lable at ScienceDirect

International Biodeterioration & Biodegradation 99 (2015) 157e164

Contents lists avai

International Biodeterioration & Biodegradation

journal homepage: www.elsevier .com/locate/ ibiod

Fungi on mummified human remains and in the indoor air in theKuffner family crypt in Sl�adkovi�covo (Slovakia)

Alexanda �Simonovi�cov�a a, Lucia Krakov�a b, Domenico Pangallo b, c, *, M�aria Majoro�sov�a d,Elena Pieckov�a d, Silvia Bodorikov�a e, Michaela D€ornhoferov�a e

a Department of Soil Science, Faculty of Natural Sciences Comenius University, Bratislava, Slovakiab Institute of Molecular Biology, Slovak Academy of Sciences, Bratislava, Slovakiac Caravella, Ltd., Bratislava, Slovakiad Medical Faculty, Slovak Medical University, Bratislava, Slovakiae Department of Anthropology, Faculty of Natural Sciences Comenius University, Bratislava, Slovakia

a r t i c l e i n f o

Article history:Received 7 September 2014Received in revised form22 December 2014Accepted 23 December 2014Available online

Keywords:Microscopic fungiHuman remainsIndoor airEnzymatic activitiesCrypt environment

* Corresponding author. Institute of Molecular Bioences, Bratislava, Slovakia. Tel.: þ421 2 59307439; fax

E-mail address: domenico.pangallo@savba.sk (D. P

http://dx.doi.org/10.1016/j.ibiod.2014.12.0110964-8305/© 2014 Elsevier Ltd. All rights reserved.

a b s t r a c t

Microscopic fungi were isolated from different materials including muscles, bones, skin and funeralclothes from the mummified human remains of three members of the Kuffner's family and from thesurrounding air environments. Their hydrolytic abilities such as cellulolytic, lipolytic, and proteolytic-keratinolytic were also assessed. The most isolated fungi, from human remains, belonged mainly tothe species of Aspergillus (Aspergillus candidus, Aspergillus calidoustus, Aspergillus fumigatus, Aspergillusniger, Aspergillus sydowii, Aspergillus terreus, Aspergillus ustus, Aspergillus venenatus, Aspergillus versicolor,Aspergillus westerdijkiae) and Penicillium (Penicillium chrysogenum, Penicillium commune, Penicilliumcrustosum, Penicillium griseofulvum, Penicillium hordei, Penicillium polonicum). Aspergilli and penicilliawere the predominant actors also in the air samples, but also many strains belonging to the Rhizopusgroup were isolated as well. Several fungi exhibited different hydrolytic ability, the most active isolatedfrom human remains belonged to the species A. candidus, A. westerdijkiae, Coprinellus xanthothrix, P.chrysogenum, P. commune, P. griseofulvum and Scopulariopsis brevicaulis. The species recovered from theair displayed stronger deterioration characteristics as compared to human samples. This study can beconsidered one of few investigations focused on mummified human remains conserved in this kind ofthe environment.

© 2014 Elsevier Ltd. All rights reserved.

Introduction

In the frame of cultural revitalization of the town Sl�adkovi�covodifferent important monuments (the sugar factory and themausoleum), established by the Kuffner dynasty, were chosen to bereconstructed and, hopefully, maintained in order to preserve thisvaluable cultural heritage. Our contribution was to recognize andinvestigate the human remains found inside the crypt of themausoleum (Fig. 1A). The remains were naturally mummified dueto favorable microclimate and air flow in the crypt. But theseparticular climatic conditions have not saved them against the ac-tion of vandals. The anthropological study (Bodorikov�a et al., 2011)

logy, Slovak Academy of Sci-: þ421 2 59307416.angallo).

demonstrates that the remains belonged to: Baron Karl Kuffner deDioszegh (23rd October 1847e12th December 1924), his wifecountess Maria Franziska von und zu Firmian (23rd March1856e28th June 1925) and their daughter-in-law Cara Carolina vonHaebler (20th August 1889 e 8th June 1932) (Fig. 2).

Recently, some attempts were made to investigate the micro-flora present in mummified remains (Palla et al., 2011; Pi~nar et al.,2013) and other crypt samples (Pangallo et al., 2013), similar tothose reported here, using culture-dependent and -independentapproaches, but few of them were focused on the biodegradativeproperties of isolated microbial communities. According to Hydeet al. (2013) human decomposition is a mosaic system with anintimate association between biotic and abiotic factors. There areonly few studies which documented microbiological analyses ofmummies or human remains. Mummies are studied mainly fromthe importance of understanding past bacterial diseases exploredincluding tuberculosis, leprosy, typhoid, endemic and epidemic

Fig. 1. Description of the mausoleum of Kuffner family in Sl�adkovi�covo. The mausoleum inside the park (A). The entrance of the mausoleum (B), with the spiral staircase down tothe crypt. The crypt environment (C).

A. �Simonovi�cov�a et al. / International Biodeterioration & Biodegradation 99 (2015) 157e164158

typhus and viral diseases (Fletcher et al., 2003; Zink et al., 2003;Drancourt and Raoult, 2005; Herskovitz et al., 2008; Anastasiouand Mitchell, 2013). The occurrence of microscopic fungi andtheir role in decomposition of soft tissues of human remains hasbeen studied only sporadically till now (�Cavka et al., 2010). Inaddition, the analysis of fungal community in these kinds of sam-ples could help to explain e. g. some forensic features, especially incriminal investigations (post-mortem interval, cause of death etc.),(Hitosugi et al., 2006; Hawksworth and Wiltshire, 2011).

In confined environment as a crypt it is important to assess thehealth risks that can be caused by airborne microflora. The fungalmicrobiota possesses a great enzymatic potential to degrade organicmaterials. When dealing with mouldy organic materials the airconcentration of viable fungal propagules can reach high level,including a broad spectrumof chemical fungal toxicants (G�orny et al.,2002). Fungal infections are mostly airborne, with significant sea-sonal variations while high numbers of spores can accumulate indust layers, and also fungal concentrations are associated with in-door source of contamination (Ponsoni and Radi, 2010; Sterflingerand Pi~nar, 2013). Especially the occupants and sensitive visitors aswell, may suffer from mucose and skin irritations, while even somesevere acute or chronic damage of their respiratory tract can develop,as well (G�orny, 2004). Therefore, the quality of indoor environmentboth for the historical and artistic objects conserved in it and for thepeople that could visit the crypt is of great significance.

The aim of this study was the identification and biodegradativecharacterization of the fungal microflora isolated from differentkinds of human remains and air surrounding samples inside theKuffner mausoleum and crypt. The biodegradative properties ofisolated mycobiota can give important information about the po-tential of the fungal actors in attacking, proliferating and degradingthese important historical items composed mainly by proteina-ceous substrates. The hydrolytic abilities of occurring mycoflora,during the monitoring of the exhibition places and before anappropriate conservation-restoration strategy, can be consideredvaluable data which complete the typical identification list of iso-lated strains.

Material and methods

Historical importance of Kuffner family

The Kuffner family contributed greatly to the development ofthe sugar industry in Austro-Hungarian Monarchy by establishing asugar factory in the town of Di�oszeg (today Sl�adkovi�covo, Slovakia)in the 19th century. The international influence of the Kuffner's hasbeen shown in the construction of a synagogue in B�reclav (CzechRepublic), and the Kuffner Observatory in Vienna (Austria). KarlKuffner was the author of many patents and he received numerousawards for his achievements, including the Royal Diploma awardedto him by Franz Josef I for his participation in the rescue works aftera flood in 1872. In 1896 he was promoted to the nobility and wasawarded the predicate de Dioszegh. Eight years later he wasawarded the title of Baron, which extended to his entire family(Pekarovi�c, 2009).

Sampling and cultivation

Several samples, for mycological analysis, were recovered fromdifferent materials including surface of muscles, bones, skin andfuneral clothes from the human remains (Fig. 2) using sterile cottonswabs and themethod of adhesive tape (SDL, Des Plaines, USA; Urzìand De Leo, 2001). Two media, Sabouraud Dextrose Agar (SAB) andPotato Dextrose Agar (PDA) (Himedia, Mumbai, India) were usedfor analyses. In addition, parts of textile material sniped in 1 �1 cmpieces were put on the surface of agar media described above.Cultivation of microscopic fungi in three replications from allsamples was carried out in the dark and at laboratory temperatureof 23e25 �C from about seven days up to 2 weeks. Fungi collectedfrom the mixed cultures were purified by several cultivation stepson SAB and PDA agars. Pure cultures were identified according tophenotype on their micromorphological features using diagnostickeys (Klich, 2002; Domsch et al., 2007) and according to their In-ternal Transcribed Spacer (ITS) sequences.

Fig. 2. Human remains of Kuffner family and fungal strains observed on adhesive tapes. Portrait of Baron Karl Kuffner (1A); human remains of Baron Karl Kuffner (1B and 1C) withsampling points (1ae1d); non-specified Penicillium from the sample 1d (1D). Portrait of Cara Carolina von Haebler (2A); human remains of Cara Carolina von Haebler (2B and 2C)with sampling points (2ae2b, 3ae3d); Rhizopus stolonifer var. stolonifer from the sample 2a (2D). Portrait of Maria Francziska (Kuffner's wife) (3A); human remains of MariaFrancziska (3B) with sampling points (4ae4b); non-specified fungus from the sample 4b (3C).

A. �Simonovi�cov�a et al. / International Biodeterioration & Biodegradation 99 (2015) 157e164 159

Portions of adhesive tape from different samples were observedby Stereomicroscope (Leica DMD 108; Solms, Germany) in order todirectly visualize the occurrence of fungal microflora.

The indoor air samples were collected near the entrance of themausoleum and downstairs inside the crypt [indoor temperature 6and 11 �C, relative humidity 82 and 89% respectively;measured by aportable weather station (K€onig KN-WS600, MC's-Hertogenbosch,The Netherlands)] next to the coffins (Fig. 1B and C) using a volu-metric air sampler (Aeroscope A-AIR 010; Agea, Ltd., Prague, CzechRepublic). The sampling was performed three times consecutively.The moulds were isolated onto dichloran agar with 18% glyceroland SAB (Himedia) incubated at 25 �C for 7 days. The cultivatedfungi were identified according to their macro- and micromor-phological characteristics (CCD camera uEye; Promicra, Ltd.,

Prague, CR; 400�). To achieve penicillia identification up to thespecies level, their pure cultures were incubated at 5, 25 and 37 �Cfor 7 days onto Czapek agar with yeast extract and at 25 �C ontomalt extract agar simultaneously as well (Pitt, 1979; Samson, 2004;Crous et al., 2010). The ITS sequencing was also performed.

DNA identification

The fungal isolates were inoculated in Sabouraud broth at roomtemperature until growth was observed. They were then separatedfrom the broth by filtration through sterile filter paper, after whichthe DNA was extracted using the DNeasy Blood and Tissue Kit(Qiagen, Hilden, Germany), according to the enclosed protocol foranimal and vegetable tissue.

A. �Simonovi�cov�a et al. / International Biodeterioration & Biodegradation 99 (2015) 157e164160

The internal transcribed spacer (ITS), of fungal isolates, wasamplified using the primers ITS1 (TCCGTAGGTGAACCTGCGG) andITS4 (TCCTCCGCTTATTGATATGC) from White et al. (1990). The PCRreaction mix included 20 pmol of each primer, 200 mmol l�1 dNTP,1.5 U HotStarTaq plus DNA polymerase (Qiagen), 1 � PCR buffer,2 mM Mg2þ and 3 ml of template DNA in a total reaction volume of25 ml. The temperature program consisted of an initial denaturationat 95 �C for 5 min, 35 cycles (95 �C for 45 s, 55 �C for 45 s, 72 �C for1 min) and a final polymerization at 72 �C for 8 min.

The resulting PCR products were purified using ExoSAP-IT(Affymetrix, Cleveland, USA) and both strands were sequenced bya commercial facility (GATC-Biotech, Konstanz, Germany). Theresulting sequences were directly compared with those in GenBankusing BLAST searches (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Thesequences obtained were deposited in GenBank under the acces-sion numbers KM063192-KM063249.

Hydrolytic agar assays

Different hydrolytic tests to assess the cellulolytic (Congo redagar), proteolytic (Gelatin agar), esterase (Tributyrin agar) andlipolytic (Spirit Blue Agar) activities were applied to all fungal iso-lates. Congo-Red agar composed of KH2PO4 0.5 g, MgSO4 0.25 g,cellulose 2 g, Congo-Red 0.2 g, gelatin 2 g, and agar 15 g; distilledwater 1 l and at pH 6.8e7.2.

Gelatin agar plates were prepared mixing autoclaved R2A Agar(Himedia) with 0.4% of sterilized gelatin (SigmaeAldrich, St. Louis,USA). After the growth of microorganisms, in order to have a bettervisualization of the hydrolysis zone, a 10% tannin solution wasflooded on the agar plates (Krakov�a et al., 2012a).

Tributyrin agar was prepared by adding 5 g of peptone, 3 g ofyeast extract, 10 ml of tributyrin and 20 g of agar to 1 l of distilledwater, pH 7.0; the medium was sterilized by autoclaving. Lipolyticmicroorganisms make clear zones around their colonies due to thehydrolysis of tributyrin.

Spirit Blue agar was prepared by suspending 32.15 g of SpiritBlue agar (Himedia) in 1000 ml distilled water, autoclaved, cooleddown to 50 �C and supplemented with 30 ml of lipase substrate(1 ml of Tween 80, 400 ml of warm distilled water and 100 ml ofolive oil; sterilized by autoclaving), slow mixing and pour on Petridishes.

Each assay was performed in triplicate using 60 mm platesincubated at room temperature (22e26 �C) generally from 3 up to 7days.

Results and discussion

The presence of microfilamentous fungi was readily evidencedby the simple microscopic observation of the adhesive tapescollected from different samples (Fig. 2e1D, 2D, 3C).

Fungal strains isolated from different materials, includingfuneral clothes, skin, muscles and bones were systematicallyassigned to the phyla Ascomycota, Zygomycota and Basidiomycota.From textile samples (1c and 3d, Table 1, Fig. 2) strains belonging tothe species Rhizopus stolonifer var. stolonifer, Aspergillus niger,Aspergillus fumigatus, Penicillium polonicum, Penicillium chrys-ogenum and Coprinellus xanthothrix (the only Basidiomycota spe-cies detected in this study) were recovered. The fungal speciesidentified in this study appeared more similar to those obtained bythe culture-dependent analysis of textile materials discovered in acrypt environment in Bratislava (Pangallo et al., 2013), than thosedescribed by Pi~nar et al. (2013), through cloning, from themummies’ clothes present in Capuchin Catacombs of Palermo, Italy.Perhaps, the different analysis approaches (culture-independentagainst our culture-dependent strategy) and also the climatic

conditions, considering mainly the diverse outdoor environments(Palermo with a warm Mediterranean weather, while Slovakiacharacterized by a relatively continental climate with almost noextremes belowminimal �20 �C or above maximal 37 �C), can playa crucial role for the growth and detection of some species thanothers. Textile materials present a range of different substratessuitable for microbial growth. Natural cellulose and cellulosic ma-terials such as cotton, hemp, silk, jute and other plant fibers mayserve as a nutrient source for fungi. Among fungi involved in thedegradation of cellulose, the most active belong to the fungalgenera of Aspergillus, Penicillium, Trichoderma, Alternaria andChaetomium (Krakov�a et al., 2012b), but others also to basidiomy-cetous (Machado et al., 2006) and white rot fungi (Hastrup et al.,2012). Keratin as the main constituent of wool is degraded to ahigher degree by fungi belonging to the genera Rhizopus, Aspergillusand Penicillium (Szostak-Kotowa, 2004; Noorpreet et al., 2013). Thehydrolytic assays of the strains isolated from textile materials dis-played almost the absence of proteoekeratinolytic activity (onlytwo Penicillium isolates have positive reaction on gelatin agar), buta significant spread of cellulolytic and lipolytic properties; only thestrains A. fumigatus and P. chrysogenum were observed to have arelevant cellulolytic activity (Table 2).

The skin is another significant source of substances, such asproteins, lipids, carbohydrates, mineral constituents and impuritieswhich can be easily metabolized by fungi. From three skin samples(1d, 3a and 3b in Table 1) different fungal species encompassingAspergillus candidus, Aspergillus venenatus, Aspergillus ustus, Peni-cillium commune, Penicillium crustosum, Neosartotya fischeri, Sco-pulariopsis hibernica and Cladosporium sp. were identified. A. ustusand A. venenatus are considered two rare isolated species. In fact,according to Klich (2002) A. ustus is present at low frequencies inmany soils, predominantly from tropical to warm temperate areas.The species A. venenatus was up to now isolated only from toxicdairy feed in Tennessee in 1984 and from corn in Missouri, USA in1989 (Jurjevic et al., 2012). These two species of Aspergilluswere notparticularly active, both demonstrated to prefer lipid materials andonly A. venenatus was positive to cellulolytic assay (Table 2). Fromskin samples only the species P. commune, P. crustosum and A.candidus exhibited rapid positive reactions on Spirit Blue andGelatin agar.

The muscle surfaces comprised the largest group of samples 1a,1b, 2b, 3c and 4b (Table 1; Fig. 2). Different species, such as Copri-nellus xanthothrix, Eurotium repens, A. venenatus, Aspergillus versi-color, Aspergillus calidoustus, Aspergillus sydowii, Penicillium hordei,Penicillium griseofulvum, P. chrysogenum, P. polonicum and Scopu-lariopsis brevicaulis, were isolated from these samples. The strain A.venenatuswas the most predominant species recovered from threemuscle samples. The isolates E. repens, P. hordei and P. griseofulvumwere specific from the muscle samples of Baron Kuffner (samples1a and 1b). The species Scopulariopsis brevicaulis and A. sydowiiwere only isolated from the internal part of the thorax with rem-nants of muscles (sample 3c). Scopulariopsis brevicaulis has aworldwide distribution and has been found on a wide range oforganic substrates (Abbott et al., 1998; Gorbushina et al., 2004;Nov�akov�a et al., 2012); similar characteristics were reported alsofor the species A. sydowii (Sterflinger, 2010). The aspergilli isolatedfrom muscle surfaces were not able to hydrolyze the gelatin; thebest results were shown by two strains of A. calidoustus whichquickly and broadly metabolized the lipids on Spirit Blue medium.On the other hand, several other strains such as Coprinellus xan-thothrix, Scopulariopsis brevicaulis, P. griseofulvum, P. hordei andP. polonicum produced positive and extensive reactions on gelatinagar.

The richest mycobiota diversity was revealed in the bone(sample 2a), where seven different fungal species were isolated: A.

Table 1DNA identification of fungal strains isolated from human remains, funeral clothes and air samples.

Identification on the basis of highest ITS similarityscore Query Coverage %/Max Identity %

Order Number of strains isolated from different samples

1ABaron Karl Kuffner 2ACara Carolina von Haebler 3AMaria Franziska(Kuffner's wife)

Air

1a 1b 1c 1d 2a 2b 3a 3b 3c 3d 4a 4b

HQ115723 Coprinellus xanthothrix 100%/96%;HF543673 100%/98%

Agaricales þ � � � � � � � � þ � � �

JX423531 Eurotium repens 99%/100% Eurotiales þ � � � � � � � � � � � �JQ301896 Aspergillus venenatus 100%/100% Eurotiales þ þ � þ þ � � � � � � þ �AJ004817 Penicillium hordei 99%/99% Eurotiales � þ � � � � � � � � � � �HQ262520 Penicillium griseofulvum 100%/100% Eurotiales � þ � � � � � � � � � � �JN315028 Rhizopus stolonifer 100%/100%;

AF543526 100%/99%Mucorales � � þ � � � � � � þ � � �

KF267254 Aspergillus fumigatus 99%/100% Eurotiales � � þ � � � � � � � � � �KJ589583 Penicillium polonicum 100%/100% Eurotiales � � þ � � � � � � � � þ �KJ589568, KJ173538, JX996998, KF999008

Penicillium chrysogenum 100%/100%;JQ228243, KJ413371 100%/99%

Eurotiales � � þ � þ þ � � þ � � � þb

JQ724416 Aspergillus candidus 100%/100% Eurotiales � � � þ þ � � � � � � � �KJ027992 Penicillium commune 100%/99% Eurotiales � � � þ � � � � � � � � �JQ780629 Cladosporium sp. 100%/100% Capnodiales � � � þ � � � � � � � � �HQ594530 Aspergillus ustus 100%/99% Eurotiales � � � þ � � � � � � � � �KF986529 Aspergillus westerdijkiae 100%/100%;

FM986326 100%/99%Eurotiales � � � � þ � � � � � � � þa

JX045844 Talaromyces flavus 100%/99% Eurotiales � � � � þ � � � � � � � �KJ527011 Aspergillus versicolor 100%/99%;

KJ152174 99%/100%Eurotiales � � � � þ þ � � � � þ � þb

KF619563 Aspergillus terreus 100%/100% Eurotiales � � � � þ � � � � � � � �HG931699 Aspergillus calidoustus 100%/99% Eurotiales � � � � � þ � � � � � þEF669936 Neosartorya fischeri 100%/100% Eurotiales � � � � � � þ � � � � � �EU128606 Penicillium crustosum 100%/100% Eurotiales � � � � � � þ � � � � � �HQ649994 Microascales sp. 100%/100%;

FJ946484 Scopulariopsis hibernica 100%/99%cMicroascales � � � � � � � þ � � � � �

JN942890 Scopulariopsis brevicaulis 100%/99% Microascales � � � � � � � � þ � � � �KJ173528 Aspergillus sydowii 98%/98% Eurotiales � � � � � � � � þ � � � �KF028368, KF986548 Aspergillus niger 100%/100% Eurotiales � � � � � � � � � þ � � þb

KJ417578 Rhizopus microsporus var. oligosporus100%/100%; DQ641312 99%/98%

Mucorales � � � � � � � � � � � � þb

KF717370 Rhizopus oryzae 100%/100% Mucorales � � � � � � � � � � � � þb

KC253948 Aspergillus caespitosus 100%/100% Eurotiales � � � � � � � � � � � � þa

HQ850929 Penicillium digitatum 100%/99% Eurotiales � � � � � � � � � � � � þa

KC576705 Trichoderma harzianum 100%/100% Hypocreales � � � � � � � � � � � � þb

HM999906 Nigrospora oryzae 100%/100% Trichosphaeriales � � � � � � � � � � � � þa

KC466532 Eurotium amstelodami 100%/99% Eurotiales � � � � � � � � � � � � þa

KF367488 Eurotium sp. 100%/100% Eurotiales � � � � � � � � � � � � þa

1A) e Samples from Baron Karl Kuffner de Dioszegh: 1a ¼ muscle below the knee (the proximal anterior part of tibia); 1b ¼ muscle in the anterior part of the thigh;1c ¼ funeral clothes; 1d ¼ skin from the gluteal region.2A)e Samples from Cara Carolina von Haebler, Karl Kuffner's daughter-in-law: 2a¼ bone, between fingers of the left hand; 2b¼muscle below the knee (the proximal anteriorpart of tibia); 3a ¼ a skin on the back between the scapulae; 3b ¼ a skin on the back in the sacral region; 3c ¼ muscle, internal part of thorax; 3d ¼ funeral clothes.3A) e Samples from Maria Franziska von und zu Firmian, Karl Kuffner's wife: 4a ¼ bone, between toes of the left leg; 4b ¼ muscles of the left calf.

a Air sample from the mausoleum entrance.b Air sample inside the crypt.c The BLAST search was also performed excluding the Uncultured/environmental sample sequences.

A. �Simonovi�cov�a et al. / International Biodeterioration & Biodegradation 99 (2015) 157e164 161

candidus, A. venenatus, Aspergillus terreus, A. versicolor, Aspergilluswesterdijkiae, P. chrysogenum and Talaromyces flavus. From theother bone sample only isolates of the species A. versicolor wereidentified. The most active fungal strains belong to the genusAspergillus; the species A. candidus and A. westerdijkiae were veryeffective in hydrolyzing gelatin (Table 2).

It is evident why aspergilli and penicillia are the predominantfungi isolated from human remains. These fungi are generallyxerophilic, therefore they can adapt well to the conditions offeredby a mummified body characterized by a low availability of water.Aspergillus spp. and Penicillium spp. have been detected fromsimilar samples (Ishii et al., 2006; Elnaggar et al., 2010; Pi~nar et al.,2013) and they were also the main fungi isolated in the bloated,putrefaction and skeletonization stages during degradation of hu-man bodies (Sidrim et al., 2010). In addition, members of the generaPenicillium and Aspergillus are able to produce osteolytic

metabolites dissolving organic and inorganic constituents of bonetissue (Thurzo and Be�nu�s, 2005).

The indoor air of the Kuffner mausoleum yielded differentspectra of viable microfungi; in fact from the entrance of themausoleum, on the upstairs floor, these strains were recovered: A.westerdijkiae, Aspergillus caespitosus, Penicillium digitatum, Nigro-spora oryzae, Eurotium amstelodami and Eurotium sp. While insidethe crypt, subterranean floor, the following strains were isolated: P.chrysogenum, A. versicolor, A. niger, Rhizopus microsporus var. oli-gosporus, Rhizopus oryzae and Trichoderma harzianum. Thus, thediverse airborne fungal communities present in the two areas ofthe mausoleum, and a certain degree of similarity between thefungal community from human remains, and that one from the airin the crypt is obvious (Table 1). The unique link betweenmummiesand entrance airbornemicroflora is represented by the isolates of A.westerdijkiae. These connections make it tempting to hypothesize

Table 2Hydrolytic characteristics of the fungal strains isolated from human remains, funeral clothes and air samples.

Sample of isolation Strain Congo Reda Tributyrinb Spirit Bluec Gelatind

Air origin e entrance K Air-29 Aspergillus caespitosus þþ þ þþ þþHuman remains: 1d (skin), 2a (bone) K 1-10; K 1-11; K 2-9 Aspergillus candidus þ þ þþ þþþHuman remains: 2b (muscle) K 2-12 Aspergillus calidoustus � þ þþ �Human remains: 4b (muscle) K 5-1 Aspergillus calidoustus þ þ þþþ �Textile remains: 1c K 1-7B Aspergillus fumigatus þþ þ þ �Textile remains: 3d K 3-13 Aspergillus niger þ þ þ �Air origin e crypt K Air-12; K Air-14 Aspergillus niger � � þ þHuman remains: 3c (muscle) K 3-8 Aspergillus sydowii þ þ þ �Human remains: 2a (bone) K 2-6 Aspergillus terreus þ þ þ �Human remains: 1d (skin) K 1-15 Aspergillus ustus � þ þ �Human remains: 1a, 1b, 4b (muscle);

2a (bone); 1d (skin)K 1-3; K 1-4; K 1-13; K 2-4; K 2-5; K 2-10; K 5-2;K 5-3 Aspergillus venenatus

þ þ þþ �

Human remains: 2a, 4a (bone); 2b (muscle) K 2-3; K 2-13; K 4-1 Aspergillus versicolor þ þ þ �Air origin e crypt K Air-7 Aspergillus versicolor þ � þþ þþHuman remains: 2a (bone) K 2-1 Aspergillus westerdijkiae þ þ þ þþþAir origin e entrance K Air-34; K Air-38 Aspergillus westerdijkiae þþ þ þþ þþþHuman remains: 1d (skin) K 1-14 Cladosporium sp. þ þ þ �Human remains: 1a (muscle) K 1-1 Coprinellus xanthothrix þ þ þþ þþþTextile remains: 3d K 3-9; þ � þ �

K 3-10; � þ þ �K 3-11 Coprinellus xanthothrix þ þ þ �

Air origin e entrance K Air-59 Eurotium amstelodami � � þ �Human remains: 1a (muscle) K 1-2 Eurotium repens � þ þ �Human remains: 3b (skin) K 3-3 Scopulariopsis hibernica þ þ þ �Human remains: 3a (skin) K 3-1 Neosartorya fischeri þ þ þ �Air origin e entrance K Air-55 Nigrospora oryzae þ þ þ þþþTextile remains: 1c.Human remains: 2a (bone), 3c (muscle)

K 1-9; K 2-11; K 3-6 Penicillium chrysogenum þþþ þ þ þþ

Human remains: 2a (bone) K 2-7; K 2-8 Penicillium chrysogenum þ þ þ �Human remains: 2b, 3c (muscle) K 2-14; K 3-7 Penicillium chrysogenum � þ þ þAir origin e crypt K Air-10; K Air-17 Penicillium chrysogenum þþ � þþþ þþþHuman remains: 1d (skin) K 1-12 Penicillium commune þ þ þþ þþHuman remains: 3a (skin) K 3-2 Penicillium crustosum � þ þþ þþþAir origin e entrance K Air-40; K Air-41 Penicillium digitatum þþ � þþ þþHuman remains: 1b (muscle) K 1-6 Penicillium griseofulvum þ þ þ þþþHuman remains: 1b (muscle) K 1-5 Penicillium hordei � þ þ þþTextile remains: 1c.Human remains: 4b (muscle)

K 1-8; K 5-5 Penicillium polonicum � þ þ þ

Human remains: 4b (bone) K 5-4 Penicillium polonicum � þ þ �Air origin e crypt K Air-1; K Air-2 Rhizopus microsporus var. oligosporus þ þ þþþ �Air origin e crypt K Air-6 Rhizopus microsporus var. oligosporus þ þþ þþþ þþþAir origin e crypt K Air-8 Rhizopus microsporus var. oligosporus � � þþ þAir origin e crypt K Air-26 Rhizopus oryzae þ þ þþþ �Air origin e crypt K Air-24; K Air-28 Rhizopus oryzae � þ þþþ �Textile remains: 1c; 3d K 1-7A; K 3-12 Rhizopus stolonifer � þ þ �Human remains: 3c (muscle) K 3-4; K 3-5 Scopulariopsis brevicaulis þ þ þ þþHuman remains: 2a (bone) K 2-2 Talaromyces flavus � � þ �Air origin e crypt K Air-15; K Air-19 Trichoderma harzianum þþ � þþþ þþþ

1A) e Samples from Baron Karl Kuffner de Dioszegh: 1a ¼ muscle below the knee (the proximal anterior part of tibia); 1b ¼ muscle in the anterior part of the thigh;1c) ¼ funeral clothes; 1d ¼ skin from the gluteal region.2A) Samples from Cara Carolina von Haebler, Karl Kuffner's daughter-in-law: 2a ¼ bone, between fingers of the left hand; 2b ¼muscle below the knee (the proximal anteriorpart of tibia); 3a ¼ a skin on the back between the scapulae; 3b ¼ a skin on the back in the sacral region; 3c ¼ muscle, internal part of thorax; 3d ¼ funeral clothes.3A) Samples from Maria Franziska von und zu Firmian, Karl Kuffner's wife: 4a ¼ bone, between toes of the left leg; 4b ¼ muscles of the left calf.þþþ, quick and extensive positive reaction; þþ, good positive reaction; þ, weak positive reaction; �, negative reaction.

a Congo Red Agar e cellulolytic activity.b Tributyrin Agar e esterase activity.c Spirit Blue Agar e lipolytic activity.d Gelatin Agar e proteolytic activity.

A. �Simonovi�cov�a et al. / International Biodeterioration & Biodegradation 99 (2015) 157e164162

that the fungal community settled the human remains by a series ofevents and colonization steps over time; although the fungalanalysis of air was carried out only once during the samplingcampaign. Body remains in the Kuffner mausoleum weremummified naturally (drying out) due to free outdoor airflow.Thus, the indoor aeromycobiota, very probably originated from therelevant outdoor sources, but in some cases mummies may serve asa reservoir of other fungi being dispersed to the air as well, or re-settled back onto other indoor surfaces.

The quantitative mycological analysis of the indoor air showedquite different average values of fungal propagules in the twoanalyzed area; in the entrance we recorded 261 colony forming

units (CFU)/m3; instead next to the coffins, inside the crypt, theaverage value was 960 CFU/m3. Unfortunately, in literature thepapers treating these kinds of samples in such an environment arerare; our findings are similar to those described by Pi~nar et al.(2013) inside the catacombs in Palermo, where the fungal con-centration displayed high values in the vicinity of the mummiesrespect to the area near the entrance/exit, where the mummieswere not exposed.

Representatives of the airborne mycobiota were tested for theirdegradation enzymatic ability as well. They showed the strongestpotential in some degrees of lipolytic activity, especially high pro-duction of lipases (Spirit Blue), as well as proteolytic one. The

A. �Simonovi�cov�a et al. / International Biodeterioration & Biodegradation 99 (2015) 157e164 163

cellulolytic capabilities were slightly less expressed. The mostrobust hydrolytic airborne isolates belonged to the Aspergillus,Penicillium and Rhizopus genera, although also T. harzianum andNigrospora oryzae expressed interesting degradation abilities(Table 2).

Conclusions

The investigation reported here, on one hand, confirmed somefindings of the few previous works focused on mummies and hu-man remains discovered in crypts (Pangallo et al., 2013) orconserved in musea (Arya et al., 2001; �Cavka et al., 2010) which insome case present particular conditions (Pi~nar et al., 2013). On theother hand, new knowledge was produced regarding the fungalcontaminations of naturally mummified human remains; greatspecies diversity within the order Eurotiales was detected andsome members such as A. venenatus, A. versicolor and P. chrys-ogenumwere isolated both in different human and air samples. Themembers of Rhizopus genus were frequently isolated from the air inthe crypt. Another important feature of our investigation, previ-ously and partially attempted only by Arya et al. (2001), was thedegradation abilities of all isolated fungal strains which evidencedthe major hydrolytic potentiality of airborne isolates respect tomummy's fungal strains.

Therefore, our survey points the attention not only to the mi-crobial damage of the objects conserved in an indoor place, but alsoto monitor the “health” conditions of surrounding air environment.In fact, the most dangerous biodegradative agents were repre-sented by the airborne microflora.

Moreover, this study showed the importance to combine thetraditional media, used until now for the isolation of fungal strains,with the various biodegradation agar assays which can display thehydrolytic properties of isolated microorganisms. Such kind ofstrategy can be used directly during the first isolation step in orderto isolate a largest number of microorganisms and rapidly recog-nize their biodegradative abilities. Different specific hydrolytic agarassays, depending on thematerials composition of cultural heritageitems, can be employed to screen both the objects and the indoorenvironments in museums, galleries or in other kinds of exhibitionplaces, for the presence of biodeteriogen agents. These simple andlow-cost agarized media can be used by many groups and indifferent institutions working in the field of cultural heritagepreservation. The appearing of the hydrolytic zone on plates per-mits the quick recognition of the most dangerous microbescontaminating the objects and the close environment.

Obviously each technique can be improved and also substitutedwith other powerful tools as for example the use of PCR-basedmethods oriented to functional genes and the amplification of theRNA instead of DNA. Some attempt was already done by ourresearch group by the development of a PCR assay able to amplifythe cellobiohydrolase gene (Krakov�a et al., 2012b) which encodesone of the enzymes responsible for the cellulose degradation.

An important aspect for the future preservation strategiesapplied to cultural heritage is to reveal the properties of themicroflora colonizing an object and the surrounding environmentand not only to describe the list of identifying microorganisms.Such kind of approach consents a deeper view of the problematicand consequently precise and effective conservation methodsagainst the most critical art and historical “pathogens”.

Acknowledgment

This work was mainly financed by VEGA Agency, project num-ber: 1/0442/13; “Reconstruction the way of life of historical pop-ulations from the territory of Slovakia”.

References

Abbott, S.P., Sigler, L., Currah, R.S., 1998. Microascus brevicaulis sp. nov., the tele-omorph of Scopulariopsis brevicaulis, supports placement of Scopulariopsis withthe Microascaceae. Mycologia 90, 297e302.

Anastasiou, E., Mitchell, P.D., 2013. Paleopathology and genes: investigating thegenetics of infectious disease in excavated human skeletal remains andmummies from past populations. Gene 528, 33e40.

Arya, A., Shah, A.R., Sadasivan, S., 2001. Indoor aeromycoflora of Baroda museumand deterioration of Egyptian mummy. Curr. Sci. 81, 793e799.

Bodorikov�a, S., Panenkov�a, P., Be�nu�s, R., D€ornh€oferov�a, M., Masnicov�a, S.,Zatkalíkov�a, L., Bazovský, R., Turansk�a, M., Mazura, I., Zachov�a, M., Pexa, T., 2011.Identification of the mummified remains of the Kuffner's family members. FoliaSoc. Med. Leg. Slovacae 1, 48e52.

Crous, P.W., Verkley, G.J.M., Groenewald, J.Z., Samson, R.A., 2010. Fungal Biodiver-sity. Centraal Bureau voor Schimmelcultures (CBS), Utrecht.

�Cavka, M., Glasnovi�c, A., Jankovi�c, I., �Sikanji�c, P.R., Peri�c, B., Brklja�ci�c, B., Mlinari�c-Missoni, E., �Skrlin, J., 2010. Microbiological analysis of a mummy from thearcheological museum in Zagreb. Coll. Antropol. 34, 803e805.

Domsch, K.H., Gams, W., Anderson, T., 2007. Compendium of Soil Fungi, second ed.IHW-Verlag, Eching.

Drancourt, M., Raoult, D., 2005. Palaeomicrobiology: current issues and perspec-tives. Nat. Rev. Microbiol. 3, 23e35.

Elnaggar, A., Sahab, A., Ismail, S., Mahgoub, G., Abdelhady, M., 2010. Microbial study ofEgyptian mummies. An assessment of enzyme activity, fungicides and somemummification materials for the inhibition of microbial deterioration. E-conser-vation Mag. 16, 39e49. http://www.e-conservationline.com/content/view/931.

Fletcher, H.A., Donoghue, H.D., Tylor, G.M., van der Zander, A.G.M., Spigelman, M.,2003. Molecular analysis of Mycobacterium tuberculosis DNA from a family of18th century Hungarian. Microbiology 149, 143e151.

Gorbushina, A.A., Heyrman, J., Dornieden, T., Gonzales-Delvalle, M., Krumbein, W.E.,Laiz, L., Petersen, K., Saiz-Jimenez, C., Swings, J., 2004. Bacterial and fungal di-versity and biodeterioration problems in mural painting environments of St.Martins church (Greene e Kreiensen, Germany). Int. Biodeterior. Biodegrad. 53,13e24.

G�orny, R.L., Reponen, T., Willeke, K., Schmechel, D., Robine, E., Boissier, M.,Grinshpun, S.A., 2002. Fungal fragments as indoor air biocontaminants. Appl.Environ. Microbiol. 68, 3522e3531.

G�orny, R.L., 2004. Filamentous microorganisms and their aggregates in indoor air.Ann. Agric. Environ. Med. 11, 185e197.

Hastrup, A.C.S., Howell, C., Larsen, F.H., Sathitsuksanoh, N., Goodell, B., Jellison, J.,2012. Differences in crystalline cellulose modification due to degradation bybrown and white rot fungi. Fungal Biol. 116, 1052e1063.

Hawksworth, D.L., Wiltshire, P.E.J., 2011. Forensic mycology: the use of fungi incriminal investigations. Forensic Sci. Int. 206, 1e11.

Hershkovitz, I., Donoghue, H.D., Minnikin, D.E., Besra, G.S., Lee, O.Y.-C., Gernaey, A.M.,Galili, E., Eshed, V., Greenblatt, Ch.L., Lemma, E., Bar-Gal, G.K., Spigelman, M.,2008. Detection and molecular characterization of 9000-Year-Old Mycobacteriumtuberculosis from a Neolithic settlement in the Eastern Mediterranean. Plos One 3,e3426. http://dx.doi.org/10.1371/journal.pone.0003426.

Hitosugi, M., Ishii, K., Yaguchi, T., Chigusa, Y., Kurosu, A., Kido, M., Nagai, T.,Tokudome, S., 2006. Fungi can be a useful forensic tool. Leg. Med. 8, 240e242.

Hyde, E.R., Haarmann, D.P., Lynne, A.M., Bucheli, S.R., Petrosino, J.F., 2013. The livingdead: bacterial community structure of a cadaver at the onset and end of thebloat stage of decomposition. Plos One 8, e77733. http://dx.doi.org/10.1371/journal.pone.0077733.

Ishii, K., Hitosugi, M., Kido, M., Yaguchi, T., Nishimura, K., Hosoya, T., Tokudome, S.,2006. Analysis of fungi detected in human cadavers. Leg. Med. 8, 188e190.

Jurjevic, Z., Peterson, S.W., Horn, B.W., 2012. Aspergillus section Versicolores: nine newspecies and multilocus DNA sequence based phylogeny. IMA Fungus 3, 59e79.

Klich, M.A., 2002. Biogeography of Aspergillus species in soil and litter. Mycologia94, 21e27.

Krakov�a, L., Chovanov�a, K., Selim, S., �Simonovi�cov�a, A., Pu�skarov�a, A., Makov�a, A.,Pangallo, D., 2012a. A multiphasic approach for investigation of the microbialdiversity and its biodegradative abilities in historical paper and parchmentdocuments. Int. Biodeterior. Biodegrad. 70, 117e125.

Krakov�a, L., Chovanov�a, K., Pu�skarov�a, A., Bu�ckov�a, M., Pangallo, D., 2012b. A novelPCR-based approach for the detection and classification of potential cellulolyticfungal strains isolated from museum items and surrounding indoor environ-ment. Lett. Appl. Microbiol. 54, 433e440.

Machado, K.M.G., Compart, L.C.A., Morais, R.O., Rosa, L.H., Santos, M.H., 2006.Biodegradation of reactive textile dyes by basidiomycetous fungi from Brazilianecosystems. Braz. J. Microbiol. 37, 481e485.

Noorpreet, I.K.D., Bharti, M., Ashish, C., Saurabh, G., 2013. Biodegradation of textiledyes using fungal isolates. J. Environ. Sci. Technol. 6, 99e105.

Nov�akov�a, A., �Simonovi�cov�a, A., Kub�atov�a, A., 2012. List of cultivable microfungirecorded from soils, soil related substrates and underground environment ofthe Czech and Slovak Republics. Mycotaxon 119, 186.

Palla, F., Sineo, L., Manachini, B., 2011. Bacteria, fungi and arthropod pests collectedon modern human mummies. J. Entomol. Acarol. Res. 43, 69e76.

Pangallo, D., Krakov�a, L., Chovanov�a, K., Bu�ckov�a, M., Pu�sk�arov�a, A.,�Simonovi�cov�a, A., 2013. Disclosing a crypt: microbial diversity and degradationactivity of the microflora isolated from funeral clothes of Cardinal PeterP�azm�any. Microbiol. Res. 168, 289e299.

A. �Simonovi�cov�a et al. / International Biodeterioration & Biodegradation 99 (2015) 157e164164

Pekarovi�c, J., 2009. Kuffner castle and the mausoleum. In: Sudov�a, E. (Ed.), BaronKarl Kuffner de Dioszegh and the Di�oszeg sugar mill. Sl�adkovi�covo: The City ofSl�adkovi�covo: krovar. Sl�adkovi�covo: The city of Sl�adkovi�covo, pp. 67e82 (inslovak).

Pi~nar, G., Piombino-Mascali, D., Maixner, F., Zink, A., Sterflinger, K., 2013. Microbialsurvey of the mummies from the Capuchin Catacombs of Palermo, Italy:biodeterioration risk and contamination of the indoor air. FEMS Microbiol. Ecol.86, 341e356.

Pitt, J.I., 1979. The Genus Penicillium and its Teleomorphic States Eupenicillium andTalaromyces. Academic Press, London, 634 pp.

Ponsoni, K., Radi, M.S.G., 2010. Indoor air quality related to occupancy at an air-conditioned public building. Braz. Arch. Biol. Technol. 53, 99e103.

Samson, R.A., Frisvad, J.C., 2004. Penicillium Subgenus Penicillium: New TaxonomicShemes, Mycotoxins and the Other Extrolites. Centraalbureau voor Schimmel-cultures, Utrecht, 260 pp.

Sidrim, J.J.C., Moreira Filho, R.E., Cordeiro, R.A., Rocha, M.F.G., Caetano, E.P.,Monteiro, A.J., Brilhante, R.S.N., 2010. Fungal microbiota dynamics as a post-mortem investigation tool: focus on Aspergillus, Penicillium and Candida species.J. Appl. Microbiol. 108, 1751e1756.

Sterflinger, K., 2010. Fungi: their role in deterioration of cultural heritage. FungalBiol. Rev. 24, 47e55.

Sterflinger, K., Pi~nar, G., 2013. Microbial deterioration of cultural heritage and worksof art e tilting at windmills? Appl. Microbiol. Biotechnol. 97, 9637e9646.

Szostak-Kotowa, J., 2004. Biodeterioration of textiles. Int. Biodeterior. Biodegrad. 53,165e170.

Thurzo, M., Be�nu�s, R., 2005. The Basics of Taphonomy Hominids and Other Verte-brates (in Slovak), first ed. Polygrafick�e stredisko UK, Bratislava. 116 pp.

Urzì, C., De Leo, F., 2001. Sampling with adhesive tape strips: an easy and rapidmethod to monitor microbial colonization on monument surfaces. J. Microbiol.Methods 44, 1e11.

White, T.J., Bruns, T., Lee, S., Taylor, J., 1990. Amplification and direct sequencing offungal ribosomal RNA genes for phylogenetics. In: Innis, M.A., Gelfand, D.H.,Sninsky, J.J., White, T.J. (Eds.), PCR Protocols: a Guide to Methods and Applica-tions. Academic Press, New York, pp. 315e321.

Zink, A.R., Sola, Ch, Reischl, U., Grabner, W., Rastogi, N., Wolf, H., Nerlich, A.G., 2003.Characterization of Mycobacterium tuberculosis complex DNAs from Egyptianmummies by spoligotyping. J. Clin. Microbiol. 41, 359e367.