence for additional extrapyra-

midal circuitry. Brain Res 252:367–372

Semba K, Fibiger HC (1992) Afferent connections of the laterodorsal

and the pedunculopontine tegmental nuclei in the rat: a retro- and

antero-grade transport and immunohistochemical study. J Comp

Neurol 323:387–410

Semba K, Reiner PB, Fibiger HC (1990) Single cholinergic meso-

pontine tegmental neurons project to both the pontine reticular

formation and the thalamus in the rat. Neuroscience 38:643–654

Sofroniew MV, Priestley JV, Consolazione A, Eckenstein F, Cuello

AC (1985) Cholinergic projections from the midbrain and pons

to the thalamus in the rat, identified by combined retrograde

tracing and choline acetyltransferase immunohistochemistry.

Brain Res 329:213–223

Stefani A, Lozano AM, Peppe A, Stanzione P, Galati S, Tropepi D,

Pierantozzi M, Brusa L, Scarnati E, Mazzone P (2007) Bilateral

deep brain stimulation of the pedunculopontine and subthalamic

nuclei in severe Parkinson’s disease. Brain 130:1596–1607

Steininger TL, Rye DB, Wainer BH (1992) Afferent projections to the

cholinergic pedunculopontine tegmental nucleus and adjacent

midbrain extrapyramidal area in the albino rat. J Comp Neurol

321:515–543

Steriade M, Datta S, Pare D, Oakson G, Curro Dossi RC (1990)

Neuronal activities in brainstem cholinergic nuclei related to

tonic activation processes in thalamocortical systems. J Neurosci

10:2541–2559

Stornetta RL, Sevigny CP, Schreihofer AM, Rosin DL, Guyenet PG

(2002) Vesicular glutamate transporter DNPI/VGLUT2 is

expressed by both C1 adrenergic and non-aminergic vasomotor

neurons of the rat medulla. J Comp Neurol 444:207–220

Sugimoto T, Hattori T (1984) Organization of efferent projections of

nucleus tegmenti pedunculopontinus pars compacta with special

reference to its cholinergic aspects. Neuroscience 11:931–946

Vila M, Perier C, Feger J, Yelnik J, Faucheux B, Ruberg M, Raisman-

Vozari R, Agid Y, Hirsch EC (2000) Evolution of changes in

neuronal activity in the subthalamic nucleus of rats with

unilateral lesion of the substantia nigra assessed by the metabolic

and electrophysiological measurements. Eur J Neurosci

12:337–344

Vincent SR (2000) The ascending reticular activating system: from

aminergic neurons to nitric oxide. J Chem Neuroanat 18:23–30

Vincent SR, Satoh K, Armstrong DM, Fibiger HC (1983) NADPH-

diaphorase: a selective histochemical marker for the cholinergic

neurons of the pontine reticular formation. Neurosci Lett 43:31–36

Wang H-L, Morales M (2009) Pedunculopontine and laterodorsal

tegmental nuclei contain distinct populations of cholinergic,

glutamatergic and GABAergic neurons in the rat. Eur J Neurosci

29:340–358

330 Brain Struct Funct (2011) 216:319–330

123