Funny Current Downregulation and Sinus Node Dysfunction Associated With Atrial Tachyarrhythmia: A...

Funny Current Downregulation and Sinus Node DysfunctionAssociated With Atrial Tachyarrhythmia

A Molecular Basis for Tachycardia-Bradycardia Syndrome

Yung-Hsin Yeh, MD*; Brett Burstein, PhD*; Xiao Yan Qi, PhD*; Masao Sakabe, MD, PhD;Denis Chartier, MSc; Philippe Comtois, PhD; Zhiguo Wang, PhD;

Chi-Tai Kuo, MD; Stanley Nattel, MD

Background—Sinoatrial node (SAN) dysfunction is frequently associated with atrial tachyarrhythmias (ATs). Abnormal-ities in SAN pacemaker function after termination of ATs can cause syncope and require pacemaker implantation, butunderlying mechanisms remain poorly understood. This study examined the hypothesis that ATs impair SAN functionby altering ion channel expression.

Methods and Results—SAN tissues were obtained from 28 control dogs and 31 dogs with 7-day atrial tachypacing (400bpm). Ionic currents were measured from single SAN cells with whole-cell patch-clamp techniques. Atrialtachypacing increased SAN recovery time in vivo by �70% (P�0.01), a change which reflects impaired SANfunction. In dogs that underwent atrial tachypacing, SAN mRNA expression (real-time reverse-transcription polymerasechain reaction) was reduced for hyperpolarization-activated cyclic nucleotide–gated subunits (HCN2 and HCN4) by�50% (P�0.01) and for the �-subunit minK by �42% (P�0.05). SAN transcript expression for the rapiddelayed-rectifier (IKr) �-subunit ERG, the slow delayed-rectifier (IKs) �-subunit KvLQT1, the �-subunit MiRP1, theL-type (ICaL) and T-type (ICaT) Ca2�-current subunits Cav1.2 and Cav3.1, and the gap-junction subunit connexin 43 (wereunaffected by atrial tachypacing. Atrial tachypacing reduced densities of the HCN-related funny current (If) and IKs by�48% (P�0.001) and �34% (P�0.01), respectively, with no change in voltage dependence or kinetics. IKr, ICaL, andICaT were unaffected. SAN cells lacked Ba2�-sensitive inward-rectifier currents, irrespective of AT. SAN action potentialsimulations that incorporated AT-induced alterations in If accounted for slowing of periodicity, with no additionalcontribution from changes in IKs.

Conclusions—AT downregulates SAN HCN2/4 and minK subunit expression, along with the corresponding currents If andIKs. Tachycardia-induced remodeling of SAN ion channel expression, particularly for the “pacemaker” subunit If,may contribute to the clinically significant association between SAN dysfunction and supraventriculartachyarrhythmias. (Circulation. 2009;119:1576-1585.)

Key Words: sinoatrial node � pacing � arrhythmia � ion channels � electrophysiology

It is well-established that sinoatrial node (SAN) dysfunctionis common in patients with atrial fibrillation (AF) and can

lead to syncopal attacks after AF termination, a conditionoften called the tachycardia-bradycardia syndrome.1,2 Al-though abnormalities of SAN structure have been noted inpatients with AF,3 there is increasing evidence of a reversiblecomponent related to SAN remodeling caused by rapid atrialtachyarrhythmias. SAN dysfunction is commonly noted 1 dayafter electrical cardioversion in patients with lone AF.4

Although this finding was originally believed to be due to theintrinsic electrophysiological abnormalities that characterize

the condition, Elvan et al5 demonstrated in an elegant studythat electrically induced AF causes SAN dysfunction in dogs,with SAN abnormalities becoming reversed within a weekafter AF termination. SAN dysfunction noted after termina-tion of chronic atrial flutter was also found to reverse itselfover several weeks,6 which supports the notion that atrialtachyarrhythmias lead to reversible SAN dysfunction inhumans. Subsequently, Hocini et al7 demonstrated that whenAF patients show prolonged sinus pauses on AF termination,successful AF ablation is followed by marked recovery inSAN function indices.

Received April 30, 2008; accepted October 17, 2008.From the Department of Medicine (Y.-H.Y., B.B., X.Y.Q., M.S., D.C., P.C., Z.W., S.N.), Department of Physiology and Institute of Biomedical

Engineering (P.C.), Montreal Heart Institute Research Center and Université de Montréal, Montreal, Quebec, Canada; Department of Pharmacology andTherapeutics (B.B., S.N.), McGill University, Montreal, Quebec, Canada; and the First Cardiovascular Division, Chang-Gung Memorial Hospital andChang-Gung University (Y.-H.Y., C.-T.K.) Tao-Yuan, Taiwan.

*The first 3 authors contributed equally to this work.The online-only Data Supplement is available with this article at http://circ.ahajournals.org/cgi/content/full/CIRCULATIONAHA.108.789677/DC1.Correspondence to Stanley Nattel, 5000 Belanger St E, Montreal, H1T 1C8, Quebec, Canada. E-mail [email protected]© 2009 American Heart Association, Inc.

Circulation is available at http://circ.ahajournals.org DOI: 10.1161/CIRCULATIONAHA.108.789677

1576

Clinical Perspective p 1585Despite extensive accumulating evidence for atrial

tachyarrhythmia–induced SAN dysfunction, the underlyingmechanisms have remained unclear. Atrial tachyarrhythmias,including AF, cause substantial remodeling of the ionic currentproperties of atrial cardiomyocytes, which causes action poten-tial abbreviation that increases vulnerability to AF induction andmaintenance.8 It is quite conceivable that SAN ionic currentchanges induced by AF lead to the depressed SAN function thatcharacterizes the tachycardia-bradycardia syndrome.

The present study tested the hypothesis that sustained atrialtachycardia alters ionic current properties in SAN cardiomyo-cytes, thereby causing SAN dysfunction. We first studiedchanges in the expression of SAN ion channel subunits thatresulted from 1 week of atrial tachypacing (ATP) at 400 bpm,a recognized paradigm of AF-related atrial tachycardia re-modeling.8,9 We then developed the necessary methods toisolate canine SAN cardiomyocytes and performed voltage-clamp studies to characterize the effects of ATP on their ioniccurrents. Our results implicate alterations of the funny cur-rent, If, in atrial tachyarrhythmia–induced SAN dysfunction.

MethodsAnimal Handling and Tachypacing ProtocolAnimal care procedures were consistent with National Institutes ofHealth guidelines and were approved by the animal research ethicscommittee of the Montreal Heart Institute. Adult mongrel dogs(weight 25 to 35 kg; Laka Inc, Saint-Basile-le-Grand, Quebec,Canada) were instrumented with a unipolar right-atrial (RA) leadattached to a pacemaker programmed to provide 1 week of RApacing at 400 bpm. Ventricular rate control was ensured by radio-frequency ablation–induced AV block, with a right ventriculardemand pacemaker set at 80 bpm. ATP dogs (n�31) were comparedwith control dogs (n�28) that were similarly instrumented but withthe RA pacemaker inactivated. At the time the animals wereeuthanized, SAN cardiomyocytes were isolated for electrophysiolog-ical study, and SAN and RA free-wall (RAFW) tissue samples werecollected, snap-frozen in liquid N2, and stored at �80°C.

Sinus Node Recovery Time ChangesOn study days, dogs were anesthetized (morphine 2 mg/kg SC;�-chloralose 120 mg/kg IV load, 29.25 mg · kg�1 · h�1) andmechanically ventilated. Bipolar pacing and recording hook elec-trodes were inserted into the RA appendage. The baseline sinus ratewas measured after suppression of potentially confounding vagal and�-adrenergic influences by administration of nadolol (0.5 mg/kg IV)

and severing of the vagus nerves in the neck.2 The RA was thenpaced at cycle lengths (CLs) of 250 or 300 ms for 1 minute. Thecorrected sinus node recovery time (SNRTc) was obtained from theinterval from the last paced atrial activation to the first sinus escapebeat, minus the prepacing spontaneous CL.

RNA Extraction and TaqMan Real-TimePolymerase Chain ReactionRNA was isolated from tissue samples by guanidine thiocyanate-phenol-chloroform extraction, then treated with DNase (RNeasymini kit, Qiagen, Valencia, Calif), quantified, and subjected toquality control by microelectrophoresis on polyacrylamide gels(Agilent 2100 Bioanalyzer, Agilent Technologies Inc, Santa Clara,Calif).1 DNA contamination was excluded by reverse-transcription–negative polymerase chain reaction (PCR). First-strand complemen-tary DNA was synthesized from 2 �g of total RNA with ahigh-capacity cDNA archive kit (Applied Biosystems, Foster City,Calif). Real-time quantitative PCR was performed with either 6-car-boxy-fluorescein–labeled fluorogenic TaqMan primers and probes(assay-by-design) with TaqMan universal master mix (AppliedBiosystems) or custom primers (Invitrogen, Carlsbad, Calif) withSYBR Green master mix (Applied Biosystems; sequences providedin the Table). Fluorescence signals were detected with the Strat-agene Mx3000P sequence-detection system (Stratagene, La Jolla,Calif) in duplicate, normalized to the reference (18S ribosomalRNA, Applied Biosystems), and quantified with MxPro QPCRsoftware (Stratagene).

SAN Cardiomyocyte IsolationAn RA preparation containing the SAN region was perfused at �10mL/min via the right coronary artery for cardiomyocyte isolation.9The preparation was first perfused with 2 mmol/L Ca2�-containingTyrode solution until all leaking coronary artery branches wereligated, followed by Ca2�-free Tyrode solution for 15 minutes. Then,Ca2�-free Tyrode solution that contained collagenase (110 U/mLCLS II collagenase; Worthington Biochemical, Lakewood, NJ) and0.1% bovine serum albumin was used to perfuse the preparation for�40 minutes. The SAN region was identified as a whitish endocar-dial zone near the junction between the superior vena cava and theRA appendage. Dispersed cells were stored in a high-K� storagesolution.

SAN Cellular ElectrophysiologyCurrents were recorded with whole-cell patch clamping at 36�0.5°Cas described previously.9 Potential SAN cardiomyocytes were iden-tified on the basis of distinct morphologies (fine, elongated spindle-like or spider-shaped cells; see supplemental Figure I). Only cellspresenting If, which was never seen in atrial cardiomyocytes, wereselected for SAN cell current recording. Borosilicate glass electrodeshad tip resistances between 2.0 and 4.0 M� when filled. Compen-sated series resistances and capacitive time constants averaged3.4�0.3 M� and 289�64 �s, respectively. SAN cell capacitance

Table. Gene-Specific Primers (and TaqMan Probe Sequences) Used in Real-Time RT-PCR Analysis

Gene Forward Primer Sequence Reverse Primer Sequence Probe Sequence Accession No.

Cav1.2 GACATTGTTTTCACTACCATTTTCACCAT GGCAAAAAGAGCCCTTATGTAGGAA ATCTTCAGAGCAATTTC XM_534932

Cav3.1 GAGGACATCGCCTGTGACT GGCAAAGAAGGCAAAGATGAAGTC ATCCTGCAGGCCTTTG XM_860802

Cx43 ACTCTTGTACCTGGCTCATGTG ACCTTGCCGTGCTCTTCAAT NM_001002951

ERG GCAAAGTGGAGATCGCCTTCTAC CATCCACCAGGCACAGGAA CAGCTCCCATCCTTCC NM_001003145

HCN2 GCGGCGCCAGTACCA GCAGCTTGTGGAAGGACATGTA CCTGCTTGTACTTCTCC XM_850140

HCN4 CTGGGCGAGCTGAGTGA CCAGCTTCCGGCAGTTGAA CTGAGGGAGGAGATCATCAA XM_535535

Kv4.3 TCCCCTGTTATCTGTACGAACCT TTCTGCTCAAACATCTGCTCATCT CCACCATCAAGAACCA XM_845974

KvLQT1 ATTCGGCGCATGCAGTACTT TTGATGCGCACCATGAGGTT XM_540790

minK GGCTCTAGATCAGGAACCTTCTTG CACGAAGGCCAAACATCACA CCTGCAGCCGGTCACT XM_544868

MiRP1 CCATCCTGGTGAGCACTGT AGTCCTCTACAATGTACTGGTGGTA CCGTCTCTTGGATTTC XM_544867

Yeh et al SA Node Ion Channels in Tachy-Brady Syndrome 1577

averaged 80�5 pF (n�30) for control dogs and 85�3 pF (n�44) fortachypaced dogs. Original recordings are presented in terms ofabsolute current amplitude, but mean data are shown as currentdensity (pA/pF). Junction potentials averaged 15.0�0.7 mV and werecorrected only for resting-potential measurements. Resting potentialsaveraged �52�1 mV in control and �53�1 mV in tachypaced SANcells (n�14 and 17 cells, respectively, from 3 dogs each).

SolutionsThe cell-storage solution contained (in mmol/L) KCl 20, KH2PO4 10,dextrose 10, mannitol 40, L-glutamic acid 70, �-OH-butyric acid 10,taurine 20, EGTA 10, and 0.1% bovine serum albumin (pH 7.3,KOH). Tyrode (extracellular) solution contained (in mmol/L) NaCl136, KCl 5.4, MgCl2 1, NaH2PO4 0.33, HEPES 5, and dextrose 10(pH 7.35, NaOH), with CaCl2 of 1 mmol/L for If recording and 2 or0 mmol/L for cell isolation. The internal solution for If and K�-currentrecording contained (in mmol/L) K-aspartate 110, KCl 20, MgCl2 1,MgATP 5, Li-GTP 0.1, HEPES 10, Na-phosphocreatine 5, andEGTA 5 (pH 7.3, KOH). Ba2� (1 mmol/L)-sensitive current was usedto assess inward-rectifier K� currents as described previously.9 ForIKs recording, nifedipine (5 �mol/L), 4-aminopyridine (2 mmol/L),dofetilide (1 �mol/L), and atropine (200 nmol/L) were added tosuppress ICaL, Ito, IKr, and 4-aminopyridine–dependent muscarinic K�

currents. For IKr recording, the same solutions were used as for IKs,except dofetilide was not included and the IKs blocker HMR 1556(0.5 �mol/L) was added. The external solution for ICa recordingcontained (in mmol/L) tetraethylammonium chloride 136, CsCl 5.4,CaCl2 2, MgCl2 0.8, HEPES 10, and dextrose 10 (pH 7.4, CsOH).Niflumic acid (50 �mol/L) was added to inhibit Ca2�-dependent Cl�

current . The internal solution for ICa recording contained (in mmol/L)CsCl 120, TEA-Cl 20, MgCl2 1, MgATP 5, Li-GTP 0.1, EGTA 10, andHEPES 10 (pH 7.3, CsOH). Unless otherwise specified, chemicals wereobtained from Sigma Chemicals (St Louis, Mo).

Transmembrane Potential SimulationsThe Kurata model of the rabbit SAN cell action potential10 wasmodified to produce a spontaneous rate similar to that in dogs in thepresent study (the sustained inward current [Ist] was set to zero) andimplemented in C�� on an AMD64 processor–based computer(AMD, Sunnyvale, Calif). Model implementation used a variabletime-step algorithm (Runge-Kutta-Merson fourth-order integrationscheme) with maximum relative tolerance of 10�6. Simulations with

each parameter value set were run for 100 seconds. The last 2seconds of simulation were then analyzed to compare the effects ofthe observed degrees of If and IKs remodeling on SAN activity.

Statistical AnalysisData are expressed as mean�SEM. Repeated-measures 2-wayANOVA and Bonferroni-adjusted t tests were used for statisticalcomparisons of current-voltage relations. Reverse-transcription PCRdata (nonrepeated measures) were also analyzed by 2-way ANOVA.When ANOVA revealed a statistically significant interaction,Bonferroni-adjusted comparisons were performed to compare indi-vidual group means by multiplying each probability value by thenumber of comparisons. In the absence of significant interactions,statistical data are presented only in terms of main effects (region[SAN versus RA] or condition [control versus ATP]). An unpairedStudent t test was used to compare spontaneous CL between controland ATP-remodeled dogs. Analyses of ionic currents controlled fordog of origin as a variable to avoid weighting results from differentdogs by the number of cells studied. A 2-tailed probability value�0.05 was considered statistically significant. Clampfit 9.0 (AxonInstruments, Foster City, Calif) and GraphPad Prism 3.0 (GraphPad,San Diego, Calif) software were used for data analysis.

The authors had full access to and take full responsibility for theintegrity of the data. All authors have read and agree to themanuscript as written.

ResultsSAN Recovery Times In VivoFigure 1A illustrates RA electrogram recordings used tocalculate the SNRTc. The left panel shows baseline aftervagotomy and nadolol administration, whereas the right panelshows recordings just before and after the end of tachypacing.There was a clear delay to the emergence of the firstspontaneous postpacing beat, which was enhanced after 1week of ATP. After vagotomy and nadolol administration,the sinus CL was longer in ATP dogs than in control(P�0.05), which indicates reduced intrinsic SAN automatic-ity (Figure 1B). SNRTc was substantially prolonged in ATPdogs versus controls (Figure 1C).

Figure 1. In vivo recordings at baselineand immediately after overdrive pacing forsinus node recovery time (SNRT) mea-surements. A, Representative atrial ECGrecordings from control (CTL) and ATP(AT-P) dogs. Left, Prepacing baseline AArecordings after vagotomy and intrave-nous nadolol. Right, Postpacing (at a CLof 250 ms) AA recordings. The SNRT wasthe first postpacing A-A interval. SNRTcwas calculated as SNRT minus the meanprepacing AA CL. B, Mean�SEM sinusCL at baseline after vagotomy/intravenousnadolol. C, Mean�SEM SNRTc at 250and 300 ms pacing CLs. N�12 dogs pergroup. *P�0.05, ***P�0.01; analysis in Bby unpaired Student t test, in C byrepeated-measures 2-way ANOVA.

1578 Circulation March 31, 2009

Ion Channel Subunit ExpressionATP causes atrial electrical remodeling, which alters themRNA expression of ion channel subunits.8 Quantitativereverse-transcription PCR was used to investigate ATP-induced changes in mRNA expression profiles and to com-pare SAN and RAFW expression patterns to support tissue-identification validity (Figure 2).

If SubunitsThe mRNA expression levels of hyperpolarization-activatedcyclic nucleotide–gated subunits (HCN2 and HCN4) wereenriched in control SAN tissue versus RAFW (�5.5-fold and12-fold, respectively, P�0.001 for both; Figures 2A and 2B).There was a statistically significant interaction betweenregion (RAFW and SAN) and condition (control versus ATP)in expression of both HCN2 (F�5.67, dfn�1, dfd�34,P�0.023) and HCN4 (F�6.07, dfn�1, dfd�34, P�0.019),which indicates that region is a determinant of the response toATP. ATP reduced SAN expression of both HCN2 (by 56%,P�0.05) and HCN4 (59%, P�0.05). There was no interac-tion between region and condition for the putative If

�-subunit MiRP1 (Figure 2C), but there was a significantmain effect of region (F�15.70, dfn�1, dfd�30, P�0.0004),with greater expression in SAN than in RAFW, which wasunchanged by tachypacing.

IK SubunitsExpression of the �-subunits corresponding to IKr (ERG;Figure 2D) and IKs (KvLQT1; Figure 2E) was similar forRAFW versus SAN tissues, and neither was significantlyaltered by ATP. The IKs �-subunit minK (Figure 2F) wasmore strongly expressed in SAN than in RAFW (main effectof region: F�12.42, dfn�1, dfd�33, P�0.0013) and wasglobally reduced by ATP (main effect of condition: F�11.48,dfn�1, dfd�33, P�0.0018).

ICa SubunitsThe L-type Ca2� current (ICaL) �-subunit Cav1.2 (main effectof region: F�22.95, dfn�1, dfd�32, P�0.0001; Figure 2G)and T-type Ca2� current (ICaT) �-subunit Cav3.1 (main effectof region: F�10.25, dfn�1, dfd�33, P�0.0030; Figure 2H)were both more strongly expressed in SAN than in RAFW.Neither subunit was significantly affected by ATP.

Connexin43There was a significant interaction between region andcondition for connexin 43 (Cx43) expression (F�26.21,dfn�1, dfd�32, P�0.0001; Figure 2I). In control tissue,Cx43 was expressed �3.4-fold more in RAFW than in SAN(P�0.001). Although ATP had no effect on SAN Cx43expression, tachypacing downregulated Cx43 by 48%(P�0.001) in RAFW.

Figure 2. Real-time reverse-transcription PCR.Mean�SEM mRNA expression of If-associatedsubunits (A–C), IK-related subunits (D–F), ICaL andICaT subunits (G and H), and Cx43 (I). N�8 to 10per group. *P�0.05, ***P�0.001 for individualgroup mean differences by Bonferroni-adjusted ttest in the presence of significant group-by-regioninteraction; ††P�0.01, †††P�0.001 for main effectof region; ‡‡P�0.01 for main effect of condition;by 2-way ANOVA. CTL indicates control;AT-P, ATP.


Reference GeneExpression of the reference gene, which encoded 18S ribo-somal RNA, was comparable among groups (RAFW control6.38�0.47; RAFW ATP 6.75�0.63; SAN control6.68�0.67; SAN ATP 6.77�0.31).

Hyperpolarization-Activated CurrentsIonic currents were selected for measurement on the basis ofthe mRNA data. The 2 currents that showed significantsubunit expression changes (If and IKs) were recorded, alongwith 2 Ca2� currents believed to play important roles in SANpacemaking4 that showed no significant alteration in�-subunit expression (ICaL and ICaT) and 1 K� current thatshowed no mRNA change (IKr). Figure 3A shows represen-tative recordings of If in control and ATP cells. Bothtime-dependent activating (Figure 3B) and tail-current com-ponents of If were significantly reduced by ATP. For exam-ple, at a step voltage of �140 mV, If was reduced from�10.8�1.0 pA/pF in control cells to �6.0�1.0 pA/pF inATP cells (P�0.001). If activation kinetics were well fittedby biexponential relations and were not affected by ATP(Figure 3C), showing similar fast (�fast) and slow (�slow)activation time constants, of the order of 50 to 200 and 250 to1000 ms, respectively, over the full voltage range. To analyzesteady state activation voltage dependence, If tail currents onrepolarization to �140 mV were normalized by the maxi-mum tail-current value and plotted as a function of thepreceding step potential. Tachypacing did not significantlyaffect the activation variable at different voltages (Figure

3D). The V1/2 and slope-constant values obtained from Bolt-zmann fits of data in each experiment averaged �72.4�3.0and �8.3�1.1 mV, respectively, for control cells and�76.4�3.3 and �7.6�1.3 mV, respectively, for ATP cells.

We also recorded Ba2�-sensitive K� currents in SAN cellsto assess their constitutive acetylcholine-regulated (IKACh) andbackground inward-rectifier (IKl) expression phenotype and toevaluate possible ATP-induced inward-rectifier current up-regulation of the type previously observed in atrial cells.8

Supplemental Figures IIA and IIB show such current record-ings from 1 SAN cell before and after exposure to 1 mmol/LBa2�. Consistent with very limited IKl expression in the SANregion, Ba2� had no clear effect on the currents, and theBa2�-sensitive currents obtained by digital subtraction (sup-plemental Figure IIC) were negligible. Mean Ba2�-sensitivecurrent-voltage density relations in SAN cells are illustratedin supplemental Figure IID and contrasted with correspond-ing results in RA cardiomyocytes. Unlike SAN cells, atrialcardiomyocytes showed clear Ba2�-sensitive currents withcurrent-voltage relations typical of inward-rectifier K� cur-rents. These results support the characteristic ion channelproperties of the canine SAN cells that we studied, becauselack of IKl is characteristic of most mammalian SAN cells.11

In addition, we recorded Ba2�-sensitive currents in SAN cellsisolated from ATP dogs. As shown by the results in supple-mental Figure IID, no significant Ba2�-sensitive currents weredetected, which indicates the absence of inward-rectifiercurrent (IKl or constitutive IKACh) upregulation by ATP in SANcells.

Figure 3. Reduction of SAN hyperpolarization-activated current (If) by atrial tachycardia remodeling. A, Representative If recordingsfrom control (CTL; left) and ATP (AT-P; right) SAN cardiomyocytes. B, Mean�SEM If step-current density-voltage relations. C, Activa-tion kinetics of step If. D, Voltage-dependent If activation. N�14 cells from 10 dogs for control and 16 cells from 10 dogs for ATP. TPindicates test potential. *P�0.05, **P�0.01, ***P�0.001, by repeated-measures 2-way ANOVA.


Delayed-Rectifier CurrentsThe slow delayed-rectifier current IKs plays important roles inSAN pacemaking in most species,11 and IKs �-subunit minKgene expression was downregulated. Figure 4A shows re-cordings of IKs in control and ATP cells. Both the step (Figure4B) and tail (Figure 4C) currents were significantly reducedby ATP. For example, the IKs step-current density at 60 mVwas reduced from 12.3�0.7 pA/pF in control to 8.8�0.7pA/pF in ATP cells (P�0.001), whereas the tail current densitywas reduced from 2.9�0.3 pA/pF in control to 1.9�0.2 pA/pFin ATP (P�0.01). Voltage dependence of IKs activation (tail-current analysis) was not altered by tachypacing (Figure 4D),with control and ATP cells showing similar mean V1/2 values,which averaged 10.2�2.1 and 13.5�2.4 mV, respectively.The time courses of both step-current activation on depolar-ization to 60 mV and tail-current deactivation on repolariza-tion from 60 to �40 mV were biexponential. Time constantscorresponding to both the slow and fast components of

step-current activation and tail-current deactivation showedno significant differences between control and ATP values, asillustrated in Figure 4E.

Results of rapid delayed-rectifier current recordings areshown in Figure 5. IKr tail currents were recorded during4-second repolarizing pulses to �40 mV after a 2-secondactivating pulse to voltages between �40 and 70 mV. Asshown in Figures 5A and 5B, IKr tail currents were small incanine SAN cells, both from dogs without and with ATP.Figure 5C shows mean tail-current density-voltage relations,which were unchanged by ATP.

Calcium CurrentsCa2� currents are important in SAN pacemaking,11 and atrialtachyarrhythmias have been shown to change atrial ICaL, withboth transcriptional and posttranscriptional mechanisms hav-ing been implicated.8 Accordingly, we compared ICaL and ICaT

in SAN cells from control and ATP dogs. Original ICaL

Figure 4. Reduction of SAN slowdelayed-rectified K� current (IKs) by atrialtachycardia remodeling. A, RepresentativeIKs recordings from control (CTL; left) andATP (AT-P; right) SAN cardiomyocytes.B and C, Mean�SEM IKs step- and tail-current density-voltage relations. D,Mean�SEM normalized IKs tail-currentdensity-voltage relation. E, Activationkinetics of step IKs and deactivation kinet-ics of tail IKs. N�15 cells from 10 dogsper group. *P�0.05, **P�0.01, ***P�0.001,by repeated-measures 2-way ANOVA.

Figure 5. Unchanged SAN rapid delayed-rectifier K� current (IKr) in atrial tachycardia remodeling. A and B, IKr recordings from control(CTL; A) and ATP (AT-P; B) SAN cardiomyocytes. C, Mean�SEM IKr tail-current density-voltage relations from 14 cells from 3 controldogs and 26 cells from 5 ATP dogs. Analysis by repeated-measures 2-way ANOVA. TP indicates test potential.


recordings are shown in Figure 6A. ICaL densities werecomparable between ATP and control cells (Figure 6B). Forexample, at 10 mV, ICaL density averaged �4.6�0.6 pA/pF incontrol and �4.1�0.7 pA/pF in ATP cells, respectively.Original recordings corresponding to total ICa (including bothICaL and ICaT components) obtained on depolarization from�90 to �20 mV and recordings from the same cells thatreflect ICaL without a contribution from ICaT (obtained bydepolarization from �50 to �20 mV) are shown in Figure6C. T-type current was obtained by subtracting currentsrecorded with a holding potential of �50 mV from currentrecorded with a holding potential of �90 mV, as describedpreviously.9 ICaT was not present in all SAN cells but wasfound in a large and similar proportion (�70%) of bothcontrol and ATP cells. No significant change in ICaT (Figure6D) current density-voltage relations was produced by ATP;for example, ICaT at �20 mV was �1.4�0.4 for controlversus �1.3�0.2 pA/pF for ATP cells.

Transmembrane Potential SimulationsSimulation of SAN cell action potentials provided the spon-taneous activity shown by the blue curves in Figure 7. Theresults of different combinations of If and IKs remodeling aresuperimposed in specific colors. Remodeling of IKs alone wassimulated by reproducing the same mean density decrease(35%) obtained in voltage-clamp recordings and did notchange spontaneous SAN cell periodicity (CL 407.8 ms incontrol versus 407.7 ms with reduced IKs). A 50% decrease inIf slowed periodic activity by increasing the CL �9%, whichwas a change of the same order as but slightly less than theincrease in spontaneous CL seen with ATP (13.8%) in the

absence of autonomic influences (vagotomy/nadolol). Simu-lation of the decrease in If and IKs together did not appreciablyalter the slowing effect of simulated ATP compared with If

effects alone (CL 443.6 ms with If reduction alone versus443.4 ms with combined IKs/If reduction).

DiscussionWe have completed a detailed analysis of the functional andgene expression changes for selected ion channel subunits ofSAN cells isolated from dogs subjected to 1 week of atrialtachycardia remodeling. The results indicate significantchanges in the expression of specific subunits involved inSAN pacemaking, with alterations in If appearing to beparticularly important for associated SAN dysfunction.

Mechanisms Underlying Reversible SAN Dysfunctionin Tachycardia-Bradycardia SyndromeEarly studies implicated anatomic structural abnormalities inSAN dysfunction associated with atrial tachyarrhythmias,which suggests a fixed SAN dysfunction substrate1,3; how-ever, several subsequent lines of evidence have pointed to animportant functional, and potentially reversible, component.Elvan et al5 showed that electrically sustained AF over 2 to 6weeks induced SAN dysfunction in parallel with atrial re-modeling and that significant SAN recovery occurred within1 week of AF cessation. These observations were confirmedby studies that showed that SAN dysfunction due to atrialtachycardia remodeling was fully reversed 4 weeks aftertachycardia cessation.12 Termination of chronic atrial flutterin humans is followed by progressive improvement in SNRTcabnormalities over 3 weeks, which supports the applicability

Figure 6. Unaltered SAN calcium currents (ICaL and ICaT) with atrial tachycardia remodeling. A, Representative recordings of ICaL fromcontrol (CTL; left) and ATP (AT-P; right) SAN cardiomyocytes. B, Mean�SEM ICaL density-voltage relations; n�12 cells from 4 dogs pergroup. C, Representative recordings of calcium current from control and ATP cardiomyocytes, respectively. The currents were recordedwith holding potentials of �90 mV and �50 mV. The subtracted currents represent ICaT. D, Mean�SEM ICaT density-voltage relations;n�10 cells from 4 dogs per group. Analysis by repeated-measures 2-way ANOVA. TP indicates test potential.


of the experimental findings to clinical tachyarrhythmias.6

Paroxysmal AF patients with prolonged (�3 seconds) sinuspauses on AF termination show progressive improvements insinus node function after AF ablation, with a clinical evolu-tion that indicates an absence of clinically significant SANdisease.7 The results obtained in the present study provide apotential ionic current mechanism to explain these experi-mental and clinical observations, based on atrialtachycardia–induced remodeling of SAN ion channel expres-sion and function. If contributes to cellular automaticity bydepolarizing cells toward their threshold potential, whereasIKs can contribute by accelerating phase 3 repolarization andadvancing the time when the cell begins spontaneous phase 4depolarization. Our mathematical modeling analyses suggestthat the If changes caused by atrial tachycardia remodelinglargely account for the associated SAN dysfunction. The lackof a significant role for IKs changes is likely due to the verypositive activation potential for this current,9 which is notattained by SAN cells with their low resting potential andlimited overshoot.11

Relationship to Previous Studies of AtrialTachycardia Remodeling and Disease-RelatedSAN DysfunctionAtrial ionic current remodeling due to sustained atrialtachycardia has been evaluated in detail. The principalchanges include downregulation of ICaL

8,9,13,14 and Ito8,9,14,15

and upregulation of inward-rectifier K� currents.8,14–18 Atrialdelayed-rectifier K� current function is not altered by atrialtachycardia.8,9 Changes in atrial If function have not beendescribed in atrial tachycardia remodeling. The profile ofatrial tachycardia–induced SAN remodeling differs substan-tially from changes seen at the atrial level, being dominatedby alterations in HCN subunits and If function, along withstatistically significant changes in minK expression and IKs

density. The tachycardia-induced downregulation of ICaL andupregulation of inward-rectifier K� currents that are believedto be of great functional importance at the atrial level8 are notobserved in SAN cells.

mRNA profiling in the present study showed some inter-esting differences between ATP-induced remodeling in SANand RAFW. HCN subunits were downregulated only in SANtissue, and Cx43 was downregulated only in RAFW. The IKs

�-subunit minK was downregulated in both SAN and RAFW.Although we found SAN IKs to be downregulated by ATP inthe present study, previous reports have not described corre-sponding changes in atrial tissue.9 Cav1.2 mRNA expressionwas not altered by ATP in either SAN or RAFW. The SANresult is consistent with unchanged SAN ICaL in the presentstudy, but the atrial findings are discrepant with results ofprevious investigations of ATP-induced atrial remodeling.8

The reason for this discrepancy in atrial Cav1.2 mRNAchanges is unclear and may relate to technical factors or thesite of atrial sampling, but a detailed experimental analysisgoes beyond the scope of the present study.

The basis for the differential atrial tachycardia remodelingresponse of atrial cardiomyocyte ionic currents versus thosein SAN cells is unclear. Although we were unable to identifyprevious studies of SAN cell ion-channel remodeling with atrialtachycardia, Verkerk et al19 have analyzed in detail thechanges in SAN ionic currents caused by congestive heartfailure in rabbits with chronic pressure and volume overload.They found changes quite similar to those we noted here, withdecreases in If and IKs and lack of change in the other currentsthey studied. The alterations that they observed were of thesame order that we saw but were slightly smaller: �40%versus �50% decrease in If and �20% versus �35% de-crease in IKs. They also performed mathematical modeling toassess the relative importance of If and IKs changes to alteredSAN automaticity, and like us, they concluded that If down-

Figure 7. Simulations of SAN transmem-brane potential showing changes in spon-taneous periodicity caused by reductionsin If, IKs, and If and IKs together. V indi-cates voltage; t, time.


regulation is the principal contributor. Verkerk et al19 did notexamine the molecular basis of the SAN ionic currentremodeling they observed with congestive heart failure, butwe subsequently studied HCN subunit expression changes ina canine ventricular-tachypaced congestive heart failuremodel and observed downregulation of HCN2 and HCN4mRNA.20 The similarities in SAN ionic current changes thatoccur with congestive heart failure–induced and ATP-relatedremodeling are striking and may suggest a characteristic SANionic current response to pathological insults. A possibleexplanation for the lack of changes in SAN ICaL and inward-rectifier K� currents could be that SAN cells are not fired atsuch high frequencies as atrial cardiomyocytes during AF,owing to SAN slow-channel properties that cause entry blockinto the central SAN and limit follow frequencies.21

Novelty and Potential SignificanceThe present study is the first of which we are aware to studychanges in SAN ion channel subunit expression and ioniccurrent function with atrial tachycardia remodeling. Ourresults provide novel insights into the fundamental mecha-nisms at the ionic and molecular level responsible for aclinically important phenomenon, the SAN dysfunction thatis associated with atrial tachyarrhythmias. The importance ofthis problem has been underlined in a recent detailed reviewof SAN physiology in relation to sick sinus syndrome, withan absence of information about the underlying molecular/ionic basis being evident.22 The observation that HCN subunitdownregulation underlies SAN dysfunction in the presentexperimental model of tachycardia-bradycardia syndrome, asit does in experimental congestive heart failure,19,20 providesfurther rationale for the development of cell/gene therapyapproaches that involve HCN subunit expression enhance-ment for the management of clinical bradyarrhythmiasyndromes.23

The present study is also the first to the best of ourknowledge to study the properties of ionic currents in thecanine SAN. The rabbit has been the species most commonlyused for SAN cell isolation and study, but the dog has clearadvantages in terms of widespread availability of clinicallyrelevant pathological models. Kwong et al24 isolated cells ofvarious morphologies from canine SAN preparations anddescribed spider- and spindle-shaped cells as having uniqueconnexin distribution properties that suggested a primary rolein pacemaking function. The same group subsequently iso-lated cells with these morphologies from rabbit SANs andshowed that they have prominent If-like currents, which arelarger for the spider-type cells.25 In the present study, weconfirmed the prominent If shown by these cell types incanine SAN, which contrasts with the lack of If that we notedin atrial cells. The present studies thus provide furtherevidence for the pacemaker-cell phenotype specialization ofspider and spindle cells in the dog. Further studies of SANcell pathophysiology in other canine models of human car-diac disease would be of potential interest.

Potential LimitationsThe SAN origin of isolated cells and tissue preparations isalways difficult to confirm with certainty. We isolated cells

for study on the basis of SAN localization in the dog that weidentified in previous studies,20 and we used well-describedmorphological criteria24,25 to define SAN-derived spider andspindle cells. The SAN preparations that we used for real-time PCR quantification of ion channel subunits also hadsubunit distribution properties typical of SAN: greater mRNAexpression-levels of HCN2, HCN4, and MiRP1 subunits andlower expression levels of Cx43 than RA tissue.20,26

Although the present results are compelling evidence for acontribution of HCN/If downregulation to ATP-induced SANdysfunction, we cannot exclude the possibility that otherchanges may contribute as well. We did not study theproperties of all channels, ion transporters, and ion-handlingsystems in SAN tissue. In particular, there is recent evidencefor an important contribution of sarcoplasmic reticulum Ca2�

uptake and release processes to cardiac pacemaking.27 Thus,changes in important components of the cellular Ca2�-handling machinery, including, for example, the Na�,Ca2�

exchanger, sarcoplasmic reticulum Ca2� ATPase (SERCA),the ryanodine receptor, calsequestrin, and phospholamban,could have been changed by ATP and could contribute toaltered SAN automaticity. A role for other ionic currentscannot be excluded, including Cl� currents such as theCa2�-dependent, swelling-induced, and cAMP-regulated Cl�

current; K� currents such as the Ca2�-dependent K� current;various 2-pore, 4-transmembrane domain channels; and non-selective cation channels. In addition, adrenergic and cholin-ergic regulation importantly modify If function and SANautomaticity. We cannot exclude a role for ATP-relatedchanges in autonomic and associated G-protein–coupledregulation of If or other currents controlling SAN function.Nevertheless, we have succeeded in identifying congruentionic current and channel subunit mRNA changes that areconsistent with previous studies of SAN pathological remod-eling and that on the basis of an ion-current–based SANmathematical model account for a substantial portion of theSAN slowing that we observed. Finally, although the presentresults implicate HCN/If remodeling in ATP-induced SANdysfunction, we did not study the underlying molecularmechanisms, which would be an appropriate objective forfuture studies.

AcknowledgmentsThe authors thank Nathalie L’Heureux and Chantal St-Cyr fortechnical assistance and France Thériault for secretarial support.

Sources of FundingThis study was supported by the Canadian Institutes of Health Research(Award MOP 44365), the Quebec Heart and Stroke Foundation, theMathematics of Information Technology and Complex Systems (MI-TACS) Network of Centers of Excellence, and the European-NorthAmerican Atrial Fibrillation Research Alliance (ENAFRA) networkaward from Fondation Leducq. Dr Burstein received a CanadianInstitutes of Health Research (CIHR) MD/PhD studentship.

DisclosuresNone.

References1. Ferrer MI. The sick sinus syndrome in atrial disease. JAMA. 1968;206:

645–646.


2. Kaplan BM. The tachycardia-bradycardia syndrome. Med Clin North Am.1976;60:81–99.

3. Thery C, Gosselin B, Lekieffre J, Warembourg H. Pathology of sinoatrialnode: correlations with electrocardiographic findings in 111 patients. AmHeart J. 1977;93:735–740.

4. Kumagai K, Akimitsu S, Kawahira K, Kawanami F, Yamanouchi Y,Hiroki T, Arakawa K. Electrophysiological properties in chronic loneatrial fibrillation. Circulation. 1991;84:1662–1668.

5. Elvan A, Wylie K, Zipes DP. Pacing-induced chronic atrial fibrillationimpairs sinus node function in dogs: electrophysiological remodeling.Circulation. 1996;94:2953–2960.

6. Sparks PB, Jayaprakash S, Vohra JK, Kalman JM. Electricalremodeling of the atria associated with paroxysmal and chronic atrialflutter. Circulation. 2000;102:1807–1813.

7. Hocini M, Sanders P, Deisenhofer I, Jais P, Hsu LF, Scavee C, Weera-soriya R, Raybaud F, Macle L, Shah DC, Garrigue S, Le Metayer P,Clementy J, Haissaguerre M. Reverse remodeling of sinus node functionafter catheter ablation of atrial fibrillation in patients with prolonged sinuspauses. Circulation. 2003;108:1172–1175.

8. Nattel S, Maguy A, Le Bouter S, Yeh YH. Arrhythmogenic ion-channelremodeling in the heart: heart failure, myocardial infarction, and atrialfibrillation. Physiol Rev. 2007;87:425–456.

9. Yue L, Feng J, Gaspo R, Li GR, Wang Z, Nattel S. Ionic remodelingunderlying action potential changes in a canine model of atrial fibrillation.Circ Res. 1997;81:512–525.

10. Kurata Y, Hisatome I, Imanishi S, Shibamoto T. Dynamical descriptionof sinoatrial node pacemaking: improved mathematical model for primarypacemaker cell. Am J Physiol Heart Circ Physiol. 2002;283:H2074–H2101.

11. Satoh H. Sino-atrial nodal cells of mammalian hearts: ionic currents andgene expression of pacemaker ionic channels. J Smooth Muscle Res.2003;39:175–193.

12. Zupan I, Kozelj M, Butinar J, Rakovec P. Impaired sinus node functionand global atrial conduction time after high rate atrial pacing in dogs. CellMol Biol Lett. 2002;7:383–384.

13. Van Wagoner DR, Pond AL, Lamorgese M, Rossie SS, McCarthy PM,Nerbonne JM. Atrial L-type Ca2� currents and human atrial fibrillation.Circ Res. 1999;85:428–436.

14. Bosch RF, Zeng X, Grammer JB, Popovic K, Mewis C, Kühlkamp V.Ionic mechanisms of electrical remodeling in human atrial fibrillation.Cardiovasc Res. 1999;44:121–131.

15. Van Wagoner DR, Pond AL, McCarthy PM, Trimmer JS, Nerbonne JM.Outward K� current densities and Kv1.5 expression are reduced inchronic human atrial fibrillation. Circ Res. 1997;80:772–781.

16. Dobrev D, Graf E, Wettwer E, Himmel HM, Hála O, Doerfel C, ChristT, Schüler S, Ravens U. Molecular basis of downregulation ofG-protein-coupled inward rectifying K� current (I(K,ACh) in chronichuman atrial fibrillation: decrease in GIRK4 mRNA correlates withreduced IK,ACh and muscarinic receptor-mediated shortening of actionpotentials. Circulation. 2001;104:2551–2557.

17. Dobrev D, Friedrich A, Voigt N, Jost N, Wettwer E, Christ T, Knaut M,Ravens U. The G protein-gated potassium current IK,ACh is constitutivelyactive in patients with chronic atrial fibrillation. Circulation. 2005;112:3697–3706.

18. Cha TJ, Ehrlich JR, Chartier D, Qi XY, Xiao L, Nattel S. Kir3-basedinward rectifier potassium current: potential role in atrial tachycardiaremodeling effects on atrial repolarization and arrhythmias. Circulation.2006;113:1730–1737.

19. Verkerk AO, Wilders R, Coronel R, Ravesloot JH, Verheijck EE. Ionicremodeling of sinoatrial node cells by heart failure. Circulation. 2003;108:760–766.

20. Zicha S, Fernández-Velasco M, Lonardo G, L’Heureux N, Nattel S. Sinusnode dysfunction and hyperpolarization-activated (HCN) channel subunitremodeling in a canine heart failure model. Cardiovasc Res. 2005;66:472–481.

21. Kirchhof CJ, Allessie MA. Sinus node automaticity during atrial fibril-lation in isolated rabbit hearts. Circulation. 1992;86:263–271.

22. Dobrzynski H, Boyett MR, Anderson RH. New insights into pacemakeractivity: promoting understanding of sick sinus syndrome. Circulation.2007;115:1921–1932.

23. Robinson RB, Brink PR, Cohen IS, Rosen MR. If and the biologicalpacemaker. Pharmacol Res. 2006;53:407–415.

24. Kwong KF, Schuessler RB, Green KG, Laing JG, Beyer EC, Boineau JP,Saffitz JE. Differential expression of gap junction proteins in the caninesinus node. Circ Res. 1998;82:604–612.

25. Wu J, Schuessler RB, Rodefeld MD, Saffitz JE, Boineau JP. Morpho-logical and membrane characteristics of spider and spindle cells isolatedfrom rabbit sinus node. Am J Physiol Heart Circ Physiol. 2001;280:H1232–H1240.

26. Yu H, Wu J, Potapova I, Wymore RT, Holmes B, Zuckerman J, Pan Z,Wang H, Shi W, Robinson RB, El Maghrabi MR, Benjamin W, Dixon J,McKinnon D, Cohen IS, Wymore R. MinK-related peptide 1: a betasubunit for the HCN ion channel subunit family enhances expression andspeeds activation. Circ Res. 2001;88:E84–E87.

27. Lakatta EG, Vinogradova TM, Maltsev VA. The missing link in themystery of normal automaticity of cardiac pacemaker cells. Ann N Y AcadSci. 2008;1123:41–57.

CLINICAL PERSPECTIVESinoatrial node dysfunction is frequently associated with atrial tachyarrhythmias, and patients with the combination are saidto suffer from the relatively common tachycardia-bradycardia syndrome. Abnormalities in sinus node pacemaker functionon termination of atrial tachyarrhythmias such as atrial fibrillation can cause syncope and require pacemaker implantation,but the underlying mechanisms remain poorly understood. There is evidence from clinical and experimental studies thatsuggests that a significant component of sinus node dysfunction in patients with the tachycardia-bradycardia syndrome mayactually be caused by supraventricular tachyarrhythmia and may be reversible if the tachyarrhythmia is controlled. Thepresent study examined the hypothesis that very rapid atrial tachyarrhythmias can cause ion channel downregulation in thesinus node, thereby causing abnormal sinus node function. Dogs subjected to atrial tachypacing at 400 bpm for 7 daysshowed prolonged sinus node recovery time, which indicates sinus node dysfunction. Ion channel subunit messenger RNAexpression was measured in sinus node tissue and showed downregulation by atrial tachycardia of 2 specific types ofsubunits: Those underlying the funny current, which is known to be particularly important in cardiac pacemaking activity,and an accessory subunit involved in the slow delayed-rectifier K� channel. Patch-clamp studies on sinus node cellsisolated from control dogs and dogs subjected to atrial tachypacing confirmed the specific downregulation of funny currentand slow delayed-rectifier K� current with atrial tachycardia. These alterations were incorporated in a mathematical modelof sinus node electrical activity, which suggested that the funny current changes were the principal factor in sinus nodesuppression by atrial tachycardia. Our results provide insights into the molecular mechanisms underlying clinicallysignificant bradycardic complications of this common and important clinical syndrome.


Funny Current Downregulation and Sinus Node Dysfunction Associated With Atrial Tachyarrhythmia: A...

Documents

Transcript of Funny Current Downregulation and Sinus Node Dysfunction Associated With Atrial Tachyarrhythmia: A...