Flow Cytometry Based Sc and Improving Bioindustr

Flow Cytometry Based Screening System for Finding

and Improving Bioindustrial Important B

Date of Defense: 4th

of December, 2009

School of Engineering and Science


and Improving Bioindustrial Important Biocatalysts

Cytochrome P450 BM3 by

Milan Blanusa

A thesis submitted in partial fulfillment

of the requirements for the degree of

Doctor of Philosophy

in

Biochemical Engineering

Approved, Thesis Committee

_______________________________________________

Prof. Dr. Ulrich Schwaneberg

RWTH Aachen University, Aachen

Jacobs University Bremen, Bremen

___________________________________

Prof. Dr. Sebastian Springer

Jacobs University Bremen, Bremen

_______________________________________________

Prof. Dr. Harald Gröger

University of Erlangen-Nuremberg, Erlange

of December, 2009

School of Engineering and Science


iocatalysts –

____________________________

_______________________________________________

____________________________

Nuremberg, Erlangen

Page | 2

Table of contents

Acknowledgements

Abbreviations

Abstract

Overview of the Thesis

1. Introduction ...................................................................................................................... 8

1.1 Directed evolution and rational design ..................................................................................... 8

1.2 High throughput and ultra high throughput screening systems ............................................... 9

1.3 Ultra high throughput screening and directed evolution using double emulsions and flow

cytometry ........................................................................................................................................ 14

1.4 P450 monooxygenases (P450s) and Cytochrome P450 BM3 (Cyt P450 BM3) as a model

System ............................................................................................................................................. 19

1.5 Metagenome libraries: a source for novel enzyme activity ...................................................... 30

2. Phosphorothioate based Ligase-Independent Gene cloning (PIGe) and application in cloning of

Cyt P450 BM3 ........................................................................................................................ 31

2.1 Introduction ............................................................................................................................... 31

2.2 Materials and methods ............................................................................................................. 33

2.3 Results and discussion ............................................................................................................... 44

2.4 Conclusion ................................................................................................................................. 53

3. Expression and purification of Cyt P450 BM3 ...................................................................... 55

3.1 Introduction ............................................................................................................................... 55


3.3 Results and discussion .............................................................................................................. 62

3.4 Conclusion ................................................................................................................................. 66

4. Coumarine based substrates for high throughput screening of Cyt P450 BM3 activity in microtiter

plates (MTPs) and by flow cytometry in double emulsions ..................................................... 68

4.1 Introduction .............................................................................................................................. 68



4.4 Conclusion ................................................................................................................................ 109

5. Development of ultra high throughput screening system based on flow cytometry and double

emulsions for directed evolution of Cyt P450 BM3 ................................................................. 112

5.1 Introduction .............................................................................................................................. 112


5.3 Results and discussion ............................................................................................................... 116

5.4 Conclusion ................................................................................................................................. 123

6. Screening the metagenome libraries using flow cytometry and double emulsions: the source of

novel P450 activity ................................................................................................................ 124

6.1 Introduction .............................................................................................................................. 124



6.4 Conclusion ................................................................................................................................ 130

7. Future outlook .................................................................................................................. 131

8. References ........................................................................................................................ 133

Supplementary data

Page | 3

Acknowledgements

This Thesis is a product of three-year-long

research in the field of directed evolution of Cyt P450

and development of ultra high throughput technology

based on flow cytometry and double emulsion. In this

Part I would like to acknowledge all the people who

contributed to this work in any way; people who

helped me with mental, scientific as well as financial

support and people who helped me ease my long time

here in Bremen.

First, I would like to thank my professor and

supervisor Ulrich Schwaneberg, for his courage to

accept me in his group, for his guidance and help

through these three years. I know that most of the

time I was a difficult person to work with but Uli had a

great deal of patience and confidence in me and gave

me freedom to pursue my scientific interests. This I

could not have found in many other places. At the end

we had very fruitful collaboration and I hope it will

continue wherever each of us ends up.

I am grateful to my project coordinator, Dr.

Radivoje Prodanovic, for his unselfish help in scientific

work. Long discussions and never ending scientific

quarrels always ended up with some good results,

problem solutions and ideas. At the end, I would like

to thank him not just as a scientist but as a friend for

always being there for me.

I am grateful to Raluca Ostafe and Ran Tu

who worked together with me on this hard project.

They were truly good coworkers always participating

in fruitful discussions and having fresh ideas. I think

that without our team work this project would not

have been so successful. Raluca will always, besides

being my colleague, remain one of my dearest friends.

Additionally, I would like to thank Frank

Niehaus and Jürgen Eck, our collaborators from

B.R.A.I.N. AG for their help in writing the project,

putting together endless reports and supplying us with

metagenome libraries needed for experimental work.

I would like to thank my committee members

Prof. Springer and Prof. Krüger for accepting to read

my thesis. Their advice and criticism will help me to

improve my constructive and writing skills in the

future.

I would like to acknowledge BMBF:

Bundesministerium für Bildung und Forschung for

financial support of this project.

I would specially like to thank to my all-time-

best colleague, my flat mate and my friend Jovana

Grujic for her unconditional help in every aspect of my

life. I think I would have never had the strength to

push this PhD as far as I did, without you. Thank you

for your support in those hard moments, and we both

know we had them a lot in the first two years. I would

like to thank the Serbian group members and friends

Dragana and Ljubica, for the scientific help but also for

all those small gossips in Serbian. They truly made my

time in the group more pleasant. I miss you both.

My students: Hengameh, Tsvetan, Vladimir,

Alexey and Jacob deserve special gratitude. They

spent a lot of time under my guidance and I hope it

was worth their while. I hope that I was able to give

them at least a little bit of knowledge and experience

that will help them on their future path.

I would like to thank my ex-colleagues: Tuck,

Ziwei, Carmen and Ozana for their help in getting to

know the lab and adapting to studies at International

University Bremen, at that time. Also, people who

spend most of their time in the lab together with me –

the Schwaneberg group – Aala, Aamir, Amol, Arcan,

Dominik, Guray, Hemanshu, Jan, Kang Lan, Katja,

Krishna, Lei Lei, Li-Quing, Marko, Matthias, Noor,

Pravin, Ronny, Saskia, Zhenwei and Ying ying. Thank

you guys you are really great. Special thanks need to

go to Andreea.

Specially, I would like to thank Marina and

Daniela. Without them my practical work, in the lab,

would be impossible.

These people played a special role in my life,

not as much in Bremen as in the period before. They

helped me to become a person and a scientist I am

now and I will be forever grateful to them. Biljana,

without you I would have never finished my basic

studies, never learnt how to push things in life and

how to truly fight. You will forever remain my best

and dearest friend, no matter where I am. Milice, I

need to say thanks to you too. Without our “wonder

Page | 4

trio” energy at University we would have never

achieved what we have until today.

J, for you I can not even put my words here. I

hope you know what you mean to me. Your love and

guidance in the last years have meant a great deal to

me. I can not and do not want to spend any moment

of my life without you.

Finally, I would like to thank my parents,

Gordana and Milovan for believing in me from the

beginning. I know I was not a role-model-child but this

never stopped them to teach me about right things in

life and how to discover what I really want. I would

have never made it anywhere without them and I can

not even express my gratitude in words.

Putting together this Thesis took a lot of

mental and physical effort and I apologize if I forgot to

mention someone in these Paragraphs. Once more - I

apologize.

Abbreviations

4-MU = 4-metyl umbelliferone

ALA = aminolevulinic acid

Amp = Ampicillin

BCA = Bicinchoninic acid

BCC = 7-benzoxy-3-carboxy coumarin methyl ester

BCC Acid = 7-benzoxy-3-carboxy coumarin

CFU = Colony Forming Unit

CV = Column Volume

Cyt P450 BM3; P450 BM3; BM3 = Cytochrome P450

BM3

DBCC = 7-benzoxy-3-carboxy coumarin benzyl ester

DMSO = dimethyl sulfoxide

EDTA = ethylenediaminetetraacetic acid

EGFP = Enhanced Green Fluorescent Protein

FACS = Fluorescence Activated Cell Sorting

FAD = Flavin Adenine Dinucleotide

FMN = Flavin Adenine Mononucleotide

FPLC = Fast Protein Liquid Chromatography

FRET = Fluorescence Resonance Energy Transfer

FSC = Forward Scattering

HTS = High Throughput Screening

IPTG = Isopropyl β-D-1-thiogalactopyranoside

IVC = in vitro compartmentalization

Kan = Kanamycin

LB media = Luria-Bertani media

LIC = ligase independent cloning

MSC = Multiple Cloning Site

MTP = micro-titer plate

NADPH = Nicotinamide Adenine Dinucleotide

Phosphate (reduced)

NMR = Nucleic Magnetic Resonance

OD600 = Optical Density at 600 nm

PAA = polyacryl amide

PBS = Phosphate Buffer Saline

PCR = Polymerase Chain Reaction

PEG = Polyethylene glycol

PIGe = Phosphorothioate based Ligase-Independent

Gene Cloning

PMB = Polymixin B Sulphate

PMBN = Polymixin B Sulphate Nonapeptide

pNCA = para- Nitrophenoxycarboxylic Acid

RP-HPLC = Reverse Phase High Pressure Liquid

Chromatography

RPM = rotations per minute

SB buffer = sodium borate buffer

SDS-PAGE = sodium dodecyl sulfate polyacrylamide

gel electrophoresis

SSC = Side Scattering

TAE buffer = tris, acetic acid, EDTA buffer

TB media = Terrific broth media

TE = transformation efficiency

TEA = N,N,N-Triethylamine

TLC = thin layer chromatography

UV = ultra violet

`

Abstract

Directed evolution presents one of the most common ways of tailoring biocatalysts

for a certain application, especially when the information about the structure of biocatalyst

is lacking. It consists of iterative cycles of diversity generation, on genetic level, and

screening for the target property using a specific screening system. One of the “bottle-

necks” of directed evolution experiment is the throughput of currently available screening

systems. Recently, a new technology based on double emulsions and flow cytometry/FACS

enabled screening for the enzyme activity with ultra high throughput (>109 clones per round

of directed evolution). In this work, we have optimized this technology for directed evolution

of bacterial enzyme, Cytochrome P450 BM3. With no fluorescent detection assay available,

the novel coumarine based substrates had to be synthesized. The assay was optimized in the

microtiter plate and emulsion format using F87A/R471C variant of BM3, which was showing

activity with all the substrates. Finally, the screening system was employed in one round of

directed evolution for the increase in activity towards novel coumarine substrates. Library

containing >105 different variants was screened in the matter of hours and improved

variants were enriched in three rounds of enrichment/sorting process using Partec CyFlow

Space flow cytometer. Three selected variants have been kinetically and genetically

characterized. The best variant showed ~14 times improvement compared to the starting

variant, F87A/R471C. Numerous amino acid changes have been found and their role in

improvement of activity was postulated. Finally, libraries containing random genes isolated

from different habitats (metagenome libraries) were screened in search of novel P450

activity. As a conclusion, a powerful ultra high throughput system has been optimized for

directed evolution of Cytochrome P450 BM3. This system, in future, will allow us to probe

much higher clone numbers in less time, allowing the new methods for high diversity library

generation to be employed.

Page | 7

Overview of the thesis

Work in this Thesis is summarized in six main Chapters. Each Chapter is describing a part of

the “big puzzle”, but on the other hand each Chapter is written as self-explanatory, containing all

data relevant for its understanding separately from all others chapters. In each Chapter short

Introduction is followed by Materials and methods, summarizing all experimental procedures used;

Results and discussion summarize all relevant data and give critical view of our findings while

Concussions in short describe the main achievements and future prospects of each Chapter.

Chapter one contains all introductory information necessary for understanding the topic of

this Thesis. In short high- and ultra- high throughput methodology is described, together with the

detailed background of the model enzyme used in this research – Cytochrome P450 BM3.

Chapter two introduces new cloning method based on Ligase-Independent Cloning (LIC) and

phosphorothioate bond cleavage with iodine (PIGe). It gives an overview of steps taken to design the

cloning method itself, proof of principle of each of these important steps (phosphorothioate bond

cleavage, cloning using phosphorothioated primers) and it describes in detail the applicability of the

method under different conditions (iodine concentration, vector/insert concentration etc.) for

cloning of three target genes. Finally, it describes the applicability of the PIGe method for cloning of

Cyt P450 BM3 and library construction for directed evolution experiments.

Chapter three summarizes the achievements in the optimization of expression of Cyt P450

BM3 using pET28 and pALXtreme vectors. The optimized protocol for an ion-exchange

chromatography using DEAE matrix is also described here.

Chapter four contains all information about synthesis of novel Cyt P450 BM3 substrates and

assay establishment. All synthesis protocols and substrate characterization are described in detail.

Establishment of the assay in MTP and emulsion format is described as well as using di-benzyl

substrate for the single cell analysis/sorting.

Chapter five is the most important chapter summarizing all the achievements of the previous

chapters into ultra-high throughput methodology for directed evolution of Cyt P450 BM3. Detailed

protocol for library and emulsion preparation is given here, as well as protocol for the flow cytometry

screening/sorting of the libraries. Main results are summarized and validated using the MTP screen.

The variants of BM3 with novel critical positions are isolated and characterized.

Chapter six focuses on application of the ultra-high throughput methodology in the

metagenome library screening. This is the first report of this technology applied in this, still new and

unexplored field.

Summary of the Thesis contains summary of the work as well as plans and ideas that might

be inspired by work in this Thesis.

Page | 8

1. Introduction

1.1 Directed evolution and rational design

In the last decade the biocatalysts are becoming a very useful tool in the synthesis of

different complex compounds, offering many advantages compared to classical chemical

methods (1). Principal benefits include stereo-, regio- and chemo-selective conversions of

molecules under mild reaction conditions (pH, pressure and temperature). On the other

side, bioindustrial application includes large scale application under the conditions which are

rarely ideally suited for maintaining highly active and long lasting enzymes. Therefore the

biocatalysts useful for that kind of application are not easily found in nature. Few

approaches of which two showed most success, directed evolution and rational design, have

been used to alter the properties of biocatalysts in a matter to make them more suitable for

harsh conditions of industrial bioreactors. The most popular properties to evolve by directed

evolution have been: activity, substrate specificity, thermal and oxidative stability, enantio-

selectivity or enantio-specificity, pH range and tolerance to different solvents.

Rational design relies on the knowledge of enzyme structure and function; one or

more amino acids changes are predicted which are suppose to elicit desired improvements

on enzyme structure and activity. The knowledge about enzyme function/structure

relationship is based on: bioinformatics analysis of the protein sequences and amino acid

properties, generalized rules derived from studying the effect of certain mutations on

protein structure/activity and implementation of molecular potential functions which are

enabling us to predict the effect of certain mutations on protein structure/activity. Rational

design is highly dependant on the property/ies of the enzyme which wants to be evolved. In

some cases general rules might be applied (i.e. increasing the stability of protein) while

sometimes specific knowledge is needed (i.e. when changing substrate specificity). In the

latter case knowledge about catalytic residues and their interaction in catalysis is necessary.

So far many success stories exist about using rational design to improve conformational

stability (i.e. with introducing disulfide bonds), making membrane proteins more soluble (i.e.

by removing their hydrophobic domains) and recently also in de novo protein design where

new binding properties or even new activity have been introduced into existing protein

structure.

Directed evolution is, on the other hand, imitating the natural process of evolution

based on random mutagenesis and sexual recombination. In laboratory conditions directed

evolution is based on iterative cycles of diversity generation followed by screening for

desired improved property. After improved variants have been indentified their genetic

material is used for another round of diversity generation. Cycles are repeated until desired

trait is achieved (Figure 1).

Page | 9

Figure 1 Scheme of directed evolution experiment. Taken over from (2).

Two most important requirements for one successful directed evolution experiment

are: a) screening or selection system which is able to identify desired hits in the library and

b) the appropriate mutagenesis strategy which could generate improvements of desired

property on genetic level. These two requirements will be further discussed in details trough

certain Chapters of this Thesis.

The ability to isolate variants from larger libraries will increase the chances of finding

the variant with desired improved property. This demonstrates the importance of high

diversity generation methods and even more importance of high throughput (103-10

6), ultra

high throughput (>109) and selection (10

14) screening systems. High throughput screening

systems are normally based on microtiter plate or solid phase screening. They are easy to

optimize, cost-effective and reproducible but still limited to screening low number of clones.

Ultra high throughput screening systems are based on flow cytometry or display technology

(phage/cell display). Their throughput is much higher but they are either limited to

fluorescence detection or screening the affinity rather than activity of the protein. Selection

based methods posses the highest throughput but they can be applied only in specific cases;

this approach rarely can be generalized. Advantages and disadvantages of these approaches

will be discussed in detail in the next part of the Introduction as well as in Chapter 4 of this

Thesis.

1.2 High throughput and ultra high throughput screening systems

High throughput and ultra-high throughput screening systems present the core of

directed evolution experiments. Most commonly HTS systems employ microtiter plate

screens and solid phase systems (agar, filter paper or nylon/nitrocellulose membranes) with

ATGGATGCGCTGA.................................GCTACTGGTCAGTAATACCTACGCGACT..................................CGATGACCAGTCATT

GENE ENCODING PROTEIN OF INTEREST

MUTANT LIBRARY

ATGGATGC CTGA.................................GCTACTGGTCAGTAATACCTACG GACT..................................CGATGACCAGTCATT

ATGGATGCGCT A................................. GCTACTGGTCAGTAATACCTACGCGA T..................................CGATGACCAGTCATTATGGATGCGCTGA.................................GCTACTGGT C GTAATACCTACGCGACT................................. CGATGACCAG CATT

ATGGATGCGCTGA.................................GCTA TGGTCAGTAATACCTACGCGACT..................................CGAT ACCAGTCATT

AT

GC

TA

CG

Step 2: Screening for improved variants

(10 to >10 )2 7

IMPROVED MUTANT(few)

Step 3: Iterative cycle

START

DESIRED VARIANT

DIRECTEDEVOLUTION

Step 1: Genetic diversity generation(400 amino acid

20 possibilities)→400

Page | 10

a throughput of 103-10

6. These systems are predominantly used for improving the enzyme

properties but not affinity. Ultra-HTS systems become more popular recently due to their

higher throughput (>107-10

9). They are based either on flow cytometry and in vitro

compartmentalization technology in double emulsions (3) or display technology (Table 1).

Table 1 Overview of screening systems. Taken over from (2).

Method Through-

put Principle Main advantages Main disadvantages

GC/LC-MS,

NMR,

HPLC

102 – 10

4

- Increased throughput of

”classical” analytical

methods ; often adapted to

sampling in 96-well plate

format

- Enantioselective

analytics

- Significant investments in

equipment and comparably

high running costs

- Low throughput

Microtiter

plate

103 – 10

5

- Colorimetric or

fluorometric reaction

performed for each

individual clone in each

well of a microtiter plate

- Quantitative

information derived for

individual variant

- Accurate

- High expenses

- Medium throughput

- Laborious

Solid phase 104 – 10

6

- Screening on a solid

surface such as agar plates,

filter papers or membrane

- High-throughput

- Low costs

- Comparably low accuracy;

often used as prescreen for

qualitative/ semi-

quantification of activity

Flow

cytometry >10

7

- Sorting of individual cells

based on the generated

fluorescence

- Ultra high throughput

- Cells are directly

isolated after screening

(no replica required)

- Mode of detection

limited to fluorescence

- Comparably low accuracy

due to dye diffusion and

variation in catalyst

expression per cell

Phage/cell

display >10

7

- Proteins are display on

the phage/cell surface

providing phenotype and

genotype linkage

- Ultra high throughput

- Powerful for

improving protein

affinities

- No general use as many

enzymes cannot be

displayed in active form

- Limited applications for

improving enzyme activity

Screening systems for oxygenases can be developed in a way that they detect: a)

cofactor or cosubstrate; b) use surrogate substrates or c) detect product formation (Figure

2). Detection of cofactors (NADH, NADPH) or cosubstrates (oxygen) presents a universal

detection system used for different substrates but still suffer from disadvantage of high

background, especially when using whole cell systems. Surrogate substrates are very

applicable for directed evolution of oxygenases (thermostability, co-solvent resistance etc.)

but problem arises in structure of surrogate substrate which is usually different than that of

the natural one. Product formation is difficult to screen in most of the cases. Usually low- or

medium throughput systems have to be employed (HPLC, NMR, GC-MS).

Page | 11

Figure 2 Reaction scheme for oxygenases with marked possible detection spots; cofactor or cosubstrate detection (blue)

and surrogate substrate or product formation detection (red). Adapted from (2).

Screening systems based on cofactor or cosubstrate detection are generally

applicable, which is one of their main advantages. They can be used for screening the activity

of oxygenases with their real substrates. NAD(P)H consumption is a continuous assay that

can be monitored by the decrease of absorbance at 340 nm. Also, fluorescence detection is

possible (ex. 360 nm, em. 460 nm) which increases the sensitivity of the assay (4).

Disadvantage of this assay is high background when using whole cell system. Detecting

oxygen has also general applicability as for previously mentioned assay. Commercially

available oxygen-sensitive fluorescence probes are now available. These probes have been

incorporated into 96- and 384-well MTP which are commercially available and can be used

directly for screening (OxoPlate). Concentration of oxygen is in this case inversely

proportional to detected fluorescence. Recently this system has been used, in medium

throughput format, for the detection of P450 activity with different substrates (5). Detection

of peroxides, as a driving force for P450s, is also possible due to existence of so called “shunt

pathway”(6). The only disadvantage is low stability of P450s towards peroxides so this

property had to be evolved by means of directed evolution (7).

Surrogate and product based screening systems have been developed and validated

for hydroxylation of fatty acids, alkanes and aromatic compounds. These systems include: p-

nitrophenyl surrogate substrates for fatty acids (p-nitro carboxylic acid, pNCA), dimethyl

ether (DME), hexametyl ether (HME) and coupled alcohol dehydrogenase (ADH) assay.

Mentioned systems are based on spectrophotometric detection (by release or formation of

chromophore). Systems based on fluorimetric detection include: screening systems based on

coumarine or resorufin probes. For aromatic compounds following detection systems have

been developed: 4-aminoantioyridine (4-AAP) assay, a Fast Blue B assay, a catechol

detection assay, HRP coupled assay and Gibbs assay. All these assays are nicely summarized

in review article by Tee at al. (2). In this Thesis only most important assays will be discussed

in detail.

O2 H O2

NAD(P)H NAD(P)+

HO

OH

OH

O

Hydroxylation(Assays: -nitrophenyl surrogates;

ether surrogates; ADH coupled assay; coumarin and resorufin surrogates;

4-AAP assay; HRP-coupled assay;catechol assay; Fast Blue B;

Gibbs assay)

p

Dihydroxylation(Assays: Gibbs assay; Catechol

assay; Biphenyl assay; HRP-coupledassay)

Epoxydation(Assays: NBP assay; pNTP assay)

Modelsubstrate

Page | 12

The first continuous screening assay for monitoring fatty acid hydroxylation, p-

nitrocarboxylic acid (pNCA) assay, was developed by Schwaneberg et al. It has been

developed for F87A variant of Cyt P450 BM3 which showed nearly exclusive terminal

hydroxylation.

Figure 3 Principle of pNCA assay developed by Schwaneberg et al. for terminal hydroxylation activity of Cyt P450 BM3

F87A .

The assay is based on terminal hydroxylation of pNCA leading to formation of

instable hemiacetal (Figure 3). This hemiacetal dissociates and releases a chromophore, p-

nitrophenolate, which can be monitored continuously at 410 nm. The pNCA assay has a

reported standard deviation of 10-13 % and linear detection range of 0.03-0.3 mM for F87A

variant of Cyt P450 BM3 (8). This screening system has been reported in various directed

evolution experiments: increasing activity towards non-natural substrates (9),

thermostability (10), hydrogen peroxide tolerance (7), co-solvent resistance (11) and

mediated electron transfer (12).

Figure 4 Overview of fluorogenic substrates for mammalian Cyt P450 activity screening. Taken over from (2).

O

NO2

p-nitrophenyl

surrogate

Rn

O

NO2

RnHO

unstable hemiacetal

dissociation

O-

NO2

p-nitrophenolate

(yellow product)

+RnH

OP450 BM-3

NADPH + H+

NADP+

H2O O2

n = 5 to 8

R: - COO-

- H

OO

FF

F

O

7-ethoxy-4-trifluoro-

methylcoumarin

OO

N

O

7-methoxyresorufin

OO

coumarin

OO OH

7-hydroxycoumarin

(fluorescent product)

OO

N

OH

7-hydroxyresorufin


OO

FF

F

OH

7-hydroxy-4-trifluoro-methylcoumarin


+ CH3OH

CH3CH2OH+

Page | 13

Most system developed for mammalian P450s are based on O-dealkylation of

substrate molecule generating fluorescent product (Figure 4). Fluorescence is a requirement

for screening of mammalian P450 due to their low conversion rate. Detection in this case is

possible using whole or permeabilized cells but in same cases media exchange is needed to

minimize the background. Most of the fluorescence assays allow continuous monitoring.

Some of these assays have been reported in directed evolution experiments (Table 2).

Table 2 Fluorescence based screening system for mammalian P450 employed in directed evolution experiments. Adapted

from (2).

Detection system

(Mode of operation; detection limit under assay

conditions)

Oxygenase

(Improved property(ies)) Reference

7-ethoxy-4-trifluoromethyl coumarin surrogate

(continuous; not reported )

P450 2B1 from rat liver

(activity for 7-ethoxy-4-trifluoromethyl

coumarin)

(13)

7-methoxyresorufin surrogate

(continuous; not reported)

P450 1A2 from human

(activity for 7-methoxyresorufin) (14)

Coumarin hydroxylation

(continuous; not reported)

P450 2A6 from human

(activity for coumarin hydroxylation) (15)

Up to now, only one fluorescent high throughput screening assay for Cyt P450 BM3

activity has been reported (16). This assay is based on O-dealkylation of alkoxy-resorufin,

approach well characterized for mammalian P450s (Figure 5). Released resorufin molecule

possesses high fluorescence (580 nm) when excited at 530 nm. This part of the spectra is

well separated from the fluorescence spectra of NADPH (ex. 340, em. 440 nm) and auto-

fluorescence spectra of the cells giving this assay an additional advantage. One more

advantage is that authors wanted a screening system for drug-like molecules and alkoxy-

resorufin possesses such structure. Few different substrates were tested, dependant on the

length of the alkoxy chain (methoxy-resorufin MR, ethoxy-resorufin ER, pentoxy-resorufin PR

and benzoxy-resorufin BR).

Figure 5 Dealkylation scheme of alkoxy-resorufins by Cyt P450 BM3. Metoxyresorufin R=H, etoxyresorufin R=CH3,

pentoxyresorufin R=C4H9 and benzoxyresorufin R=C6H5. Taken over from (16).

Wild type BM3 showed only low activity with BR while it didn’t show any activity with

other 3 substrates. Site directed mutants at positions 47, 87 and 188 have been generated to

increase the activity. Arginine 47 is located at the entrance of the substrate-binding channel

and supposedly involved in the substrate recognition. This residue was exchanged by

hydrophobic leucine which should increase the recognition of hydrophobic substrates.

Phenylalanine at position 87 located above the porphyrin plane prevents the binding of

voluminous substrates. This residue was replaced by much smaller valine. Finally,

Page | 14

hydrophobic leucine at position 188 was replaced by glutamine. All mutation had an effect

on activity of new variant. These activities with all substrates are summarized in Table 3.

Table 3 Alkoxy-resorufin dealkylation by Cyt P450 BM3 Wt and site-directed variants. Table adapted from (16).

MR ER PR BR

Wt BM3 - - - 0.005

R47L - - - 0.005

R47L/L188Q - - - 0.20

R47L/F87V - - 0.20 0.71

F87V/L188Q - - - 1.44

R47L/F87V/L188Q - 0.012 0.22 4.48 Note: Values are expressed as nanomoles resorufin per minute per nanomole of enzyme. Substrate

concentrations were 10 µM. Enzyme concentrations were 100 nM for BM3 Wt and R47L and 10 nM for other

mutants

Assay was established in 96-well MTP format using partially purified enzyme as well

as the whole cells. LPS deficient strain of DH5α, generated by the authors, showed much

higher response possibly due to much higher transport of the substrate trough the

membrane of E. coli. Also, a high throughput inhibition assay was established and tested on

few commercially available drugs known to inhibit or to be substrates for the human P450s.

1.3 Ultra high throughput screening and directed evolution using

double emulsions and flow cytometry

Ultra high throughput methods (>109) are based either on flow cytometry or

phage/cell display. Latter have much higher throughput, reaching 1014

, but are limited to

screening for the protein affinity, rather than for the activity. Modern flow cytometers

having the possibility to sort >104 events/s, even using multiple parameters, are very

perspective candidates for use in high throughput screening schemes. The challenge which

remains to be solved is to maintain a physical connection between the enzyme, diffusible

product and the enzyme encoding gene (Figure 6).

Figure 6 Overview of methods for maintaining a link between enzyme, diffusible product and enzyme encoding gene.

Taken over from (17).

Page | 15

Few approaches can be applied. Specific case would be when the target reaction

involves modification of the hydrophobic substrate by introducing a charged group. That

way unmodified substrate can be washed out of the cell while product would be retained

within (Figure 6a). One example would be modification of 7-amino-4-chlorometyl coumarin

with glutathione by the action of intracellular glutathione-S-transferase (GST). Product is too

hydrophilic and entrapped within the cell. This approach was used for directed evolution of

GST expressed as intracellular enzyme in E. coli (18). Second approach would be display of

the enzyme on the cell surface and the entrapment of the product on the cell surface at the

same time (Figure 6b). Example would be expression of protease OmpT on the surface of E.

coli cells. FRET substrate (positively charged) that adheres to the membrane of E. coli cells

was used for screening. After cleavage by the protease, quenching group is released leading

to increase in fluorescence on the cells displaying active OmpT. These cells could then easily

be distinguished and isolated by flow cytometry (19). Third approach would include

entrapment of fluorescent products by compartmentalization in emulsion droplets (in vitro

compartmentalization, IVC) (Figure 6c). Technology is based on use of water-in-oil (w/o)

droplets to compartmentalize the gene, the encoded enzyme and reaction product. After

conversion of this primary emulsion into water-in-oil-in-water (w/o/w) emulsions they can

be analyzed and sorted by flow cytometry. This approach has been used for directed

evolution of different enzymes (i.e. endonucleases (20), β-galactosidase (21) and

thiolactonases (22)) and will be discussed in detain in the following Paragraphs.

Generally two approaches exist in IVC regarding weather the enzyme is expressed in

a cell or a cell free system (Figure 7). In one case entire cell expressing the target enzyme is

entrapped within an aqueous phase of primary emulsion while in the latter case only the

gene is entrapped and the enzyme production happens within the emulsion droplet. First

approach is easier to optimize and offers wide range of intracellular expressed enzymes to

be used. Second approach allows us to overcome the transformation efficiency problem of

expression hosts by using genetic material directly in the emulsion droplet.

One successful application of the whole cell system would be directed evolution of

the thiolactonases using double emulsions and FACS (22). In this case, the mutant library was

prepared and transformed into expression host (E. coli BL21-Gold) constitutively expressing

GFP as a cell marker. Cells were entrapped within the aqueous phase of primary emulsion.

Subsequently, substrate (TBL) together with fluorogenic product detection dye (CPM) was

added. Secondary emulsion was prepared, incubated on ice and subsequently analyzed and

sorted by FACS (Figure 8A). Emulsions were prepared by homogenization (Ultra Turax)

employing polymeric detergent ABIL EM-90 in the primary emulsion.

Page | 16

Figure 7 Overview of ultra high throughput screening technology using double emulsion and flow cytometry in whole cell

(b, c and d) and cell free systems (a, c, and d). Taken over from (23).

In the three rounds of sorting library was enriched with active clones (from few

percent of active clones up to ~30 % of active clones). Over 107 mutants were screened by

FACS. After MTP screening and characterization clones with 20-100 times increased activity

compared to the starting clones were isolated. After sequencing, residues responsible for

increased activity were identified (22).

Second, a cell free, approach was successfully used for directed evolution of Ebg

protein into β-galactosidase (21). Generated mutant library was directly entrapped in the

aqueous phase of the double emulsion together with components of the cell free expression

system (Figure 9 1-2). Carboxyl coumarin was used as the internal water phase control dye.

Expressed enzyme converted the fluorogenic substrate and released fluorescein as a product

(Figure 9 3). Green droplets, containing the active enzyme, were analyzed and sorted out by

flow cytometry (Figure 9 4). Isolated genetic material was used in the new round of diversity

generation (Figure 9 5-6). Emulsion formulation was somewhat different from the previously

described method; more adapted to the components of cell free expression system.

Membrane emulsification was used in this case.

Page | 17

Figure 8 Overview of ultra high throughput screening strategy for thiolactonases using double emulsions and FACS (A)

and fluorogenic assay used for product detection (B). Taken over from (22).

Figure 9 Overview of ultra high throughput screening methodology for ββββ-galactosidases using cell free system in double

emulsions. Taken over from (21).

Page | 18

This system allowed screening up to 4 x 107 different variants in every generation.

Finally, the characterized β-galactosidases had 1700-fold increase in kcat/Km compared to the

starting, wild type Ebg. Only two specific mutations were responsible for this remarkable

increase in the activity.

Emulsion offer many advantages compared to standard HTS system. First, it is

possible to generate >1010

discrete compartments per one ml of emulsion. This practically

means that 108 different reaction compartments can be generated (statistically 99/100 have

to be empty to make sure that 1/100 contains only one entity). Using flow cytometry for

analysis and sorting of double emulsions throughput can be increased up to 107-10

9. This can

not be achieved by any standard HTS systems including solid phase screening. Flow

cytometry gives an option for clones to be sorted directly in wells of MTP or on agar plates.

Also multiple parameters can be analyzed simultaneously.

Disadvantage of this method would be it’s limitation to fluorescence detection. Up to

now, the fluorescent assays are still not unavailable for many enzyme classes. Also

equipment needed for fully employing the technique is usually quite expensive.

Overall, having this technology widely applicable could push directed evolution a step

further. Screening the libraries generated with new, high diversity generation methods,

would allow us to screen more protein sequence space simultaneously, draw new

structure/function relationship concussions and eventually develop new, highly improved

biocatalysts.

1.4 P450 monooxygenases (P450s) and Cytochrome P450 BM3 (Cyt

P450 BM3) as a model system

Cytochrome P450s: classification, structure and function

Cytochrome P450 (abbreviated CYP or P450) is a very large and diverse superfamily

of hemoproteins. Usually they form part of multi-component electron transfer chains, called

P450-containing systems. The most common reaction catalyzed by Cytochrome P450 is a

monooxygenase reaction, e.g. insertion of one atom of oxygen into an organic substrate (RH)

while the other oxygen atom is reduced to water:

RH + O2 + 2H+ + 2e

– → ROH + H2O

The name Cytochrome P450 is derived from the fact that these are colored ('chrome')

cellular ('cyto') proteins, with a "pigment at 450 nm", so named for the characteristic Soret

peak formed by absorbance of light at wavelengths near 450 nm when the heme iron is

reduced (often with sodium dithionite) and complexed to carbon monoxide.

Until recently P450s have been categorized into four classes, depending on the

electron transport from NAD(P)H to the active site (24). However, the recently discovered

Page | 19

P450 redox systems have broadened this classification to ten classes which are summarized

in Figure 10 (25).

Mitochondrial and the most bacterial P450s are three component systems

comprising a P450, ferredoxin and NADH-dependent, FAD-containing ferredoxin reductase

(Class I). The best representative of this class would be the most intensively studied -

camphor hydroxylase (P450cam) from Pseudomonas putida. Class II P450s are the most

common ones in eukaryotes and include the microsomal P450s. They are two component

systems, both membrane bound, with a P450 and a NADPH-dependent diflavin reductase

(FAD and FMN). Class III P450s were reported in 2002 as a novel class, strongly resembling

the classical bacterial system i.e. Class I (26). They are also a three component system

consisting of an NAD(P)H-dependant, FAD-containing ferrodoxin, a flavodoxin (as opposed to

ferrodoxin of Class I) and a P450. The class is represented by the novel Cytochrome P450cin

isolated from Citrobacter braakii. Class IV Cytochromes P450 are represented by the soluble

CYP119 identified in the extreme acidothermophilic archeon Sulfolobus solfataricus (27).

This was the first discovered thermophilic Cytochrome P450 and the first example of a P450

enzyme that does not obtain its reducing equivalents from an NAD(P)H-dependent

flavoprotein (28). The novel Class V Cytochromes P450 consist of two separate protein

components: a so far unknown NAD(P)H-dependant reductase and a Cytochrome P450-

ferrodoxin-fusion protein. The only example of this class of P450s is CYP51 isolated from

Methylococcus capsulatus. The class VI Cytochrome P450 system is composed of an

NAD(P)H-dependent flavoprotein reductase and a flavodoxin-P450-fusion protein. The class

is standing somewhere in between the P450 BM3 and P450cin systems, which principally use

the same redox centers – FAD, FMN and heme – but differ in the number and characteristics

of separate proteins comprising the system. The first example of the novel class VI P450s is

the Cytochrome P450-like gene from Rhodococcus rhodochrous strain 11Y (designated as

xplA) (29). The bacterial fusion system of class VII is a completely novel class of P450 systems

with a unique structural organization. The Cytochrome P450 is C-terminally fused to a

phthalate dioxygenase reductase domain. The first class VII Cytochrome P450 to be reported

is the Cytochrome CYP116B2 (P450RhF) from Rhodococcus sp. strain NCIMB 9784. Class VIII

compromises P450s which are fused to their eukaryotic-like diflavin reductase partner in a

single polypeptide chain and are therefore catalytically self-sufficient as monooxygenases.

The most widely studied member of this class of P450s is P450 BM3 from Bacillus

megatherium. The only member of Class IX P450s is nitric oxide reductase. CYP55 (P450nor)

was identified in Fusarium oxysporum as a P450 with particular features. It is a soluble

protein that independent of other electron transfer proteins, uses NADH to reduce two

molecules of nitric oxide to nitrous oxide (30). The P450s of Class X catalyze substrate

conversion using an independent intramolecular transfer system. Enzymes of this family are

localized in membranes of chloroplasts (31) and unlike typical P450 monooxygenases do not

require O2 , the reductase or even the electron source NAD(P)H for the rearrangements of

fatty acid hydroperoxides (32,33). They employ the acyl hydroperoxide of the substrate as

oxygen donor to form C – O bonds.

Page | 20

Sequence identity between classes is very low, less than 20 %. Many of the

mammalian and some prokaryotic P450 have been crystallized. Crystal structure revealed

that highest preservation in sequence and structure was around heme, suggesting the

common mechanism of oxygen activation in all P450s. Highest variability was in the regions

involved in membrane anchoring as well as in substrate binding and recognition, giving an

explanation for such high substrate diversity of this class of enzymes.

Genes for P450s are subdivided and classified on the basis of amino acid identity,

phylogenic diversity and gene organization. P450s originated from Prokaryotes. It is believed

that diversity of P450s family was a result of gene duplication and less frequent gene

amplification, conversions, genome duplication, gene loss and lateral transfer. They can be

found throughout the nature in really surprising number, i.e. Mycobacterium tuberculosis

has 20 P450 genes while E. coli has none; S. cerevisiae has 3 while Drosophila melanogaster

has 83 genes and 7 pseudogenes. Humans have in total 55 P450 genes and 25 pseudogenes

while in plant life they are more common and more diverse; Arabidopsis thaliana has 286

P450 genes.

P450s in their resting (substrate free) state generally exist as a mixture of a hexa-

coordinate low spin Fe(III) heme with a water molecule ligated trans to the endogenous

cysteinate ligand and penta-coordinate high-spin Fe(III) heme with the cysteinate as the only

axial ligand. Substrate binding causes a shift in the equilibrium between two Fe(III) states

favouring the penta-coordinate complex, accompanied by the displacement of the sixth

water ligand and an increase in the heme’s reduction potential. This triggers one electron

transfer, reducing the complex to a ferrous state Fe(II). Oxygen binds to ferrous P450

resulting in an unstable ferrous-oxy species which then accepts the second electron. The

electron transfer steps are believed to be rate-limiting under natural conditions. The

mechanism following the formation of the peroxo-iron species involves incorporation of two

protons and cleavage of the O-O bond, resulting in water formation. The two protons are

pumped into the active site to the distal peroxo-oxygen, with the initial formation of a

hydroperoxo-iron intermediate. The two electrons required for this step come from the

heme, resulting in heme oxidation to an oxy-ferryl, or ironoxo species. Oxygen atom transfer

from the iron-oxo complex to the substrate yields the oxidized product (ROH) and

regenerates the resting state. In the presence of external oxygenation agents like H2O2, the

complex may yield the hydroperoxo-complex via a “shunt” pathway. The catalytic

mechanism is shown in Figure 11.

Page | 21

Figure 10 Schematic organization of different Cytochrome P450 systems. (A) Class I, bacterial system; (B) Class I,

mitochondrial system; (C) Class II microsomal system; (D) Class III, bacterial system; example P450cin; (E) Class IV,

bacterial thermophilic system; (F) Class V, bacterial [Fdx]–[P450] fusion system; (G) Class VI, bacterial [Fldx]–[P450]

fusion system; (H) Class VII, bacterial [PFOR]–[P450] fusion system; (I) Class VIII, bacterial [CPR]–[P450] fusion system; (J)

Class IX, soluble eukaryotic P450nor; (K) independent eukaryotic system, example P450TxA. Taken over from (25).

Page | 22

Figure 11 Catalytic cycle of P450 including the peroxide shunt pathway. RH is substrate, and ROH is product. The

porphyrin molecule is represented as a parallelogram. The overall charge on the structures is shown to the left of each

bracket (Adapted from “Laboratory Evolution of Cytochrome P450 for Peroxygenase Activity” Thesis by Patrick C. Cirino).

Function of P450 is very diverse specially when compared trough different kingdoms

in nature. In Prokaryotes P450s are mostly soluble enzymes. Primary role is catabolism of

compounds used as a carbon source, detoxification of xenobiotics in some extent, fatty acid

metabolism and synthesis of antibiotics. In Eukaryotic organisms Class I P450s are mostly

associated with mitochondrial membrane and catalyze few important steps in steroid

hormone biosynthesis; in mammals additionally vitamin D3 production. This Class is found in

insects and nematodes but not in Plants. Class II P450s are most spread throughout

Eukaryotes. P450 and NADPH-P450 reductase are dissociated and independently anchored

in membrane of endoplasmic reticulum. In some cases it is found that Cytochrome b5 is the

one who enhanced the activity of P450s and conveys electrons from cofactor source

(NAD(P)H). Functions of this Class are extremely diverse. In Funghi they are involved in

synthesis of membrane sterols and mycotoxins, detoxification and metabolism of lipid

carbon sources. In Plants they are involved in biosynthesis and catabolism of all types of

hormones and in oxygenation of fatty acids for the synthesis of cutins. Additionally, many

P450s are involved in pathways of secondary metabolism which involve process of

lignifications, synthesis of flower pigments and defense chemicals. Many of these chemicals

have diverse applications as aromas, flavors, antioxidants and anti-cancer drugs.

Page | 23

Most important role of both classes is detoxification and this role is present in all

organisms. It has been shown that P450s of both classes have contribution in cancerogenesis

and are essential in drug and pesticide metabolism, tolerance, selectivity and compatibility

to some drugs.

Cytochrome P450 BM3 (CYP102A1): structure, mechanism and function

Cytochrome P450 BM3 (Cyt P450 BM3, CYP102) is a 119 kDa water soluble heme

containing enzyme originally isolated from Bacillus megaterium. Interestingly, heme domain

of BM3 is fused to a mammalian like NADPH-diflavin reductase making this enzyme self-

sufficient in catalysis. Catalytic activity is one of the highest among all known P450s (up to

17000 min-1

with arachidonate). Due to these properties P450 BM3 presents an excellent

example for studying factors that govern substrate binding and catalysis as well as electron

transfer from NADPH to catalytic core. Natural substrates for BM3 comprise long chain poly

unsaturated and saturated fatty acids. Conversion of long chain alcohols and amines has also

been reported as natural activity (34). Hydroxylation preferentially occurs at ω-1, ω-2 and

rarely ω-3 position of fatty acid. Natural role of P450 BM3 still remains unclear although

there are some speculations about its involvement in detoxification of poly unsaturated fatty

acids.

The single polypeptide chain of P450 BM3 contains three structural domains that

contain heme, FMN and FAD. Attempts to crystallize full length protein were unsuccessful

possibly due to the presence of very flexible “hinge” region connecting heme and reductase

domains of the protein. On the other hand, structure of heme (35) as well as heme/FMN-

binding complex (36) have been solved. These structures enabled rational investigation of

structure/function relationship in the P450 BM3 by identifying key residues involved in the

substrate binding and catalysis as well as electron transfer from NADPH.

The heme domain of P450 BM3 consists of α and β sub-domains. The heme in the

active site is positioned on the “bottom” of long hydrophobic substrate binding channel

formed predominantly by β sub-domain. Heme porphyrin ring is bound to the rest of the

polypeptide chain trough Cys400 residue, well conserved among other P450s. A number of

different residues have been indentified as the ones having a possible effect on binding or

catalysis. Arg47 and Thr51 are thought to interact with carboxyl group of fatty acid

stabilizing the negative charge of the substrate trough ionic interaction (Arg47) and trough

hydrogen bonding (Tyr51). Phe87 is thought to have the important role on substrate binding

and regioselectivity of oxidation. Phe42 is forming a “cap” on the long hydrophobic substrate

binding pocket. It is believed that this residue has important role on substrates binding (37).

Structure of heme domain is shown on Figure 12.

Page | 24

Figure 12 Model of the tertiary structure of P450 monooxygenases. The heme (protoporphyrin IX) is colored orange, the

substrate recognition site (SRS1-SRS6) is colored red, and the heme coordinating I and L helices are shown in green. The

model was generated using PyMol (http://pymol.sourceforge.net) from the crystal structure 1jpz of P450 BM-3 (38).

Resolved crystal structure of heme- and FMN-binding domains has given us an insight

on the residues involved in FMN binding as well as electron transfer from FMN to heme

domain (36). The FMN-binding domains consist of 5 stranded parallel β sheets surrounded

by 4 α helices. Important residues are shown in Figure 13. It is believed that transfer of

electrons from FMN involves Trp574 residue, then Pro382-Gln387 peptide and then directly

to heme iron via Cys400. Alternatively, main- or side-chain atoms of Pro392, Gly393 and

Arg398 might be involved.

Page | 25

Figure 13 Crystal structure of part of the complex between the heme- and FMN-binding domains of P450 BM3 showing

amino acid residues involved in electron transfer from the FMN- to the heme-binding domain (PDB code: 1bvy). Taken

over from Nazor, J. (2007) PhD Thesis.

Up to now, no structure is available for reductase domain of P450 BM3. Alternatively,

the reductase domain of rat CPR has been crystallized and it provided and insight into

important residues and spatial organization of this domain (39). Homology analysis with

BM3 amino acid sequence has been done (40).

Interestingly, in solved conformation orientation of the FMN was opposite to that

obtained from complex of heme/FMN-binding domain crystal. Since in BM3 FMN and FAD

reside on distinct domains connected with a flexible “hinge” domain it is suggested that

during catalytic cycle this “hinge” region moves reduced FMN from FAD towards heme. Later

it has been proposed that this process occurs between reductase domain of one BM3

molecule and heme domain of other BM3 molecule suggesting that active form of the

enzyme is actually a dimer (41).

The crystal structure of the palmitoleate-bound form of P450 BM3 provided clear

picture of how long-chain fatty acids bind in the hydrophobic pocket of the enzyme and

allowed rational design altering substrate selectivity. The site-directed mutant F87G

catalyzed the accelerated oxidation of polycyclic aromatics (including pyrene and benzo-a-

pyrene), as well as affecting the regioselectivity of fatty acid oxidation (42). In addition,

mutant F87V specifically catalyzed the production of 14S,15R-epoxyeicosatrienoic acid from

arachidonic acid, as opposed to the mixture of this compound with 18R-

Page | 26

hydroxyeicosateraenoic acid formed by wild-type P450 BM3 (43). Removal of the

carboxylate-binding motif of P450 BM3 in the double mutant R47L Y51F increased the

capacity of the enzyme to oxidize pyrene and other polycyclic aromatic hydrocarbons, and

additional mutations to phenylalanine (F87A) and an active site alanine (A264G) further

improved the turnover and coupling of substrate oxidation to NADPH oxidation, respectively

(44). Mutant R47E also catalyzed efficient hydroxylation of fatty acid alkyl

trimethylammonium derivatives, further showing the potential of the engineered P450 in

organic synthesis (45). Rational mutagenesis was also used to alter the fatty acid substrate-

binding profile of P450 BM3. The P450 BM3 F87A mutant has been shown to shift its

substrate specificity (towards lauric and myristic acid) from sub-terminal to terminal

hydroxylation (42). This fact has been cleverly used to design surrogate substrates with

different chromophores attached to the terminal position of different-length chain fatty

acids (8). Engineering alternative carboxylate-binding residues closer to the heme in the

hydrophobic active site core resulted in improved binding and turnover of short chain

alkanoic acids. Mutant L181K and double mutant L75T L181K had catalytic efficiencies

improved 13-fold and 15-fold with butyrate and hexanoate, respectively (46). Laboratory (or

directed) evolution has also proven to be a useful tool in engineering P450s substrate

selectivity. One notable success in this area has been the engineering of P450 BM3 into a

highly efficient catalyst for the conversion of alkanes to alcohols (47). The same mutant was

found to be active also on benzene, styrene, cyclohexene, 1-hexene and propylene.

Lately more effort has been put to use the prokaryotic Cytochromes in catalysis of

reactions normally done by human P450s due to their superior properties (stability, self-

sufficiency and higher activity) (48). It has been shown that P450 BM3 Wild type has an

ability to convert substrates normally used by human P450 (Figure 14).

Figure 14 Activity of P450 BM3 with metabolites normally converted by human P450s. Taken over from

This spectrum was broadened by means of directed evolu

proving the potential of P450 BM3 as a biocatalyst with possible bioindustrial application

Mutants of P450 BM3 with higher activities

human homologues have been indentified (Figure 15).

Activity of P450 BM3 with metabolites normally converted by human P450s. Taken over from

This spectrum was broadened by means of directed evolution and rational design

proving the potential of P450 BM3 as a biocatalyst with possible bioindustrial application

with higher activities and broader substrate range to

s have been indentified (Figure 15).

Page | 27

Activity of P450 BM3 with metabolites normally converted by human P450s. Taken over from (48).

tion and rational design

proving the potential of P450 BM3 as a biocatalyst with possible bioindustrial application.

and broader substrate range to that of their

Page | 28

Figure 15 Conversion of human metabolites catalyzed by P450 BM3 mutants. Taken over from

As mentioned previously, Cytochrome P4

with growing interest in the

their low stability, low activity, substrate/product inhibit

reduction co-factors (NADH, NADPH).

In the last 20 years, with the discovery of Prokaryotic P450s, efforts have been made

to use these instead of their Eukaryotic P450 counterparts, due to their superior properties.

They are usually water soluble, self

Conversion of human metabolites catalyzed by P450 BM3 mutants. Taken over from

As mentioned previously, Cytochrome P450s comprise a large family of biocatalysts

bioindustrial application. This application is still hampered by

their low stability, low activity, substrate/product inhibition and dependence on high cost

, NADPH).



They are usually water soluble, self-sufficient systems with significantly higher turnover rate.

Conversion of human metabolites catalyzed by P450 BM3 mutants. Taken over from (48).

50s comprise a large family of biocatalysts

bioindustrial application. This application is still hampered by

ion and dependence on high cost



nificantly higher turnover rate.

Page | 29

But even so these biocatalysts are still far from optimal for harsh bioindustrial processes. By

means of rational design and directed evolution properties like: substrate specificity,

catalytic activity, co-solvent resistance, thermostability and reduction cofactor exchange

were successfully altered in the case of P450 BM3. These efforts made us a step closer of

using this biocatalyst in industrial scale processes. With recent development of powerful

ultra high throughput systems (flow cytometry, microfluidics) directed evolution became

more versatile and more applicable weapon for biocatalysts design.

Page | 30

1.5 Metagenome libraries: a source for novel enzyme activity

More than 99 % of the microorganisms existing in the environment can not be

cultivated in laboratory conditions. Few PCR methods have been devised to overcome this

obstacle but they all suffer from a problem of accessing full genetic diversity of the sample.

Finally, in the late 1990s the metagenomics appeared as a best solution to accessing full

natural diversity of a certain sample.

Metagenomics is based on culture-independent isolation of DNA from environmental

samples (Figure 16). DNA isolation and purification is followed by metagenome library

construction in suitable cloning/expression vectors (plasmids, cosmids, fosmids and bacterial

artificial chromosomes – BACs). Sometimes to increase efficiency of cloning library

enrichment step is performed in laboratory. E. coli is used as a common expression stain.

Finally, library is then screened using two different approaches: a) – sequence based

screening – where degenerated primers are used in PCR reaction and homology sequences

are screened and b) – functional based screening – where activity assay is used in high

throughput format (usually MTPs or solid phase) and novel activity is screened.

Figure 16 Key steps in Metagenomics. Taken over from (49)

Page | 31

2. Phosphorothioate based Ligase-Independent Gene Cloning

(PIGe) development and application for cloning of Cyt P450

BM3

2.1 Introduction

Directed protein evolution, has over the last decades, become a versatile and

successful approach for tailoring protein properties to industrial demands and for advancing

our understanding of structure/function relationships in biocatalysts. In iterative cycles of

diversity generation and functional selection/screening for improved variants, numerous

success stories (e.g. enantioselectivity (50), enzymes for bioremediation (51), vaccines (52))

have been reported. Directed protein evolution employs as host mainly E. coli strains and

requires, in contrast to standard cloning methods, a high number of variants and in ideal

case zero background to generate statistical relevant information on mutational loads,

mutation frequencies and biases.

A high number of robust and powerful gene cloning methods have been published

and validated in the last decades (53). Those methods can, depending on the DNA

preparation, be grouped in Group 1: “fully” enzyme/ligase dependent methods; Group 2:

methods which employ enzyme or ligase in one of DNA preparation/fusion steps and Group

3: completely enzyme/ligase-free methods (Figure 17). Enzyme/ligase based methods (group

1) rely on the activity of restriction enzymes to generate compatible single stranded ends

(“sticky and blunt ends”) and ligase to fuse them. Enzyme/ligase-free methods (group 2 and

group 3) have been developed to address problems often related to restriction cloning

protocols (group 1 methods) due to incomplete enzymatic reactions, laborious handling,

variations in transformation efficiency and “empty” vector background. Group 2 methods

employ either enzymes to generate long complementary sticky ends (6-12 nt; such as. LIC

cloning (54)) or employ ligase only to fuse pre-formed DNA fragments into a final construct

(e.g. TA cloning (55)). Group 3 methods do not employ any enzymes in DNA preparation or in

DNA fusion and are mostly PCR based (i.e. heterostagger cloning (56,57), ligase-free

subcloning (58,59), restriction free cloning (60), TOPO cloning (61)).

The first and most commonly cited LIC (Ligase Independent Cloning)-PCR method

(54), is based on the 3’->5’ exonuclease activity of T4 DNA polymerase. Dependant on DNA

sequence and nucleotides supplemented in reaction mix T4 DNA polymerase exhibits

exonuclease activity. When only one nucleotide is present it reaction mix polymerase starts

to digests single strand of double stranded DNA, starting from 3’ end and stops when it

reaches in the sequence “the one” nucleotide type that is supplemented (54,62). In this way

long single stranded (12 bp) regions are generated. Inserts ranging from 150-3000 bp have

been cloned in pUC119 vector (size 3 kb) with transformation efficiencies up to 2-5x105

cfu/µg vector backbone (54). Alternatives to T4 DNA polymerase comprise exonucleases

Page | 32

(Exonuclease III (42,63), T7 Gene6 Exonuclease (64)) and uracil-DNA glycosylase (65,66).

Commercialized ligase-independent methods comprise: the Gateway system (based on

recombination using bacteriophage lambda integrase/att system, Invitrogen (67)), the In-

Fusion™

system (employing In-Fusion enzyme blend, Clonetech (68)), the LIC kit (based on T4

DNA polymerase digestion, Novagen), and the USER Friendly Cloning Kit (based on uracil-

DNA glycosylase, New England Biolabs (69)).

Figure 17 Overview of commercially available cloning methods. More detailed overview is summarized in a Table X

(Supplementary data)

Reported transformation efficiencies (4.4 kbp: 100 %, 8 kbp: 80 %, 10.3 kbp: 40 % and

13.2 kbp: 20 % (70)) are calculated for small vector like pUC and mostly rely on transforming

DNA isolated using standard mini-prep protocol (compact super-coiled DNA). E. coli

transformation efficiencies are however largely affected by the vector/insert size and

compactness of DNA. Standard vectors in commercial cloning systems and molecular biology

labs are often 5 to 6 kb in size. Additionally, ligated DNA constructs are very relaxed in

structure. Therefore, high transformation efficiencies can only be generated for relatively

short inserts (<2 kb).

Chemical cleavage of DNA fragments offers many advantages over “Km-dependent”

enzymatic systems if specific cleavage chemistry can be developed. The phosphorothioate

chemistry provides the opportunity to specifically cleave phosphorothiodiester bonds with

an efficiency of 70 % per position in presence of ethanol/iodine in alkaline solution (71).

Primers can be ordered with multiple phosphorothioate nucleotides as “phosphorothioate-

tails”.

Page | 33

With PIGe we report a first mutant library cloning system optimized for directed

protein evolution in E. coli. In this report we solved the chemical cleavage challenge by

including multiple phosphorothioate nucleotides and optimizing cleavage conditions,

resulting in a background-free cloning system that is sequence-independent from the gene

of interest and allows cloning of mutant libraries up to sizes of 3.5 kb with efficiencies up to

105 at room temperature with minimized time consumption (10 min) and preparative effort

(no purification of digested fragments required).

2.2 Materials and methods

Chemicals and reagents

All chemicals used in this research were purchased from Sigma-Aldrich (Steinheim,

Germany), Serva (Heidelberg, Germany) and AppliChem (Darmstadt, Germany) and were of

analytical grade unless stated otherwise. Milli-Q water (Millipore, Billerica, MA, USA) was

used in all experiments. All enzymes for molecular biology work were purchased from

Fermentas (St. Leon-Rot, Germany).

Cells and media

Strains used in this research are following. For cloning purposes E. coli XL10-Gold was

used. As expression strains E. coli BL21-Gold (DE3) and E. coli BL21-Gold (DE3) lacIQ1

were

used. All original cell stocks were purchased from Stratagene (La Jolla, CA, USA). E. coli BL21-

Gold (DE3) lacIQ1

strain was produced by Dr Alexander Schenk (Jacobs University Bremen,

Bremen, Germany).

Chemically competent E. coli XL10-Gold, BL21-Gold (DE3) and BL21-Gold (DE3) lacIQ1

cells were prepared as published before (70) with transformation efficiency being 2x108,

1x106 and 1x10

7 cfu/µg pUC19 vector, respectively. All transformations have been done

according to standard protocol (70).

For cell growth LB (Luria Bertani) liquid and agar (1.5 % wt/vol) media was used (53).

Kanamycin was supplemented in final concentration of 50 µg/ml. For expression IPTG was

supplemented in final concentration of 0.5 mM. For preparation of expression agar plates

IPTG was added directly into prepared agar media before solidification. For skim milk agar

plates, 2 % skim milk was supplemented.

Vectors and oligonucleotides

Four vector backbones have been used for cloning purposes in this research. pET-

28a(+) was purchased from Stratagene (La Jolla). It’s homolog harboring gene for

levansucrase (sacB), pET-28a(+)-sacB, has been constructed by Kang Lan (Jacobs University

Bremen, Bremen, Germany). pALXtreme-1a and pALXtreme-1a-sacB have been constructed

and kindly donated by Dr Alexander Schenk (Jacobs University Bremen, Bremen).

Page | 34

pEGFP was purchased from BD Biosciences Clonetech (Heidelberg, Germany). pET-

42b(+)-protease M57 (M57) was courtesy of Ran Tu (Jacobs University Bremen, Bremen).

pCWORI-Cyt P450 BM3 was available from glycerol stock of Schwaneberg group (Jacobs

University Bremen, Bremen).

pUC19 vector has been purchased from Stratagene (La Jolla) and was kept at -80°C.

All vector maps are available in Supplementary data.

All oligonucleotides have been purchased from Operon (Cologne, Germany) in dry

from. Solutions have been made in concentration of 100 µM in 1X TBE buffer (0.1 mM tris-

HCl pH 7.5, 1 mM EDTA) and kept at -20°C. List of all used oligonucleotides is available in

Supplementary data.

DNA electrophoresis was performed on 1 % agarose gels using TAE buffer system (53)

or SB buffer system (72,73) as specified.

I. Restriction cloning of Cyt P450 BM3 gene

Cyt P450 BM3 gene was originally cloned in both vectors, pET28a(+) and pALXtreme-

1a using restriction enzymes (NcoI, BamHI and EcoRI) and ligase (T4 DNA ligase).

Sites for restriction enzymes were incorporated in forward (FP) and reverse primer

(RP) used to amplify target gene from pCWORI vector (Table 1, Supplementary data). PCR

amplification of the target gene was assembled according to the table (prepare 2 tubes of

the following):

Component Volume per PCR reaction (µl) Final concentration

10X Taq buffer 5 1X

dNTP mix (10 mM) 1 0.2 mM each

Forward primer (25 µM) 1 0.5 µM

Reverse primer (25 µM) 1 0.5 µM

2 mM MnCl2 (optional) X -

Template DNA (~100 ng/µl) 1 2 ng/µl

Taq polymerase (5 U/µl) 1 5 U

MilliQ water 40 -

Final volume 50-x -

Cycling was done as following:

Step Temperature (°C) Time (min) Number of cycles

Initial denaturation 94 2 1

Denaturation 94 1

35 Annealing 65 0:30

Extension 72 2*

Final extension 72 10 1 *longer time necessary for epPCR

After the PCR two tubes were pooled together and PCR purification kit (Qiagen) was

used to recover and purify specific PCR product (band should be 3.2 kb). Sample was eluted

Page | 35

in 40 µL of elution buffer. Product was quantified using the NANO Drop (concentration

should be around 100-150 ng/µL). Sample was diluted with Milli-Q water up to 80 µL and

used in the next step. pET28 and pALXtreme vectors were purified using standard plasmid

purification protocol (74) starting from 3 ml of pre-culture. Sample was diluted in 40 µL of 1X

TE buffer and concentration was determined by Nano Drop (around 2000-4000 ng/uL).

Restriction digestion was set up as follows:

Digestion with NcoI/EcoRI

10X Tango buffer 20 µL final concentration 2X

Sample (~40-100 ng/µL) 40 µL 4-10 ng/µL

NcoI (10 U/µL) 1 µL 10 U/reaction

EcoRI (10 U/µL) 1 µL 10 U/reaction

Milli-Q water 38 µL

Final volume: 100 µL

Digestion with BamHI/EcoRI

10X Tango buffer 20 µL final concentration 2X

Sample (~40-100 ng/µL) 40 µL 4-10 ng/µL

BamI (10 U/µL) 2 µL 10 U/reaction

EcoRI (10 U/µL) 1 µL 10 U/reaction

Milli-Q water 37 µL

Final volume: 100 µL

Reaction mix was incubated overnight (37°C). Subsequently enzymes were

inactivated (80°C, 20 min). Samples were purified using PCR Purification Kit (Qiagen) and

eluted in 40 µL elution buffer supplied with the kit. Quantify of the samples was determined

after purification using the NANO Drop (concentration should be around 40-80 ng/µl).

In the tubes with the vector 2 µl of CIAP (Calf Intestine Alkaline Phosphatase) was

added and incubated 2 hours at 37°C. Subsequently enzymes were inactivated at 80°C for 15

min.

Ligation reaction was assembled directly on ice. Components were pipetted in the

following order:

Vector (40-50 ng/µl) 2 µl final concentration 4-5 ng/µl

Insert (80-100 ng/µl) 2 µl 8-10 ng/µl

10X ligation buffer 2 µl 1X

50% PEG 4000 (optional) 2 µl 5%

Milli-Q water 11.8 (13.8) µl

T4 DNA ligase (5 U/µl) 0.4 µl 2 U/reaction

Final volume: 20 µl

Page | 36

Reaction mix was incubated for one hour (16°C or at room temperature) and then

left at 4°C over night. In case of adding PEG T4 DNA ligase was inactivated by incubation

(65°C, 20 min). Aliquot (3-5 µl) was directly transformed into 50-100 µl chemically

competent E.coli cells.

II. MEGAWHOP cloning of Cyt P450 BM3 whole gene and heme domain

For MEGAHWOP two components are required for cloning: 1. vector template

(purified using Plasmid isolation kit (Qiagen), concentration adjusted to 100 ng/µl) and 2.

megaprimer - amplified in the following PCR reaction:


10X Taq buffer (with magnesium) 5 1X




2 mM MnCl2 (optional) x -

Template DNA (~100 ng/µl) 1 2 ng/µl


MilliQ water 40 -

Final volume 50-x -




Denaturation 94 1


Extension 72 2*

Final extension 72 10 1 *longer time necessary for epPCR. Additionally, in case when only heme domain needs to be amplified shorter extension time can be used.

Both megaprimers (Cyt P450 BM3 whole gene and heme domain) were purified using

PCR Purification kit (Qiagen) and concentration was, after measurement with NANO Drop,

adjusted to 200 ng/µl. Final extension reaction was set up as following:

Component I II III IV

10X TLA buffer 20

dNTP (10 mM) 6

MEGAPRIMER (200 ng/µl) 10

Vector template (100 ng/µl) 2.4

Taq/Pfu mix (10:1) 4

Milli-Q water 100

Aliquot 4 x 35.6 µl and add following components.

5 M betaine - 10 - 10

DMSO - - 1.5 1.5

Milli-Q water 14.4 4.4 12.9 2.9

Total volume 50 50 50 50

Page | 37

The following program was run:


“Polishing” 68 5 1


Denaturation 94 1


Extension 68 8

Final extension 68 30 1

Aliquots of all samples (5 µl), before and after PCR were analyzed on SB agarose gels

(120 V, 20 min). Additionally, left over sample was purified using PCR purification kit

(Qiagen) and transformed (3-5 µl) directly into chemically competent E. coli XL10-Gold.

III. Cleavage of phosphorothioate bonds in oligonucleotides using

iodine/ethanol solution – proof of principle

Components were added, according to the Table bellow, in the following order:

phosphorothioated oligonucleotide (Table 1, Supplementary data), Milli-Q water, cleavage

buffer, ethanol and finally iodine in ethanol (5, 50 and 100 mM stock). All the components

were kept on ice while pipetting.

Component Control 1 I II III IV V VI VII VIII Control 2

Sample (µl) 10 10 10 10 10 10 10 10 10 10

Iodine (50 mM) - 0.1+ 0.25

+ 0.5

+ 0.1 0.5 2.5 5 5

* -

Ethanol (100%) 5 4.9 4.75 4.5 4.9 4.5 2.5 - - 5

10 x Cleavage buffer (µl) 5 5 5 5 5 5 5 5 5 5

Milli-Q water (µl) 30 30 30 30 30 30 30 30 30 30

5 min, 70°C

Final volume (µl) 50 50 50 50 50 50 50 50 50 50

Final conc. iodine (mM) 0 0.01 0.025 0.05 0.1 0.5 2.5 5 10 10

Final conc. ethanol (%) 10 10 10 10 10 10 10 10 10 10 + Use 5 mM iodine in ethanol.

* Use 100 mM iodine in ethanol.

Mixed and digested sample (70°C, 5 min) was split in 2 tubes (2 x 25 µl). In one tube

75 µl of Mili-Q water was added and sample was left on 60°C (10 min) on room temperature

(15 min) and then transferred to the vacuum for ethanol to evaporate. This sample was run

on C2/C18 RP-HPLC under standard conditions described bellow in Section 1.

In other 25 µl concentrated loading dye (12.5 µl) was added. Sample was heated

(60°C, 10 min) and analyzed (7.5 µl) on 20 % denaturing poly-acrylamide (PAA) gel as

described bellow in Section 2.

1. Denaturing polyacrylamide (PAA) gel electrophoresis of phosphorothio-

oligonucleotides and digestion products

Denaturing polyacrylamide (PAA) gel was prepared by mixing the following

components in plastic 15 mL Falcon tube:

Page | 38

10% gel 15 % gel 20 % gel

Urea 2.52 g 2.52 g 2.52 g

10 x TAE 0.6 mL 0.6 mL 0.6 mL

40% AA solution 1.5 mL 2.3 mL 3 mL

Water up to 6 mL

All the components were mixed until completely dissolved. If necessary, components

were incubated in water bath at 55-60°C for 10-15 minutes. When all components were

dissolved and well mixed, gel was transferred in small vacuum bottle and degassed until

bubbles were completely gone. After that 4 µl TEMED (kept on ice) and 33 µl 10% APS (kept

on ice) were quickly added.

Gel was mixed slowly by rotating the flask, not to introduce air bubbles. Mixture was

poured in between the glass plates, comb was immersed immediately and gel was let

polymerize for 30 minutes. Wells were washed thoroughly with Milli-Q water before

applying the sample. Once loading the sample gel was run on 150-200 V for 180 minutes in

1X TAE buffer. Staining was done in 1X SYBR Green (Invitrogen) dye diluted in 1X TAE buffer,

with agitation.

Sample was prepared as described. Twenty five µl of sample was mixed with 12.5 µL

of 3X Loading dye with urea. Sample was heat up on 60°C for 10 minutes. Load 2-3 µL on the

gel.

2. Reverse phase (RP)-HPLC chromatography of phosphorothio-oligonucleotides

and digestion products

All the solutions for HPLC have been filtered and degassed before the separation.

Following solutions were used: Milli-Q water (degassed 20 minutes in sonic bath); 0.1 TEA

pH 7.0 (2.77 mL TEA, 1.12 mL glacial acetic acid in 150 mL of Milli-Q water, pH adjusted to

7.0 and then filled up to 200 mL, filtered trough 0.45 µm filter, degassed 20 minutes in sonic

bath) and acetonitrile (HPLC grade).

Following buffers were prepared for separation: Buffer A (95% 0.1 TAE pH 7.0, 5%

acetonitrile (v/v)), Buffer B (85% 0.1 TAE pH 7.0 , 15% acetonitrile (v/v)) and Buffer C (100%

acetonitrile).

C2/C18 RP-HPLC column was connected to Akta Purifier (GE Healthcare). Pumps were

washed with Milli-Q water before starting the analysis. Column was also washed with Milli-Q

water. Then inlets were correctly positioned into the running buffers. Inlet A1 in Buffer A,

inlet B1 in Buffer B and inlet B2 in Buffer C. Pumps were washed again with running buffers.

Column was flushed with buffer C (2 CV), then buffer B (2 CV) and then equilibrated in buffer

A (5 CV). Fifty µl of sample was loaded trough 100 µl loading loop.

Page | 39

Run the following program:

1. Equilibrate column – buffer A – 2 CV

2. Inject the sample

3. Wash unbound sample – buffer A – 2 CV

4. Elution – linear gradient 1 – buffer A/B – 0-60% B in 2 CV

5. Elution – linear gradient 2 – buffer A/B – 60-100% B in 8 CV

6. Wash – buffer B – 1 CV

Flow was kept constant at 0.8 ml/min while detection was absorbance measurement

at 260 nm.

IV. Establishing Phosphorothiate based Ligase-Independent Gene (PIGe)

cloning platform for directed evolution experiments

1. Preparation of templates for vector backbone and gene amplification in PCR

As a template for amplification 4 vectors backbones have been used. Two were

pET28a(+) (5.3 kbp) and its smaller homolog pALXtreme-1a (2.3 kbp). As an option for

“background” free cloning pET28-sacB and pALXtreme-sacB vectors, harboring the selection

gene (coding for levansucrase), were used.

pALXTreme-1a vector is constructed from pET-28a(+) backbone by removing 63 % of

sequence and integrating lacI gene in E. coli BL21-Gold (DE3) genome. All vectors have been

isolated from 4 ml of overnight culture (LBKan, 37°C, 250 rpm) using a standard protocol (74).

Digestion was set up as follows: 40 µl plasmid sample, 20 µl 10X TANGO buffer (Fermentas),

39 µl Milli-Q water and 1 µl EcoRI (10 U/ µl, Fermentas). Mixture was incubated at 37°C for 2

hours after what enzymes were inactivated at 65°C for 15 minutes. Sample was purified

using PCR purification kit (Qiagen) and eluted in 40 µl of EB buffer. Concentration was

adjusted to ~50 ng/µl with EB buffer, aliquoted and stored at -20°C.

For gene amplification plasmids (pEGF for EGFP, pET42-M57 for M57 protease and

pCWORI-P450 BM3 for Cyt P450 BM3) were purified using a standard protocol (74). Samples

were aliquoted and stored at -20°C.

Page | 40

2. Amplification of vector backbones (pET28 and pALXtreme-1a) in LA (Long and

Accurate)-PCR

PCR mix was assembled according to the following table:


10X TLA buffer 10 1X




Betaine (5 M) 20 1 M

Template DNA (~50 ng/µl) 2 100 ng

Taq/Pfu blend* 2 -

MilliQ water 56 -

Final volume 100 2 x 50 µl * Taq/Pfu blend was prepared by mixing 10 µl of Taq stock (5 U/µl) and 1 µl of Pfu stock (0.8 U µl)




Denaturation 94 0:30


Extension 68 10

Final extension 68 10 1

After PCR, 5 µl of each sample was analyzed on agarose-SB gel. Remaining samples

was purified using PCR purification kit (M&N), eluted in 40 µl elution buffer, quantified using

a Nano Drop. Tubes containing pET28 and pALXtreme were subjected to DpnI digestion by

addition of 1 µl of DpnI (20 U/µl) and incubating for 2 hours at 37°C. Inactivated samples

(70°C, 15 min) were purified once more using PCR purification kit (M&N), eluted in 40 µl

elution buffer, aliquoted (5 µl) and kept at -20°C.

Tubes containing pET28-sacB and pALXtreme-sacB were not DpnI digested. They

were purified using PCR purification kit (M&N), eluted in 40 µl elution buffer, aliquoted (5 µl)

and kept at -20°C.

3. Amplification of target genes (EGFP, protease M57 and P450 BM3) in PCR

PCR mix was assembled according to the following table:


10X Taq buffer (with magnesium) 5 1X




Template DNA (~50-100 ng/µl) 1 50-100 ng


MilliQ water 40 -

Final volume 50 - * Taq/Pfu blend was prepared by mixing 10 µl of Taq stock (5 U/µl) and 1 µl of Pfu stock (0.8 U µl)

Page | 41




Denaturation 94 0:30


Extension 72 0:20, 0:30 and 1*

Final extension 72 5 1 * Time is stated for EGFP, M57 and P450 BM3 gene, respectively.

After PCR, 5 µl of sample was analyzed on agarose-SB gel (120 V, 40 min).

Subsequently, all samples were purified using PCR purification kit (M&N), eluted in 40 µl

elution buffer, quantified using a Nano Drop, aliquoted and stored at -20°C. Sample

containing M57 protease was additionally digested with DpnI as described previously.

4. Optimization of iodine concentration needed for phosphorothioated DNA

cleavage

To estimate the amount of iodine needed for phosphorothioate bonds cleavage, 0.01

pmol/µL of vector (pET28) and 0.03 pmol/µL of insert (EGFP) were prepared in Milli-Q water.

Concentrated (10X) cleavage buffer was 0.5 mM tris-HCl pH 9.0 while cleavage solution was

100 mM iodine in 99% ethanol (keep in dark). Reaction mix was set up as follows for both

vector and insert:

# Sample (µL) 10X cleavage

buffer (µL)

Cleavage solution

(µL) 99% ethanol (µL)

Final concentration

of iodine (mM)

1 4 0.5 0.2 0.3 4

2 4 0.5 0.3 0.2 6

3 4 0.5 0.4 0.1 8

4 4 0.5 0.5 - 10

5 4 0.5 - 0.5 0

Samples were mixed, votrexed shortly and spun down. Incubation was at 70°C for 5

minutes in Eppendorf Mastercycler.

Hybridization reaction was assembled by mixing equal amounts (1 µL) of vector and

insert, incubating at room temperature for 5 minutes and transforming total amount (2 µL)

into 40 µL competent XL10-Gold cells (70). Cells were grown as specified under Cells and

media. Three repetitions were done for each iodine concentration. Transformation efficiency

was calculated as number of colony forming units (cfu) per µg of vector backbone and 100

µL of competent cells.

Page | 42

5. Effect of iodine cleavage products on transformation efficiency of E. coli

To test weather iodine or any other component of cleavage mix are affecting

transformation efficiency of E. coli, experiments were designed as follows. Small amount of

pUC19 vector (20 pg) was added to cleavage reaction mix (specified in the table above),

incubated at room temperature for 5 minutes and transformed in 40 µl of competent XL10-

Gold cells. Cells were plated and grown as specified under Cells and media. Three repetitions

were done for each iodine concentration. Transformation efficiency was calculated as

number of colony forming units (cfu) per µg of vector backbone and 100 µL of competent

cells.

6. Effect of vector/insert concentration on iodine cleavage and transformation

efficiency of E. coli

To examine weather vector/insert concentration will have an effect on iodine

cleavage step and subsequently on transformation efficiency of E. coli experiment was

designed as follows. Three different concentrations of the vector (pET28, 0.022, 0.011 and

0.005 pmol/µL) and insert (EGFP, 0.07, 0.04 and 0.02 pmol/µL) were prepared in Milli-Q

water. Reaction mix was assembled according to the table:

# Sample (µL) 10X cleavage

buffer (µL)

Cleavage solution

(µL) 99% ethanol (µL)

Final concentration

of iodine (mM)

1 4 0.5 0.2 0.3 4

2 4 0.5 0.3 0.2 6

3 4 0.5 0.4 0.1 8

4 4 0.5 0.5 - 10

5 4 0.5 - 0.5 0

Samples were mixed, votrexed shortly and spun down. Incubation was at 70°C for 5

minutes in Eppendorf Mastercycler.

Hybridization reaction was assembled by mixing equal amounts (1 µL) of vector and

insert (for each vector/insert concentration respectively), incubating at room temperature

for 5 minutes and transforming total amount (2 µL) into 40 µL competent XL10-Gold cells.

Cells were grown as specified under Cells and media. Transformation efficiency was

calculated as number of colony forming units (cfu) per µg of vector backbone and 100 µL of

competent cells.

Page | 43

7. Cloning of EGFP, M57 and P450 BM3 genes into target vectors using PIGe

From previous set of experiments optimal conditions for cloning using PIGe have

been discovered (6 mM iodine, 10% ethanol). Under these conditions three target genes

(EGFP, protease M57 and P450 BM3) have been cloned into two target vectors (pET28 and

pALXtreme-1a).

Following samples were prepared: pET28 (0.02 pmol/µL), pALXtreme (0.01 pmol/µL),

EGFP (0.03 pmol/µL), M57 (0.04 pmol/µL) and BM3 (0.03 pmol/µL) in Milli-Q water.

Cleavage mix was assembled by mixing 4 µL sample, 0.5 µL 10X cleavage buffer, 0.3 µL

cleavage solution and 0.2 µL 99% ethanol. Incubation was done on 70°C for 5 minutes in

Eppendorf Mastercycler. Cleaved vectors and inserts were mixed in 1:1 ratio (1 µL of each),

incubated on room temperature for 5 minutes and transformed in 40 µL of competent XL10-

Gold cells (70). Cells were plated and grown as specified under Cells and media.

Transformation efficiency was calculated as number of colony forming units (cfu) per µg of

vector backbone and 100 µL of competent cells.

8. Verification of clones by plasmid preparation, analytical digestion, colony PCR

and expression

To check the integrity of the transformants plasmid isolation, analytical digestion and

colony PCR were performed. Plasmid was isolated from 4 ml of overnight culture (LBKan,

37°C, 250 rpm) using a standard plasmid isolation protocol (74). Restriction digestion was set

up as following: 8 µl plasmid sample, 1 µl 10X TANGO buffer (Fermentas) and 1 µl XbaI (10

U/µl, Fermentas). Reaction mix was vortexed spin down and incubated at 37°C for 2 hours.

Enzymes were inactivated at 60°C for 15 minutes. Colony PCR was assembled according to

the following table:


10X Taq buffer 5 1X





Template (plasmid prep) 1

MilliQ water 40 -

Final volume 50 -




Denaturation 94 1


Extension 72 0:20, 0:30, 1*

Final extension 75 5 1 * Extension time is stated for EGFP, M57 and P450 BM3 gene, respectively.

Page | 44

After plasmid isolation, restriction digestion and colony PCR, 5 µl of each sample was

analyzed on agarose-TAE gel (120 V, 30 min).

Plasmids were re-transformed into expression strain E. coli BL21-Gold (DE3) in case of

pET28 and BL21-Gold (DE3) lacIQ1

in case of pALXtreme-1a. Cells harboring a vector with

EGFP gene were spread on induction agar plates (containing IPTG), grown and visualized

under UV light (366 nm). Cells harboring vectors with M57 protease gene were spread on

induction plates with skim milk (2 %), grown and inspected for halo formation. Detail about

growth and media are described under Cells and media.

9. Verification of clones by sequence determination

Sequencing was done by MWG Biotech (Cologne, Germany). Plasmid was isolated

from 4 ml of overnight culture (LBKan, 37°C, 250 rpm) using Mini Prep kit (Qiagen). Sample

was eluted in 40 µl elution buffer and quantified via NANO Drop. Concentration of DNA was

adjusted to ~75 ng/µl with Milli-Q water. Sequencing was done starting from T7 promoter of

pET28/pALXtreme vectors (primer sequence – Supplementary data).

2.3 Results and discussion

I. Restriction cloning of Cyt P450 BM3

As mentioned previously Cyt P450 BM3 has been cloned in both (pET28 and

pALXtreme) vectors using restriction cloning. Restriction sites have been integrated in PCR

primers with few bases overhang to increase efficiency of restriction (Table 1,

Supplementary data). Using restriction cloning with BamHI and EcoRI we achieved

transformation efficiency of 6.8 x 103 cfu/µg vector backbone. On the other hand, cloning

efficiency in restriction cloning was quite low, reaching only ~73 %.

When cloning into pALXtreme higher transformation efficiencies were obtained (up

to one order magnitude more) but problem with low cloning efficiency was still present.

II. MEGAWHOP cloning of Cyt P450 BM3

MEGAWHOP is elegant way of creating mutant libraries (75). It requires gene to be

cloned into target vector and can not be used as an initial construct generation method. We

optimized conditions to obtain MEGAWHOP PCR product (Figure 18).

Page | 45

Figure 18 MEGAWHOP PCR of whole protein (left) and heme domain (right) without additives (I), with betaine (II), with

DMSO (III) and with betaine/DMSO (IV). Left lane is PCR mix before cycling while right lane is PCR mix after cycling.

MEGAWHOP product is marked with blue arrow. M – Molecular weight markers.

In our case, MEGAWHOP gave satisfying cloning efficiency, especially in the case

when only heme domain was mutated. Unfortunately, low transformation efficiency (up to

103) was achieved with this method.

III. Cleavage of phosphorothioate bonds in oligonucleotides using

iodine/ethanol solution – proof of principle

Before devising a strategy for development of new cloning method we needed to test

weather phosphorothioated oligos can indeed be digested with iodine/ethanol solution and

what is the concentration dependence in this cleavage reaction.

Samples (thioated and non-thioated oligonucleotide) have been subjected to

cleavage using different iodine concentration (0-10 mM) while ethanol concentration was

kept constant. From our previous experimental data it has been shown that both iodine and

ethanol concentrations affect the cleavage (data not shown). Due to not fully known

mechanism of cleavage changing both variables (concentration of iodine and ethanol) would

be difficult to optimize. On the other hand, from the supposed mechanism of reaction we

hypothesized that ethanol needs to be added in excess while iodine has catalytic role and

thus, its concentration is more important (Figure 20). We decided to investigate effect of

different iodine concentrations on cleavage.

As mentioned in Materials and methods samples were subjected to cleavage with

iodine/ethanol and then analyzed by PAA denaturing electrophoresis. Visualization was done

by staining with SYBR Green. Control 1 contains phosphorothioated oligo but no iodine (only

ethanol) while control 2 contains non-phosphorothioated oligo in highest concentration of

iodine/ethanol. After PAA separation both control samples gave only one band. This shows

us that none of the phosphorothioate bonds can be digested only by ethanol alone. Iodine is

Page | 46

needed to catalyze the cleavage reaction.

specifically degraded in highest

In samples containing both,

iodine/ethanol, two bands are visible

with increase in iodine concentration

products and it is not sharp since 4

digestion products. These can not

iodine up to 0.5 mM are not su

incubation time. Higher concentrations (>0.5 mM) do

of the bands meaning that this concentration is critical for quantitative digestion.

sample contained 20 µM thioated oligo which would correspond to 80 µM thioated bond

per tube. Judging from our experimental data we

of iodine are needed compared to phosphorothioated bonds

cleavage.

From the control 2 we concluded that iodine can not degrade DNA unless

phosphorothioates are present in the backbone

excess iodine has been added in reaction.

Figure 19 Polyacrylamide gel electrophoresis of phosphorothioated and non

cleavage with iodine/ethanol. Control 1 contains phosphorothioated oligo but no iodine while control 2 contains non

phosphorothioated oligo in highest iodine/ethanol concentration. Other lanes contain phosphorothioated oli

using different concentrations of iodine (0.01

done under UV light (366 nm) aft

We also observed that even in highest iodine/ethanol concentration cleavage is not

complete. This is a consequence of the mechanism of the

we can see from the figure there are three possible r

are giving cleaved products (in our case shorter bands) while the third one substitutes the

sulfur in the backbone with oxygen and actually restores phosphodiester bond. In this case

needed to catalyze the cleavage reaction. Additionally, non-thioated oligo can

ally degraded in highest concentration of iodine (Figure 19).

In samples containing both, phosphorothioated oligo and different concentrations of

, two bands are visible after cleavage (Figure 19). Ratios of the bands change

concentration, as expected. Lower band corresponds to

products and it is not sharp since 4 phosphorothioates are present giving at least 4 differe

digestion products. These can not be well separated on 20% PAA gel. Concentrations

up to 0.5 mM are not sufficient for complete phosphorothioate digestion in 5 min

Higher concentrations (>0.5 mM) do not affect the intensity or distribution

of the bands meaning that this concentration is critical for quantitative digestion.

contained 20 µM thioated oligo which would correspond to 80 µM thioated bond

per tube. Judging from our experimental data we could see that much higher concentration

needed compared to phosphorothioated bonds, for “quantitative” bond

2 we concluded that iodine can not degrade DNA unless

phosphorothioates are present in the backbone. This property can be utilized

excess iodine has been added in reaction.

Polyacrylamide gel electrophoresis of phosphorothioated and non-phosphorothioated oligonucleotide after

. Control 1 contains phosphorothioated oligo but no iodine while control 2 contains non

ed oligo in highest iodine/ethanol concentration. Other lanes contain phosphorothioated oli

using different concentrations of iodine (0.01-10 mM) in constant ethanol concentration (10 % vol/vol). Visualization was

done under UV light (366 nm) after staining with SYBR Green.

that even in highest iodine/ethanol concentration cleavage is not

complete. This is a consequence of the mechanism of the cleavage reaction (Figure

we can see from the figure there are three possible routes in reaction pathway. Two of them



oligo can not be un-

different concentrations of

of the bands change

. Lower band corresponds to digestion

are present giving at least 4 different

. Concentrations of

fficient for complete phosphorothioate digestion in 5 min

not affect the intensity or distribution

of the bands meaning that this concentration is critical for quantitative digestion. In all cases

contained 20 µM thioated oligo which would correspond to 80 µM thioated bonds

see that much higher concentrations

for “quantitative” bond

2 we concluded that iodine can not degrade DNA unless

can be utilized in case when

phosphorothioated oligonucleotide after

. Control 1 contains phosphorothioated oligo but no iodine while control 2 contains non-

ed oligo in highest iodine/ethanol concentration. Other lanes contain phosphorothioated oligo cleaved

10 mM) in constant ethanol concentration (10 % vol/vol). Visualization was

that even in highest iodine/ethanol concentration cleavage is not

reaction (Figure 20). As

outes in reaction pathway. Two of them



Page | 47

product has original length. If all routes are equally substituted, maximum cleavage per

phosphorothioate bond would be 66.7 %.

In our case this means if we want to have quantitative removal of a part of a DNA

multiple phosphorothioate bonds need to be included in this region.

Figure 20 Mechanism of phosphorothioate alkylation and cleavage (71).

Result from PAA analysis was additionally confirmed by RP-HPLC (Figure 21). Samples

prepared in the same manner were, after cleavage, run on C2/C18 RP column under

conditions described in Materials and methods.

Control sample had retention time of 13.23 ml with peak high approx. 40 mAU. With

addition of small concentration of iodine (0.05 mM) cleavage starts and this can be seen by

decreasing the peak height (approx. 20 mAU) while retention time still corresponds to un-

cleaved sample (12.89 ml). Peaks corresponding to cleavage products could not be detected

in this case. In conditions with higher iodine concentrations (0.5 mM and 5 mM) peaks

corresponding to un-cleaved oligo disappeared completely while peak corresponding to

products appeared (10.26 ml and 10.73 ml).

Highest iodine concentration (5 mM), used in this experiment, didn’t degrade DNA.

Retention times and peak heights were comparable with sample with optimal iodine

concentration (0.5 mM).

Page | 48

Figure 21 Chromatogram of RP-HPLC separation of phosphorothioated poly-T oligo cleaved using different iodine

concentrations. Colored curves represent absorbance at 260 nm (blue – no iodine, green – 0.05 mM iodine, brown – 0.5

mM iodine and red – 5 mM iodine). Concentration of ethanol was kept constant (10 % vol/vol).

IV. Establishing Phosphorothioate based Ligase-Independent Gene (PIGe)

cloning platform for directed evolution experiments

As preliminary experiments showed, phosphorothioate bonds included in

oligonucleotide can be specifically cleaved without affecting the rest of the DNA molecule.

Next step was development of novel cloning method based on LIC (54). Primers, for vector

and gene amplification, have been designed in a way that they contain 5’

phosphorothioated tail (12 nucleotides) and vector/gene specific part at 3’ end (Table 1,

Supplementary data). Phosphorothioated sequences in vector and insert primers were

complementary to each other.

Due to complexity and length of vector backbone, amplification only with Taq or Pfu

polymerases alone was unsuccessful, even with addition of DMSO (data not shown). Only

blend of two polymerases was able to amplify long (5.3 kb) vector backbone in LA-PCR

(Figure 22). Yield was drastically increased (more than 2 times) when 1 M betaine was

included in PCR mix. Target genes (EGFP, M57 protease and P450 BM3) were easily amplified

under standard conditions using Taq polymerase. In order to increase transformation

efficiency (TE) with large genes, such as P450 BM3, alternative vector backbone to pET28

was used (pALXtreme, size ~2.3 kbp).

Page | 49

As mentioned previously, both vector backbones have been successfully amplified in

LA-PCR using optimized conditions. Yield per PCR reaction (50 µl) was 6-7 µg DNA. Inserts

have been amplified in PCR using Taq polymerase, as described in Materials and methods.

Yield per reaction (50 µl) was 2-3 µg DNA. Bands of all products, after agarose

electrophoresis and staining, are shown in Figure 22. All products were purified via PCR

purification kit (Qiagen) and quantified using a Nano Drop. Concentrations were as follows:

pET28 385.0 ng/µl (0.11 pmol/µl), pALXtreme 179.0 ng/µl (0.13 pmol/µl), EGFP 159.0 ng/µl

(0.35 pmol/µl), M57 71.6 ng/µl (0.09 pmol/µl) and P450 BM3 62.2 ng/µl (0.03 pmol/µl).

Figure 22 Agarose electrophoresis of EGFP (lane 1), M57 (lane 2) and P450 BM3 (lane 3) amplified in PCR using Taq

polymerase. pET28 (lane 4) and pALXtreme (lane 5) were amplified in LA-PCR using blend of Taq and Pfu polymerase

with addition of betaine. Smearing in the lane 4 and 5 is due to viscosity of the sample caused by the betaine.

As we have seen from preliminary experiments, both concentration of iodine and

ethanol affect the cleavage efficiency. Additionally, concentrations of vector and insert will

affect the cleavage, as well, due to the fact that they are directly proportional to the amount

of phosphorothioate bonds present in the reaction mix. Reviewing the mechanism of

reaction we assumed that iodine is used in the reaction as the catalyst, while ethanol needs

to be supplemented in excess (Figure 20).

Taking all this into account, we decided to optimize iodine concentration needed for

optimal cleavage, while keeping ethanol concentration constant (10 % vol/vol). Amount of

vector and insert were adjusted to 0.01 and 0.03 pmol/µl, respectively. Iodine

concentration, in reaction mixture, was varied from 4 to 10 mM (in 2 mM increments).

Vector and insert were cleaved, both under same conditions, mixed (1:1 ratio) and

transformed in XL10-Gold. Transformation efficiency (TE) plotted over iodine concentration

showed typical bell-shaped form with peak at 6 mM iodine (Figure 23). This indicated the

optimal concentration of iodine which is needed for maximal TE. Peak in TE can also be

explained by the fact that lower concentrations of iodine are not sufficient for quantitative

Page | 50

phosphorothioate-bond cleavage, while higher concentrations are interfering with DNA or

transformation process itself.

0 4 6 8 10

0

1

2

3

4

5

6

7

Iodine concentration (mM)

Transform

ation efficiency

(x104 cfu/ug vector backbone)

Figure 23 Optimization of iodine concentration needed for cleavage of vector (pET28, 0.01 pmol) and insert (EGFP, 0.03

pmol).

In order to investigate weather iodine or any component of cleavage reaction

mixture interferes with TE of the E. coli cells, pUC19 vector was incubated together with the

mix and transformed into E. coli. This could, on one hand, explain the drop in TE with iodine

concentrations >6 mM. On the other hand, if this effect would be minor purification of DNA

out of cleavage reaction mix wouldn’t be necessary.

After incubation of pUC19 (20 pg) and transformation into E. coli, no significant

difference between samples containing different iodine concentrations (4-10 mM) and blank

sample (no iodine), was observed (Figure 24). This means that cleaved DNA can be directly

used in hybridization reaction and transformation. Additionally, it also proves that drop in TE

with iodine concentrations >6 mM could be assigned to nonspecific degradation of DNA.

0 4 6 8 10

0

2

4

6

8

10

12

14

Transform

ation efficiency



Figure 24 Effect of iodine (or any other component of cleavage mix) on transformation efficiency of E. coli with pUC19.

Page | 51

Effects of different amounts of vector and insert on cleavage conditions (iodine

concentration) were also investigated. Different amounts of vector (0.005, 0.01 and 0.02

pmol/µl) and insert (0.015, 0.03 and 0.06 pmol/µl) were cleaved under optimal conditions (6

mM iodine, 10 % ethanol, 70°C, 5 min), hybridized and transformed in E.coli. Smallest

amount of vector/insert didn’t produce any clones, possibly due to low competency of used

cells. In the other two cases, bell-shaped curve was observed for both concentrations of

vector/insert. Maximum TE, in both cases, was reached at 6 mM iodine (Figure 25). This

means that 0.009 pmol of vector is already saturating amount for TE and increasing the

vector amount additionally has no effect on TE. On the other side, number of clones

produced with higher vector amount was two times higher. This is something to keep in

mind when goal is to produce large mutagenesis libraries where final number of clones plays

important role.

0 2 4 6 8 10

0

2

4

6

8

10

12

Transform

ation efficiency



0.018 pmol

0.009 pmol

Figure 25 Effect of vector/insert concentration and iodine concentration of transformation efficiency of E. coli with

cleaved and hybridized pET28 and EGFP.

Using optimal conditions established from previous experiments (0.01 pmol vector,

~0.03 pmol insert, 6 mM iodine, 10 % vol/vol ethanol, 70°C, 5 minutes) three target genes

(EGFP, M57 and P450 BM3) were successfully cloned in pET28 and pALXtreme (Figure 26).

Transformation efficiency in case of smaller vector backbone (pALXtreme, 2.3 kbp) was one

order magnitude higher than compared to pET28 (5.3 kbp). Maximum TE reached 8 x 105

cfu/µg vector, in case of small gene (EGFP), and 0.9 x 105 cfu/µg vector in case of P450 BM3,

when employing pALXtreme for cloning. This TE was sufficient for directed evolution

experiments.

Page | 52

Blank EGFP M57 BM3

0.0

0.2

0.4

0.6

0.8

2

4

6

8

10

Transform

ation efficiency


pALXtreme-1a

pET-28a(+)

Figure 26 Cloning of three target genes EGFP (0.7 kbp), M57 protease (1.3 kbp) and P450 BM3 (3.2 kbp) in two target

vectors, pET28 (5.4 kbp) and pALXtreme (2.3 kbp) using optimized conditions for PIGe.

Clones were validated by plasmid isolation, restriction digestion (XbaI) and colony

PCR. Expression test was performed directly on induction agar plates after re-transformation

in expression strain (BL21-Gold (DE3) for pET28 and BL21-Gold (DE3) lacIQ1

for pALXtreme).

Sequencing was performed to prove that iodine and ethanol cause no changes is DNA

structure (deamination, oxidation). All clones tested (20 of each construct) showed correct

plasmid size after plasmid isolation and additionally after digestion. Colony PCR proved that

all clones harbor target genes, achieving cloning efficiency of 100 %. All clones harboring

EGFP gene after induction showed green fluorescence when visualized under UV light (366

nm, Figure 27A). Also, all clones harboring M57 protease formed halo after induction on

skim milk agar plates (Figure 27B).

Page | 53

Figure 27 Expression test of clones harboring EGFP gene in pET28 (A, left) and pALXtreme (A, right) vector. Green

fluorescence is visualized under UV light (366 nm).

At the end 9 kbp of DNA from different construct was sequenced. Only one mutation

was found which would correspond to error rate of Taq polymerase used in amplification of

these genes (77). Additionally, this mutation was transition (A->T) showing the bias of the

polymerase.

2.4 Conclusion

High throughput screening technologies have in the recent years been advanced

rapidly and allow to routinely screen >106 variants in less than one hour employing for

instance in-vitro compartmentalization technology and flow cytometry (78). Directed protein

evolution experiments comprise iterative cycles of diversity generation and high throughput

screening. Directed evolution experiments require therefore robust cloning and

transformation protocols to generate large mutant libraries (105-10

6) in order to increase the

likelihood to find variants that are improved in the targeted property. Figure 17 categorizes

the existing cloning technologies in three groups depending on the method employed for

DNA digestion/preparation and subsequent DNA fusion. Group 1 and group 2 methods

employ enzymes for primer digestions and/or ligase for DNA fusions and are therefore

limited in their completeness by Km values of employed enzymes. In order to maximize the

number of mutant variants the existing cloning technology was advanced by introducing a

chemical cleavage reaction of phosphorothioate bonds in aqueous solution in presence of

Page | 54

iodine and ethanol and thereby avoiding any enzymatic digestion or ligation step. Figure 28

illustrate the principle of PIGe.

Figure 28 Principle of PIGe cloning technology (A). Comparison of 5’-3’ phosphodiester and 5’-3’ phosphothioate linkage

(B).

Key to success and robustness of PIGe was the introduction of subsequent

phosphorothioate bonds (12 nts) in the cloning primers since the iodine-ethanol cleavage

reaction has an efficiency of ~70 % per phosphorothioate position. A iodine concentration of

6 mM in presence of 10 vol% ethanol proved to be efficient in the cleavage reaction (70°C, 5

min, 0.05 M tris, pH 9) and iodine did not effect negatively transformation efficiency (see

control in Supplementary data). Restriction analysis of 240 variants yielded for all three

investigated genes (BM3, M57, EGFP) and both vectors (pET-28 and pALXtreme) only

transformations with inserts of correct size. Sequencing of in total 9 kb showed 1 mutations

(transition bias) which are close to reported mutation frequencies of employed Taq-

polymerase. The PIGe primers were designed to hybridize with the vector-backbones of pET-

28 or pALXtreme. Hybridization within the vector backbone enables to develop cloning

systems that are gene independent using vectors which can be amplified well. A further

advantage of PIGe compared to existing cloning technologies (Figure 17, Supplementary

Table 1, Supplementary data) is the rapid cloning procedures which require 10 min for

digestions and hybridization without any purification step. Cleaved primer fragments

containing phosphorothioate bonds did slightly reduce the cloning efficiency (7.4 vs 5.8x104

cfu/µg) likely because the cleaved primer tails consisting of phosphorothioates (12 nt) are

cleaved in a multiple manner resulting in small sized fragments which do not hybridize at

room temperature. Two further advantages of PIGe are: A) background-free cloning and B)

Page | 55

robustness in handling since hybridization is exclusively driven by H-bond formation

between complementary DNA sequences. These two attributes are important prerequisite

for developing successful strategies in directed evolution experiments through determining

mutational loads and fraction of active clones. Since the transformation efficiencies for long

genes like BM3 were insufficient (~0.9x104 cfu/µg) a shortened vector pALXtreme was

generated increasing the transformation efficiency to (~9x104 cfu/µg) in E. coli. Figure 26

shows that reducing the vector size by 3 kb (pET-28; 5.3 kb // pALXtreme; 2.3) boosted the

transformation efficiency by an order of magnitude.

Supplementary Table 1 in the Supplementary data summarizes, mainly for

commercialized methods, the key performance parameters (transformation efficiency,

cloning efficiency, time requirement, handling effort and general applicability (sequence

dependency)) and introduces briefly their cloning principles. PIGe performs competitively to

commercialized methods in terms of transformation (8x105 cfu/µg (PIGe) vs 5x10

5 cfu/µg

(LIC; Table XY) and cloning efficiencies (>95 %). Most commercialized cloning methods

employ small vectors (<3 kb; pUC derivates) and small inserts (<2 kb) for benchmarking their

performance. PIGe is advantageous is terms of time requirement and robustness in handling.

PIGe is furthermore one of few other cloning methods (exonuclease, In-Fusion, restriction-

free, ligase-free cloning; see Supplementary Table 1, Supplementary data) that are sequence

independent.

In summary we hope that the efficient PIGe cloning technology will assist many

researchers to succeed in directed evolution experiments by obtaining with minimal effort

high numbers of transformants, allowing statistical analysis and comparison of mutational

loads in directed evolution experiments. Furthermore a patent has been filed for employing

PIGe in mutant library generation through DNA fusion, metabolic pathway engineering and

gene assembly which seem further attractive applications of the PIGe cloning technology.

3. Expression and purification of Cyt P450 BM3

3.1 Introduction

Cytochrome P450s, especially eukaryotic ones, are membrane bound proteins

containing heme in their catalytic core. Expression of such proteins in heterologous hosts,

especially in bacteria, is somewhat difficult without modifications of enzyme on its amino

terminus. Using E. coli as an expression host usually leads to improper protein folding and

formation of inclusion bodies. Additionally, proper incorporation of heme into functional

enzyme is a problem by itself. On the other hand, prokaryotic P450s are fusion proteins,

containing both - heme domain and diflavin reductase in one polypeptide chain. More

importantly, they are cytosolic enzymes which make them very water soluble. Expression of

prokaryotic P450s in E. coli has been well established using many different expression

systems leading to high levels of produced enzyme.

Page | 56

Table 4 Overview of expression systems for Cyt P450 in

Most of the systems for high

(Table 4). pCWori is inducible vector under control of

temperature-inducible vector. Lately, there are reports about cloning of P450 variants into

pET28 vector (80,81)(see also

more stable, giving less expression background due to two control points

polymerase and lac promoter (Figure

Figure 29 Expression control in pET28 (left) and

Disadvantage of pET vectors is their big size, being between 5.5 an

containing large BM3 gene (~3.2 kbp) are drastically decreasing the transformation efficiency

of E. coli (down to 103 cfu/µg vector backbone

Overview of expression systems for Cyt P450 in E. coli host. Taken over from (79).

Most of the systems for high-level expression include pCWori and pCYTEX vectors

). pCWori is inducible vector under control of lac promoter while pCYTEX is

inducible vector. Lately, there are reports about cloning of P450 variants into

(see also Chapter 2). Compared to the others, pET expression system is

more stable, giving less expression background due to two control points

promoter (Figure 29, left)

Expression control in pET28 (left) and pALXtreme (right) vectors. Adapted from pET System Manual

Edition, Novagen).

Disadvantage of pET vectors is their big size, being between 5.5 an

large BM3 gene (~3.2 kbp) are drastically decreasing the transformation efficiency

cfu/µg vector backbone, see Chapter 2). Smaller vector backbone

level expression include pCWori and pCYTEX vectors

promoter while pCYTEX is

inducible vector. Lately, there are reports about cloning of P450 variants into

). Compared to the others, pET expression system is

more stable, giving less expression background due to two control points – T7 RNA

pET System Manual (11th

Disadvantage of pET vectors is their big size, being between 5.5 and 6 kbp. Constructs

large BM3 gene (~3.2 kbp) are drastically decreasing the transformation efficiency

Smaller vector backbone

Page | 57

would be preferred for cloning of large genes. pALXtreme vectors are modified pET vectors

where 63 % of the non-crucial sequences have been deleted (Dr Alexander Schenk,

unpublished data). Additionally, lacI gene has been transferred to genome of E. coli host

under the control of Q1 promoter (Figure 29, right). In this way, BL21-Gold (DE3) lacIQ1

expression strain has been generated. This system drastically improved transformation

efficiency (see Chapter 2) keeping all the advantages of good and stable expression system.

Expression system, if it was to be used for ultra-HTS based on flow cytometry has to

posses few important properties:

1. Expression needs to be inducible;

2. Background expression has to be low;

3. Induction of target protein must not affect cell growth;

4. Expression level of target protein has to be easily fine-tunable.

First three properties are especially important for the expression of cell toxic proteins

like P450s. Expression system needs to be established in a way that cell growth is unaltered

both when protein induction doesn’t occur and when protein of interest is induced.

Otherwise there would be a big difference, when growing a library, between cells expressing

functional or improved target genes, which would grow much slower, compared to the cells

carrying “dead” genes or no target genes at all. Last mentioned point is important for fine-

tuning of the activity signal in double emulsions. Usually, due to high sensitivity of the flow

cytometer and double emulsion system expression level of the expressed enzyme has to be

low. This decreases stress applied on the cell due to synthesis of heterologous proteins but

also due to concentration of reaction product in cytosol (especially if the reaction products

are toxic for the cell). Opposite to flow cytometry for MTP screening much higher protein

levels are needed for activity detection.

Due to their associations with the membrane, mammalian P450s are difficult to

purify. Usually, whole membrane preparations are used for the conversion experiments. On

the other hand, prokaryotic P450s including BM3 are water soluble and therefore easily

purified using different chromatography methods. There are reports of purification of BM3

using anion-exchange chromatography with step salt elution (82) and combination of

hydrophobic/size exclusion chromatography (83). Anion-exchange chromatography using

DEAE matrix and FPLC (Fast Protein Liquid Chromatograpy) present reproducible, easy, cost-

effective way to isolate P450 BM3. Method can be optimized for high purity (85-95 %) and

high amount of protein in single step purification.

In this Chapter we describe optimization of conditions for small scale (flow cytometry

application) and high scale (purification application) expression of Cyt P450 as well as

expression in MTPs. Two different expression systems have been used – BL21-Gold

(DE3)/pET28 and BL21-Gold (DE3) lacIQ1

/pALXtreme. We determined that media plays

Page | 58

important role in expression with an influence on cell growth as well as on protein activity.

Additionally, in this Chapter, optimized protocol for purification of P450 BM3 has been

described. It is based on previously published protocol by Schwaneberg et al. with a

difference that combination of step and gradient salt elution was used. High purity (90-95 %)

of protein obtained was sufficient for kinetic characterization.



All chemicals used in this research were purchased from Sigma-Aldrich (Steinheim,


analytical grade unless stated otherwise. Milli-Q water (Millipore, Billerica, MA, USA) was

used in all experiments.

Cells and media

For optimization of expression of Cyt P450 BM3 two strains were used: BL21-Gold

(DE3) carrying pET28-Cyt P450 BM3 F87A and BL21-Gold (DE3) lacIQ1

carrying pALXtreme-Cyt

P450 BM3 F87A.

LB (Luria Bertani) media was used for pre-culture preparation, cell growth and

expression (53). TB (Terrific Broth) was used as a standard rich media for expression (53).

Auto-induction media (MD-5052, LSG-5052, P-5052 and TYM-5052) were used for protein

expression in high density cultures (84). All media were supplemented with kanamycin (50

µg/ml) to enable selection of cells harboring pET28/pALXtreme vectors. Additionally, in

some cases medium was supplemented with δ-amino levulinic acid (ALA, 0.5 mM) and

thiamine (0.5 mM) to enhance cofactor production. Trace elements (TE), as a source of iron

for heme biosynthesis, were added when stated (53).

Vectors

pET28 vector with Cyt P450 BM3 gene was constructed using restriction cloning (as

described in Chapter 2) while gene was inserted in pALXtreme using PIGe cloning (as

described in Chapter 2).

I. Small scale expression (4 ml) of Cyt P450 BM3 from BL21-

Gold(DE3)/pET28 system in auto-(MD-5052, LSG-5052, P-5052 and TYM-

5052) and non-auto induction media (TB)

BL21-Gold (DE3) carrying pET28 vector with Cyt P450 BM3 F87A gene was used. Cells

were grown overnight (4 ml LBKan, 37°C, 250 rpm, 16 h) and used as a pre-culture. Auto-

induction media (MD-5052, LSG-5052, P-5052 and TYM-5052) were prepared as described in

Cells and media. As standard control TB media was used.

Page | 59

For MD-5052 media, pre-culture was inoculated in specified dilutions (1:50, 1:100

and 1:200) and expression was continued for 14 hours (37°C, 250 rpm). For other auto-

induction media only 1:100 dilution of pre-culture was used. In case of TB media, pre-culture

was inoculated in 1:100 dilution, grown for 2 hours (OD600~0.6-0.9, 37°C, 250 rpm), induced

with IPTG (0.5 mM) and expression was continued for additional 12 hours (37°C, 250 rpm).

In 2 hour interval 25 µl of cell suspension was taken and centrifuged (8000 rpm, 3

min). Wet cell mass (WCM), as a measurement of cell growth was calculated from difference

of tube containing a cell pellet and empty tube using analytical scale.

Optical density at 580 nm (OD580) was measured using TECAN Sunrise in 100 µl of cell

suspension. For activity determination sample of cell suspension (100 µl) was centrifuged

(8000 rpm, 3 min) and re-suspended in the same volume of 0.1 M phosphate buffer pH 9.

Assay was set up by mixing 25 µl of cell suspension with 40 µl of reaction mix (80 mM

phosphate pH 9, 450 µM PMB, 187 µM BCC and 1 mM NADPH). Fluorescence (exc. 400 nm,

em. 440 nm) was monitored for 15 minutes (1 minutes interval) using TECAN Safire. Slope

(AU/min) was calculated for first 10 minutes of reaction (linear range).

II. Small scale expression (4 ml) of Cyt P450 BM3 from BL21-

Gold(DE3)/pET28 and BL21-Gold(DE3) lacIQ1

/pALXtreme system in auto-

induction media (MD-5052)

In this case two different cell/expression systems were used. BL21-Gold (DE3) cells

were used for expression of Cyt P450 BM3 F87A gene from pET28 vector, while BL21-Gold

(DE3) lacIQ1

cells were used for the expression of the same mutant from pALXtreme-1a.

Pre-culture as prepared as described in Part I. Auto-induction media (4 ml MD-5052)

was inoculated with different dilutions of pre-culture (1:25, 1:50 and 1:100) and protein was

expressed for 12 hours (30 and 37°C, 250 rpm).

Optical density (OD600) and expressed enzyme activity were determined as described

previously (Part I).

III. Small scale expression (3 ml) of Cyt P450 BM3 from BL21-


/pALXtreme system in non

auto-induction media (TB)

For this experiments following cell/expression systems were used. For expression of

Cyt P450 BM3 139-3 mutant from pET28 vector, BL21-Gold (DE3) strain was used. For the

expression of the same mutant from pALXtreme-1a vector, BL21-Gold (DE3) lacIQ1

strain was

used.

Pre-culture was prepared as described in Part I. Dilution (1:100) of pre-culture was

inoculated in 3 ml TBKan media with supplements (specified under Cells and media) and

Page | 60

grown (37°C, 250 rpm, 2 h) in pre-induction phase. Cells were induced with addition of IPTG

(0.5, 0.05 and 0.005 mM) and grown for another 8 hours (30 and 37°C, 250 rpm).

Optical density (OD600) and activity measurements were done as described previously

(Part I).

IV. Expression (4 ml) of Cyt P450 BM3 from BL21-Gold(DE3)

lacIQ1

/pALXtreme system under inducing and non inducing conditions

(LB)

For the pre-culture BL21-Gold (DE3) lacIQ1

strain harboring pALXtreme P450 BM3

F87A was used. Pre-culture was prepared as described in Part I. Different dilutions of pre-

culture (1:25, 1:50, 1:100 and 1:500) were inoculated in 4 ml LBKan media. Media was

supplemented with ALA (0.5 mM), thiamine (0.5 mM) and trace elements (1X). Inducer was

also supplemented directly into media (5, 50 and 500 µM IPTG). Cell growth and enzyme

expression was monitored for 24 hours (30°C, 250 rpm).

Optical density (OD600) and activity measurements were done as described previously

(Part I).

V. Large scale expression (200 ml) of Cyt P450 BM3 from BL21-Gold

(DE3)/pET28 system in auto- (MD-5052, TYM-5052 and LSG-5052) and

non auto-induction media (LB and TB)

BL21-Gold (DE3) cells carrying pET28 P450 BM3 F87A were used. Media was

prepared as described under Cells and media. Overnight culture was prepared (4 ml LBKan,

37°C, 250 rpm, 16 h) and used to inoculate 1 l flasks, each containing 200 ml different media

(LB, TB and auto-induction media MD-5052, TYM-5052, LSG-5052). Dilution of the pre-

culture was 1:100. Media was supplemented with 0.5 mM ALA. Cultures were grown at 200

rpm and 30°C and 37°C, respectively. Induction in TB and LB media was achieved by addition

of 0.25 mM IPTG after the culture reached OD600 of 0.6-0.9. Expression was monitored for 14

hours.

Samples were taken at intervals of 2 hours and OD600 measurements made with

Specord 200 UV/Vis spectrophotometer (Analytik Jena). Activity was detected by performing

an assay as follows. Twenty five micro liters of cell suspension was centrifuged (8000 rpm, 3

min); supernatant was discarded and pellet was re-suspended in 55 µl 0.1 M phosphate

buffer pH 9. Five micro liters of PMB (3.6 mM) were added together with 1 µl DBCC

substrate (10 mM in DMSO). Sample was incubated for 5 minutes at room temperature.

Four micro liters of NADPH (10 mM) were added to initiate the reaction. Fluorescence was

measured in TECAN Safire (exc. 400 nm, em. 440 nm) after 10 minutes.

Page | 61

VI. Expression of Cyt P450 BM3 from BL21-Gold(DE3) lacIQ1

/pALXtreme

system in microtiter plates

For expression in 384-well format deep well plates (Eppendorf) were used. Cells,

harboring vector with Cyt P450 BM3 F87A gene, were picked directly from the agar plate

using sterile tooth picks into wells containing 200 µl LBKan media. Cells were grown until

saturation (37°C, 900 rpm, 70 % humidity, 16 hours). Glycerol stock was prepared by adding

50 µl sterile 50 % glycerol and freezing the plate on -80°C (Master plate). Master plate was

replicated into Assay plate and grown (TBKan media, 5 µM IPTG, 30°C, 700 rpm, 70 %

humidity) for 12 hours. Assay was done after transferring cell pellet into black flat bottom

384-well plate.

For expression in 96-well format Master plate was prepared as follows. Cells,

expressing Cyt P450 BM3 F87A variant, were picked directly from agar plates into 150 µL

LBKan media and grown until saturation (37°C, 900 rpm, 70 % humidity, 16 hours). Glycerol

stock was prepared by adding 50 µl of sterile 50 % glycerol and freezing the plate on -80°C.

Assay plate was prepared by replicating Master plate directly into black flat bottom 96-well

plate containing 150 µl media. LB media without and with 5 µM IPTG was used to test the

expression (30°C, 700 rpm, 70 % humidity, 14 hours). Assay was done directly after pelleting

the cells (4000 rpm, 10 min, 4°C).

VII. Purification of Cyt P450 BM3 using DEAE ion-exchange chromatography

with gradient elution of salt

For purification, Cyt P450 BM3 was expressed on large scale (250 ml) as described in

Part VI. After expression cells were pelleted by centrifugation (4000 rpm, 10 min, 4°C). Pellet

was well re-suspended in 15 ml lysis buffer (10 mM tris-HCl pH 7.8) by vortexing and

pipetting up/down. Cell suspension was passed trough French press (3 passes, 1500 bar).

Cell debris was removed by centrifugation (14000 rpm, 10 min, 4°C). Additionally, sample

was cleared by filtration (Millipore filter, 0.45 µm).

Sample (10 ml) was loaded on DEAE-ion exchange column equilibrated in 100 mM

tris-HCl pH 7.8 (buffer A). Flow was kept constant (5 ml/min). Detection was absorbance set

up for total proteins (280 nm) and for heme proteins (417 nm). Unbound sample was

washed with 2 CV of buffer A. Gradient of buffer B (100 mM tris-HCl pH 7.8 with 2 M NaCl)

was adjusted to 5 % and loosely bound proteins were washed out (2 CV). Then linear

gradient 5-20 % was set up in 5 CV. Cyt P450 BM3 was eluted in this region. After 20 % B

gradient was adjusted to 100 % B in 2 CV and washing of the column (100 % B) was

continued for another 2 CV. At the end, column was washed with buffer A, then with Milli-Q

water and kept in 20 % ethanol.

Page | 62

Fractions containing Cyt P450 BM3 were pooled together and analyzed by SDS-PAGE

for purity (85). Total protein concentration was determined using commercial BCA Protein

Kit (Pierce). Concentration of Cyt P450 BM3 was determined with CO binding assay (86).


I-VI. Expression of Cyt P450 from pET28 and pALXtreme vectors using

different media

Auto-induction media presents an elegant solution for expression of proteins under

the control of T7 promoter (84). Media is supplemented with dual sugar source, glucose and

lactose. After glucose, being the favored sugar source, is consumed cell are forced to switch

to lactose as an alternative energy source. On the other side, lactose serves as an inducer for

T7 promoter, so protein expression starts automatically.

We tested Cyt P450 BM3 expression in three different auto-induction media (L-5052,

P-5052 and MD-5052) as well as one non-induction media (TB) where expression needs to be

initiated by addition of inducer (IPTG). Growth and activity curves are shown in Figure 9

(Supplementary data). Cell growth (proportional to CWM) was most pronounced in TB and

TYM-5052 media, both being rich source media. From minimal media, MD-5052 showed best

performance regarding cell growth. Increase in protein expression (activity) was most

pronounced in TB media between 2-6 hours, while in other media activity was only marginal.

After 6 hours of expression in TB media drop of activity is detected. In all auto-induction

media expression started somewhat later (between 6-8 hours) and kept constant level

during the monitored time (14 hours). From data presented here MD-5052 was chosen as

the most suitable for expression of P450 BM3.

In the next experiment, expression of P450 BM3 was tested using two expression

systems pET28/BL21-Gold (DE3) and pALXtreme/BL21-Gold (DE3) lacIQ1

. Not so much

literature data is available for expression from lacIQ1

strains but we expected that conditions

would need to be slightly adjusted compared to pET28 system. In these experiment

constructs generated using PIGe cloning platform were used. Distance between ribosome

binding site (RBS) and beginning of the gene was adjusted to optimal, and we expected that

this would additionally affect expression. Media was MD-5052 and different pre-culture

dilutions were used (1:25, 1:50 and 1:100). Expression was tested on 30 and 37°C. Lower

temperatures are known to increase yield of expressed proteins from T7 promoter system

(Invitrogen pET System Manual). BL21-Gold lacIQ1

strain showed similar growth speed on

both temperatures, while growth of BL21-Gold strain was much slower at 30°C. Regarding

the protein expression, in both cases expression was much higher at lower temperature, as

expected. Growth and activity curves are shown in Figure 10/11 (Supplementary data).

Expression of protein from pALXtreme vector, on the other side, was quite low on both

temperatures, showing that auto-induction media maybe is not the best option for optimal

Page | 63

expression. Additionally, when tested for expression in 96-well MTP format auto-induction

media (MD-5052) showed very high standard deviation of cell growth, reaching up to ~50 %.

In order to reduce standard deviation in MTP and to be able to control expression

easier in tube format, we decided to use non-inducing rich media (TB). Pre-culture was

inoculated, grown for 2 hours at 37°C for cells to reach optimal OD for expression (0.6-0.9)

and then induced with addition of IPTG. We used different concentrations of IPTG (5, 50 and

500 µM) and two different expression temperatures 30 and 37°C. Growth and activity curves

are shown in Figure 12/13 (Supplementary data). In case of BL21-Gold/pET28 system growth

of cells was the same at both temperatures, unaffected by the addition of inducer.

Nevertheless, expression was lower at 37°C. In case of pALXtreme/BL21-Gold lacIQ1

expression system low expression level was observed on 37°C. In case when 500 µM IPTG

was used (recommended conditions, Invitrogen pET System Manual) no activity could be

seen at all. Additionally, here we observed negative effect of inducer on cell growth. Higher

concentrations of inducer hampered the cell growth. On both temperatures, drop in activity

was observed after 6-8 hours of expression. One explanation could be that high protein

concentration in cytoplasm lead to inclusion body formation. We could confirm this partially

by SDS-PAGE showing that band from expressed protein was present in soluble fraction at

the beginning of expression, while the activity was high and after prolonged incubation most

of the protein was in insoluble fraction (drop in activity).

At the end, as we concluded from many previous experiments, for flow cytometry

system we need to have expression system which would satisfy the following conditions:

1. Expression needs to be inducible, especially in the case of proteins which are toxic

for cells or could use cellular metabolites (i.e. NADPH) and hamper the cell growth;

2. Expression doesn’t need to yield high amount of protein, since detection on flow

cytometry is very sensitive;

3. Expression has to be timed in a way that preparation of sample and screening on

the flow cytometer would be possible in the same day.

From IVC/flow cytometry literature we found out that even low amount of enzyme,

leaked from the vector, would be sufficient for detection by flow cytometry. System was

tested as follows. Cells were inoculated in simple media (LB) with or without

supplementation of inducer, for comparison, and grown on 30 and 37°C. Activity and OD

were measured in 24 hour period. Again, in case when 500 µM IPTG was used as an inducer

cell growth was affected, while in case of other two concentrations. Growth and activity

curves are shown in Figure 14 (Supplementary data).

Growth and activity curves for large scale, batch (250 ml) expression of Cyt P450 BM3

are shown in Figure 15 (Supplementary data).

Page | 64

For verification of flow cytometry screening and assay in MTP format we tested

expression in deep well 384-well MTP and flat bottom 96-well MTP. Cell growth and

expression level showed high standard deviation (>50 %) when 386-well MTP were used. For

expression in 96-well plates there was no need to used deep well plates since sensitivity of

the assay was sufficient to detect enzyme expressed in 100-150 µl media.

For minimizing standard deviation coming from media evaporation during incubation

different sealing techniques were tested. Results of cell growth and standard deviation are

shown in Table 5. Smallest standard deviation of growth was in the case when MTP plate

was sealed with plastic sticky tape.

Table 5 Standard deviation of cell growth in 96-well MTPs sealed with different types of sealers.

Type of sealing Average OD600 Standard error Standard deviation (%)

Commercial plastic sealer 0.697 0.23 32.99

Parafilm 1.083 0.14 12.93

Plastic sticky tape 1.223 0.02 1.63

Semi permeable film 1.138 0.04 3.51

We chose LB media as expression media in this case, and tested expression without

inducer and in the presence 5 µM IPTG. Standard deviation of the assay is shown in Figure

30. There was a decreasing trend in standard deviation in time due to the fact that

fluorescence intensity was increasing while measurement and other errors remained the

same in the time. Ninety minutes was chosen as optimal for activity measurement in 96-well

MTP assay.

0 20 40 60 80 100 120

0

5

10

15

20

25

30

35

40

Standard deviation (%)

Time (min)

no IPTG

with 5 µM IPTG

Figure 30 Standard deviation (%) of assay in 96-well MTP during the incubation.

Page | 65

VII. Purification of Cyt P450 BM3 using DEAE ion-exchange chromatography

with gradient elution

Cyt P450 BM3 has previously been purified using DEAE ion-exchange

chromatography with the step elution of salt (82). We slightly modified the protocol in a way

that gradient elution was used.

First, loosely bound proteins are washed out with 5 % buffer B in 2 CV. Cyt P450 BM3

is eluted in ~10 ml of elution buffer, at linear gradient of buffer B (5-20 % B), well separated

from other contaminating proteins (Figure 31).

Figure 31 Chromatogram of purification of Cyt P450 BM3 Wt. Blue line indicates absorbance of total protein (280 nm),

red line indicated absorbance of prosthetic group (heme, 417 nm), green line represents fraction of the buffer B (%) while

brown line is conductivity (mS/min).

Purity of the protein was estimated to 90-95 % using SDS-PAGE (Figure 32). Result

was confirmed by comparing concentrations of total proteins (determined with BCA

method) and concentration of Cyt P450 BM3 (determined with CO binding method).

Page | 66

Figure 32 SDS-PAGE comparison of Cyt P450 BM3 purified by previously published ion

et al. (lane 2 and 3) and our optimized protocol (lane 3).

After chromatography protein purity was sufficient for kinetic characterization.

3.4 Conclusion

Expression of Cytochrome P450 in heterologous hosts (

problematic due the presence of hydrophobic “docking” region. Removing or modifying this

amino terminal region leads to higher expression

formation. Additional problem with Cytochrome

active site. Cytochromes are mostly expressed in

have a functional enzyme reductase domain has to be expressed in the same host

Cytochrome P450 BM3 is

and purification much easier. P450 BM3 has been expressed in

using a series of different vectors, pCWORI, pCTEX, pET28 etc. Each vector possesses

different induction system and offers some advantages and disadvantages compared to the

others. pCWORI is the commonly used, high yield, expression vector under the control of

promoter. This vector has been used in most directed evolution experiments, also in our

laboratory. Due to control over

background activity. Also, problems in site directed and site saturation

protocols have been reported

PCR (data not shown).

pET system offers many advantages. First, expression i

points, lac promoter and T7 RNA polymerase (Figure

background. Vectors are commercially available and offer many

(multiple tags, different resistance). Expression

M 1 2 3 4

PAGE comparison of Cyt P450 BM3 purified by previously published ion-exchange method by

(lane 2 and 3) and our optimized protocol (lane 3). Lane 4 is non purified sample (cell homogenate

molecular weight markers (Fermentas).


Conclusion

Expression of Cytochrome P450 in heterologous hosts (E. coli, S. cerevisia


amino terminal region leads to higher expression levels and prevents inclusion body

formation. Additional problem with Cytochrome P450 expression is incorporation of heme in

active site. Cytochromes are mostly expressed in E. coli using pCWORI vector. In order to

have a functional enzyme reductase domain has to be expressed in the same host

3 is a self-sufficient water soluble enzyme making its expression

and purification much easier. P450 BM3 has been expressed in E. coli as a heterologous host


uction system and offers some advantages and disadvantages compared to the

others. pCWORI is the commonly used, high yield, expression vector under the control of


aboratory. Due to control over lac promoter expression is “leaky”

background activity. Also, problems in site directed and site saturation

protocols have been reported due to the difficult amplification of the vector backbone

pET system offers many advantages. First, expression is regulated by two control

and T7 RNA polymerase (Figure 29, left) giving very low expression

background. Vectors are commercially available and offer many cloning possibilities

(multiple tags, different resistance). Expression strains used with this vector are

exchange method by Schwaneberg

ell homogenate) while lane M is


coli, S. cerevisiae) is usually


and prevents inclusion body

expression is incorporation of heme in

using pCWORI vector. In order to

have a functional enzyme reductase domain has to be expressed in the same host (79).

sufficient water soluble enzyme making its expression

as a heterologous host


uction system and offers some advantages and disadvantages compared to the

others. pCWORI is the commonly used, high yield, expression vector under the control of lac


giving high P450

background activity. Also, problems in site directed and site saturation mutagenesis

due to the difficult amplification of the vector backbone in

s regulated by two control

, left) giving very low expression

cloning possibilities

strains used with this vector are also

Page | 67

commercially available – BL21 (DE3) and BL21-Gold (DE3). Disadvantage of this vector

system is its size, being between 5-6 kb. Cloning of large genes, i.e. P450 BM3 (size ~3.2 kb),

is problematic resulting in low transformation efficiency (see Chapter 2). Smaller version of

the pET vectors has been generated in our lab by Dr. Alex Schenk (pALXtreme vector series).

Non-crucial sequences (63%) have been deleted out from the vector. Additionally, lacI gene

has been transferred into the genome of expression host resulting in new strain BL21-Gold

(DE) lacIQ1

. This drastically reduced the size of the vector to ~2 kb and increased

transformation efficiency for one order of magnitude (see Chapter 2). Finally,

pET28/pALXtreme expression vectors offer few advantages for flow cytometry screening

system: low expression background and fine tunable expression level.

In this chapter, we report optimization of expression conditions using two expression

systems – BL21-Gold (DE3)/pET28 and BL21-Gold (DE3) lacIQ1

/pALXtreme. Seldom reports

exist about optimal conditions of expression of Cytochrome P450s out of pET28 system

while pALXtreme expression system has been first tested in this Thesis. We observed that

different media play important role not only in level of protein expression but also in activity

of expressed protein.

We tested different auto-induction media where induction of the target protein

starts automatically after critical optical density of cells is reached. We observed that

different media formulation affect the cell growth as well as the protein expression. This

media seemed like a very elegant way for large batch expression experiments but in the

MTPs gave high growth and expression variations (up to 50%).

Different non auto-induction media have been tested (LB, TB, etc.). In this case

protein expression had to be induced by addition of IPTG. We observed that high level of

P450 BM3 expression affect the growth of the cells drastically possibly due to the toxic effect

of this protein on cell metabolism (consumption of reduction cofactors – NADPH). Lower

amount of IPTG led to lower levels of expression and thus did not affect the cell growth so

drastically. Concentrations of IPTG between 5-50 µM didn’t affect the growth at all. Level of

expressed protein, in this case, was sufficient to be detected by the flow cytometry/double

emulsion system as well as by fluorescent assay in 96- and 384-well MTP. Testing standard

assays (pNCA, 4-AAP) gave high coefficient of variance due to low levels of measured values.

Reason was too low expression level of P450 BM3. Expression was optimized for flow

cytometry experiments and MTP screening by using 5 µM for induction and longer

incubation times on 30°C. For batch expression 0.5 mM IPTG was used and only 8 hours of

induction (30°C).

Purification of Cyt P450 BM3 has been done by using ion-exchange chromatography

(82) or combination of hydrophobic/size-exclusion chromatography (83). Here we adapted a

method by Schwaneberg et al. to include linear gradient in which protein is eluted freed

from other contaminating proteins (Figure 31). Purity determined by measuring protein

concentration and by SDS-PAGE (90-95%) was satisfying for kinetic characterization.

Page | 68

4. Coumarine based substrates for high throughput screening of

Cyt P450 BM3 activity in microtiter plates (MTPs) and by flow

cytometry in double emulsions

4.1 Introduction

Two bottlenecks exist in one typical directed evolution experiment: the

transformation efficiency of the commonly used expression strains and the availability of

screening methods (Figure 33).

Up to now, few high diversity generation methods have been available (i.e. SeSaM

(87)). These methods are able to generate libraries with up to 1012

different gene variants.

On the other hand, transformation efficiency (TE) of most commonly used expression strains

(E. coli, S. cerevisiae, B. subtilis) is reaching only 108-10

9 meaning that significant part of the

library will be lost. Additionally, high throughput screening (HTS) methods developed up to

now, based on microtiter plate (MTP) or solid phase screening, have throughput of 103-10

6.

The inability to screen more clones would lead to loss of additional part of originally

generated diversity. Recently, methods based on flow cytometry and phage/cell display have

been published. These method increase throughput to 108-10

9, and can be regarded as ultra-

high throughput methods (ultra-HTS), but they still suffer from few main disadvantages.

Flow cytometry based methods are limited only to fluorimetric detection, while phage/cell

display techniques are limited in screening for protein affinity rather than activity.

The core of one ultra- and HTS methodology is the activity detection assay. Assay

needs to be reproducible, easy to perform, cost effective and most important, adaptable to

ultra- or HTS format. Fluorescence detection based assays offer many advantages compared

to the other detection based methods (i.e. spectrometry). Fluorescent assays are highly

reproducible and highly sensitive, decreasing the detection limits of target compounds. Also,

simultaneous detection of multiple probes is possible. Commercial substrates are available

for detection of different enzyme activity. Finally, fluorescent assays can be easily adapted to

HTS format using 96-, 384- and recently 1536-well MTPs.

Page | 69

Figure 33 Typical scheme of directed evolution experiment marking two bottlenecks of the method; transformation

efficiency of expression strains (red) and throughput of activity assay (blue). Adapted from Wong, T.S. (2006) PhD Thesis

Screening systems for monooxygenase activity in general can be based on detection

of changes in: A) cofactor or co-substrate, B) surrogate substrate or C) can detect the

product formation. Each of these approaches offers different advantages and disadvantages.

Detecting a cofactor/co-substrate can lead to many interference by other cellular

components when using a whole cell system. Additionally, variants are preferably selected

for improved cofactor/co-substrate binding or consumption and in rare cases for improved

product formation. Surrogate substrates are commonly used to improve enzyme properties

(pH, thermostability, solvent resistance). These often suffer from a problem that structure of

surrogate substrate is most of the time very different from the natural one. This leads to

variants with shifted substrate specificity. Finally, product formation is in most of the cases

difficult to detect unless it possesses a new property (i.e. color, fluorescence, luminescence),

compared to the substrate(s), which can be easily monitored with most commonly used

detection techniques (spectroscopy, fluorimetry). Otherwise, HTS techniques can not be

applied and a low- and medium-throughput approach has to be developed (i.e. HPLC, MS)

(88).

Cytochromes are principal enzymes involved in oxidative metabolism of drugs and

other xenobiotics. From the bioindustrial point of view these enzymes can be involved in

diverse synthetic transformations such as hydroxylation of the alkanes and aromatic

hydrocarbons, epoxidation of carbon-carbon double bonds and heteroatom oxygenation

(89,90). Reaction of hydroxylation from the chemical point of view doesn’t change drastically

the properties of the product molecule. Rarely any of those changes can be detected by

Page | 70

standard methods (spectrophotometry, fluorimetry). On the other side, detection of

reduction cofactors (NADH, NADPH) and co-substrates (oxygen) is more difficult due to high

interference of many compounds. That is why designing an assay for monitoring the activity

of Cytochromes still presents quite a challenge.

Up to now, MTP fluorimetry assays have been developed for mammalian

Cytochromes CYP1A1 (91) and CYP2B1 (92). Most assays for other mammalian Cytochromes

(i.e. CYP2C9, CYP2C19, CYP2D6 and CYP3A4) are time consuming and labor intensive; usually

requiring HPLC separation for metabolite quantification and therefore difficult to perform in

HT format.

Unlike mammalian, prokaryotic Cytochromes are mostly fusion proteins, with all

domains present in one polypeptide chain (25). Cytochrome P450 BM3 is isolated from

Bacillus megatherium and presents one of the most studied prokaryotic Cytochromes and in

many cases has been taken as a model system not only for prokaryotic members but

mammalian Cytochromes as well (48). Natural substrates of Cyt P450 BM3 comprise long

chain fatty acids and alcohols.

Many screening system have been developed for Cytochrome P450 BM3. Most of

them are based on detection of color (spectrometry) arising from conversion of chromogenic

surrogate substrate (8). Some assays have been developed to detect the product formation

(93). Additionally, NADPH consumption assays have been developed for Cyt P450 BM3 (94)

but these suffer from high background and high number of interfering compounds. Recently,

assay for monitoring co-substrate (oxygen) consumption has been developed (5). This

approach offers few advantages compared to other methods. It can be universally applied

for screening of activity towards any substrates, fluorescent detection which is used is highly

sensitive and oxygen probes are commercially available. On the other hand, this assay

suffers from problems when whole cells are used (increased background due to cellular

oxygen consumption).

Only one fluorescent assay for Cyt P450 BM3, based on surrogate substrate

conversion, has been published up to now. It is based on dealkylation of alkoxy-resorufin

and increase in green/yellow fluorescence arising from released resorufin (ex. 530 nm, em.

580 nm). Different alkoxy chains have been tested with P450 BM3 Wt and difference in the

activity was more than obvious. Benzoxy-resorufin was converted, in a very small extent, by

the P450 BM3 Wt. For the conversion of metoxy-, ethoxy- and pentoxy-resorufin site

directed mutants were produced (16).

Main idea of our work was to develop new fluorogenic substrates for Cytochrome

P450 BM3 which could be a part of HTS and more importantly ultra-HTS platform (based on

flow cytometry). The logic of the assay was based on previously well characterized

chromogenic substrate, pNCA (8). Fluorescent probe was to be attached on the terminal

position of the 12-dodecanoic acid. This chemical reaction would lead to decrease in

fluorescence of the probe and result in non-fluorescent substrate. After hydroxylation of the

Page | 71

substrate by P450 BM3 variant, instable hemiacetal would be formed. Hemiacetal would be

stabilized by release of fluorescent probe and increase in fluorescence of the reaction mix

could be detected (Figure 34).

Additionally, since the system was to be applied for double emulsion/flow cytometry

screening fluorescent probe had to fulfill certain demands: 1) excitation wavelength had to

be in the range of laser employed by flow cytometry device (375 or 488 nm); 2) detection

has to be possible in blue (455 nm), green (520 nm) or red (620 nm) filter channel and 3)

probe needs to be relatively small not to affect overall structure of the substrate. One of the

most important properties of the probe, if it is to be used in double emulsion/flow

cytometry screening, which we discovered by ourselves is the presence of the charge on the

core molecule. Non-charged molecules diffuse out through the lipid layer of the double

emulsion droplet (95).

In this Chapter we describe, in detail, the synthesis and characterization of novel,

coumarine based substrates for Cyt P450 BM3 Wt and variants. Also, we describe

optimization of the HTP assay in 96- and 384-well MTP’s as well as conversion in double

emulsions and single E. coli cells. Results of this Chapter will be later compiled into ultra-HTS

platform based on flow cytometry and double emulsion for directed evolution of Cyt P450

BM3 (see Chapter 5).



All chemicals used in this Chapter were purchased from Sigma-Aldrich (Steinheim,


analytical grade unless stated otherwise.

TLC plates coated with silica gel 60 F254 were from Merck (Haar, Germany).

Phosphomolybdic acid was used for visualization. After TLC has been developed plate has

been sprayed with phosphomolybdic acid and heated for short. Black spots appear on the

place where organic compound is present. Additionally, UV detection system was used. TLC

plates were exposed to UV light (366 nm and 254 nm).

Silica gel, used for chromatography, was type 60 and purchased from Roth

(Karlsruhe, Germany).

Rotary evaporator (Rotavap) was from Heidolp Instruments (Schwabach, Germany).

All fluorescent spectra were recorded using TECAN Safire (TECAN Group, Maenndorf,

Switzerland) in black flat bottom 96- or 384-well MTP (Greiner Bio-One, Frickenhausen,

Germany).

Page | 72

Proton and carbon NMR spectra were recorded using NMR Joel ECX 400 (Peabody,

USA).

I. Synthesis and characterization of substrates for Cyt P450 BM3 using 4-

methyl umbelliferone (4-MU) as a fluorescent probe

Synthesis and characterization of 12-(4-MU)-dodecanoic acid and methyl ester

Step 1 – protection of carboxylic group of fatty acid by esterification. For this step,

1.275 g (4.57 mmol) of 12-bromo-dodecanoic acid was dissolved in 20 ml dry methanol.

Next, 100 µl of concentrated H2SO4 was added. Reaction was incubated at 75°C for 3 hours.

Process was monitored by TLC using petrol ether: ethyl acetate (2:1) as a developing

solution. For visualization phosphomolybdic acid system was used.

BrOH

O

9

+ CH3 OH BrO

O

CH3

9+ OH2

75 °C, 3 h

cat. H2SO

4

After reaction was completed, sample was evaporated using ad Rotavap at 40°C for

10-15 minutes. Pellet was dissolved in CH2Cl2 and extracted twice with 10 ml of saturated

KHCO3, once with distilled water and once with brine. Organic phase was separated, dried

with MgSO4, filtered and evaporated using Rotavap.

Step 2 – Conversion of 4-MU into sodium salt. For this step, 0.80 g (4.54 mmol) of 4-

MU was dissolved in 15 ml dry methanol. 0.18 g (4.50 mmol) of NaOH was added. Reaction

was mixed with magnetic stirrer until NaOH completely dissolved. At this point, solution

changed color to bright yellow. Methanol was evaporated using Rotavap.

O O

CH3

OH

+ NaOH

O O

CH3

NaO

Step 3 – Attaching of fluorescent probe (4-MU) to fatty acid. Previously prepared

sodium salt of 4-MU was dissolved in 15 ml DMSO and dried shortly (10 min) on 120°C using

an oil bath. Then methyl ester of 12-bromo-dodecanoic acid was added (dissolved in 15 ml

DMSO). Mixture was stirred at 160°C for 3 hours. Progress was monitored by TLC.

BrO

O

CH3

9

+O O

CH3

NaOO O

CH3

OO

CH2

CH3

9180 °C 4 h

DMSO

After the reaction was done, mixture was poured into 200 ml of ice cold distilled

water and white precipitate formed immediately. After 10-15 minutes mixture was

centrifuged (4000 rpm, 5 min). Pellet was dissolved in CH2Cl2, extracted twice with saturated

Page | 73

NaHCO3 and twice with distilled water. Organic layer was dried with MgSO4, filtered and

evaporated using Rotavap.

Step 4 – de-esterification of the substrate – release of carboxyl group. Pellet from

previous step was dissolved in 25 ml potassium-metoxide (prepared by dissolving 0.8 g

(20.46 mmol) of KOH in 5 ml of water and then filling it up to 50 ml with methanol). Reaction

was incubated for 1 hour at 80°C. Sample was cooled down to room temperature and

poured in ~100 ml ice cold water (pH adjusted to ~1 with HCl). Formed precipitated was

filtered and dried over night under the vacuum.

OO

CH3

OO

CH2

CH3

9

OO

CH3

OOH

CH2

980 °C 1 h

potassium metoxide

For characterization by NMR, ~10 mg of both samples, ester and acid, were dissolved

in 1 ml of CDCl3. 13

C and 1H NMR spectra were recorded using a 400 MHz NMR (JOEL ECX

400, Peabody, USA).

For fluorescent spectra characterization stock solution of substrate was prepared in

DMSO (15 mM). Dilutions of stock solution were made in buffer and 3D fluorescent spectra

were recorded using TECAN Safire (Switzerland).

Conversion of 12-(4-MU)-dodecanoic acid and methyl ester

To test the possibility of conversion of novel coumarin/fatty acid compounds by Cyt

P450 BM3 we used soluble purified enzyme. Activity was tested with Cyt P450 BM3 wild-

type (Wt) and selected variants (F87A, F87A/R47Y, F87A/R47Y/M354S and Y51F).

Assay was assembled as follows: 230 µl of buffer (50 mM phosphate, 50 mM tris-HCl

pH 8.0 0.25 KCl), 5 µl substrate (15 mM in DMSO) and 10 µl soluble enzyme. Reaction was

incubated for 5 minutes at room temperature. Conversion was initiated by addition of 20 µl

NADPH (5 mM). Fluorescence was monitored using TECAN Safire (ex. 310 and 380 nm, em.

390 and 440 nm, respectively) in black flat bottom 96-well MTPs (Greiner Bio-One). After

reaction, 3 µl of each sample was analyzed by TLC (petrol ether: ethyl acetate = 1: 1).

Visualization was by UV light (254 and 366 nm).

To test protonation/deprotonation of the fluorescent probe 20 µl of 2 M NaOH was

added in 200 µl reaction mix. 3D fluorescent spectra were recorded before and after

addition.

Synthesis and characterization of 7-benzoxy-4-MU

First, 0.5 g (2.84 mmol) of 4-MU was dissolved in 20 ml DMSO with stirring. 600 µl

(3.51 mmol) of benzyl bromide was added together with catalytic amount of NaOH and

mixture was refluxed at 100°C for 2 hours. After the reaction mixture was poured into ice

Page | 74

cold water (~200 ml) and left over night. Precipitate was separated by filtration and dried in

vacuum. Dry pellet was re-dissolved in CH2Cl2. Chromatography was done on silica gel

column using petrol ether: ethyl acetate (1:1) for elution. Fractions with target compound

are pooled, solvent evaporated on Rotavap and pellet dried in vacuum, overnight.

Br

+

O O

CH3

OHO O

CH3

O100 °C 2 h

DMSO, cat. NaOH

For NMR characterization 5 mg of purified compound was dissolved in 1 ml CDCl3. 13

C

and NMR spectra were recorded using a 400 MHz NMR (JOEL ECX 400, Peabody, USA).

Conversion of 7-benzoxy-4-MU

To test the conversion of coumarin/benzyl compound (crude) with Cyt P450 BM3,

reaction was assembled as follows: 100 µl buffer (50 mM phosphate, 50 mM tris-HCl pH 8.0,

0.25 mM KCl), 2.5 µl substrate (15 mM in DMSO) and 10 µl enzyme. After 5 minutes

incubation on room temperature reaction was initiated with addition of 10 µl NADPH (10

mM). Conversion was done 1 hour at room temperature. Reaction products were analyzed

by TLC using petrol ether: ethyl acetate (1:1) as a developer. Visualization was done under

UV light (366 nm). Activity was tested for both, Cyt P450 BM3 wild-type (Wt) and selected

variants (F87A, F87A/R47Y, F87A/R47Y/M354S and Y51F).

For kinetic testing assay was assembled as described in paragraph above.

Fluorescence was monitored using TECAN Safire (ex. 380 nm, em. 440 nm, gain 50) in 60

minutes period (5 minutes interval).

To test applicability of NADPH-recycling system, assay was assembled as described in

paragraph above. Additionally, 5 µl of isocitric acid (80 mM) and 10 µL of isocitrate

dehydrogenase (0.01 U/µL) were added in reaction mix. Reaction was initiated with addition

of 2.5 µl NADPH (5 mM). Fluorescence was monitored using TECAN Safire (ex. 380 nm, em.

440 nm, gain 50) in 60 minutes period (5 minutes interval).

Influence of substrate concentration on conversion reaction was tested in the

following experiment. Reaction mix was assembled as follows: 100 µl buffer (50 mM

phosphate, 50 mM tris-HCl pH 8.0, 0.25 KCl), 2.5 µl substrate (different concentrations in

DMSO), 10 µl enzyme (Wt, 11 µM), 5 µl isocitric acid (80 mM), 10 µl isocitric dehydrogenase

(0.01 U/µl). Reaction mix was incubated 5 minutes on room temperature. Reaction was

initiated by addition of 2.5 µl of NADPH (5 mM). Concentration of the substrate was ranging

from 2.9 mM to 23 µM (in serial dilution by two). Fluorescence was monitored using TECAN

Safire (ex. 380 nm, em. 440 nm, gain 50) in 160 minutes period (10 minutes interval). V0 was

calculated for first 30 minutes of reaction (linear part).

Page | 75

Standard curve, using 4-MU, was prepared by measuring fluorescence of different

dilutions of fluorescent probe under the conditions stated in the paragraph above.

To test dependence of the conversion on enzyme concentration as well as detection

limit of the assay reaction was assembled as described above. Serial dilutions of the enzyme

stock (11 µM, 2-128 dilution) were prepared in activity buffer.

II. Synthesis and characterization of substrates for Cyt P450 BM3 using 3-

carboxy coumarin (3-CC) as a fluorescent probe

Step 1 – synthesis of methyl ester of 3-carboxy coumarine. 8.4 g (60.82 mmol) of 2,4-

dihydroxybenzaldehyde was dissolved in 45 ml of anhydrous methanol. Solution was stirred

and 8.7 g (65.85 mmol) of dimethyl malonate was added. Solution was brought to reflux

temperature. 450 mg (5.16 mmol) of moprholine and 150 mg (2.49 mmol) of acetic acid

were added to 2 ml of methanol and stirred until precipitate fully dissolved. This solution

was then added to refluxed reaction mixture and reflux was continued for another 3 hours.

After cooling, the product was filtered and re-crystallized from boiling methanol (~300 ml).

O

OH

OH

OO

O O

CH3 CH3+O O

O

OCH3

OH3 h

methanol

cat. morpholine, cat. CH3COOH

Step 2 – preparation of sodium salt of 3-CC. For this step, 1.5 g (6.81 mmol) of 3-CC

methyl ester was re-suspended in 50 ml of toluene, with stirring, and heated at 120°C until 5

ml of toluene evaporated (30-60 minutes). After cooling the mixture to room temperature

0.5 g (10.84 mmol) of NaH was added. Mixture was heated at 120°C and stirred until toluene

evaporated (1-2 hours). Obtained salt was dried in vacuum overnight.

O O

O

OCH3

OH

+ Na H120 °C 2 h

toluene

O O

O

OCH3

NaO

Step 3 – Attaching benzyl group to 3-CC methyl ester. 3 g (12.39 mmol) of prepared 3-

CC methyl ester sodium salt was dissolved in 200 ml of DMF (dried with molecular sieves).

Mixture was heated to 120°C. During heating, 2.138 g (12.5 mmol) of benzyl bromide was

added. Mixture was kept on 120°C for 2 hours with stirring. Then, additional 1 g (5.85 mmol)

of benzyl bromide was added and reaction continued at 120°C for 4-6 hours. At the end, one

more batch (0.7 g, 4.09 mmol) of benzyl bromide was added. Reaction was continued for

additional hour. At the end, mixture was cooled to room temperature for few hours and

poured to 400 ml of ice cold water. After precipitate formed (30-60 min), suspension was

filtered and rinsed with water. Precipitated was dried and re-dissolved in CH2Cl2. Organic

phase was extracted twice with water, filtered and evaporated on Rotavap. Precipitate was

dried overnight in vacuum.

Page | 76

CH3

+

ONaO O

O

OCH3

O O

O

O

O

CH3

120 °C 6 h

THF

Target compounds were isolated after chromatography on silica gel. Sample was

loaded in CH2Cl2. Elution was done by adding small amount of ethyl acetate into CH2Cl2

(1:20). Two main fractions were pooled according to TLC. Re-chromatography of un-pure

Fraction II was done on silica gel using CH2Cl2: ethyl acetate (20:1) for elution. Purity was

monitored on TLC using the same solvent system.

Step 4 – De-esterification of methyl ester group. 50 mg (161.13 µmol) of 7-benzoxy-3-

carboxy coumarin methyl ester was dissolved in 4 ml THF (kept at 4°C). At the same time,

0.07 g (1.67 mmol) of LiOH was dissolved in 4 ml of distilled water (kept at 4°C). When both

components were cooled to 4°C they were mixed, stirred 1 hour on ice and left overnight in

the fridge (with constant stirring). The following day, 1.66 ml of 3M HCl was added to

reaction mix and left to warm up to room temperature. Finally, 3.22 ml of brine was added

and organic phases separated. Reaction mix was extracted three times with 20 ml ethyl

acetate. All organic phases are pooled, evaporated on Rotavap and precipitate was dried

overnight under vacuum. Purity was monitored by TLC.

O O

O

O

O

CH3

O O

O

OH

O4 °C overnight

50% THF

For characterization by NMR, ~5 mg of both samples (Fraction 12 and Fraction 24)

were dissolved in 1 ml of CDCl3. 13

C and 1H NMR spectra were recorded using a 400 MHz

NMR (JOEL ECX 400, Peabody, USA).

Conversion of 3-carboxy coumarine based compounds using Cyt P450 BM3

Conversion of substrates based on 3-carboxy coumarine was done with purified Cyt

P450 BM3. Tested variants included Wt and mutants F87A, F87A/R47F, F87A/R47Y,

F87A/R47F/M354S and Y51F. Assay was assembled in black flat bottom 384-well MTPs

(Greiner Bio-One) as follows: 50 µl buffer (100 mM phosphate buffer pH 9.0), 1 µl substrate

(15 mM BCC and BCC Acid in DMSO, 10 mM DBCC in DMSO) and 5 µl enzyme (10 mg/ml).

Reaction mix was incubated 5 minutes on room temperature. Reaction was initiated by

addition of 4 µl NADPH (10 mM). Fluorescence was monitored in 1 min interval for 40

minutes using TECAN Safire (TECAN Group, gain 70, z-position 7800).

After reaction 3 µl of each reaction mix was loaded and analyzed on TLC.

Visualization was done by UV light (366 nm).

Page | 77

Reverse phase HPLC was performed to analyze reaction products of conversion of

BCC and BCC Acid by Cyt P450 BM3 F87A/R47F/M354S variant.

HPLC was performed on AKTA Purifier (GE Healthcare) connected to SOURCE 5RPC ST

4.6/450 column (GE Healthcare). Buffer A was 10 mM phosphate buffer pH 2.8 and buffer B

was 90 % acetonitrile in 10 mM phosphate buffer pH 2.8. Flow was kept constant at 1

ml/min and detection was on 210 nm and 350 nm (specific for the coumarin structures).

Sample (100 µl) was loaded in buffer A. Next, unbound sample is washed out with 2 CV of

buffer A and linear gradient of buffer B (0-100 % in 10 CV) was applied. All target compounds

were eluted in this region. Column was washed with 3 CV of buffer B (100 %). Four samples

were prepared for each substrate and they included:

Sample 1 (100 µl) – blank: buffer + DMSO + NADPH + enzyme

Sample 2 (100 µl) – standard substrate: buffer + substrate

Sample 3 (100 µl) – standard product: buffer + 3-carboxy coumarin

Sample 4 (100 µl) – reaction mix: buffer + substrate in DMSO + NADPH + enzyme

Reaction mix was incubated 2 hours on room temperature before analysis. Fractions

containing unknown reaction products were collected and analyzed by TLC and by 3D

spectral fluorimetry. 3D spectra were recorded using TECAN Safire (TECAN Group) and black

flat bottom 96-well MTP (Greiner Bio-One).

For optimization of different excitation/emission wavelengths assay was set up as

follows: 50 µl buffer (100 mM phosphate buffer pH 7.5), 1 µl substrate (dilution in DMSO)

and 5 µl enzyme (Cyt P450 BM3 139-3). Reaction mix was incubated on room temperature

for 5 minutes. Reaction was initiated by addition of 4 µl NADPH (10 mM). Assay was done in

black flat bottom 384-well MTPs (Greiner Bio-One). Fluorescence was monitored using

TECAN Safire on three excitation (375, 400 and 405 nm) and three emission (455, 440 and

455 nm) wavelengths, respectively. Substrate concentrations were 167, 83, 42, 21, 10 and

5.2 µM, respectively.

To test effect of different permeabilizers (organic solvents and polymixin B sulphate -

PMB) on conversion of BCC experiment was set up as follows. E. coli DH5α harboring

pCWORI vector with Cyt P450 BM3 Wt gene was expressed in TBAmp media overnight (50 ml,

0.5 mM IPTG, 37°C, 250 rpm). After expression cells were centrifuged (4000 rpm, 10 min,

4°C) and washed twice with PBS. At the end, cell pellet was re-suspended in 10 ml of activity

buffer (100 mM phosphate buffer pH 7.5) and kept on ice. This concentrated cell suspension

was used in assays. Assay was carried out as described in paragraph above using only 167

µM substrate and adding 5 µl of cell suspension instead of purified enzyme. Organic solvents

(ethanol, acetone, isopropanol and toluene) were added directly to reaction mix in final

concentration of 10 % (vol/vol). Fluorescence (ex.400 nm, em. 440 nm) was recorded for 60

minutes (1 min interval).

After testing different permeabilizers we tested the effect of different concentrations

of PMB on activity. DH5α expressing Cyt P450 BM3 Wt has been used. Assay was assembled

Page | 78

as described in the paragraph above. Different amounts (1-5 µl in 1 µl steps) of PMB stock

solution (3.6 mM) have been added. Final volume of the reaction mix was kept constant by

decreasing the volume of activity buffer.

To test the difference in permeabilization potential between PMB and PMBN

experiment was set up as follows. DH5α cells expressing Cyt P450 BM3 139-3 variant have

been used. Assay was assembled as described previously. Five and one µl of each

permeabilizer stock (3.6 mM PMB or PMBN) was added in the reaction mix. Fluorescence

was monitored for 60 minutes (1 min interval).

III. Optimization of the conversion of target compounds based on 3-carboxy

coumarin with Cyt P450 BM3

Optimization of conditions using 3-carboxy coumarin based substrates and Cyt P450 BM3

F87A

By changing different parameters we investigated conversion of the novel coumarine

substrates. Only substrates based on 3-carboxy coumarin were used (BCC, BCC Acid and

DBCC). Parameters we changed were:

1. Composition of the buffer (0.1 M phosphate and 0.1 M tris-HCl)

2. pH of the buffers (pH 5-12)

3. Effect of different salts (NaCl and MgCl2)

4. Different concentration of substrates (167-3 µM)

For all assays black flat bottom 384-well plates (Greiner Bio-One) were used. Assay

was assembled as following: 50 µl of buffer, 5 µl enzyme (P450 BM3 F87A/R47F, c = 15.6

µM) and 1 µL substrate (in DMSO). Reaction mix was incubated for 5 minutes, with shaking,

on room temperature. Reaction was initiated by addition of 4 µl NADPH (10 mM).

Fluorescence was monitored using TECAN Safire (ex. 400 nm, em. 440 nm). Slope was

calculated for the first 9 minutes of reaction (linear range).

IV. Testing the 7-benzoxy-3-carboxy coumarin (BCC) in double emulsions

To test the applicability of 7-benzoxy-3-carboxy coumarin (BCC Acid) as a probe for

detection of Cyt P450 BM3 activity in double emulsion experiment was done as follows. Cells

harboring Cyt P450 BM3 gene were grown and expressed in MD-5052 auto-induction media

as described previously. After washing the cells with PBS, concentration was adjusted to ~3 x

108 cell/ml using 0.1 M tris-HCl pH 7.5 as activity buffer. Emulsion reaction mix was prepared

by mixing 80 µl of cell stock, 10 µl of PMB (3.6 mM) and 20 µl of NADPH (10 mM). Sample

was vortexed and kept on ice. Primary emulsion was prepared by mixing 100 µl of emulsion

reaction mix and 1 ml of solution A (2.9 % (wt/wt) ABIL EM90 in LMO). Components were

emulsified using Ultra Turax at setting 2 (~1000 rpm) for 5 minutes, on ice. Substrate (4 µl,

Page | 79

200 mM in DMSO) was added directly in primary emulsion. Secondary emulsion was

prepared immediately by adding 1 ml of solution B (1.5 % (wt/vol) CMC, 2 % (wt/vol) Tween

20 in PBS) to primary emulsion. Components were emulsified using Ultra Turax at setting 1.5

(~8000 rpm) for 3 minutes, on ice.

Dilutions of secondary emulsion were prepared in PBS (1:200) every 30 minutes and

analyzed on CyFlow Space flow cytometer (Partec). Forward and side scatter (FSC and SSC)

were detected from blue laser (488 nm) while product florescence was in blue spectra (UV

ex: 375 nm laser, em: 440 nm blue filter).

To increase analysis and sorting rate of “true” double droplets fluorescein (5 µM) was

included as internal control dye. Fluorescein is excited with blue laser (488 nm) and shows

high green fluorescence (520 nm, green filter). In this case, recordings could be taken using

“green triggering” where machine is guided by green fluorescence coming from fluorescein.

Samples were prepared in the same manner as described previously except that 5 µM

fluorescein was included in emulsion reaction mix. Diluted emulsion (1:100 in PBS) was

recorded using normal settings and “green triggering”.

To test the effect of permeabilizer PMB emulsions are prepared as described with an

exception that PMB was excluded from emulsion reaction mix.

V. Testing 7-benzoxy-3-carboxy coumarine benzyl ester (DBCC) in single cell

flow cytometry experiments

Conversion products of purified Cyt P450 BM3 139-3 variant and BCC/DBCC

substrates were analyzed by TLC. Reaction was set up in the MTP as follows: 50 µl of 100

mM tris-HCl buffer pH 7.5, 1 µl substrate (15 mM in DMSO), 5 µl enzyme solution (~8 µM).

Reaction was incubated 5 minutes on room temperature and initiated with addition of 4 µl

NADPH (5 mM). Incubation time was 120 minutes on room temperature. Three µl of

reaction mix were applied on TLC plates and developed using CH2Cl2 : ethylacetate (20 : 1)

mixture. Acetic acid (100 µl per 10 ml of eluent) was supplemented to the developing

solution. TLC was visualized under UV light (366 nm).

To test weather DBCC can be used as a substrate for activity cell staining experiment

was set up as follows. DH5α cells carrying pCWORI BM3 139-3 vector were used. Cells were

inoculated in 100 ml TBAmp medium, grown 5-6 hours (37°C, 250 rpm) and then induced with

IPTG (0.1 mM). Cell suspension was expressed overnight (16-20 h, 37°C, 250 rpm). After

induction cells were washed twice with PBS (3000 rpm, 10 min, 10°C) and re-suspended in

20 ml PBS.

Reaction mix consisted of 50 µl tris-HCl buffer pH 7.5, 1 µl DBCC (5, 10, 77 and 100

mM stock in DMSO), 5 µl PMBN (3 mg/ml) and 5 µl cell suspension. After 5 minutes of

incubation 4 µl NADPH was added (10 mM). Reaction mix was incubated 60 minutes at room

temperature with shaking (800-900 rpm). After incubation cells were washed twice with ice

Page | 80

cold PBS and finally re-suspended in PBS. Analysis was done on Partec CyFlow Space flow

cytometer using PBS as sheet fluid.

To test weather permeabilization of membrane by sucrose would increase transport

of substrate into the cell experiment was done as follows. Cells were grown and enzyme

expressed as described previously. After expression cell suspension was cooled at 4°C. Cells

were harvested by centrifugation (1000 x g, 5 min, 4°C) and pellet was re-suspended in ice

cold TSE buffer (10 mM tris-HCl pH 7.5, 10 % sucrose, 2.5 mM EDTA) to OD600~0.4. Cell

suspension was incubated for 10 minutes on ice. Pellet was harvested by centrifugation

(1000 x g, 5 min, 4°C) and re-suspended in the same volume of 1 mM ice cold MgCl2 (1 mM).

Substrate (100 mM DBCC in DMSO) was added directly in 100 µl cell suspension and

incubated 60 min on room temperature or on ice (in dark). Reaction was diluted up to 1 ml

with ice cold PBS and directly analyzed on flow cytometer. Standard sample was prepared as

follows: 100 this buffer pH 7.5, 10 µl cell suspension (non-treated with sucrose), 1 µl DBCC

(100 mM in DMSO) and 10 µl PMBN (3.6 mM). After 5 minutes incubation at room

temperature 8 µl NADPH (10 mM) was added. Reaction was done for 60 minutes at room

temperature after what reaction mix was diluted to 1 ml in PBS and directly analyzed as

described previously.


I. Synthesis and conversion of substrates based on 4-MU by Cyt P450 BM3

Wt and variants

Synthesis and conversion of 12-(4-MU)-dodecanoic acid and ester

Both substrates 12-(4-MU)-dodecanoic acid and

corresponding methyl ester were synthesized successfully

(TLC Figure 16/17, Supplementary data). After purification

structure was confirmed by 1H and

13C NMR (Figure 18,

Supplementary data).

Our substrates were based on published

chromogenic substrate for Cyt P450 BM3, pNCA (22).

Instead of chromophore (p-nitrophenolate), we used

fluorescent reporter molecule 4-methyl umbelliferone (4-

MU), one of the most commonly used coumarine based

reporter molecule. After hydroxylation of the specific

location in the fatty acid part (Figure 34) instable

hemiacetal is formed. Structure is stabilized by the release

of fluorescent reporter molecule (4-MU) and fluorescence

Figure 34 Principle of fluorogenic assay. After hydroxylation of

the fluorogenic substrate by Cyt P450 BM3, instable

hemiacetal is formed. Hemiacetal is stabilized by release of

highly fluorescent 4-MU (ex. 400 nm, em. 440 nm).

or the reaction mixture increases

Recorded 3D fluorescent spectra of substrate

fluorescence peak in pink region,

35). Peak was more pronounced in case of acid substrate. This peak should,

conversion by the enzyme, shift

(ex. 360 nm, em. 450 nm).

When doing a conversion reaction w

the substrate is quenched by the addition of NADPH and

spectral region, when enzyme is added in the reaction mix.

plate reader we couldn’t detect fluorescence coming fr

A)

Figure 35 3D fluorescence spectra (x

substrate (B) showing specific fluorescence peak at excitation 310 nm and emission ~390 nm

As mentioned, after reaction,

emission spectra, but more the increase in the

same spectral region (Figure 36

A)

350 370 390 410 430 450 470 490 510

350 370 390 410 430 450 470 490 510

increases.

orescent spectra of substrates showed that both pos

in pink region, at excitation of 310 nm and emission of

Peak was more pronounced in case of acid substrate. This peak should,

, shift to wavelengths corresponding to fluorescence of

When doing a conversion reaction we observed phenomenon that fluorescence of

y the addition of NADPH and it increases again

when enzyme is added in the reaction mix. Using the fluoresc

couldn’t detect fluorescence coming from 4-MU.

A) B)

3D fluorescence spectra (x axis – emission (nm), y axis – excitation (nm)) of acid substrate (A) and ester

showing specific fluorescence peak at excitation 310 nm and emission ~390 nm

after reaction, we didn’t observe a shift in fluorescence

but more the increase in the intensity of the substrate fluorescence

36).

B)

300

320

340

360

380

400

530 550

150-200

100-150

50-100

0-50

350 370 390 410 430 450 470 490 510

300

320

340

360

380

400

530 550

400-600

200-400

0-200

350 370 390 410 430 450 470 490 510

Page | 81

that both posses a

at excitation of 310 nm and emission of ~390 nm (Figure

Peak was more pronounced in case of acid substrate. This peak should, after the

fluorescence of 4-MU itself

that fluorescence of

increases again, in the same

Using the fluorescence microtiter

) of acid substrate (A) and ester

showing specific fluorescence peak at excitation 310 nm and emission ~390 nm

we didn’t observe a shift in fluorescence towards blue

intensity of the substrate fluorescence in the

300

320

340

360

380

400

510 530 550

400-600

200-400

0-200

300

320

340

360

380

400

510 530 550

400-600

200-400

0-200

Page | 82

C)

Figure 36 3D fluorescence spectra (x axis

conversion (B); and acid substrate before (C) and after co

Interestingly, increase

reaching a plateau when reaction is finished

depletion). Additionally, different

substrate (Figure 37).

-5

0

2000

4000

6000

8000

10000

12000

14000

16000

18000

20000

Fluorescence (AU)

Figure 37 Enzyme kinetics of conversion of ester substrate by Cyt P450 BM3 Wt and different variants

measured at excitation 310 nm and emissio

Therefore we concluded

fluorophore (4-MU) is probably

analyzed both substrates and

we saw that enzyme is converting both substrates into products, in s

multiple ones (ester substrate). Unfortunately

corresponded to fluorescent probe (4

product at a similar position as 4

with the substrates, had pink color after UV illumination while fluor

blue fluorescence (Figure 38).

350 370 390 410 430 450 470 490 510

D)

3D fluorescence spectra (x axis – emission (nm), y axis – excitation (nm)) of ester substrate before (A) and after

conversion (B); and acid substrate before (C) and after conversion (D) by Cyt P450 BM3 Wt. All scale

to same fluorescence level.

ncrease in fluorescence was showing typical enzyme kinetics

a plateau when reaction is finished (i. e. inhibition by the product, NADPH

different we mutants tested showed different

-5 0 5 10 15 20 25 30 35

Blank

Wt

F87A

F87A/R47Y

F87A/R47Y/M354S

Y51F

Time (min)

Enzyme kinetics of conversion of ester substrate by Cyt P450 BM3 Wt and different variants

measured at excitation 310 nm and emission at 390 nm.

Therefore we concluded that both substrates actually do get converted, but the

probably not released as a product. To test this hypothesis

both substrates and products by TLC. After visualization under UV

we saw that enzyme is converting both substrates into products, in s

multiple ones (ester substrate). Unfortunately in case of the ester none of the products

corresponded to fluorescent probe (4-MU). In case of the acid substrate, we could see a

product at a similar position as 4-MU standard. On the other hand, all products, together

with the substrates, had pink color after UV illumination while fluorophore showed

.

300

320

340

360

380

400

530 550

400-600

200-400

0-200

350 370 390 410 430 450 470 490 510

excitation (nm)) of ester substrate before (A) and after

nversion (D) by Cyt P450 BM3 Wt. All scales have been adjusted

was showing typical enzyme kinetics curve,

inhibition by the product, NADPH

tested showed different activity with ester

Enzyme kinetics of conversion of ester substrate by Cyt P450 BM3 Wt and different variants. Fluorescence was

get converted, but the

not released as a product. To test this hypothesis we

After visualization under UV light (366 nm)

we saw that enzyme is converting both substrates into products, in some cases even

none of the products

substrate, we could see a

ll products, together

ophore showed bright

300

320

340

360

380

400

510 530 550

400-600

200-400

0-200

Page | 83

Figure 38 TLC of conversion of ester (lane 1-7) and acid substrate (lane 8-14). Lane 1 and 8 contain pure substrates, while

lane 2 and 9 contain substrates with NADPH. Lane 3-14 contain reaction products of conversion with Cyt P450 BM3 Wt

(lane 3 and 10), F87A (lane 4 and 11), F87A/R47Y (lane 5 and 12), F87A/R47F/M354S (lane 6 and 13) and Y51F (lane 7 and

14), respectively. Lane 15 contains Cu4 standard.

Figure 39 TLC image of conversion of ester (lane 2 and 3) and acid C12 substrates (lane 4 and 5). Lane 2 and 4 contain

substrate and NADPH while lane 3 and 5 contain corresponding reaction mix with Cyt P450 BM3 Wt, respectively.

According to a literature paper (96) fluorescence peak we observed (ex. 310 nm, em.

390 nm) could be assigned to protonated form of the fluorophore. In order to increase

fluorescence and shift to spectra towards expected wavelengths (ex. 360 nm, em. 450 nm)

fluorophore needs to be de-protonated (Figure 40). The pKa value of the 7-OH group being

quite high, around 8, would mean that reaction needs to be done at pH>10 in order for the

group to be fully deprotonated.

O O

CH3

OH O O

CH3

O-

-H

+H

Figure 40 Protonation and deprotonation of fluorophore 4-MU (pKa~8). Fluorescent probe need to be in deprotonated

form (right) to show specific blue fluorescence (ex. 360 nm, em. 450 nm)

To test weather we could get the expected fluorescence peak from 4-MU after the

reaction, we increased the pH by adding base (NaOH) to reaction mix.

Page | 84

3D spectra showed, indeed, that a

expected fluorescence peak of

By this we proved that acid substrate is indeed being converted into desired product, at least

to some small extent. On the other hand,

product are insufficient for detection by fluorescence readers

A)

Figure 41 3D fluorescence spectra (x axis

This assay couldn’t be used as a detection assay for Cyt P450 BM3 activity due to the

fact that continuity of the assay couldn’t be maintained. Since Cytochromes

activity on pH>9 reaction would have to be done on lower pH and products detected by

adding base to reaction mix. Additionally, this kind of detection in the “assay” would limit its

application only to MTPs and disable the application in flow cytometry/double emulsion

system.

We speculated that size of the surrogate substrate (fatty acid together with 4

was simply too big for efficient conversion by Cyt P450 BM3 we decided to synthesize a

smaller one. From the literature we knew that Cyt P450 BM3 can, in very low ex

benzyl-resorufin (22). We decided to synthesize a

probe and benzyl residue as surrogate substrate part

Synthesis and conversion of 7

Substrate was synthesized successfully

Figure 19/20, Supplementary data)

structure was confirmed with

In order to see weather enzyme can at all convert

tested the conversion of crude (

30

0

32

0

34

0

36

0

38

0

40

0

42

0

44

0

46

0

48

0

Emisson (nm)

3D spectra showed, indeed, that a shift in the pH produced perfect match of the

ce peak of fluorescent probe, 4-MU (Figure 41, ex. 360 nm, em. 45

acid substrate is indeed being converted into desired product, at least

On the other hand, reaction conditions or very small

product are insufficient for detection by fluorescence readers on the pH<11

B)

3D fluorescence spectra (x axis – emission (nm), y axis – excitation (nm)) of product before (A) and after (B)

addition of NaOH


ct that continuity of the assay couldn’t be maintained. Since Cytochromes

9 reaction would have to be done on lower pH and products detected by


to MTPs and disable the application in flow cytometry/double emulsion

We speculated that size of the surrogate substrate (fatty acid together with 4

big for efficient conversion by Cyt P450 BM3 we decided to synthesize a

smaller one. From the literature we knew that Cyt P450 BM3 can, in very low ex

. We decided to synthesize a homolog, using a 4-MU as a fluorescent

as surrogate substrate part.

nversion of 7-benzoxy-4-MU

Substrate was synthesized successfully as described in Materials and methods

, Supplementary data). After purification trough a silica gel chromatography,

structure was confirmed with 1H and

13C NMR (Figure 21, Supplementary data)

In order to see weather enzyme can at all convert surrogate structure like this we

tested the conversion of crude (non-purified) 7-benzoxy-4-MU by TLC (Figure

300

320

340

360

380

400

420

440

460

480

500

50

0

20000-30000

10000-20000

0-10000

30

0

32

0

34

0

36

0

38

0

40

0

42

0

44

0

46

0

Emission (nm)

produced perfect match of the

ex. 360 nm, em. 450 nm).

acid substrate is indeed being converted into desired product, at least

or very small amount of

on the pH<11.

excitation (nm)) of product before (A) and after (B)


ct that continuity of the assay couldn’t be maintained. Since Cytochromes mostly show no

9 reaction would have to be done on lower pH and products detected by


to MTPs and disable the application in flow cytometry/double emulsion

We speculated that size of the surrogate substrate (fatty acid together with 4-MU)

big for efficient conversion by Cyt P450 BM3 we decided to synthesize a

smaller one. From the literature we knew that Cyt P450 BM3 can, in very low extent, convert

MU as a fluorescent

aterials and methods (TLC

a silica gel chromatography,

, Supplementary data).

structure like this we

TLC (Figure 42).

300

320

340

360

380

400

420

440

460

480

500

48

0

50

0

3000-4000

2000-3000

1000-2000

0-1000

Page | 85

Figure 42 TLC of conversion of crude benzyl-Cu4. Lane 1 contains fluorophore standard (Cu4). Lane 2 contains only

substrate while lane 3 contains substrate with NADPH. Lanes 4-7 contain reaction mix of conversion with Cyt P450 BM3

Wt (lane 4), F87A (lane 5), F87A/R47Y (lane 6) and F87A/R47F/M354S (lane 7).

After identifying the spot coming from released 4-MU we were sure that specific

hydroxylation of the benzyl part of the substrate can release the desired product. 7-benzoxy-

4-MU was additionally purified to remove other components and lower the background

fluorescence of the substrate.

We recorded the kinetics of conversion of 7-benzoxy-4-MU by Cyt P450 BM3 Wt and

selected mutants (Figure 43). Interestingly, from all the variants tested, wild-type showed

the highest activity for the novel substrate. Second in activity was F87A variant, while other

tested variants showed very low or no activity. This finding was opposite from the one when

fatty acid-4-MU substrates were employed suggesting a different mechanism involved in

enzyme reaction, probably due to the structure of the substrate itself.

0 10 20 30 40 50 60

0

100

200

300

400

500

Blank 1

Blank 2

Wt

F87A

F87A/R47Y

F87A/R47F/M354S

Y51F

Fluorescence (AU), gain 50

Time (min)

Figure 43 Kinetics of Cyt P450 BM3 Wt and selected mutants with 7-benzoxy-4-MU.

Page | 86

To see if higher levers of fluorescence can be reached we employed NADPH-recycle

system (Figure 44). In that way NADPH which is being used up by Cyt P450 BM3 is being

recycled by another enzyme system – isocitrate/isocitrate-dehydrogenase.

0 20 40 60 80 100 120

0

50

100

150

200

250

300

350

400

450

Blank

Wt

F87A

F87A/R47Y

F87A/R47Y/M354S

Y51FFluorescence (AU), gain 50

Time (min)

Figure 44 Kinetics of Cyt P450 BM3 Wt and selected mutants with 7-benzoxy-4-MU employing NADPH-recycling system

We saw that fluorescence plateau was reached after ~60 minutes of the reaction and

it is similar in intensity to one when no NADPH-recycle system was employed. This suggests

that the reaction stops probably due substrate/product inhibition and not due to NADPH

depletion.

Next, we tested the activity under different substrate concentrations (Figure 45).

Increasing the concentration of the substrate up to 180 µM had a positive effect on activity

(increase in V0). On the other hand, concentrations of substrate higher than 180 µM showed

radical drop in activity. Explanation could be connected with lowered solubility of substrate

in aqueous solution, at high concentrations. This hypothesis could be additionally supported

by the observation that “fatty looking” precipitate was formed on the surface of reaction

mixture when higher substrate concentrations were used.

Page | 87

-20 0 20 40 60 80 100 120 140 160

0

50

100

150

200

250

300

350

400

2.9 mM

1.4 mM

720 µM

360 µM

180 µM

90 µM

45 µM

23 µM

Fluorescence (AU), gain 50

Time (min)

0 500 1000 1500 2000 2500 3000

2

3

4

5

6

7

8

9

10

Slope (AU/m

in)

Substrate concentration (µM)

Figure 45 Kinetic curves of Cyt P450 BM3 Wt with 7-benzoxy-4-MU employing different concentrations of the substrate

(left) and V0 (slope) of Cyt P450 BM3 Wt with varying substrate concentration (right)

Dilution of enzyme had a negative influence on activity. Diluted enzyme solutions

showed very low activity in concentrations bellow ~100 nM. This might be as well the lowest

detection limit of the assay regarding the enzyme concentration.

0 20 40 60 80 100 120

0

20

40

60

80

100

120

140

160

180

200

220

Fluorescence (AU)

Time (min)

423 nM

212 nM

106 nM

53 nM

26 nM

13 nM

7 nM

Blank

0 100 200 300 400 500

0

5000

10000

15000

20000

25000

30000

35000

Fluorescence (AU)

Enzyme concentration (nM)

Figure 46 Kinetic curves of different serial dilutions (2-128X) of Cyt P450 BM3 Wt with 7-benzoxy-4-MU (left) and plot

enzyme concentration (nM) vs. fluorescence (AU) after 60 minutes of reaction (right)

Using the standard curve prepared for 4-MU kinetic parameters (Km and kcat) for Cyt

P450 BM3 Wt enzyme and 7-benzoxy-4-MU substrate could be calculated (y = 153.29x).

Michaelis-Menten hyperbola fit was used to acquire kinetic parameters.

Calculated kcat value for Wt enzyme was 0.07 eq min-1

while Km value was ~30 µM (eq

= nmolproduct/nmolenzyme).

Page | 88

II. Synthesis and conversion of substrates based on 3-carboxy coumarin by

Cyt P450 BM3 Wt and variants

Using a 3-carboxy coumarine as a fluorescent probe we synthesized a series of novel

Cyt P450 BM3 substrates with structures shown in Table 6. All substrates were purified (TLC

Figure 22, Supplementary data) and structure was confirmed by NMR spectroscopy (Figure

23/24, Supplementary data).

Table 6 Structure and names of novel coumarine based substrates for screening Cyt P450 BM3 activity in MTP and double

emulsions

Structure IUPAC name Common name Short name

OO O

O

OCH3

Methyl 7-

(benzyloxy)-2-oxo-

2H-chromene-3-

carboxylate

7-benzoxy-3-carboxy

coumarin methyl ester BCC

OO O

O

OH

7-(benzyloxy)-2-oxo-

2H-chromene-3-

carboxylic acid

7-benzoxy-3-carboxy

coumarin BCC Acid

OO O

O

O

Benzyl 7-

(benzyloxy)-2-oxo-

2H-chromene-3-

carboxylate

7-benzoxy-3-carboxy

coumarin benzyl ester DBCC

To test weather substrates could be converted by Cyt P450 BM3 we set up reaction

as described in Materials and methods and analyzed products by TLC (Figure 47). BCC and

DBCC substrates could be converted by all tested variants except Y51F. Wild type in both

cases showed lowest activity; spot from the product could be barely seen (Figure 47A and B).

Other variants (F87A, F87A/R47F, F87A/R47Y and F87A/R47F/M354S) showed increase in

activity respectively. This was opposite to our findings with conversion of 7-benzoxy-4-MU,

which from a chemical point of view had a very similar structure to novel substrates but Wt

and variants showed activity in reverse order (Wt had a highest activity while triple mutant

had no activity). Conversion products from BCC Acid could not bee seen on TLC due to

charge present on substrate and product molecule. Molecule was simply to polar to move

with a solvent in TLC, even when acetic acid was added (Figure 47C and D).

Page | 89

A) 1 2 3 4 5 6 7 B) 1 2 3 4 5 6 7

C) D)

Figure 47 TLC of conversion of BCC (A), DBCC (B) and BCC Acid (C, D). Conversion was tested with Cyt P450 BM3 Wt (lane

2) and variants F87A (lane 3), F87A/R47F (lane 4), F87A/R47Y (lane 5), F87A/R47F/M354S (lane 6) and Y51F (lane 7).

Reaction containing only substrate and NADPH (Blank) was analyzed in lane 1

To analyze product molecules after the reaction with Cyt P450 BM3

F87A/R47F/M354S we used RP-HPLC. With this technique we were able to directly analyze

the reaction mix, separate target molecules (products) according to their properties (size,

hydrophobicity) and indentify them in comparison to standards separated under same

conditions. We optimized conditions for separation and detection of coumarine compounds

using C5 ST 4.6/450 column and Akta Purifier HPLC system. Detection was based on

absorbance of all aromatic organic compounds (210 nm) and compounds having coumarine

ring system (350 nm). Analysis of blank sample (containing only buffer, enzyme and NADPH)

showed no peaks on selected wavelengths which could interfere with product analysis

(Figure, Supplementary data). Retention time of 3-carboxy coumarine, as a product

standard, was determined (~16 ml, fraction 12) as well as retention times of both substrates

BCC (~35 ml) and BCC Acid (~27 ml) (Figure 25, Supplementary data).

After analyzing conversion products of BCC substrate by RP-HPLC we detected a new

peak. Retention time was lower (~25 ml) which would correspond to more hydrophilic

released coumarine molecule, 3-carboxy coumarin methyl ester (Figure 26, Supplementary

data). This was indeed confirmed by 3D fluorescence spectroscopy (data not shown).

Page | 90

In the other case, when BCC Acid was used a substrate for conversion, after analysis,

two new peaks were detected (Figure 27, Supplementary data). Both peaks in fluorescence

spectroscopy showed spectra corresponding to 3-carboxy coumarin, an expected reaction

product (data not shown). Since observed spot showed the same Rf value on TLC in case of

both mentioned fractions we suppose that RP-HPLC was able to separate stereoisomers of

the corresponding molecule (data not shown).

By RP-HPLC we indeed proved that hydroxylation of BCC and BCC Acid by Cyt P450

BM3 occurs. Additionally, hydroxylation is at expected position (Figure, C-α atom of benzyl

group) so that fluorescent reporter molecule is released. In the case of BCC used as a

substrate, 3-carboxy coumarin methyl ester is released while in case of BCC Acid, 3-carboxy

coumarin was the reporter molecule. In both cases reaction was followed by increase in

specific blue fluorescence (ex. 380 nm, em. 440 nm) originating from released coumarine

probe.

Fluorescence detection is one of the most important parameters determining the

sensitivity of the assay, both in MTPs and emulsions. When using a MTP fluorescence reader

one is not limited to excitation/emission wavelengths. Newer devices are usually based on

diode technology and choice of any wavelength is possible. On the other hand, excitation

and emission wavelengths in flow cytometer are defined by installed lasers. These are

usually quite expensive and couldn’t be easily exchanged. As mentioned previously, one of

our reasons for synthesis of substrates based on coumarin fluorophore was that excitation

and emission of the fluorophore corresponded to the UV laser present in Partec CyFlow

Space flow cytometer (ex. 375 nm, em. 455 nm). Unfortunately, when using a cofactor as

NADPH, which by itself shows fluorescence in the similar region as coumarine (ex. 340 nm,

em. 440 nm) it might be interfering with the detection (increasing the background).

We wanted to test sensitivity (Product/Blank ratio) of our assay using different

settings which would correspond to real conditions, either screening in MTPs or in double

emulsions. Three different sets of wavelengths were tested; excitation at 400, 375 and 405

and emission at 440, 455 and 455 nm, respectively (Figure 48). The first setting (400/440 nm)

was found to be optimal for detection using MTP reader, since excitation wavelength was

shifted away from excitation wavelength of NADPH and background interference was

minimal. Second excitation/emission wavelength pair (375/455 nm) was corresponding to

UV laser in flow cytometer while third set (405/455 nm) corresponded to “hypothetical”

violet laser. Recordings were tested under six different substrate concentrations.

Page | 91

A) B)

Figure 48 Sensitivity of the assay (Product/Blank ratio) under different recording settings employing BCC (A) or DBCC (B)

as a substrate

As it prove to be the case, the highest sensitivity (relative increase in fluorescence)

could be achieved when using excitation/emission pair of 400/440 nm. This was chosen as

an optimal setting for MTP assay. For flow cytometry, best results could be achieved with

violet laser setting (405/455 nm). Unfortunately, sensitivity of the assay when using UV laser

settings (375/455 nm) is very low, barely detectable when compared to other two. There are

two possible reasons for this. One reason is high level of fluorescence arising from NADPH

which is excited and emits in the same spectral region (ex. 340 nm, em. 460 nm). Second one

is high background arising from substrates which also show high fluorescence in the selected

region (Figure, Supplementary data). These two reasons could cause big problems when

applying coumarine substrates for flow cytometry screening and UV laser settings.

Subsequently, we tested kinetics of conversion employing all three novel coumarine

substrates and different variants of Cyt P450 BM3.

0

50

100

150

200

250

166.7 83.4 41.7 20.8 10.4 5.2

Pro

du

ct/B

lan

k r

ati

o


400/440

405/455

375/455

0

200

400

600

800

1000

1200

1400

1600

1800

166.7 83.4 41.7 20.8 10.4 5.2

Pro

du

ct/B

lan

k r

ati

o


400/440

405/455

375/455

Page | 92

A)

0 10 20 30 40 50

0

5000

10000

15000

20000

25000

30000

35000

Fluorescence (AU)

Time (min)

Blank

Wt

F87A

F87A/R47F

F87A/R47Y

F87A/R47F/M534S

Y51F

B)

0 10 20 30 40 50

0

1000

2000

3000

4000

5000

6000

7000

Fluorescence (AU)

Time (min)

Blank

Wt

F87A

F87A/R47F

F87A/R47Y

F87A/R47F/M354S

Y51F

C)

0 10 20 30 40 50

0

5000

10000

15000

20000

25000

30000

Fluorescence (AU)

Time (min)

Blank

Wt

F87A

F87A/R47F

F87A/R47Y

F87A/R47F/M354S

Y51F

Figure 49 Kinetic curves of conversion of BCC (A), BCC Acid (B) and DBCC (C) by Cyt P450 BM3 Wt and selected variants

Together, Cyt P450 BM3 Wt and few selected variants were tested (F87A, F87A/R47F,

F87A/R47Y, F87A/R47F/M354S and Y51F). Interestingly, all variants showed different kinetic

profiles with three different substrates (Figure 49).

Page | 93

BCC is non-charged and not as bulky substrate as compared to its homolog DBCC.

Different variants of P450 BM3 showed increased activity compared to wild-type in the

following order F87A>F87A/R47F=F87A/R47F/M354>F87A/R47Y. Double mutant

(F87A/R47F) and triple mutant (F87A/R47F/M354S) showed same staring speed; with a

difference that triple mutant reached the plateau (~ 5000 AU) only after few minutes. This

clearly shows that for conversion of BCC, mutation M354S has no influence on activity.

Additionally, it could even be responsible for fast stop of reaction by possible product

inhibition. Interestingly, two double mutants F87A/R47F and F87A/R47Y showed remarkable

difference in activity (~2500 AU/min and 9000 AU/min, respectively) pointing out how one

amino acid can have important role in substrate binding or catalysis. For conversion of BCC

Acid and DBCC variants showed increase in activity in the following order

Wt>F87A>F87A/R47F>F87A/R47Y>F87A/R47F/M354S. In this case triple mutant showed

increase in activity compared to both double mutants suggesting a difference in the

mechanism of catalysis between three substrates. In all cases, Y51F variant didn’t show any

detectable activity.

Next step was to test weather assay can be applied to whole cell system. Since Cyt

P450 BM3 is expressed as intracellular enzyme in E. coli host, it was necessary to test

weather substrates can at all reach the enzyme or membrane needs to be permeabilized.

When we tested conversion of substrates using only cells we couldn’t observe any increase

in fluorescence, probably due to slow or no diffusion of substrates into cytoplasm. This

suggested that permeabiliziers has to be used to increase the influx of substrates trough

membrane of E. coli. It is know that organic solvents can increase transport trough

membrane and we tested: ethanol, acetone, iso-propanol and toluene (Figure 50). We also

tested polymixin B sulphate (PMB), peptide permeabilizer known to increase transport of

pNCA trough membrane (22).

0 10 20 30 40 50 60

0

10000

20000

30000

40000

50000

Fluorescence (AU)

Time (min)

No permeabilizer

Polymixin B

Ethanol

Aceton

Isopropanol

Toluene

Figure 50 Effect of permeabilizers (PMB and organic solvents) on activity of Cyt P450 BM3 in whole cell assay

Page | 94

From all organic solvents used, increase in fluorescence was detected only in the case

of toluene. On the other side, PMB showed high increase in fluorescence suggesting that

influx of the substrate trough the membrane is high. Also, it could be the case that PMB

lysed the cell and that enzyme was released in the buffer. We tested different

concentrations of PMB to see the influence on the product formation (increase in

fluorescence, Figure 51).

0 5 10 15 20 25 30

600

800

1000

1200

1400

1600

1800

2000

2200

2400

Fluorescence (AU)

Time (min)

0 µM

60 µM

120 µM

180 µM

240 µM

300 µM

Figure 51 Effect of concentration of permeabilizer PMB on activity of Cyt P450 BM3 in whole cell assay

There was so significant difference in fluorescence increase when PMB was used in

concentrations ranging 60-300 µM. Once more we confirmed that if we do not add the PMB

no conversion (increase in fluorescence) occurs.

Unfortunately, when plating the cells exposed to PMB on agar media we observed

very low survival rate (~10-40%). Due to disturbance of the membrane cells were dying out.

On the other side we had to use polymixin compounds to increase fluidity of the membrane

or no conversion would occur. This problem becomes even more pronounced when doing

screening in double emulsion where it is critical that cell containing an active enzyme

survives. Since this cell contains only copy of the gene encoding the desired variants it is

necessary that it can propagate.

This is why, consulting the literature, we decided to test polymixin B nonapeptide

(PMBN). Due to its changed structure (absence of fatty acid part), permeabilization capacity

should remain similar to PMB but survival of the cells should be much higher (~90-100%).

Page | 95

A) B)

0 10 20 30 40 50 60

0

10000

20000

30000

40000

50000

60000

Fluorescence (AU)

Time (min)

No polymixin B

60 µM polymixin B

300 µM polymixin B

0 10 20 30 40 50 60

0

1000

2000

3000

4000

5000

6000

7000

8000

Fluorescence (AU)

Time (min)

No polymixin B nonapeptide

60 µM polymixin B nonapeptide

300 µM polymixin B nonapeptide

Figure 52 Effect of concentration of different polymixin based permeabilizers PMB (A) and PMBN (B) on activity of Cyt

P450 BM3 in whole cell assay

Indeed we showed that PMBN still posses permeabilization capabilities (Figure 52B)

although much lower than its homolog PMB (Figure 52A). On the other side, survival of the

cells was much higher (90-100%, data not shown).

III. Optimization of conversion conditions using Cyt P450 BM3

Finally, after choosing the most optimal substrates which on one side could show

activity with Cyt P450 BM3 and on the other side still can be used for screening in double

emulsions we wanted to optimize the conditions for conversion (highest activity). All the

experiments were done with purified variants of Cyt P450 BM3.

First we tested different buffer compositions and pH (Figure 53). We used 0.1 M

phosphate and 0.1 M tris-HCl buffer. Knowing that Cyt P450 BM3 would be sensitive to

changes in pH but we had to have another thing in the mind, 3-carboxy coumarin and 3-

carboxy coumarin methyl ester both posses 7-OH group which can be protonated dependant

on the pH of the buffer (Figure 28, Supplementary data). As we have seen with 4-MU,

protonation of 7-OH group could have a drastic effect on fluorescence of the probe.

A) B)

Figure 53 Activity (AU/min) of Cyt P450 BM3 F87A in 0.1 M phosphate (A) and 0.1 M tris-HCl buffer (B) under different pH

As it proves to be the case, enzyme is more tolerable to pH changes in tris-HCl buffer,

but on the other side showed lower overall activity (400-1000 AU/min). In phosphate buffer,

0

200

400

600

800

1000

1200

1400

1600

1800

pH 5.0 pH 6.0 pH 7.0 pH 8.0 pH 9.0 pH 10.0 pH 11.0 pH 12.0

Slo

pe

(A

U/m

in)

0

200

400

600

800

1000

1200

1400

1600

1800

pH 7.0 pH 7.5 pH 8.0 pH 8.5 pH 9.0 pH 10.0 pH 11.0 pH 12.0

Slo

pe

(A

U/m

in)

Page | 96

we could see the pick of activity at pH 9.0 and total drop in activity at pH higher than 10 and

lower than 7.

Since Cytochromes are enzymes working on hydrophobic substrates we tested if

addition of salts would have a positive effect on reaction (Figure 54). In theory, hydrophobic

effect (in this case binding of the substrate to the enzyme) would be enhanced in high

dialectic constant environment.

A) B)

C)

Figure 54 Effect of NaCl on activity of Cyt P450 BM3 F87A in 0.1 M phosphate buffer pH 9.0 (A) and 0.1 M tris-HCl buffer

pH 8.0 (B). Effect of MgCl2 on activity of enzyme in 0.1 M tris-HCl buffer pH 8.0 (C)

As seen from the graphs, NaCl did not have high influence on activity of the enzyme

in any of the buffers. Activity slightly dropped at high salt concentrations (0.6 M NaCl) in case

of phosphate buffer. In tris-HCl buffer the effect of NaCl was even lower for all salt

concentration. When using divalent salt (MgCl2) effect was somewhat different. Addition of

salt had a positive effect (increase in activity) up to ~0.2 M after what addition of salt had

diminishing effect on activity.

Nevertheless, highest activity could be achieved in 0.1 M phosphate buffer pH 9.0

without addition of any salts and this was the buffer chosen for all the assays.

We postulated that concentration of the substrate would play an important role in

activity of the enzyme. Not only due to properties of enzyme (Km and kcat) but also due to the

fact that solubility of substrates drops with increasing concentration and eventually

precipitation occurs.

0

200

400

600

800

1000

1200

1400

1600

0.00 0.05 0.10 0.20 0.30 0.60

Slo

pe

(A

U/m

in)

Concentration of NaCl (mM)

0

200

400

600

800

1000

1200

1400

1600

0.00 0.05 0.10 0.20 0.30 0.60S

lop

e (

AU

/min

)

Concentration of NaCl (mM)

0

200

400

600

800

1000

1200

1400

1600

0.00 0.05 0.10 0.20 0.30 0.60

Slo

pe

(A

U/m

in)

Concentration of MgCl2 (mM)

Page | 97

We tested activity (calculated as slope in linear range) of all three substrates with Cyt

P450 BM3 F87A but also evaluated Product/Blank ratio (increase in fluorescence compared

to blank reaction) as a measure of sensitivity of the assay (Figure 55).

A)

B)

C)

Figure 55 Effect of concentration of BCC (A), BCC Acid (B) and DBCC (C) on activity of Cyt P450 BM3 F87A (gray).

Sensitivity of detection represented as Product/Blank ratio for all three substrates and different concentrations (orange)

As expected at the concentrations of substrates higher than 83 µM we detected

slight drop in activity. Also drop in activity was detected as the concentration got lower, but

profile was different for each of the substrates. When compared between the substrates,

F87A variant showed highest conversion rate with DBCC (max ~1800 AU/min). Conversion of

BCC was lower (max ~750 AU/min) while conversion of BCC Acid was the slowest (max ~140

AU/min). This clearly demonstrates that Km of this variant of each of the substrates has

different value.

0

100

200

300

400

500

600

700

800

167 83 42 21 10 5 3

Slo

pe

(A

U/m

in)

BCC concentration (µM)

0

100

200

300

400

500

600

167 83 42 21 10 5 3

Pro

du

ct/B

lan

k r

ati

o

BCC concentration (µM)

0

20

40

60

80

100

120

140

160

167 83 42 21 10 5 3

Slo

pe

(A

U/m

in)

BCC Acid concentration (µM)

0

20

40

60

80

100

120

167 83 42 21 10 5 3

Pro

du

ct/B

lan

k r

ati

o

BCC Acid concentration (µM)

0

200

400

600

800

1000

1200

1400

1600

1800

2000

167 83 42 21 10 5 3

Slo

pe

(A

U/m

in)

DBCC concentration (µM)

0

50

100

150

200

250

300

167 83 42 21 10 5 3

Pro

du

ct/B

lan

k r

ati

o

DBCC concentration (µM)

Page | 98

Also, due to difference in background fluorescence Product/Blank ratio showed

different profile for each of the substrate. In case of BCC, highest detection was achieved at

lowest concentrations of substrate (5-3 µM) while for BCC Acid and DBCC this value was in

the middle of the concentration range (42-21 µM)

IV. Conversion of 7-benzoxy-3-carboxy coumarin (BCC acid) in double

emulsions

Conversion of BCC Acid substrate by Cyt P450 BM3 should release 3-carboxy

coumarin, fluorescent probe hydrophilic enough to be entrapped within the aqueous phase

of double emulsions. This should lead to increase in the population of droplets having blue

fluorescence (em. 455 nm) when excited in UV region (ex. 375 nm).

To test this hypothesis whole cells (BL21-Gold (DE3)) expressing P450 BM3 F87A

were entrapped together with substrate (BCC Acid) as described in Materials and methods.

Every 30 minutes a sample of double emulsion was diluted (1:200) and analyzed by flow

cytometry using standard settings for emulsions. Due to limited space in this thesis we are

only showing FSC/FL3-DAPI plot for each recording of the sample (Figure 56).

A) B) C) D)

E) F) G)

Figure 56 Flow cytometry recording (FSC/FL3-DAPI) of double emulsion containing BL21-Gold cells expressing Cyt P450

BM3 F87A and BCC Acid substrate. Measurements are taken at 0 time (A) and every 30 minutes for the next 3 hours (B-

G). Forward scattering (FSC) is proportional to particle size and detected from blue laser (ex. 488 nm, em. 488 nm) while

FL3-DAPI is the blue fluorescence detected from the product (UV laser - ex. 375 nm, blue filter – em. 455 nm)

It is clearly seen that population of blue droplets, in this case droplets containing the

product of conversion 3-carboxy coumarin, increase in time. Result is even more obvious in

the Table 7. By this we not only proved that BCC Acid can be used as a substrate for Cyt P450

BM3 but also that product is hydrophilic (charged) enough to be entrapped inside aqueous

Page | 99

phase of double emulsion. Incubation of emulsion on room temperature didn’t affect the

integrity of the double emulsion.

Table 7 Increase in population of blue droplets (gating R1) in time as consequence of Cyt P450 BM3 activity in emulsions.

Time of incubation (min) Percentage of droplets in R1 (%)

0 3.14

30 2.49

60 4.61

90 3.99

120 7.14

150 6.35

180 9.03

As we see percentage of the blue droplets (R1) in 0 time is relatively high (3.14 %).

This is due to the presence of high concentration of NADPH which shows fluorescence in the

same region. As the cells, even the ones not expressing P450 BM3, start consuming this

energy rich compound background fluorescence drops and the target population of droplets

(containing the product) gets more distinguished from the background population. This can

bee seen by the shape of the recorded population in 0 time where we observe “tail” in high

fluorescence region. As incubation proceeds, this “tail” is lost and new population of blue

droplets is well separated from the background droplets (empty secondary emulsion,

primary emulsion, lipid droplets etc).

After the plating of the diluted emulsion we observed low survival rate of the cells

preferably due to the use of permeabilizer (PMB) inside emulsion. PMB is affecting the

fluidity of the E. coli membrane and in higher concentrations causes cell death (22). In the

following experiment we tested weather permeabilizer needs to be included in double

emulsions to get high fluorescence response (Figure 57).

Page | 100

A)

B)

C)

D)

Figure 57 Flow cytometry recording of double emulsion on normal (A, C) and “green” triggering (B, D) with (A, B) and

without PMB (C, D).

1000 0.1 1 10 100 10000

320

640

960

1280

1600

FL3 -DAPI

counts

1 10 100 10000.1

1

10

100

1000

FSC -FL3 -DAPI

0.1 1 10 100 10000.1

1

10

100

1000

FL1 -FITC

FL3 -DAPI

1000 0.1 1 10 100 10000

320

640

960

1280

1600

FL3 -DAPI

counts

RN1

1 10 100 10000.1

1

10

100

1000

FSC -FL3 -DAPI

0.1 1 10 100 10000.1

1

10

100

1000

FL1 -FITC

FL3 -DAPI

0.1 1 10 100 10000

200

400

600

800

1000

FL3 -DAPI

counts

1 10 100 10000.1

1

10

100

1000

FSC -

FL3 -DAPI

0.1 1 10 100 10000.1

1

10

100

1000

FL1 -FITC

FL3 -DAPI

0.1 1 10 100 10000

200

400

600

800

1000

FL3 -DAPI

counts

RN1

1 10 100 10000.1

1

10

100

1000

FSC -

FL3 -DAPI

0.1 1 10 100 10000.1

1

10

100

1000

FL1 -FITC

FL3 -DAPI

0.1 1 10 100 10000

500

1000

1500

2000

2500

FL3 -DAPI

counts

1 10 100 10000.1

1

10

100

1000

FSC -

FL3 -DAPI

0.1 1 10 100 10000.1

1

10

100

1000

FL1 -FITC

FL3 -DAPI

0.1 1 10 100 10000

500

1000

1500

2000

2500

FL3 -DAPI

counts

RN1

1 10 100 10000.1

1

10

100

1000

FSC -

FL3 -DAPI

0.1 1 10 100 10000.1

1

10

100

1000

FL1 -FITC

FL3 -DAPI

1000 0.1 1 10 100 10000

200

400

600

800

1000

FL3 -DAPI

counts

1 10 100 10000.1

1

10

100

1000

FSC -

FL3 -DAPI

0.1 1 10 100 10000.1

1

10

100

1000

FL1 -FITC

FL3 -DAPI

1000 0.1 1 10 100 10000

200

400

600

800

1000

FL3 -DAPI

counts

RN1

1 10 100 10000.1

1

10

100

1000

FSC -

FL3 -DAPI

0.1 1 10 100 10000.1

1

10

100

1000

FL1 -FITC

FL3 -DAPI

Page | 101

As we can see from flow cytometry recordings response is very similar when using

PMB (Figure 57D) and when no permeabilized was used (Figure 57B). Explanation could be

that concentration of substrate which we use in emulsion preparation in high enough to

break diffusion barrier over the E. coli membrane. Enough substrate could penetrate inside

the cell and get converted to the product to get the same response as when using

membrane permeabilizer. On the other hand, sensitivity of flow cytometer is higher that

that of MTP fluorescence reader so lower amounts of product are needed in order to be

seen by the machine. To ensure higher survival rate of cells after sorting we decided to

exclude permeabilizer from emulsion reaction mix.

Finally, to increase analysis and sorting rate we decided to include an internal water

phase standard. In our case it was 5 µM fluorescein (ex. 488 nm, em. 520 nm). Fluorescein is

water soluble probe which couldn’t diffuse trough the lipid layer of the double emulsion and

therefore would stay located in inner aqueous phase. This would allow us to distinguish by

flow cytometer “real” double emulsions from primary emulsions and lipid droplets present

in the mixture as a result of incomplete emulsification. Additionally, flow cytometer has an

option to be guided by fluorescence signal that we choose meaning that only particles

possessing that signal could be “visible” by the device. This is called “triggering”. Normally,

device is triggered by blue fluorescence coming from 488 nm laser known as forward

scattering (FCS) or side scattering (SSC) which would correspond to particle size and

complexity, respectively. In this way machine practically detect all particles which posses a

certain size (>200 nm). In our case this would mean that machine would count and analyze a

vast majority of particles which are not at all double emulsions (improperly formed double

emulsion, primary emulsion, lipid droplets, and cell debris) and by this way the whole

analysis process would be slowed down. By using “green triggering” machine would be able

to detect only properties of the particles having green fluorescence in our case only “real”

double emulsions. By this way, analysis and sorting rates could be increased drastically.

We tested recordings using ”normal” (FCS) and “green triggering” (FL1-FITC) to see if

we could get improvement in detection and speed of analysis (Figure 58).

Page | 102

A)

B)

1 10 100 10000

500

1000

1500

2000

2500

FSC -

counts

1 10 100 10000

500

1000

1500

2000

2500

SSC -

counts

1 10 100 10001

10

100

1000

FSC -

SSC -

1 10 100 10000.1

1

10

100

1000

FSC -

FL1 -FITC

0.1 1 10 100 10000

500

1000

1500

2000

2500

FL1 -FITC

counts

0.1 1 10 100 10000

500

1000

1500

2000

2500

FL3 -DAPI

counts

1 10 100 10000.1

1

10

100

1000

FSC -

FL3 -DAPI

0.1 1 10 100 10000.1

1

10

100

1000

FL1 -FITC

FL3 -DAPI

1 10 100 10000

500

1000

1500

2000

2500

FSC -

counts

1 10 100 10000

500

1000

1500

2000

2500

SSC -

counts

1 10 100 10001

10

100

1000

FSC -

SSC -

1 10 100 10000.1

1

10

100

1000

FSC -

FL1 -FITC

0.1 1 10 100 10000

500

1000

1500

2000

2500

FL1 -FITC

counts

0.1 1 10 100 10000

500

1000

1500

2000

2500

FL3 -DAPI

counts

1 10 100 10000.1

1

10

100

1000

FSC -

FL3 -DAPI

0.1 1 10 100 10000.1

1

10

100

1000

FL1 -FITC

FL3 -DAPI

1 10 100 10000

500

1000

1500

2000

2500

FSC -

counts

1 10 100 10000

500

1000

1500

2000

2500

SSC -

counts

1 10 100 10001

10

100

1000

FSC -

SSC -

1 10 100 10000.1

1

10

100

1000

FSC -

FL1 -FITC

0.1 1 10 100 10000

500

1000

1500

2000

2500

FL1 -FITC

counts

0.1 1 10 100 10000

200

400

600

800

1000

FL3 -DAPI

counts

1 10 100 10000.1

1

10

100

1000

FSC -

FL3 -DAPI

0.1 1 10 100 10000.1

1

10

100

1000

FL1 -FITC

FL3 -DAPI

1 10 100 10000

500

1000

1500

2000

2500

FSC -

counts

1 10 100 10000

500

1000

1500

2000

2500

SSC -

counts

1 10 100 10001

10

100

1000

FSC -

SSC -

1 10 100 10000.1

1

10

100

1000

FSC -

FL1 -FITC

0.1 1 10 100 10000

500

1000

1500

2000

2500

FL1 -FITC

counts

0.1 1 10 100 10000

200

400

600

800

1000

FL3 -DAPI

counts

1 10 100 10000.1

1

10

100

1000

FSC -

FL3 -DAPI

0.1 1 10 100 10000.1

1

10

100

1000

FL1 -FITC

FL3 -DAPI

Page | 103

C)

D)

Figure 58 Flow cytometry recording of blank (A, C) and positive (B, D) double emulsion under “normal” (A, B) and “green”

triggering (C, D).

1 10 100 10000

500

1000

1500

2000

2500

FSC -

counts

1 10 100 10000

200

400

600

800

1000

SSC -

counts

1 10 100 10001

10

100

1000

FSC -

SSC -

1 10 100 10000.1

1

10

100

1000

FSC -

FL1 -FITC

0.1 1 10 100 10000

1000

2000

3000

4000

5000

FL1 -FITC

counts

0.1 1 10 100 10000

100

200

300

400

500

FL3 -DAPI

counts

1 10 100 10000.1

1

10

100

1000

FSC -

FL3 -DAPI

0.1 1 10 100 10000.1

1

10

100

1000

FL1 -FITC

FL3 -DAPI

1 10 100 10000

500

1000

1500

2000

2500

FSC -

counts

1 10 100 10000

200

400

600

800

1000

SSC -

counts

1 10 100 10001

10

100

1000

FSC -

SSC -

1 10 100 10000.1

1

10

100

1000

FSC -

FL1 -FITC

0.1 1 10 100 10000

1000

2000

3000

4000

5000

FL1 -FITC

counts

0.1 1 10 100 10000

100

200

300

400

500

FL3 -DAPI

counts

RN1

1 10 100 10000.1

1

10

100

1000

FSC -

FL3 -DAPI

0.1 1 10 100 10000.1

1

10

100

1000

FL1 -FITC

FL3 -DAPI

1 10 100 10000

500

1000

1500

2000

2500

FSC -

counts

1 10 100 10000

200

400

600

800

1000

SSC -

counts

1 10 100 10001

10

100

1000

FSC -

SSC -

1 10 100 10000.1

1

10

100

1000

FSC -

FL1 -FITC

0.1 1 10 100 10000

1000

2000

3000

4000

5000

FL1 -FITC

counts

0.1 1 10 100 10000

100

200

300

400

500

FL3 -DAPI

counts

1 10 100 10000.1

1

10

100

1000

FSC -

FL3 -DAPI

0.1 1 10 100 10000.1

1

10

100

1000

FL1 -FITC

FL3 -DAPI

1 10 100 10000

500

1000

1500

2000

2500

FSC -

counts

1 10 100 10000

200

400

600

800

1000

SSC -

counts

1 10 100 10001

10

100

1000

FSC -

SSC -

1 10 100 10000.1

1

10

100

1000

FSC -

FL1 -FITC

0.1 1 10 100 10000

1000

2000

3000

4000

5000

FL1 -FITC

counts

0.1 1 10 100 10000

100

200

300

400

500

FL3 -DAPI

counts

RN1

1 10 100 10000.1

1

10

100

1000

FSC -

FL3 -DAPI

0.1 1 10 100 10000.1

1

10

100

1000

FL1 -FITC

FL3 -DAPI

Page | 104

V. Conversion of 7-benzoxy-3-carboxy coumarin benzyl ester (DBCC) by

intracellular expressed Cyt P450 BM3 139-3 variant

When performing a TLC analysis of different reaction products using BCC and DBCC

as substrates and selected variants of Cyt P450 for conversion we observed an interesting

event. In the case of di-benzyl substrate, Cyt P450 BM3 139-3 variant was giving additional

reaction product. Spot on TLC had very low Rf value and high hydrophylicity (was moving

very slow in TLC). Additionally, acetic acid had a positive effect on the movement in TLC

indicating that molecule might contain a negative charge. We hypothesized that 139-3

variant was able to hydroxylate substrate at two positions and as a side product release

charged 3-carboxy coumarin (Figure 59).

O OO

O

O

P450 BM-3

F98A/R47F 139-3

NADPH, O2

NADP+, H2O

NADPH, O2

NADP+, H2O

O OHO

O

O

O OHO

O

O

O OHO

OH

O

+

non fluorescent in blue region

high blue fluorescence (λext=405; λem=455)

high blue fluorescence (λext=405; λem=455)

Figure 59 Supposed reaction products of conversion of DBCC by Cyt P450 BM3 F87A/R47F variant (left) and 139-3 variant

(right).

To test the hypothesis we performed conversion reaction in MTP using BCC and

DBCC, as substrates and Cyt 139-3 variant. Substrates and products were analyzed by TLC

(Figure 60). Additionally, acetic acid was added to into eluent to protonate carboxyl group of

3-carboxy coumarin and to enhance TLC separation (Figure 60, right).

Page | 105

Figure 60 TLC analysis of substrates (lanes 1 and 3) and products (lanes 2 and 4) of the conversion of BCC (lanes 1 and 2)

and DBCC (lanes 3 and 4) by Cyt P450 BM3 139-3 variant.

As expected, after conversion of BCC by 139-3 only one product is observed (Figure

60, lane 4). This product corresponds to 7-hydroxy-3-carboxy coumarin methyl ester. Methyl

group was too small to be recognized by the enzyme as a place of hydroxylation. On the

other hand, when using DBCC as a substrate two products are visible, main product, which

would correspond to 7-hydroxy-3-carboxy coumarin benzyl ester and a side product, 3-

carboxy coumarin (Figure 59).

This means what benzyl group bound by ether or ester connection to the coumarin

core can serve as a hydroxylation point. This is the first proof of using the Cytochrome P450

enzymes for de-esterification reactions and presents and interesting model of shifting the

type of enzyme reaction by using surrogate substrates.

This discovery could have another practical application. Release of charged

fluorescent probe from non-charged hydrophobic precursor could be property used for

activity cell staining.

Hydrophobic molecules can penetrate slightly permeablized membrane of E.coli and

end up in cytoplasm. After conversion by an intracellular enzyme into charged probe

diffusion trough the membrane, outside of the cell, is disabled. If the probe has a detectable

property like fluorescence (in our case coumarin) it could be use to stain specifically, in our

case, cells containing only Cyt P450 BM3 139-3 activity.

To test if the cells expressing intracellular Cyt P450 BM3 139-3 could be stained with

DBCC we used native cells and cells with slightly permeabilized membrane (PMBN, Figure

61).

Page | 106

Figure 61 Flow cytometry recording of DBCC stained cells expressing CytP450 BM3.

Cells whose membrane was not permeabilized showed no increase in expected blue

region (Figure 61, left). Cells whose membrane had increased fluidity, as a consequence of

PMBN, showed a new discrete population in the expected blue region (Figure 61, right).

Since diffusion in responsible for substrate entering the cytoplasm of E. coli higher

concentrations of substrate in the reaction mix should increase cell staining. We tested this

hypothesis by adding 0.08, 0.17, 1.18 and 1.53 mM DBCC in the reaction mix (Figure 62).

Figure 62 Flow cytometry of cells expressing Cyt P450 BM3 stained with different concentrations of DBCC (0.08, 0.17,

1.18, 1.53 mM).

1000 1 10 100 10000.1

1

10

100

1000

FSC -

FL3 -DAPI

1000 1 10 100 10000.1

1

10

100

1000

FSC -

FL3 -DAPI

R1

partec PAS

1 10 100 10000.1

1

10

100

1000

FSC -

FL3 -DAPI

1 10 100 10000.1

1

10

100

1000

FSC -

FL3 -DAPI

R1

partec PAS

1000 1 10 100 10000.1

1

10

100

1000

FSC -

FL3 -DAPI

1000 1 10 100 10000.1

1

10

100

1000

FSC -

FL3 -DAPI

R1

partec PAS

1000 1 10 100 10000.1

1

10

100

1000

FSC -

FL3 -DAPI

1000 1 10 100 10000.1

1

10

100

1000

FSC -

FL3 -DAPI

R1

partec PAS

1000 1 10 100 10000.1

1

10

100

1000

FSC -

FL3 -DAPI

1000 1 10 100 10000.1

1

10

100

1000

FSC -

FL3 -DAPI

R1

partec PAS

1000 1 10 100 10000.1

1

10

100

1000

FSC -

FL3 -DAPI

1000 1 10 100 10000.1

1

10

100

1000

FSC -

FL3 -DAPI

R1

partec PAS

Page | 107

As it can be clearly seen, after reaction population of stained cells increases (Figure

62). This number of gated events, even though it shows increase, has to be taken as relative

since background of the sample wasn’t determined (Table 8). Additionally, when using

higher concentrations of substrate (1.53 mM) aggregation of cell is observed (data not

shown).

Table 8 Increase in stained cell population with increase in concentration of DBCC.

Concentration of DBCC (mM) Gated population (%)

0.08 6.18

0.17 10.99

1.18 24.66

1.53 20.28

Using alternative permebilization methods could increase the transport of the probe

trough the membrane and result in higher cell staining. We tested few methods but cell

survival was low (data not shown). From the literature mild permeabilization method, using

sucrose and hypotonic cells shock, should increase membrane permeability without effect

on cell survival. This method was tested in comparison to permeabilization using PMBN.

Cells were treated with sucrose and hypotonic solution of Mg2+

after expression of

the enzyme. Sucrose permeabilized cells were then incubated with substrate both on room

(Figure 64) temperature and on ice (Figure 63). As a control PMBN was added to both

sucrose permeabilized and sucrose non-permeabilized cell to observe the effect on staining.

Figure 63 Flow cytometry recording of samples treated on ice (for detailed explanations refer to text bellow).

Page | 108

Sample that was treated on ice showed small population of blue cells (possibly only

background) in the control containing only DMSO and NADPH (black line), in the sample

containing only substrate (red line) and sample containing substrate and NADPH (blue line).

When PMBN was added to sucrose permeabilized cells together with substrate and NADPH

big shift in fluorescence was observed (Figure 63). Whole population of detected cells was

moved towards the blue region (pink line). We have to keep in mind that in this case

aggregation of the cells is observed on forward scatter graph (Figure 63, left, green line). The

cause is possible exposure of hydrophobic patches on the surface of E.coli as a consequence

of action of PMBN. Hydrophobic patches lead to additional aggregation of E.coli (even native

E.coli has a tendency to aggregate) which could also partially account for increase in

fluorescence (sum of small fluorescencent cells would give higher signal).

Figure 64 Flow cytometry recording of samples treated on room temperature (for detailed explanations refer to text

bellow).

Sample treated on room temperature showed a different profile (Figure 64). Control

containing only DMSO and NADPH (black line) didn’t show any blue cell population. Slight

increase towards blue region was detected in the sample containing only substrate but not

NADPH (red line). This slight shift could be attributed to the fact that E.coli cells contain

small amount of internal NADPH and that conversion is possible even when NADP is not

supplemented into the reaction mix. Sample containing substrate and supplemented NADPH

(blue line) showed increase in the blue region when compared to both controls mentioned

previously. No cell aggregation is observed in this case. This shows that diffusion of the

substrate is possible trough sucrose-treated membrane, but only on room temperature.

Product is charge enough not to diffuse out and to make cells detectable by flow cytometry.

From all selected conditions for cell staining this one would prove to be most optimal. Due to

the fact that no aggregation is observed and increase in the fluorescent population is

significant (Table 9) this would probably allow hugest activity detection and ensure cell

Page | 109

survival (due to less damaged membrane). Last sample containing additionally PMBN as a

permeabilizer (pink line) showed radical increase in blue region (Table 9). On the other hand,

high level of aggregation is observed.

Sample which contained only PMBN and was treated with the substrate on the room

temperature was taken as a control in both cases (Figure 63 and 64, green line). High level of

blue fluorescence is observed (Table 9) with slight cell aggregation. Together with the

sucrose treatment on room temperature mentioned previously would be the most optimal

condition for cell staining. Still survival rate in this case has to be tested.

Table 9 Summary of flow cytometry recording of DBCC treated cells (for detailed explanations refer to text above).

Sample Components of reaction mix Incubation Percentage of gated population (%)

0 NST*, S, PMBN, NADPH RT 68.07

1 DMSO, NADPH

Ice

11.57

2 S 13.58

3 S, NADPH 8.43

4 S, PMBN, NADPH 63.08

5 DMSO, NADPH

RT

1.03

6 S 2.55

7 S, NADPH 19.19

8 S, PMBN, NADPH 62.06 * NST means that cells were not treated with sucrose/hypotonic shock

4.4 Conclusion

In this Chapter we describe synthesis and characterization of novel, coumarine based

substrates for Cyt P450 BM3 (Table 6). These substrates were synthesized for high

throughput screening (HTS) format (i.e. BCC) and for ultra-high throughput screening (ultra-

HTS) format (i.e. BCC Acid, DBCC) using flow cytometry and double emulsions.

Ultra-HTS screening is based on IVC of E. coli cells expressing target enzyme inside an

aqueous phase of double emulsions. After adding fluorogenic substrate and its conversion to

fluorescent product emulsions can be analyzed and sorted using flow cytometry. Sorted

population is enriched in positive droplets containing only active variants of the enzyme (23).

This technique and its application for screening Cyt P450 BM3 activity will be in detail

described in Chapter 5.

Assay which is to be used in flow cytometry/double emulsion screening had to fulfill

certain conditions. First, it has to be based of fluorescent detection. Detection is limited by

the properties of the flow cytometer used in the experiments. In our work we used CyFlow

Space flow cytometer pre-equiped with UV (375 nm) and blue (488 nm) lasers. Detection

was possible in blue (455 nm), green (520 nm) and red (620 nm) region. Second probe needs

to be hydrophilic enough to be retained inside an aqueous phase of the double emulsion

droplet (95). Additionally, probe needs to be small not to interfere with the overall structure

of the substrate.

Page | 110

This limited the choice of fluorophores which could be used for substrate generation.

First, we synthesized a series of surrogate substrates using 4-methyl umbelliferone (4-MU)

as a fluorophore and fatty acid (dodecanoic acid, decanoic acid) as a substrate part. Assay

was based on previously well established pNCA assay (8). These substrates (acid and ester of

dodecanoic acid mentioned in this Thesis) were successfully converted by Cyt P450 BM3 Wt

and tested variants. Unfortunately, as it turned out released probe was not fluorescent

enough on pH used for conversion reaction (pH 7-8). Due to the properties of the 7-OH

group of the probe (pKa~7.8) much higher pH has to be used in order to produce highly

fluorescent anion (97). In our case it was not possible due to low activity of Cyt P450 BM3 on

higher pH (pH>9).

Smaller, 7-benzoxy-4-MU substrate was converted in higher extent so released

fluorescent probe (4-MU) could be detected both by TLC and spectrofluorimetry in MTP. On

the other hand, as it turned out to be this probe was not hydrophilic (charged) enough and

could not be used in double emulsions. When probe was entrapped inside an aqueous phase

of double emulsion, due to absence of charge, it would fast diffuse out and all emulsion

droplets would be without fluorescence (“dark”).

Using the previous knowledge we synthesized series of novel Cyt P450 BM3

substrates based on 3-carboxy coumarin (3-CC). This probe possesses charge in 3-position

and could be successfully entrapped inside double emulsions. Also, compared to 4-MU it

possesses more advantageous properties like higher fluorescence, insensitivity to changes in

pH and no effect on microbial growth (97). So far, only one fluorescence based assay was

developed for Cyt P450 BM3 based on commercially available alkoxy-resorufins (16).

Advantages of this assay would be usage of the probe which spectra is well separated from

fluorescent spectra of NADPH (98), but on the other hand it couldn’t be used in emulsion

systems due to absence of charge on resorufin molecule.

All three substrates which we synthesized, 7-benzoxy-3-carboxy coumarin methyl

ester (BCC), 7-benzoxy-3-carboxy coumarin (BCC Acid) and 7-benzoxy-3-carboxy coumarin

benzyl ester could be applied for specific screening system. Unfortunately, all substrates are

surrogate and their structure was quite different from native Cyt P450 BM3 substrates. On

the other hand, screening with theses substrates could produce mutants with drug-like

substances activity which would show high applicability in pharmaceutical industry (99).

BCC compound is small, drug-like, non-charged molecule (Table 6) converted by Cyt

P450 BM3 Wt and all tested variants (F87A, F87A/R47F, F87A/R47Y and F87A/R47F/M354S).

This substrate could be used for MTP screening of activity Cyt P450 BM3 towards drug-like

molecules. Advantages of this substrate are activity with Wt enzyme and all tested mutants,

high sensitivity (due to high fluorescence of released probe 7-hydroxy-3-carboxy coumarin

methyl ester), possibility to use whole cells directly (without any lysis and purification steps)

and continuitivity of the assay.

Page | 111

BCC Acid is charged drug-like compound (Table 6). Novelty of this substrate is that it

is the first Cyt P450 BM3 available substrate that could be used in flow cytometry/double

emulsion based screening systems. Drawback is that Wt enzyme show very low, barely

detectable activity with this substrate so another, more active variant (F87A) has to be used

for screening. On the other hand, using flow cytometry/double emulsions allow us to screen

up to 108-9

variants of enzyme in very short time frame (few hours). Under these conditions,

high mutational rate conditions can be used to randomize the gene (i.e. SeSaM) and

produced low activity library can be successfully screened/enriched. This throughput would

not be possible by standard HTS screening methods based on MTPs and solid phase.

We tested BCC Acid substrate in double emulsions and showed that increase in blue

droplets containing reaction product could be detected in time. Including second fluorescent

dye (fluorescein) as an inner water phase control could radically increase analysis speed. We

also showed that permeabilization of the bacterial membrane is not necessary, due to very

high concentrations of the substrate present in inner aqueous phase of double emulsion. In

the following Chapter this technology was further optimized and used to establish a flow

cytometry based system for screening Cyt P450 activity in double emulsions. Up to now, this

is the first such system to be established for monooxygenase screening.

DBCC is most bulky substrate compared to other two, containing two benzyl groups

at both ends of the molecule (Table 6). One of the benzyl groups is connected to coumarine

core with ether bond while other is connected with ester bond. This substrate is converted

by Wt enzyme as well as all other tested variants. As expected hydroxylation only occurs on

α-C atom of one benzyl group (bound with ether bond). Interestingly, 139-3 variant of Cyt

P450 BM3 is able to hydroxylate both α-C atoms of benzyl groups. This as a consequence has

s release of charged 3-carboxy coumarin (Figure 59). This principle, release of charged core

molecule from non-charged hydrophobic substrate has been used for activity staining of

eukaryotic cells. Similarly, our substrate could be used for Cyt P450 BM3 activity staining of

E. coli cells. We stained the cells containing expressed 139-3 variant with DBCC and could see

blue population of cells on flow cytometer. We also observed that due to the properties of

bacterial membrane substrate doesn’t diffuse freely and membrane needs to be

permeabilized (100). We tested few permeabilizers and saw that permeabilization has an

effect on stained population. More experiments are needed to optimize this system and use

it for screening and directed evolution of P450.

To conclude, novel coumarine based Cyt P450 BM3 substrates have been

synthesized. They can be used for HTS and well as ultra-HTS system employing flow

cytometry/double emulsions. New ultra-HTS have not been published for Cytochrome class

so far. Novelty of using this system for a class of these, bio-industrially important enzymes

would be much higher throughput when compared to classical HTS methods (up to 109). This

would allow high mutagenesis methods (i.e. SeSaM) to be used for gene randomization.

These libraries usually contain low amount of activity and screening then using classical HTS

methods would be very laborious and expensive. On the other hand, using flow

Page | 112

cytometry/double emulsion would allow us to enrich library in activity and additionally, with

selection parameters (gating), we could also fine tune activity of the clones in the final

library.

5. Development of ultra high throughput screening system based

on flow cytometry and double emulsions for directed

evolution of Cyt P450 BM3

5.1 Introduction

Cytochrome P450 (P450s) comprise large super-family of hemoproteins known to

catalyze diverse type of chemical reactions on broad range of chemically dissimilar

substrates. They are key components of oxidative, peroxidative and reductive metabolism of

such endogenous and xenobiotic substrates as environmental pollutants, steroids,

prostaglandins and fatty acids (101). Due to their substrate and reaction type diversity they

pose an interesting target for bioindustrial application especially in fine chemical (i.e.

pharmaceuticals) synthesis. Mammalian P450s are not suitable for industrial application due

to low stability, low catalytic activity and need for reductase partner. Bacterial P450s in

general have higher stability and much faster catalytic activity making them more suitable

candidate for large scale applications (48). On the other side they still suffer from

substrate/product inhibition and are hampered by consumption of expensive reduction co-

factors (NADH, NADPH). Directed evolution and rational design have been employed as

tools to improve properties of P450s making them more suitable for large scale industrial

applications. So far properties like substrate specificity (102-104), co-solvent resistance (11),

thermostability (105) and usage of alternate co-factors (106,107) have been successfully

improved. Even with significant success in directed evolution experiments these this suffer

from small number of clones probed (<106) due to limitations of available high throughput

screening systems. Ultra high throughput screening systems (>107) based on display

technology and in vitro compartmentalization (IVC) offer new possibilities for directed

evolution allowing us to explore more protein sequence space in single experiment.

Cytochrome P450 BM3 (CYP102A1) originally isolated from Bacillus megatherium is

self-sufficient monooxigenase with substrate specificity towards long chain fatty acids,

alcohols and amides. In the presence of NADPH and O2 it catalyses ω-1, -2 or -3

hydroxylation of fatty acid substrate with 12-22 carbon atoms (34). Unlike mammalian

P450s, BM3 is a soluble fusion protein, with heme and reductase domain present in one

polypeptide chain. Recently, it has been shown that P450 BM3 can be, by rational design or

directed evolution, be modified into an enzyme which is catalyzing reactions on substrates

structurally different that its native one. It has been engineered to convert alkanes (108),

short and medium-chain fatty acids (9,104), drug like molecules (109) and polycyclic

aromatic hydrocarbons (PAHs)(103).

Page | 113

Directed evolution offers few advantages over rational design especially in the case

where full crystal structure of the enzyme is not available. Microtiter plate and solid phase

screening systems, with throughput of 102-10

6, are commonly applied screening formats for

improving enzyme properties when it comes to oxygenases. On the other hand, even with

highest throughput these methods are still limited to sampling only small number of clones.

Recently, new techniques with ultra high throughput (>107), based on fluorescent detection

and flow cytometry have been published (3). These could potentially enable us to screen

larger libraries generated with high diversity methods (i.e. SeSaM) and explore in single

experiment more of sequence space. Additional problem occurring is low transformation

efficiency of commonly used expression hosts (E. coli, S. cerevisisae). This can be overcome

by employing small vectors for cloning in E. coli or use cell-free expression systems. Ultra

high throughput methods are either based on surface display technology (successfully used

for protein evolution trough binding affinities) or in vitro compartmentalization (IVC) within

double emulsions. The latter allowed development of flow cytometry based screening

systems which, compared to display techniques, can be extended to intracellular/excreted

enzymes with soluble reaction product. Most important is that IVC enables physical

connection between gene, encoding active variant of enzyme, and reaction product,

fluorescent probe. In case when only genes are entrapped enzymes are expressed within the

droplet using cell-free expression system. This approach has been successfully applied for

directed evolution of DNA polymerases (110), phosphotriesterases (111), methyltransferases

(112), endonucleases (20) and galactosidases (21). Whole cell can be entrapped inside the

aqueous droplets in which case enzyme is expressed within the cell. This has been a

successful approach in directed evolution of thiolactonases (22).

In this work we present ultra high throughput screening system for directed

evolution of Cytochrome P450 BM3 (Cyt P450 BM3). Method is based on IVC of cells

expressing active variants of P450 BM3 in double emulsions and sorting them by flow

cytometry. Substrate for Cyt P450 BM3 has been synthesized using 3-carboxy coumarin as a

fluorescent probe. In 7-position benzyl group has been attached. After the enzymatic

hydroxylation probe is released. This is followed by increase in fluorescence in droplets of

double emulsions containing active variants of P450 BM3, which are then enriched in 3

subsequent rounds of sorting using Partec CyFlow Space flow cytometer. Active clones are

rescreened in the 96-well MTP and only the best ones purified and kinetically characterized.


All chemicals were of analytical grade or higher purchased from Sigma-Aldrich

(Steinheim, Germany), AppliChem (Darmstadt, Germany) and Serva (Heidelberg, Germany).

ABIL EM-90 was purchased from Dechema (Frankfurt am Main, Germany). All enzymes and

buffers used in cloning experiments were from Fermentas (St. Leon-Rot, Germany).

Page | 114

As a PCR template for P450 BM3 gene and library and library amplification pCWORI

vector harboring F87A/R471C variant of BM3 was used (Prof. Frances Arnold, Caltech,

Pasadena, USA). All libraries were constructed in pALXtreme-1a vector (pET-28a(+) derivative

where 63 % of sequence have been deleted and lacI gene has been transferred to the

genome of BL21-Gold (DE3) under the control of Q1 promoter, Dr. Alexander Schenk, Jacobs

University Bremen, Bremen, Germany). For plasmid isolation constructs were transformed in

E. coli XL10-Gold (Invitrogen, Karlsruhe, Germany) and for protein expression in BL21-Gold

(DE3) lacIQ1

(Dr. Alexander Schenk). Cells were normally grown in LBKan media (50 µg/ml)

unless stated otherwise.

Substrate (7-benzoxy-3-carboxy coumarin) has been synthesized starting from 3-

carboxy coumarin methyl ester as described in the Chapter 4. Dilutions were made in DMSO

and kept on 4°C (in dark).

Assay in the emulsion was assembled as described below. Concentrated Screening

master mix was prepared by mixing 25 µl isocitric acid (80 mM), 25 µl NADPH (10 mM), 12.5

µl isocitrate dehydrogenase (0.5 U/µl) and 5 µl of fluorescein (500 µM). Cell suspension (40

µl) in buffer (0.1 M tris-HCl pH 8.0) was mixed with concentrated Screening mix (13 µl),

vortexed shortly and emulsified as described.

Assay in 96-well microtiter plate format (MTP) was performed using Corning (Hagen,

Germany) 96-well black flat bottom plates. Cells expressing P450 BM3 variants were grown

directly in the MTP, centrifuged and re-suspended directly in 100 µl of Assay mix (100 mM

phosphate buffer pH 9.0, 54 µM PMB, 75 µM BCC Acid and 250 µM NADPH). Fluorescence

was monitored using TECAN Safire (Crailsheim, Germany) MTP spectrofluorimeter

(excitation: 400 nm, emission: 440 nm, gain: 55, z-position: 5000 µm, integration time: 40 µs

and number of light flashes: 5).

Gene was amplified in error prone PCR (epPCR) conditions using balanced dNTPs,

addition of Mn2+

ions, decreasing the amount of template DNA and increasing the number of

cycles (113). All PCRs were done in 50 µl volume using thin-wall PCR tubes (Sarstedt,

Germany) and Eppendorf Gradient Cycler (Darmstadt, Germany). Reaction consisted of 1X

PCR buffer pH 9.2 (50 mM tris-HCl, 16 mM ammonium-sulphate, 1.75 mM magnesium-

chloride and 0.1% Tween 20), dNTPs (0.2 mM each), forward and reverse primer (400 nM

each, forward primer: 5’- A*C*C*A*T*G*G*G*C*A*G*C*ATGACAATTAAAGAAATGCCTCAGCC

AAAAACG -3', reverse primer: 5’- G*G*C*T*T*T*G*T*T*A*G*C*TTACCCAGCCCACACGTCTTT

TGCGTATC -3', asterisk marks positions of phosphothioester bond), MnCl2 (0.2 mM), Taq

polymerase (5 U) and template DNA (25 ng). Cycling was done as follows: 1 cycle of initial

denaturation (94°C, 2 min), 35 cycles consisting of denaturation (94°C, 30 sec), annealing

(67°C, 30 sec), elongation (72°C, 2 min) and 1 cycle of final elongation (72°C, 5 min). After

PCR sample was purified using PCR purification kit (Qiagen, Hilden, Germany) and quantified

via Nano Drop (ND-1000, Nano Drop Technologies, Delaware, USA). Gene was cloned in

pALXtreme-1a vector using Phosphorothioate based Ligase Independent Gene cloning

Page | 115

system (PIGe, see Chapter 2) and transformed in XL10-Gold cells (114). Few tubes of

transformed cells were pooled and grown together in liquid LBKan media (4 ml, 37°C, 12 h,

250 rpm). Small aliquot (5 µl) of transformation mixture was plated on LBKan agar plates to

determine transformation efficiency and size of primary library. Plasmid was recovered using

Plasmid Prep Kit (Qiagen, Hilden, Germany) and re-transformed to expression strain BL21-

Gold (DE3) lacIQ1

(114).

Induction of P450 BM3 variants was done by inoculating cells in LBKan media (4 ml)

and growing them for 2 hours (37°C, 250 rpm). Then IPTG (0.5 mM) was added and

expression was continued (30°C, 250 rpm) for additional 3 hours. After this cells were

centrifuged (5900 x g, 3 min) and washed twice with ice cold PBS. Finally cells were re-

suspended in activity buffer (0.1 mM tris pH 8.0) in concentration of 5 x 106

cell/µl. Prior to

emulsification cell suspension was passed trough 5 µm filter. Cell suspension was mixed with

concentrated Screening master mix as described under the Assay part of Materials and

methods. Emulsification was done as described previously (3) with decreasing the final

volume of emulsion to 525 µl and using Miccra D-1 (ART, Müllheim, Germany)

homogenizator. After preparation of primary emulsion, substrate was added (1 µl of 200

mM BCC Acid in DMSO) and secondary emulsion was prepared immediately after. Emulsion

was incubated on room temperature (2 h), in dark. For visualization of integrity of secondary

emulsion fluorescent microscopy was used (Keyence BZ-8000, Neu-Isenburg, Germany,

mercury lamp excitation, blue (450±20 nm) and green (520±20 nm) filters for emission).

For analysis and sorting emulsion was diluted 100 times in sterile PBS. Sample was

run with speed 5 µl/min trough Partec CyFlow Space flow cytometer (Partec, Muenster,

Germany). Sheet fluid (0.9% NaCl, 0.01 Triton X-100 in Milli-Q water) was filtered and

autoclaved before use. Detection was “triggered” on green fluorescence (excitation: 488 nm,

emission: 530 nm) coming from fluorescein used as an internal control dye. Analysis speed

was approx. 6000-7000 events/sec while sorting speed was 5-10 events/sec. For sorting

~0.1-0.01% of active population was chosen and sorted in approx. 50 ml volume.

Sorted sample was passed trough 0.2 µm filter, recovered in 1 ml of LBKan media with

shaking (1400 rpm, 10 min) and then inoculated in LBKan media (4 ml). For the next round of

enrichment this was used as a pre-culture sample. Enrichment/sorting was repeated 3 times.

After each round, 100 µl of sorted sample was plated on LBKan agar plates with IPTG

(5 µM) for activity assay and cell quantification. Cells were grown overnight (37°C, 16 h).

Activity assay was done by picking colony from the agar plate directly in 50 µl Assay mix (see

under Assay part of Materials and methods) in black flat bottom 386-well MTP. Fluorescence

(excitation: 400 nm, emission: 440 nm) was monitored using TECAN Safire in 60 min period

(gain: 80, z-position: 8500 µm, integration time: 40 µs and number of light flashes: 10).

Finally, after flow cytometry enrichment steps cells were grown on LBKan agar plates

(37°C, 16 h) and picked into 150 µl LBKan media in flat bottom transparent 96-well MTP using

sterile toothpicks. Suspension was grown (37°C, 900 rpm, 70% humidity, 16 h), diluted with

Page | 116

glycerol (25% final) and stored on -80°C (Master plate). Replica of Master plate for activity

testing was made in 150 µl LBKan media with supplements (0.5 mM δ-aminolevulinic acid, 0.5

mM thiamine, 1 x trace elements and 5 µM IPTG) in flat bottom black 96-well MTP and

grown (30°C, 700 rpm, 70% humidity) for another 12 h. Plates were centrifuged (3200 x g, 10

min, 4°C) and assay was done as described under the Assay part of Materials and methods.

Most active clones (including the starting clone M0) were selected from MTP

screening and inoculated in 4 ml LBKan media. Four milliliters of pre-culture was transferred

to 250 ml TBKan media (in 1 l flask) with supplements (0.5 mM δ-aminolevulinic acid, 0.5 mM

thiamine and 1 x trace elements), grown (37°C, 250 rpm) for 2 hours and then induced by

addition of IPTG (0.5 mM). Protein was expressed (30°C, 250 rpm) for 8 hours. After

expression cell suspension was kept on ice. Expressed cells were centrifuged (3200 x g, 10

min, 4°C), re-suspended in 15 ml lysis buffer (0.01 M tris pH 7.8) and passed trough French

press (3 times, 1500 bars). Cell lysate was cleared by centrifugation (21000 x g, 10 min, 4°C)

and filtering (0.45 µm). Protein was purified using ion-exchange chromatography as

described in Chapter 3. Peak corresponding to P450 BM3 was pooled (10 ml) and

concentration of protein was determined using CO binding method (86). Purity of the

samples was confirmed by SDS-PAGE (85).

Kinetic characterization was done in black flat bottom 96-well MTP in final volume of

120 µl. Enzyme fractions were diluted 10-15 times in PBS and kept on ice. Assay was

assembled as follows: 100 µl 0.1 M phosphate buffer pH 9.0, 10 µl enzyme solution and 2 µl

of substrate. After incubation with shaking (750 rpm, 5 min) 8 µl of NADPH (10 mM) was

added. Fluorescence (excitation: 400 nm, emission: 440 nm) was monitored for 10 minutes

(1 min interval, gain: 80, z-position: 5500 µm, integration time: 40 µs and number of light

flashes: 10). Slope (AU/min) was calculated in first 5 minutes of the reaction (linear range)

using Microsoft Excel. Concentration of the product was calculated form the standard curve

constructed for 3-carboxy coumarin (10-325 nM). For determination of standard deviation 5

repetitions were done for each substrate concentration. For Km and kcat determination data

was plotted and fitted using Origin 7.0 (OriginLab Corporation, Northampton, USA).

Sequencing of selected variants was done with MWG (Ebersberg, Germany).

Sequence was analyzed using Vector NTI (Invitrogen, Karlsruhe, Germany).


As a substrate, for screening Cyt P450 BM3 activity in MTPs and double emulsions, 7-

benzoxy-3-carboxy coumarin was used. After the specific enzyme hydroxylation, fluorophore

(3-carboxy coumarin), is released (Figure 65). In emulsion, this is followed by increase in

fluorescence (excitation: 375 nm, emission: 440 nm) of droplets containing active variant of

the P450 BM3. The negative charge present in 3-position disabled diffusion of the probe

trough the lipid layer of the double emulsion droplet and the integrity was preserved even

after incubation (2 h) on room temperature. This was not the case when probe without the

Page | 117

charge was entrapped (3-carboxy coumarin methyl ester or 4-methyl umbeliferone). In this

case fast diffusion (within minutes) disabled flow cytometry analysis and mentioned probes

could not be used as reporter molecules for activity screening in double emulsions.

Figure 65 Schematic representation of ultra high throughput based method for Cytochrome P450 BM3 directed

evolution. E. coli cells expressing different variants of Cyt P450 BM3 are entrapped in aqueous droplets of double

emulsions together with fluorogenic substrate. After the reaction and conversion to fluorescent product, “active”

droplets are enriched by using flow cytometry. Positive clones are rescreened in 96-well MTP, purified and characterized.

After sequence and amino acid analysis models of the new variants were generated and influence of new mutations

explained on molecular level.

As the wild type P450 BM3 practically showed no activity with the charged 3-carboxy

coumarin substrate, more active variant M0 (F87A/R471C) which was known to catalyze

reactions on bulky substrates (42,44), was used in all experiments. Assay was optimized in

emulsion format using 0.1 M tris-HCl pH 8.0 as activity buffer while in MTP format 0.1 M

phosphate buffer pH 9.0 was used due to more pronounced difference between substrate

and product fluorescence. NADPH shows fluorescence in conditions used for flow cytometry

screening (excitation: 375 nm, emission 440 nm). To decrease background fluorescence

arising from NADPH, lower amount had to be used in emulsion assay, but instead,

components of NADP-recycling system have been entrapped to ensure higher product/signal

levels. In MTP problem of background fluorescence was eliminated by exciting the reaction

Page | 118

mixture on higher wavelengths (400 nm instead of 375 nm) where NADPH shows very low

fluorescence. Additionally, when using whole cells for the assay in 96-well MTP

permeabilizer (polymyxin B sulphate) was added to ensure efficient transfer of substrate

trough membrane of E. coli (115). In emulsion, substrate concentration and sensitivity of the

device were higher so there was no need to disrupt the membrane of the cell. On one side

this ensured higher survival rate of cells after sorting. Finally, under the optimal settings for

96-well MTP assay showed standard deviation of 13% while standard deviation of the cell

growth in the MTP was ~9%.

Using balanced dNTPs in epPCR conditions whole P450 BM3 F87A/R471C gene was

randomized and successfully cloned in pALXtreme-1a vector. Constructs were transformed in

XL10-Gold cells and after growth in liquid culture recovered using plasmid isolation. Small

fraction of sample was plated on the agar plates after transformation and library size was

calculated. Primary library contained ~5 x 105 different variants. These were transformed in

BL21-Gold (DE3) lacIQ1

strain for protein expression. Error prone conditions we used (0.2 mM

Mn2+

, 35 cycles and 25 ng template DNA) ensured high mutagenesis rate compared to

conditions previously published (116,117). Expectantly, under there conditions large

numbers of clones in the library were rendered inactive (~98 %). This low amount of active

clones would make “standard” high throughput screening systems virtually impossible to

use. On the other side, high mutagenesis rates enable us to introduce more radical changes

in protein structure and explore more in detail structure/function relationship and

synergistic activity of certain mutations.

For flow cytometry enrichment/sorting cells were induced (0.5 mM IPTG) and grown

until OD600~0.5 which corresponds to 108 cells/ml. Finally, after washing and filtering step

which were necessary to remove cell aggregates, concentration was adjusted to 5 x 106

cells/µl. Cells were compartmentalized as published before (3) together with NADPH

recycling system (NADPH, iso-citrate, iso-citrate dehydrogenase) and substrate (BCC Acid). In

total, ~1.3 x 108 cells were entrapped in 525 µl of secondary emulsion. Number of aqueous

droplets in emulsion (>1010

) was in excess compared to number of cell entrapped, rendering

large majority of the droplets empty (22). Fluorescein (5 µM) was therefore used as internal

water phase control, enabling us to distinguish “real” double emulsions from the primary

emulsions and empty lipid droplets. Together with “green triggering” (excitation: 488 nm,

emission: 520 nm) this enabled us to use higher analysis and sorting speed. To choose

proper gaiting for sorting, negative (containing the cells with empty vector) and positive

control (cells expressing starting variant M0) were entrapped and analyzed under the same

settings. Emulsion was incubated 2 hours on room temperature and in that time showed

stability, confirmed by fluorescence microscopy. Released product (3-carboxy coumarin),

containing a negative charge, was hydrophilic enough to be stable inside the aqueous phase

of the double emulsion even after incubation (Figure 66).

Page | 119

A) B) C)

Figure 66 Fluorescent microscopy of double emulsions after the incubation (2h, room temperature) in bright field (A),

green channel (emission coming from fluorescein used as internal control, UV excitation, green emission filter: 520 nm)

(B) and blue channel (emission coming from 3-carboxy coumarin, reaction product, UV excitation, blue emission filter:

450 nm) (C). Size of the aqueous droplet varies from 2-5 µm while lipid droplets are bigger in size (20-40 µm).

Emulsion containing entrapped cells, each expressing a different P450 BM3 variant in

a cytoplasm, was subjected to three rounds of sorting/enrichment by flow cytometry. After

each enrichment step, fraction of the cells (as well as the starting library) was grown on

induction agar plates and checked for activity and survival rate. In total ~2.6 x 107 cells were

screened (100 µl of secondary emulsion). Out of this, approximately 0.1-0.01 % was sorted

out (~2.6 x 103 – 2.6 x 10

4 clones) and grown in liquid culture. Staring library showed low

percentage of activity (1.85 %, 1 active clones out of 54 screened) in agar plate/liquid assay.

After three rounds of sorting/enrichment activity reached 41 % (20 active clones out of 49

screened) resulting in quite high enrichment factor (22 times, Table 10). Flow cytometry

analysis of the emulsified cell population after each round of sorting showed increase in

percentage of blue droplets corresponding to increase in number of active clones (Figure

67A/B). Survival rate of sorted clones was ranging from 60-80%.

Figure 67 Flow cytometry recording (A) of empty emulsion (black), emulsion before (red) and after one (blue) and two

(pink) rounds of sorting. FL3 represents the blue fluorescence (emission: 520 ± 10 nm) from UV excitation (375 ± 10 nm)

coming from released 3-carboxy coumarin. Graphic representation (B) of positive events from flow cytometry recording

(light gray, gating M1) and from agar/liquid activity assay (dark grey) after successive rounds of sorting.

Page | 120

Table 10 Enrichment factors after each round of sorting obtained by agar plate/liquid assay

Sample Active/total clones

screened Percentage (%) Enrichment factor

Starting library 1/54 1.85 -

1st

round of sorting 4/23 17.39 9.4

2nd


3rd


Total 22.1

High activity, reached after three rounds of flow cytometry enrichment/sorting

(~41%) was sufficient for MTP characterization. On the other side, MTP characterization

enabled us to validate in detail flow cytometry screening system for P450 BM3 since this

data was not available so far. In total, 176 clones were screened in the 96-well MTP using

the same substrate (BCC Acid) employed previously in flow cytometry screening (Table 11).

Out of 176 total screened clones 90 showed activity (51%), which is in good correlation with

agar plate/liquid assay (~41%). Out of 90 active clones 30 clones (33%) showed activity which

was at least two times higher when compared to the staring variant (M0), expressed and

characterized under the same conditions. Out of total active population high number of

clones showed activity 3-5 times higher to that of the staring clone (Table 12). This proved

that settings used for sorting/enrichment not only enabled us to increase the number of

active clones in the library but to select clones with higher activity. This again showed the

superiority of flow cytometry methods compared to MTP high throughput screening systems

since by “fine tuning” of gating region we can influence the final outcome of the library. The

more stringent the sorting is, the more activity is present in the final library ensuring that the

clones which need to be rescreened in the MTP really poses superior properties compared

to the parent variant (22).

Table 11 Statistics on screening in the 96-well MTP

Active/screened

clones Active clones (%)

>2 times

improved/number

of active

>2 times active

clones (%)

90/176 51.14 30/90 33.33

Table 12 Screening in 96-well MTP; comparison of percentage of active clones with activity higher that starting clone

Activity

compared

to M0

0 1 2 3 4 5 Total

Number n.d. 17 6 5 16 3 47

Percentage

(%) n.d. 18.89 6.67 5.56 17.78 3.33 52.23

Three best clones from 96-well MTP screening were chosen for kinetic

characterization. They were grown in batch culture (250 ml) and purified as explained

before. On chromatograms all mutants, as compared to the starting one (M0), had slightly

Page | 121

altered retention times showing that mutations didn’t affect, in large, overall charge of the

protein (Figure 68). All analyzed fractions containing different BM3 variants showed similar

concentration after CO binding assay proving that expression level was as well not affected

by mutations. SDS-PAGE showed that all variants had sufficient purity for kinetic

characterization (>90%, Figure 69).

Figure 68 Purification of P450 BM3 variant using DEAE ion-exchange chromatography; detection was based on

absorbance at 417 nm. Chromatograms in color represent different P450 BM3 variants: red (M0), blue (M1), gray (M2)

and brown (M3) with their respective retention times, while green line represents gradient of buffer B

Figure 69 SDS-PAGE analysis of cell homogenate (a) and purified (b) P450 BM3 variants M1(1), M2 (2) and M3 (3);

molecular weight markers (MWM) were 116, 66, 45, 35, 25, 18 and 14 kDa

Kinetic characterization was done using 96-well black MTP as described earlier, final

volume being 120 µl. Substrate concentrations were ranging from 250 µM to 0.98 µM (9

concentrations). Enzyme concentration was ranging from 50-140 nM, well in the linearity

Page | 122

range of the assay. Concentration of product was recalculated (nM) using a standard curve

generated using 3-carboxy coumarin. All kinetic parameters for characterized variants as

well as for the starting one (M0) are shown in Table 13.

Table 13 Kinetic characterization of improved P450 BM3 variants (M1, M2 and M3) in comparison to starting variant

(M0)

Variant Mutations Km

(µM)

kcat

(eq min-1

)*

Kcat/Km

(eq min-1

µM-1

)* M/M0

M0 F87A, R471C 42.46 0.187 0.004 1

M1 L29S, R47Y, F87A, Q189R, R471C, Y857N 40.64 1.142 0.028 7.0

M2 E13G, R47L, F87A, R471C, L1030S 22.32 0.935 0.042 10.5

M3 E64G, F87A, R223H, M354S, R471C, T883H,

P884R, N952D 47.94 2.621 0.055 13.8

* eq represent nmol product/nmol enzyme

All variants, but one (M3), showed slightly decreased Km values for the charged

substrate being even up to two times lower (M2). On the other hand all of them showed

increased kcat values reaching even up to 13 times compared to the starting variant. Overall

activity (kcat/Km) was improved for all selected variants (from 7 to 14 times, Table 13).

As a consequence of high mutagenesis conditions used in the epPCR large numbers

of mutations (5-12) were present in DNA sequence. This corresponded to 4-8 additional

amino acid changes in the variants. Out of the nucleotide changes 16 were transitions and 9

were transversions showing bias of epPCR mutagenesis method (118). Two of the 3

characterized variants contained exchange at position 47 from Arg to Tyr (M1) and Leu (M2).

This position has been known to affect the binding of the substrate via compensating

negative charge of carboxylate group.

Variant M1 contained 5 mutations in DNA sequence giving 4 exchanges in amino acid

sequence compared to the variant M0 (Table 13). Most of the mutations were located in the

heme domain, close to the entry point of substrate binding channel. These changes at

position 29, 47 and 189 probably affect the entrance of the substrate to the heme pocket

and ease up the conversion. Only one residue has been exchanged in reductase domain,

Y857N, part of the sequence responsible for interaction with FAD (39). Variant M2 contains 3

additional mutations in amino acid sequence of which most of them are located in reductase

domain (Table 13). Variant M3 contained on DNA level 8 mutations, including one base par

deletion and insertion. This reflected 6 additional mutations in amino acid sequence (Table

13). Position 354 was exchanged from Met to Ser and this mutation has already been shown

to affect enzyme activity towards different substrates (107). Interestingly, mutation E64G

was observed. This exact mutation was found by Commandeur and coworkers in directed

evolution of P450 BM3 towards drug like molecules using resorufin based substrates (109).

Location of this residue is far from active site of the enzyme but the fact that it was present

in two unrelated screening evens using random diversity generation methods might point

out its importance.

Page | 123

5.4 Conclusion

Directed evolution, even being powerful tool for improving biocatalysts and

discovering new structure/function relationships within the protein, still suffers from few

disadvantages. First being low transformation efficiency of commonly used expression

strains (E. coli, S. cerevisiae), and the second lack of ultra high throughput screening

methods which would allow high number of clones to be probed within one directed

evolution experiment (>107).

In our work we present a novel ultra high throughput platform for screening and

improving activity of Cytochrome P450 BM3. Technology is based on in vitro

compartmentalization (IVC) of E. coli cells while detection is based on conversion of

coumarine based fluorogenic substrate. After cells, expressing different variants of Cyt P450

BM3, are entrapped within the aqueous phase of double emulsions convert the fluorogenic

substrate into fluorescent product, “positive” droplet are screened and enriched via flow

cytometry. This screening system allowed us to screen more than 107 variants within few

hours and sort out only the most active variants. The system is validated with 96-well MTP

re-screening (176 clones) and the best variants are purified and characterized (3 clones). In

three rounds or enrichment/sorting activity of the library was increased from ~2% to ~40%.

Improvement in activity of characterized variants was ranging from 7 to 14 times

when compared to the starting clone which was the consequence of 4-9 amino acid changes

in the protein structure. In the spectra of acquired mutations positions L29, R47 and M354

have been known to affect the activity in the positive way. Together with positions E13, L29,

E64, Q189 and R223, located near the entry channel in heme domain, they are probably

influencing substrate binding. However, many new positions have been discovered in the

reductase domain and the relationship with the increased activity is yet to be discovered.

From the preliminary model analysis, mutations located in the reductase domain of P450

could on one side have an effect on increase of electron transfer within the protein or simply

enhance the binding of the important co-factors (FAD). One thing is clear that most of them

are located in the reductase part responsible for interactions with FAD (I824, D838, S847,

E852 and Y857)(39).

Using high mutational load in directed evolution experiments is possible only with

development of adequate ultra high throughput screening platforms. High number of

inactive clones would render the normal screening system virtually impossible to use. If one

is aiming to evolve properties of a biocatalyst in fewer steps then benefit from multiple

mutations would be important. On one side many mutations could be complementing

themselves i.e. help the binding of the substrate and conversions at the same time. But

additionally, formation of hydrogen bonds and salt bridges would have a positive effect on

protein stability and activity under non-optimal conditions (high pH, presence of organic

solvents). It has been shown that activity of thiolactonases could be improved up to 100

times using same technology. Randomization of 16 positions within the gene enabled

Page | 124

exploration of many possible outcomes for increased activity. It has also been shown that

out of huge repertoire of possibilities only some of the mutations, present in selected clones,

were most responsible for the increase in activity (22).

IVC technology combined with flow cytometry is a powerful addition to directed

evolution. No doubt that application of this technology would be a new step further in

tailoring biocatalysts for certain applications. When planning to apply this technology few

things should be kept in mind. Detection is based only on fluorescence signal, thus

fluorescent assay for detection of activity needs to be developed. In some cases (hydrolytic

enzymes) this is easier than in other (very specialized enzymes). Using the surrogate

substrate limits the screening to improving activity towards substrate used and not the real

substrate. This activity, on the other side, can still be unaffected or even decreased.

Additional problem is diffusion of fluorescent probes trough oil layer of emulsion droplet.

Unless the probe is hydrophilic enough (preferably containing a charge) it will not be

entrapped within the water phase and it can not be used in this system.

Developing new technologies for directed evolution of bio-industrially important

enzymes, such as Cytochrome P450 BM3, is still a challenge. Problems mentioned in

previous paragraph, like low transformation efficiency or diffusion of the probes are still to

be solved. Using cell free instead of in vivo expression could overcome low transformation

problems and using per-fluoro generated emulsions would allow us to use more generalized

detection systems but nevertheless, these systems are still far from routine practice.

Our future work will be focused on using the platform described in this article and

evolve Cyt P450 BM3 in few properties which could in future help its more general

application. Changing the substrate specificity towards drug like molecules could find a

valuable place in pharmaceutical industry together with increase in activity. This platform

could help evolve other properties like thermo- and pH stability, substrate/product

inhibition and employment of alternate cofactors, all important for possible large scale

application.

6. Screening the metagenome libraries using flow cytometry and

double emulsions: the source of novel P450 activity

6.1 Introduction

Vast majority of microorganism in certain habitats can not be cultivated in laboratory

conditions. Approaches have been devised to recover gene from one such pool but most of

them were based on PCR and suffered from many disadvantages. In 1990 metagenomics was

developed. It involved isolating complete DNA out of a habitat, fractionating it and cloning it

into suitable expression hosts. This is known as a construction of metagenome libraries.

Page | 125

Libraries are then screened either with sequence based screening or activity based screening

systems to recover genes/enzymes with novel or improved activity.

Isolating and fragmenting the complete genetic material from a certain habitat after

cloning leaves a majority of clones containing “junk” DNA, fragments not cloning any of the

functional proteins. In that case, HTS methodology has to be devised to screen as high

number of clones as possible increasing a chance to find a positive hit. So far MTP screening

systems have been established and in some specific cases solid based HTS platforms (i. e.

hydrolases). No ultra-HTS methodology has, up to date, been used to screen metagenome

libraries.

As mentioned previously, Cytochrome P450, especially self-sufficient ones, present

an interesting asset to be used in bioindustrial application. Screening metagenome library

for novel P450 activity using activity screening approach would be very difficult due to low

hit rate of these enzymes and insufficient throughput of available assays. Sequence based

screening approach was devised to browse the natural diversity of self sufficient P450s

(119). Metagenome library was constructed in fosmid vectors using genetic material isolated

from soil. Final clone number was ~2 x 106

with an average insert size of 32 kb. Degenerated

primers for screening were devised on account of sequences of known self-sufficient P450s.

Many P450s sequences were found but two, syk51 and syk181, showed to be the most

different one from all known P450s (~70% homology). Sequences were fully recovered,

genes re-cloned and novel P450 expressed and characterized (119). This was the first report

of novel self-sufficient P450s discovery using metagenomics approach.

In this Thesis we have devised and optimized new ultra-HTS system for screening

mutant libraries for P450 BM3 activity using flow cytometry in double emulsions (see

Chapter 5). In the final Chapter we tested the novel methodology on screening the

metagenome libraries for β-galactosidase activity and finally, P450 activity. Identified

positive hits were still to be genetically characterized (fully sequenced), re-cloned in

expression vectors and expressed.


I. Screening for ββββ-galactosidase activity using MTP and flow cytometry

Thirteen metagenome libraries together with additional “referent” library (B.

megatherium) were supplied in the form of the plasmid preparation from our collaborators

B.R.A.I.N. AG (Zwingenberg, Germany). All vectors were, as suggested by the collaborator,

transferred to electrically competent E. coli One shot MAX Efficiency DH10β (Invitrogene,

Karlsruhe, Germany) according to manufacturer’s instruction and kept in the form of glycerol

stock.

Page | 126

To test weather β-galactosidase activity is present in any of original libraries fraction

(50 µl) was directly spread on X-Gal agar plates (250 µg/ml) and incubated until

development of blue color.

One positive and one negative colony have been selected as a model system for flow

cytometry conditions optimization (substrate addition, sorting conditions). Emulsions were

prepared as described in details in Chapter 5. We tested internal and external substrate

delivery as well as different conditions for sorting. Optimized conditions were used for

sorting of the selected sample (H171/195) that showed the highest β-galactosidase activity.

Sample before and after the sorting was pleated on the X-Gal plates and results was

observed (overnight, 30°C) after color development.

II. Screening for novel P450 activity using coumarine substrates and flow

cytometry

For detection of novel P450 activity we used BCC acid as a substrate for flow

cytometry screening and all three substrates (BCC, BCC acid and DBCC) in the MTP screen.

E. coli DH10β cells harboring all 13 metagenome libraries were grown overnight (4 ml

LBChl, 30°C, 250 rpm). Cell preparation and emulsification was as described previously in the

Chapter 5. All emulsion samples were incubated 2 hours on room temperature and analyzed

on flow cytometry together with the blank sample (cells which don’t show any P450 BM3

activity). Sample showing highest population of positive (“blue”) droplets was further used

for sorting. Sample was subjected to three subsequent rounds of enrichment process and

finally plated on agar plate containing chloramphenicol (25 µl/ml). Clones were transferred

to 96-well flat bottom MTP and kept in glycerol stock (-80°C). For activity assay in 96-well

MTP, cells were transferred into 150 µl LKChl media, grown overnight (30°C, 700 rpm, 70 %

humidity), centrifuged (4000 x g, 10 min, 4°C) and assayed as described in Chapter 5.

Clones showing activity with any of the substrates used, BCC and BCC Acid, were

grown in 4 ml LBChl media and plasmid was isolated as described previously (74). Name of

clones and relative slopes towards substrates are shown in Table 17.


Detailed information about the name of all the metagenome libraries, number of the

inserts and size of the libraries is summarized in the Table 14. From the information supplied

by out collaborators two vectors have been used for library construction. They differ only in

promoter in front of MSC. Both promoters are constitutive and work both E. coli and Bacillus

hosts. Vector is high copy number vector in both hosts and can be easily propagates using 25

µl/ml chloramphenicol resistance. Fragments are inserted by using KpnI and HindIII

combination of restriction enzymes.

Page | 127

Table 14 Metagenome libraries supplied by our collaborators, B.R.A.I.N.

All the plasmid preps were diluted 25 times with Milli-Q water and stored at -80°C.

DNA content was determined in the diluted libraries (Table, Supplementary data) using

NANO Drop and 1 µl was transformed to 100 µl commercially available cells as described by

manufacturer.

Page | 128

I. Screening for ββββ-galactosidase activity using agar plates and flow cytometry

Small sample of the cells have been (10 µl) had been plated on X-Gal plates directly

after the transformation. Percentage of active (expressing β-galactosidase activity) was

determined and expressed in the Table 15.

Table 15 Number of clones and transformation efficiency of transformed metagenome libraries. Galactosidase activity

was detected on X-Gal plates.

Library name # clones/plate Transformation efficiency

(cfu/µg vector backbone)

Galactosidases

hits Ratio

H321 124 1.07 106

H324 4800 8.29 105

H327 1 2.22 104 1

H330 848 4.02 106 1 1.18 10

-3

H334 3200 1.53 107

HB0001 4800 1.97 106

H216 496 1.27 107

H004T 1368 1.71 108

H149/136 1696 8.07 107

H165/181 3200 4.05 107

H171/195 2656 8.3 107 48 1.81 10

-2

H186/196 1040 1.05 107 1 9.6 10

-4

H319T 3200 5.0 107

B.megatherium 576 5.65 106

After detecting a galactose positive and galactose negative clones, these were used

to optimize flow cytometry based screening system for β-galactosidases. We tested different

substrates delivery methods (internal and external delivery) as well as speed and gating of

the sorting process. Optimized protocol for screening was used to enrich selected library

(H171/195) and samples were plated on X-Gal agar plates before and after flow cytometry

enrichment (Figure 70).

Figure 70 Picture of a library plated before (left) and after sorting (right). X-Gal plates were used for detection of

galactosidase activity.

Page | 129

II. Screening for novel Cyt P450 activity using coumarine substrates and flow

cytometry

As mentioned previously, same principle was applied for Cyt P450 activity screening.

All libraries were grown and assayed in emulsions by flow cytometry as well as in the liquid

culture using BCC acid and BCC substrates. Most prominent results are shown in Table 16.

Table 16 Positive hits from metagenome libraries after screening in double emulsions and liquid culture (in MTPs).

Library name

MTP screening Flow cytometry

screening (%)

Ratio between

sample and

blank

Cumulative

results BCC acid BCC

Blank* - - 0.18 1.0 -

B.megatherium* + + 0.61 3.4 +

H171/195* + + 0.31 1.7 +

Blank - - 0.40 1.0 -

H194/136 + - 0.41 1.0 -

H321 + + 0.59 1.5 -

H195/181 + + 2.84 7.1 ++

H329/T ++ ++ 2.11 5.3 ++

H186/194 + - 0.51 1.3 -

H330 - - 0.75 1.9 -

H216 ++ + 2.91 7.3 ++

HB0001 + + 1.08 2.7 +

H334 + ++ 3.37 8.5 ++

Good correlation was observed with the sample which showed activity both in MTP

and by flow cytometry.

We decided to proceed with the sample H171/195. This sample was subjected to

three rounds of sorting and transferred to MTP in the form of glycerol stock. Activity

screening was done as described previously employing all three substrates. Results are

shown in the Table 17.

Table 17 Positive hits isolated from the metagenome library H171/195 after MTP screening with BCC and BCC Acid

substrates.

Clone designation Activity with BCC (rel. units) Activity with BCC Acid (rel. units)

Clones that work preferentially with BCC

2C7 119 33

3H6 145 -41

Clones that work preferentially with BCC Acid

1C3 30 309

1C6 30 189

1C11 24 228

Clones that work with both BCC and BCC Acid

2C3 305 175

2C10 168 135

3G8 149 150

Page | 130

6.4 Conclusion

Metagenome libraries are usually constructed by fragmenting and cloning complete

genetic material isolated from a specific natural habitat (soil, deep see samples, hot spring

water). Amongst clones containing genes encoding novel, yet uncharacterized proteins, vast

majority of clones is harboring “junk” DNA; DNA not coding for any proteins. Screening such

libraries, with very low amount of positive clones, would require a usage of high or ultra high

throughput methodology which is in most of the cases unavailable for the desired activity.

Sequence based screening systems, based on PCR techniques, can also be used (49).

In this Thesis we report a new ultra high throughput screening system developed for

screening mutant libraries of Cyt P450 BM3. This screening system is based in IVC of E. coli

cells within droplets of double emulsions and using flow cytometry to screen these double

emulsions. Positive events are enriched in few rounds of flow cytometry analysis and sorting.

Since this methodology has not been previously used on screening metagenome

libraries, we tested the system by screening these libraries for β-galactosidase activity, as a

proof of principle. Metagenome libraries were first tested on agar plates, for the presence of

β-galactosidases, by using well know substrate - X-Gal. One positive and one negative clone

have been isolated from the library and used to optimize conditions for flow cytometry

screening. Optimized protocol was then used to screen/enrich H171/195 metagenome

library for β-galactosidase activity. Process of enrichment was quite successful which can be

directly seen by growing the sample on the activity agar plates before and after the sorting.

Multiple clones with β-galactosidase activity can be observed after sorting process (Figure

70).

So far, only sequence based screening methodology has been used for detecting

novel P450 activity in metagenome libraries due to low number of positive hits and

unavailability of HTS assays (119). We tested our optimized system (Chapter 5) on screening

of few metagenome libraries for P450 activity (Table 16).

Cells were grown, expressed and emulsified as described previously. Screening in

emulsions was done with BCC Acid substrate. Few libraries showed presence of positive

population of blue droplets. Library showing highest number of positive events (H171/195)

was enriched in three rounds of sorting by using flow cytometry and then transferred into

MTP. Final validation of active clones was done with BCC and BCC Acid substrate in 96-well

MTPs. Some clones indeed showed activity with either of the substrates (Table 17). These

positive hits were isolated and plasmid DNA was recovered. Partial sequencing of the

inserted fragments was done by our collaborators and recovered sequence was compared to

database using BLAST software.

Interestingly, no P450 motives were found amounts analyzed sequences. Most of

the active clones contained a domain of parathion hydrolase; enzyme which naturally works

Page | 131

on structurally similar compound as the substrate we used for screening. Nevertheless, the

full sequence of the inserts needs to be recovered and analyzed.

Here we demonstrate, for the first time, application of flow cytometry based

screening system in metagenomics. As mentioned previously, metagenome libraries contain

low activity (low number of positive clones) and are perfect candidates for screening with

this ultra-HTS method. Its ultra high throughput (>109) allows large number of clones to be

probed and rare, positive events, can be enriched by repeating growing and sorting process.

Something to keep in mind is that enzymes with diverse activity, working on the

same substrates, could be identified. Metagenome libraries contain proteins with novel

functions most of them exhibiting promiscuous activity. Additionally, there could be multiple

enzymes, from genetically different classes, working on the same substrate but catalyzing

different reactions (i.e. hydroxylation, hydrolysis). All these could be identified as positive

hits in a metagenome library.

7. Summary of the Thesis

Second Chapter of this Thesis describes the work connected to development of new

cloning method based on cleavage of phosphorothioate bonds.

Directed evolution experiments require cloning method which could generate large

number of clones in a library (high transformation efficiency) with possibly no background

(high cloning efficiency). Then statistical analysis of the libraries, percentage of active clones,

mutational frequency can be done with a certainty. Otherwise high background disables us

to get correct number but also screening of larger part of the library is necessary in order to

overcome the number of wild type/inactive clones present.

We have developed a background free, fast and reproducible cloning method based

on Ligase-Independent cloning: Phosphorothioate based Ligase-Independent Gene Cloning

(PIGe). In our case, complete method is enzyme free. Phosphorothioated nucleates are

incorporated in cloning primers which are used for vector and insert amplification. After

cleavage of these bonds in iodine/ethanol solution, single stranded regions are formed on

both vector and insert, complementary to each other. Hybridized constructs are transformed

directly to E. coli.

We optimized PCR conditions for vector backbone and insert application, iodine and

ethanol concentration for cleavage of thio-primers and amount of vector/insert needed for

cloning. To show applicability of the method, using optimal conditions, we cloned three

different genes (EGFP, M57 protease and Cyt P450 BM3) in two target vectors (pET28 and

pALXtereme). Transformation efficiency was high; in case of EGFP reaching 9 x 105 cfu/µg

vector in case of pALXtreme backbone. Entire cloning procedure requires only 10 minutes,

making it one of the fastest cloning methods available. Additional advantages are that the

method is completely enzyme free, very robust and finally, employs cost effective reagents.

Page | 132

This method has been employed for construction of Cyt P450 BM3 epPCR libraries

used for directed evolution experiments.

Third Chapter focuses on expression of Cyt P450 BM3 out of pET28 and pALXtreme

vectors. Expression has been tested under different conditions (E. coli strains, media, and

temperature) and best conditions for flow cytometry application and microtiter plate

screening application have been selected. Also, batch expression (250 ml media) has been

optimized.

We also optimized purification of Cyt P450 BM3 using DEAE-ion exchange

chromatography on HPLC. By adapting previously published method we have been able to

get highly pure protein (>95%) in one step purification.

Fourth Chapter includes synthesis and characterization of novel coumarine based

fluorogenic substrates for Cyt P450 BM3. Since no fluorogenic substrate, which could fulfill

the requirements of our flow cytometry machine was available we had to synthesize them

by ourselves. Few trials have resulted in substrates which showed activity with the enzyme

but properties of the fluorophore (hydrophilicity) were not suitable for application in double

emulsions.

Finally, substrates employing 3-carboxy coumarine as a fluorescent probe fulfilled all

the requirements: detection was possible with our flow cytometry setting (ex. 375 nm, em.

455 nm), substrates were showing activity with F87A/R471C variant and released

fluorophore was hydrophilic enough (due to negative charge in position 3) to be retained

inside an aqueous droplet of double emulsion. Assay employing these substrates was

optimized in double emulsions and in 96-well MTP format. Standard deviation of the assay in

MTPs was ~13%, while standard deviation of cell growth was 9%.

Fifth Chapter summarizes all the methods from previous three chapters in

development of ultra high throughput screening system using flow cytometry and double

emulsions.

Using flow cytometry screening system we were able to enrich library starting from

~2% up to 41% in three round of sorting. For validation, enriched library was screened in 96-

well MTP showing increased number of clones (~33%) with activity improved compared to

the starting clone (>2). Three clones have been selected and kinetically characterized. Best

one had ~14 times increased activity compared to the starting clone. Multiple amino acid

changes were present in the sequence. Modeling remains to be done and explains the role

of each amino acid in substrate binding or conversion process.

Finally, sixth Chapter focuses on application of the previously described method on

metagenome library screening.

As a proof of principle, β-galactosidases were screened using the same method,

employing fluorescein-digalactoside as a substrate. High enrichment of active clones was

achieved after only one round of sorting.Metagenome libraries obtained from our

collaborators, B.R.A.I.N. AG were screened using BCC Acid substrate in double emulsions.

Some libraries showed no activity while the ones having activity were subjected to three

rounds of sorting process. Enriched library was screened in 96-well MTP and selected clones

were sent back to our collaborators for genetic analysis.

Page | 133

8. References

1. Jaeger, K.E. (2004) Protein technologies and commercial enzymes - White is the hype - biocatalysts on

the move - Editorial overview. Current Opinion in Biotechnology, 15, 269-271.

2. Tee, K.L. and Schwaneberg, U. (2006) A screening system for the directed evolution of epoxygenases:

importance of position 184 in P450 BM3 for stereoselective styrene epoxidation. Angew Chem Int Ed

Engl, 45, 5380-5383.

3. Miller, O.J., Bernath, K., Agresti, J.J., Amitai, G., Kelly, B.T., Mastrobattista, E., Taly, V., Magdassi, S.,

Tawfik, D.S. and Griffiths, A.D. (2006) Directed evolution by in vitro compartmentalization. Nat

Methods, 3, 561-570.

4. Passonneau, J.V., and Lowry, O. H. (1993), Enzymatic Analysis. A Practical Guide. Humana Press, New

York, pp. 85-110.

5. Olry, A., Schneider-Belhaddad, F., Heintz, D. and Werck-Reichhart, D. (2007) A medium-throughput

screening assay to determine catalytic activities of oxygen-consuming enzymes: a new tool for

functional characterization of cytochrome P450 and other oxygenases. Plant J, 51, 331-340.

6. Otey, C.R., Bandara, G., Lalonde, J., Takahashi, K. and Arnold, F.H. (2006) Preparation of human

metabolites of propranolol using laboratory-evolved bacterial cytochromes P450. Biotechnol Bioeng,

93, 494-499.

7. Cirino, P.C. and Arnold, F.H. (2003) A self-sufficient peroxide-driven hydroxylation biocatalyst. Angew

Chem Int Ed Engl, 42, 3299-3301.

8. Schwaneberg, U., Schmidt-Dannert, C., Schmitt, J. and Schmid, R.D. (1999) A continuous

spectrophotometric assay for P450 BM-3, a fatty acid hydroxylating enzyme, and its mutant F87A.

Anal Biochem, 269, 359-366.

9. Li, Q.S., Schwaneberg, U., Fischer, M., Schmitt, J., Pleiss, J., Lutz-Wahl, S. and Schmid, R.D. (2001)

Rational evolution of a medium chain-specific cytochrome P-450 BM-3 variant. Biochim Biophys Acta,

1545, 114-121.

10. Salazar, O., Cirino, P.C. and Arnold, F.H. (2003) Thermostabilization of a cytochrome p450

peroxygenase. Chembiochem, 4, 891-893.

11. Wong, T.S., Arnold, F.H. and Schwaneberg, U. (2004) Laboratory evolution of cytochrome p450 BM-3

monooxygenase for organic cosolvents. Biotechnol Bioeng, 85, 351-358.

12. Nazor, J. and Schwaneberg, U. (2006) Laboratory evolution of P450 BM-3 for mediated electron

transfer. Chembiochem, 7, 638-644.

13. Kumar, S., Chen, C.S., Waxman, D.J. and Halpert, J.R. (2005) Directed evolution of mammalian

cytochrome P450 2B1: mutations outside of the active site enhance the metabolism of several

substrates, including the anticancer prodrugs cyclophosphamide and ifosfamide. J Biol Chem, 280,

19569-19575.

14. Kim, D. and Guengerich, F.P. (2004) Enhancement of 7-methoxyresorufin O-demethylation activity of

human cytochrome P450 1A2 by molecular breeding. Arch Biochem Biophys, 432, 102-108.

15. Kim, D., Wu, Z.L. and Guengerich, F.P. (2005) Analysis of coumarin 7-hydroxylation activity of

cytochrome P450 2A6 using random mutagenesis. J Biol Chem, 280, 40319-40327.

16. Lussenburg, B.M., Babel, L.C., Vermeulen, N.P. and Commandeur, J.N. (2005) Evaluation of

alkoxyresorufins as fluorescent substrates for cytochrome P450 BM3 and site-directed mutants. Anal

Biochem, 341, 148-155.

17. Bershtein, S. and Tawfik, D.S. (2008) Advances in laboratory evolution of enzymes. Curr Opin Chem

Biol, 12, 151-158.

18. Griswold, K.E., Aiyappan, N.S., Iverson, B.L. and Georgiou, G. (2006) The evolution of catalytic

efficiency and substrate promiscuity in human theta class 1-1 glutathione transferase. J Mol Biol, 364,

400-410.

19. Varadarajan, N., Gam, J., Olsen, M.J., Georgiou, G. and Iverson, B.L. (2005) Engineering of protease

variants exhibiting high catalytic activity and exquisite substrate selectivity. Proc Natl Acad Sci U S A,

102, 6855-6860.

20. Doi, N., Kumadaki, S., Oishi, Y., Matsumura, N. and Yanagawa, H. (2004) In vitro selection of restriction

endonucleases by in vitro compartmentalization. Nucleic Acids Res, 32, e95.

21. Mastrobattista, E., Taly, V., Chanudet, E., Treacy, P., Kelly, B.T. and Griffiths, A.D. (2005) High-

throughput screening of enzyme libraries: in vitro evolution of a beta-galactosidase by fluorescence-

activated sorting of double emulsions. Chem Biol, 12, 1291-1300.

Page | 134

22. Aharoni, A., Amitai, G., Bernath, K., Magdassi, S. and Tawfik, D.S. (2005) High-throughput screening of

enzyme libraries: thiolactonases evolved by fluorescence-activated sorting of single cells in emulsion

compartments. Chem Biol, 12, 1281-1289.

23. Kelly, B.T., Baret, J.C., Taly, V. and Griffiths, A.D. (2007) Miniaturizing chemistry and biology in

microdroplets. Chem Commun (Camb), 1773-1788.

24. Werck-Reichhart, D. and Feyereisen, R. (2000) Cytochromes P450: a success story. Genome Biol, 1,

REVIEWS3003.

25. Hannemann, F., Bichet, A., Ewen, K.M. and Bernhardt, R. (2007) Cytochrome P450 systems--biological

variations of electron transport chains. Biochim Biophys Acta, 1770, 330-344.

26. Hawkes, D.B., Adams, G.W., Burlingame, A.L., Ortiz de Montellano, P.R. and De Voss, J.J. (2002)

Cytochrome P450(cin) (CYP176A), isolation, expression, and characterization. J Biol Chem, 277, 27725-

27732.

27. Wright, R.L., Harris, K., Solow, B., White, R.H. and Kennelly, P.J. (1996) Cloning of a potential

cytochrome P450 from the archaeon Sulfolobus solfataricus. FEBS Lett, 384, 235-239.

28. Puchkaev, A.V. and Ortiz de Montellano, P.R. (2005) The Sulfolobus solfataricus electron donor

partners of thermophilic CYP119: an unusual non-NAD(P)H-dependent cytochrome P450 system. Arch

Biochem Biophys, 434, 169-177.

29. Seth-Smith, H.M., Rosser, S.J., Basran, A., Travis, E.R., Dabbs, E.R., Nicklin, S. and Bruce, N.C. (2002)

Cloning, sequencing, and characterization of the hexahydro-1,3,5-Trinitro-1,3,5-triazine degradation

gene cluster from Rhodococcus rhodochrous. Appl Environ Microbiol, 68, 4764-4771.

30. Kizawa, H., Tomura, D., Oda, M., Fukamizu, A., Hoshino, T., Gotoh, O., Yasui, T. and Shoun, H. (1991)

Nucleotide sequence of the unique nitrate/nitrite-inducible cytochrome P-450 cDNA from Fusarium

oxysporum. J Biol Chem, 266, 10632-10637.

31. Froehlich, J.E., Itoh, A. and Howe, G.A. (2001) Tomato allene oxide synthase and fatty acid

hydroperoxide lyase, two cytochrome P450s involved in oxylipin metabolism, are targeted to different

membranes of chloroplast envelope. Plant Physiol, 125, 306-317.

32. Lau, S.M., Harder, P.A. and O'Keefe, D.P. (1993) Low carbon monoxide affinity allene oxide synthase is

the predominant cytochrome P450 in many plant tissues. Biochemistry, 32, 1945-1950.

33. Shibata, Y., Matsui, K., Kajiwara, T. and Hatanaka, A. (1995) Fatty acid hydroperoxide lyase is a heme

protein. Biochem Biophys Res Commun, 207, 438-443.

34. Narhi, L.O. and Fulco, A.J. (1986) Characterization of a catalytically self-sufficient 119,000-dalton

cytochrome P-450 monooxygenase induced by barbiturates in Bacillus megaterium. J Biol Chem, 261,

7160-7169.

35. Ravichandran, K.G., Boddupalli, S.S., Hasermann, C.A., Peterson, J.A. and Deisenhofer, J. (1993) Crystal

structure of hemoprotein domain of P450BM-3, a prototype for microsomal P450's. Science, 261, 731-

736.

36. Sevrioukova, I.F., Li, H., Zhang, H., Peterson, J.A. and Poulos, T.L. (1999) Structure of a cytochrome

P450-redox partner electron-transfer complex. Proc Natl Acad Sci U S A, 96, 1863-1868.

37. Noble, M.A., Miles, C.S., Chapman, S.K., Lysek, D.A., MacKay, A.C., Reid, G.A., Hanzlik, R.P. and Munro,

A.W. (1999) Roles of key active-site residues in flavocytochrome P450 BM3. Biochem J, 339 (Pt 2), 371-

379.

38. Haines, D.C., Tomchick, D.R., Machius, M. and Peterson, J.A. (2001) Pivotal role of water in the

mechanism of P450BM-3. Biochemistry, 40, 13456-13465.

39. Wang, M., Roberts, D.L., Paschke, R., Shea, T.M., Masters, B.S. and Kim, J.J. (1997) Three-dimensional

structure of NADPH-cytochrome P450 reductase: prototype for FMN- and FAD-containing enzymes.

Proc Natl Acad Sci U S A, 94, 8411-8416.

40. Roitel, O., Scrutton, N.S. and Munro, A.W. (2003) Electron transfer in flavocytochrome P450 BM3:

kinetics of flavin reduction and oxidation, the role of cysteine 999, and relationships with mammalian

cytochrome P450 reductase. Biochemistry, 42, 10809-10821.

41. Neeli, R., Girvan, H.M., Lawrence, A., Warren, M.J., Leys, D., Scrutton, N.S. and Munro, A.W. (2005)

The dimeric form of flavocytochrome P450 BM3 is catalytically functional as a fatty acid hydroxylase.

FEBS Lett, 579, 5582-5588.

42. Oliver, C.F., Modi, S., Sutcliffe, M.J., Primrose, W.U., Lian, L.Y. and Roberts, G.C. (1997) A single

mutation in cytochrome P450 BM3 changes substrate orientation in a catalytic intermediate and the

regiospecificity of hydroxylation. Biochemistry, 36, 1567-1572.

43. Graham-Lorence, S., Truan, G., Peterson, J.A., Falck, J.R., Wei, S., Helvig, C. and Capdevila, J.H. (1997)

An active site substitution, F87V, converts cytochrome P450 BM-3 into a regio- and stereoselective

(14S,15R)-arachidonic acid epoxygenase. J Biol Chem, 272, 1127-1135.

Page | 135

44. Carmichael, A.B. and Wong, L.L. (2001) Protein engineering of Bacillus megaterium CYP102.The

oxidation of polycyclic aromatic hydrocarbons. Eur J Biochem, 268, 3117-3125.

45. Oliver, C.F., Modi, S., Primrose, W.U., Lian, L.Y. and Roberts, G.C. (1997) Engineering the substrate

specificity of Bacillus megaterium cytochrome P-450 BM3: hydroxylation of alkyl trimethylammonium

compounds. Biochem J, 327 (Pt 2), 537-544.

46. Ost, T.W., Miles, C.S., Murdoch, J., Cheung, Y., Reid, G.A., Chapman, S.K. and Munro, A.W. (2000)

Rational re-design of the substrate binding site of flavocytochrome P450 BM3. FEBS Lett, 486, 173-

177.

47. Edgardo, T.F., Ulrich, S., Anton, G. and Frances, H.A. (2001) Directed Evolution of a Cytochrome P450

Monooxygenase for Alkane Oxidation. Advanced Synthesis & Catalysis, 343, 601-606.

48. Yun, C.H., Kim, K.H., Kim, D.H., Jung, H.C. and Pan, J.G. (2007) The bacterial P450 BM3: a prototype for

a biocatalyst with human P450 activities. Trends Biotechnol, 25, 289-298.

49. Lorenz, P. and Eck, J. (2005) Metagenomics and industrial applications. Nat Rev Microbiol, 3, 510-516.

50. Jaeger, K.E. and Eggert, T. (2004) Enantioselective biocatalysis optimized by directed evolution. Curr

Opin Biotechnol, 15, 305-313.

51. Furukawa, K. (2003) 'Super bugs' for bioremediation. Trends in Biotechnology, 21, 187-190.

52. Locher, C.P., Soong, N.W., Whalen, R.G. and Punnonen, J. (2004) Development of novel vaccines using

DNA shuffling and screening strategies. Current Opinion in Molecular Therapeutics, 6, 34-39.

53. T. Maniatis, E.F.F., J. Sambrook. (1982) Molecular cloning: a laboratory manual. Cold Spring Harbor

Laboratory, Cold Spring Harbor, N.Y.

54. Aslanidis, C. and de Jong, P.J. (1990) Ligation-independent cloning of PCR products (LIC-PCR). Nucleic

Acids Res, 18, 6069-6074.

55. Zhou, M.Y., Clark, S.E. and Gomez-Sanchez, C.E. (1995) Universal cloning method by TA strategy.

Biotechniques, 19, 34-35.

56. Liu, Z. (1996) Hetero-stagger cloning: efficient and rapid cloning of PCR products. Nucleic Acids Res, 24,

2458-2459.

57. de Jong, R.N., Daniels, M.A., Kaptein, R. and Folkers, G.E. (2006) Enzyme free cloning for high

throughput gene cloning and expression. J Struct Funct Genomics, 7, 109-118.

58. Shuldiner, A.R., Scott, L.A. and Roth, J. (1990) PCR-induced (ligase-free) subcloning: a rapid reliable

method to subclone polymerase chain reaction (PCR) products. Nucleic Acids Res, 18, 1920.

59. Shuldiner, A.R., Tanner, K., Scott, L.A., Moore, C.A. and Roth, J. (1991) Ligase-free subcloning: a

versatile method to subclone polymerase chain reaction (PCR) products in a single day. Anal Biochem,

194, 9-15.

60. van den Ent, F. and Lowe, J. (2006) RF cloning: a restriction-free method for inserting target genes into

plasmids. J Biochem Biophys Methods, 67, 67-74.

61. Shuman, S. (1994) Novel approach to molecular cloning and polynucleotide synthesis using vaccinia

DNA topoisomerase. J Biol Chem, 269, 32678-32684.

62. Aslanidis, C., de Jong, P.J. and Schmitz, G. (1994) Minimal length requirement of the single-stranded

tails for ligation-independent cloning (LIC) of PCR products. PCR Methods Appl, 4, 172-177.

63. Kaluz, S., Kolble, K. and Reid, K.B. (1992) Directional cloning of PCR products using exonuclease III.

Nucleic Acids Res, 20, 4369-4370.

64. Zhou, M. and Hatahet, Z. (1995) An improved ligase-free method for directional subcloning of PCR

amplified DNA. Nucleic Acids Res, 23, 1089-1090.

65. Nisson, P.E., Rashtchian, A. and Watkins, P.C. (1991) Rapid and efficient cloning of Alu-PCR products

using uracil DNA glycosylase. PCR Methods Appl, 1, 120-123.

66. Rashtchian, A., Buchman, G.W., Schuster, D.M. and Berninger, M.S. (1992) Uracil DNA glycosylase-

mediated cloning of polymerase chain reaction-amplified DNA: application to genomic and cDNA

cloning. Anal Biochem, 206, 91-97.

67. Landy, A. (1989) Dynamic, structural, and regulatory aspects of lambda site-specific recombination.

Annu Rev Biochem, 58, 913-949.

68. Berrow, N.S., Alderton, D., Sainsbury, S., Nettleship, J., Assenberg, R., Rahman, N., Stuart, D.I. and

Owens, R.J. (2007) A versatile ligation-independent cloning method suitable for high-throughput

expression screening applications. Nucleic Acids Res, 35, e45.

69. Nour-Eldin, H.H., Hansen, B.G., Norholm, M.H., Jensen, J.K. and Halkier, B.A. (2006) Advancing uracil-

excision based cloning towards an ideal technique for cloning PCR fragments. Nucleic Acids Res, 34,

e122.

70. Inoue, H., Nojima, H. and Okayama, H. (1990) High efficiency transformation of Escherichia coli with

plasmids. Gene, 96, 23-28.

Page | 136

71. Nakamaye, K.L., Gish, G., Eckstein, F. and Vosberg, H.P. (1988) Direct sequencing of polymerase chain

reaction amplified DNA fragments through the incorporation of deoxynucleoside alpha-

thiotriphosphates. Nucleic Acids Res, 16, 9947-9959.

72. Brody, J.R. and Kern, S.E. (2004) Sodium boric acid: a Tris-free, cooler conductive medium for DNA

electrophoresis. Biotechniques, 36, 214-216.

73. Brody, J.R., Calhoun, E.S., Gallmeier, E., Creavalle, T.D. and Kern, S.E. (2004) Ultra-fast high-resolution

agarose electrophoresis of DNA and RNA using low-molarity conductive media. Biotechniques, 37, 598,

600, 602.

74. Zhou, A., Jiang, X. and Xu, X. (1997) Improved alkaline lysis method for rapid isolation of plasmid DNA.

Biotechniques, 23, 592-594.

75. Miyazaki, K. and Takenouchi, M. (2002) Creating random mutagenesis libraries using megaprimer PCR

of whole plasmid. Biotechniques, 33, 1033-1034, 1036-1038.

76. Shultzaberger, R.K., Bucheimer, R.E., Rudd, K.E. and Schneider, T.D. (2001) Anatomy of Escherichia coli

ribosome binding sites. J Mol Biol, 313, 215-228.

77. Tindall, K.R. and Kunkel, T.A. (1988) Fidelity of DNA synthesis by the Thermus aquaticus DNA

polymerase. Biochemistry, 27, 6008-6013.

78. Taly, V., Kelly, B.T. and Griffiths, A.D. (2007) Droplets as microreactors for high-throughput biology.

Chembiochem, 8, 263-272.

79. Gonzalez, F.J. and Korzekwa, K.R. (1995) Cytochromes P450 expression systems. Annu Rev Pharmacol

Toxicol, 35, 369-390.

80. Dietrich, M., Eiben, S., Asta, C., Do, T.A., Pleiss, J. and Urlacher, V.B. (2008) Cloning, expression and

characterisation of CYP102A7, a self-sufficient P450 monooxygenase from Bacillus licheniformis. Appl

Microbiol Biotechnol, 79, 931-940.

81. Liu, L., Schmid, R.D. and Urlacher, V.B. (2006) Cloning, expression, and characterization of a self-

sufficient cytochrome P450 monooxygenase from Rhodococcus ruber DSM 44319. Appl Microbiol

Biotechnol, 72, 876-882.

82. Schwaneberg, U., Sprauer, A., Schmidt-Dannert, C. and Schmid, R.D. (1999) P450 monooxygenase in

biotechnology. I. Single-step, large-scale purification method for cytochrome P450 BM-3 by anion-

exchange chromatography. J Chromatogr A, 848, 149-159.

83. Jun, H., Lehe, M., Qing, S., Dongqiang, L. and Shanjing, Y. (2005) Purification of cytochrome P450 BM-3

as a monooxygenase. Protein Pept Lett, 12, 327-331.

84. Studier, F.W. (2005) Protein production by auto-induction in high density shaking cultures. Protein

Expr Purif, 41, 207-234.

85. Laemmli, U.K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage

T4. Nature, 227, 680-685.

86. Omura, T. and Sato, R. (1964) The Carbon Monoxide-Binding Pigment Of Liver Microsomes. I. Evidence

For Its Hemoprotein Nature. J Biol Chem, 239, 2370-2378.

87. Wong, T.S., Tee, K.L., Hauer, B. and Schwaneberg, U. (2004) Sequence saturation mutagenesis

(SeSaM): a novel method for directed evolution. Nucleic Acids Res, 32, e26.

88. Tee, K.L. and Schwaneberg, U. (2007) Directed evolution of oxygenases: screening systems, success

stories and challenges. Comb Chem High Throughput Screen, 10, 197-217.

89. Bernhardt, R. (2006) Cytochromes P450 as versatile biocatalysts. J Biotechnol, 124, 128-145.

90. Guengerich, F.P. (2002) Cytochrome P450 enzymes in the generation of commercial products. Nat Rev

Drug Discov, 1, 359-366.

91. Kennedy, S.W. and Jones, S.P. (1994) Simultaneous measurement of cytochrome P4501A catalytic

activity and total protein concentration with a fluorescence plate reader. Anal Biochem, 222, 217-223.

92. Donato, M.T., Gomez-Lechon, M.J. and Castell, J.V. (1993) A microassay for measuring cytochrome

P450IA1 and P450IIB1 activities in intact human and rat hepatocytes cultured on 96-well plates. Anal

Biochem, 213, 29-33.

93. Wong, T.S., Wu, N., Roccatano, D., Zacharias, M. and Schwaneberg, U. (2005) Sensitive assay for

laboratory evolution of hydroxylases toward aromatic and heterocyclic compounds. J Biomol Screen,

10, 246-252.

94. Tsotsou, G.E., Cass, A.E. and Gilardi, G. (2002) High throughput assay for cytochrome P450 BM3 for

screening libraries of substrates and combinatorial mutants. Biosens Bioelectron, 17, 119-131.

95. Hai, M. and Magdassi, S. (2004) Investigation on the release of fluorescent markers from w/o/w

emulsions by fluorescence-activated cell sorter. J Control Release, 96, 393-402.

Page | 137

96. Frenette, M., Ivan, M.G. and Scaiano, J.C. (2005) Use of fluorescent probes to determine catalytic

chain length in chemically amplified resists. Canadian Journal of Chemistry-Revue Canadienne De

Chimie, 83, 869-874.

97. Chilvers, K.F., Perry, J.D., James, A.L. and Reed, R.H. (2001) Synthesis and evaluation of novel

fluorogenic substrates for the detection of bacterial beta-galactosidase. J Appl Microbiol, 91, 1118-

1130.

98. Steigenberger S, F.T., H-P Grossart & R Reuter. (2004) Blue-fluorescence of NADPH as an indicator of

marine primary production. EARSeL eProceedings, 3, 18-25.

99. Urlacher, V.B. and Eiben, S. (2006) Cytochrome P450 monooxygenases: perspectives for synthetic

application. Trends Biotechnol, 24, 324-330.

100. Vaara, M. (1992) Agents that increase the permeability of the outer membrane. Microbiol Rev, 56,

395-411.

101. Danielson, P.B. (2002) The cytochrome P450 superfamily: biochemistry, evolution and drug

metabolism in humans. Curr Drug Metab, 3, 561-597.

102. Glieder, A., Farinas, E.T. and Arnold, F.H. (2002) Laboratory evolution of a soluble, self-sufficient,

highly active alkane hydroxylase. Nat Biotechnol, 20, 1135-1139.

103. Li, Q.S., Ogawa, J., Schmid, R.D. and Shimizu, S. (2001) Engineering cytochrome P450 BM-3 for

oxidation of polycyclic aromatic hydrocarbons. Appl Environ Microbiol, 67, 5735-5739.

104. Appel, D., Lutz-Wahl, S., Fischer, P., Schwaneberg, U. and Schmid, R.D. (2001) A P450 BM-3 mutant

hydroxylates alkanes, cycloalkanes, arenes and heteroarenes. J Biotechnol, 88, 167-171.

105. Li, Y., Drummond, D.A., Sawayama, A.M., Snow, C.D., Bloom, J.D. and Arnold, F.H. (2007) A diverse

family of thermostable cytochrome P450s created by recombination of stabilizing fragments. Nat

Biotechnol, 25, 1051-1056.

106. Ryan, J.D., Fish, R.H. and Clark, D.S. (2008) Engineering cytochrome P450 enzymes for improved

activity towards biomimetic 1,4-NADH cofactors. Chembiochem, 9, 2579-2582.

107. Nazor, J., Dannenmann, S., Adjei, R.O., Fordjour, Y.B., Ghampson, I.T., Blanusa, M., Roccatano, D. and

Schwaneberg, U. (2008) Laboratory evolution of P450 BM3 for mediated electron transfer yielding an

activity-improved and reductase-independent variant. Protein Eng Des Sel, 21, 29-35.

108. Peters, M.W., Meinhold, P., Glieder, A. and Arnold, F.H. (2003) Regio- and enantioselective alkane

hydroxylation with engineered cytochromes P450 BM-3. J Am Chem Soc, 125, 13442-13450.

109. van Vugt-Lussenburg, B.M., Stjernschantz, E., Lastdrager, J., Oostenbrink, C., Vermeulen, N.P. and

Commandeur, J.N. (2007) Identification of critical residues in novel drug metabolizing mutants of

cytochrome P450 BM3 using random mutagenesis. J Med Chem, 50, 455-461.

110. Ghadessy, F.J., Ong, J.L. and Holliger, P. (2001) Directed evolution of polymerase function by

compartmentalized self-replication. Proc Natl Acad Sci U S A, 98, 4552-4557.

111. Griffiths, A.D. and Tawfik, D.S. (2003) Directed evolution of an extremely fast phosphotriesterase by in

vitro compartmentalization. Embo J, 22, 24-35.

112. Cohen, H.M., Tawfik, D.S. and Griffiths, A.D. (2004) Altering the sequence specificity of HaeIII

methyltransferase by directed evolution using in vitro compartmentalization. Protein Eng Des Sel, 17,

3-11.

113. Cadwell, R.C. and Joyce, G.F. (1992) Randomization of genes by PCR mutagenesis. PCR Methods Appl,

2, 28-33.

114. Hanahan, D., Jessee, J. and Bloom, F.R. (1991) Plasmid transformation of Escherichia coli and other

bacteria. Methods Enzymol, 204, 63-113.

115. Schwaneberg, U., Otey, C., Cirino, P.C., Farinas, E. and Arnold, F.H. (2001) Cost-effective whole-cell

assay for laboratory evolution of hydroxylases in Escherichia coli. J Biomol Screen, 6, 111-117.

116. Urlacher, V.B., Makhsumkhanov, A. and Schmid, R.D. (2006) Biotransformation of beta-ionone by

engineered cytochrome P450 BM-3. Appl Microbiol Biotechnol, 70, 53-59.

117. Li, H.M., Mei, L.H., Urlacher, V.B. and Schmid, R.D. (2008) Cytochrome P450 BM-3 evolved by random

and saturation mutagenesis as an effective indole-hydroxylating catalyst. Appl Biochem Biotechnol,

144, 27-36.

118. Wong, T.S., Zhurina, D. and Schwaneberg, U. (2006) The diversity challenge in directed protein

evolution. Comb Chem High Throughput Screen, 9, 271-288.

119. Kim, B.S., Kim, S.Y., Park, J., Park, W., Hwang, K.Y., Yoon, Y.J., Oh, W.K., Kim, B.Y. and Ahn, J.S. (2007)

Sequence-based screening for self-sufficient P450 monooxygenase from a metagenome library. J Appl

Microbiol, 102, 1392-1400.

Page | 138

Supplementary data – Page | 1

Supplementary data

1. Introduction

2. Phosphorothioate based Ligase-Independent cloning (PIGe) and application

for cloning of Cyt P450 BM3

Figure 1 Vector map of pET-28a(+) (Stratagene)

Figure 2 Vector map of pET-28a(+)-sacB (courtesy of Kang Lan)

pET-28a(+)

5369 bp

lac I

kan sequence

lac operator

T7 promoter

His tag

T7 tag

His tag

thrombin

ColE1 pBR322 origin

f1 origin

T7 terminator

BamHI (199)

EcoRI (193)

Nco I (297)

Sal I (180)

pET28IODnew2_FP (100.0%)

pET28IODnew2_RP (100.0%)

RBS (88.9%)

RBS (88.9%)

RBS (88.9%)

pET28 sacB

7159 bp

BamHI (2083)

Nco I (2087)

Sma I (6091)

XmaI (6089)

AvaI (159)

AvaI (6089)

EcoRI (831)

EcoRI (2077)

HindIII (174)

HindIII (1967)

ApaLI (2894)

ApaLI (4829)

ApaLI (5329)

ClaI (990)

ClaI (1327)ClaI (5908)

pET28IODnew1_FP_comp (85.7%)

pET28IODnew1_RP_comp (100.0%)


Figure 3 Vector map of pALXtreme-1a (courtesy of Dr. Alex Schenk)

Figure 4 Vector map of pALXtreme-1a-sacB (courtesy of Dr. Alex Schenk)

pALXtreme-1a

2055 bp

lac operator

kan sequence

T7 promoter

thrombin

His tag

T7 tag

His tag

rbs

ColE1 pBR322 origin

T7 terminator

ApaLI (1734) BamHI (190)

ClaI (1157)

EcoRI (196)

HindIII (215)

Nco I (92)

Sma I (976)

XmaI (974)

AvaI (230)

AvaI (974)

pALXtreme-1a-sacB

3747 bp

kan sequence

lac operator

sacB

shine dalgarno

T7 promoter

His tag

T7 tag

His tag

thrombin

rbs

rbs

ColE1 pBR322 origin

T7 terminator

-10

-35

signal peptide

EcoRI (7)

HindIII (26)

Nco I (1958)

Nde I (2018)

Sal I (20)

Stu I (3241)

XbaI (1919)

XhoI (41)

BamHI (1)

BamHI (2056)

pET28IODnew2_FP (100.0%)

pET28IODnew2_RP (100.0%)


Figure 5 Vector map of pEGFP (BD Biosciences Clonetech)

Figure 6 Vector map of pET-42b-M57 (courtesy of Ran Tu)

pEGFP

3355 bp

Amp

EGFP

AvaI (270)

BamHI (265)

EcoRI (1026)

HindIII (235)

Nco I (288)

PstI (251)

Sma I (272)

XmaI (270)

ApaLI (1294)

ApaLI (1671)

ApaLI (2917)

pET42b M57

6337 bp

HindIII (190)

Sma I (5269)

XmaI (5267)

AvaI (175)

AvaI (5267)

ApaLI (2309)ApaLI (4007)

ApaLI (4507)

ClaI (494)

ClaI (912)

ClaI (1606)

ClaI (5086)


Figure 7 Vector map of pCWORI-P450 BM3 (strain collection – Schwaneberg

Figure 8 Vector map of pUC19 (Stratagene)

pCWoriBM3 Wt

8119 bp

AvaI (3672)

BamHI (8095)

EcoRI (3170)

HindIII (84)

HindIII (319)

HindIII (2076)

PstI (570)

PstI (3102)

PstI (4467)

ClaI (1758)

ClaI (3177)

ClaI (7896)

ClaI (7904)

ClaI (8102)

ApaLI (540)

ApaLI (2034)

ApaLI (4037)

ApaLI (5283)

ApaLI (5783)

ApaLI (7321)

P450IODnew_FP (77.8%)

P450IODnew_RP (73.2%)

pUC19

2686 bp

AP r

ALPHAP(BLA)

P(LAC)

ORI

AvaI (413)

BamHI (418)

EcoRI (397)

HindIII (448)

PstI (440)

Sma I (415)

XmaI (413)

ApaLI (178)

ApaLI (1121)

ApaLI (2367)


Table 1 List of all oligonucleotide used in development of PIGe cloning method. Start and stop codons are marked in red, restriction sites are

underlined and phosphorothioated nucleotides are marked with an asterisk.

Name Sequence (5’��3’)

BM3_NcoI_FP ATCCATGGGAATGACAATTAAAGAAATGCCTCAGCCAAAAACG

BM3_BamHI_FP ATGGATCCATGACAATTAAAGAAATGCCTCAGCCAAAAACG

BM3_EcoRI_RP TCGAATTCTTACCCAGCCCACACGTCTTTTGCGTATC

BM3_megawhop_FP ATGACAATTAAAGAAATGCCTCAGCCAAAAACG

BM3_megawhop_RP TTACCCAGCCCACACGTCTTTTGCGTATC

BM3_heme_megawhop_RP TTTTGCTTTTACCACAAAGCCTTCAGGTTTTAACG

polyT_IOD TTTTTT*T*T*T*TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT

polyT_Control TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT

pET28_IOD_FP G*C*T*G*C*C*C*A*T*G*G*T*ATATCTCCTTCTTAAAGTTAAAC

pET28_IOD_RP G*C*T*A*A*C*A*A*A*G*C*C*CGAAAGGAAGCTGAGTTGGCTGC

GFP_IOD_FP A*C*C*A*T*G*G*G*C*A*G*C*ATGGTGAGCAAGGGCGAGGAGCTGTTC

GFP_IOD_RP G*G*C*T*T*T*G*T*T*A*G*C*GGTTTACTTGTACAGCTCGTCCATGCC

M57IOD_FP A*C*C*A*T*G*G*G*C*A*G*C*ATGTTTGAACAAGCGAGTTTTTCAACTCC

M57IOD_RP G*G*C*T*T*T*G*T*T*A*G*C*TCATTGGGGCGCTTGTGCTAAGC

P450IOD_FP A*C*C*A*T*G*G*G*C*A*G*C*ATGACAATTAAAGAAATGCCTCAGCCAAAAACG

P450IOD_RP G*G*C*T*T*T*G*T*T*A*G*C* TTACCCAGCCCACACGTCTTTTGCGTATC

T7_promoter TAATACGACTCACTATAGGG


3. Expression and purification of Cyt P450 BM3

I. Small scale expression (4 ml) of Cyt P450 BM3 from BL21-

Gold(DE3)/pET28 system in auto- (MD-5052, LSG-5052, P-5052 and

TYM-5052) and non-auto induction media (TB)

Figure 9 Activity (up) and cell growth (down) profile of Cyt P450 BM3 in different auto- and non-auto media.


II. Small scale expression (4 ml) of Cyt P450 BM3 from BL21-


/pALXtreme system in auto-

induction media (MD-5052)

Figure 10 Expression (up) and cell growth (down) profile of Cyt P450 BM3 from BL21-Gold(DE3)/pET28 system on 37°C (left) and 30°C (right).

Figure 11 Expression (up) and cell growth (down) profile of Cyt P450 BM3 from BL21-Gold(DE3) lacIQ1

/pALXtreme system on 37°C (left) and 30°C

(right).


III. Small scale expression (3 ml) of Cyt P450 BM3 from BL21-


/pALXtreme system in non

auto-induction media (TB)

Figure 12 Expression (up) and cell growth (down) profile of Cyt P450 BM3 from BL21-Gold(DE3)/pET28 system on 37°C (left) and 30°C (right).

Figure 13 Expression (up) and cell growth (down) profile of Cyt P450 BM3 from BL21-Gold(DE3) lacIQ1

/pALXtreme system on 37°C (left) and 30°C

(right).


IV. Expression (4 ml) of Cyt P450 BM3 from BL21-Gold(DE3)

lacIQ1

/pALXtreme system under inducing and non inducing conditions

(LB)

Figure 14 Expression (up), cell growth (middle) and expression/cell growth (down) profile of Cyt P450 BM3 from BL21-Gold(DE3)

lacIQ1

/pALXtreme system on 30°C.


V. Large scale expression (250 ml) of Cyt P450 BM3 from BL21-

Gold(DE3)/pET28 system in auto- (MD-5052, TYM-5052 and LSG-5052)

and non-auto induction media (LB and TB)

Figure 15 Cell growth (up) and activity (down) profile of Cyt P450 BM3 in different auto- and non-auto media on 37°C (left) and 30°C (right).


4. Coumarine based substrates for high

BM3 activity in microtiter plates (MTPs) and by flow cytometry in double

emulsions

Figure 16 TLC of synthesis of Cu4 fatty acid substrates

Coumarine based substrates for high throughput screening of Cyt P450


TLC of synthesis of Cu4 fatty acid substrates – esterification (A) and substitution (B) detected with p

nm (2) and UV 366 nm (3).

Figure 17 TLC of purification of Cu4-fatty acid.

screening of Cyt P450


A) and substitution (B) detected with phosphomolybdic acid (1), UV 254

Figure 18 1H (up) and

H (up) and 13

C (down) NMR spectra of 12-(4-MU)-dodecanoic acid methyl ester.


dodecanoic acid methyl ester.


Figure 19 TLC of synthesis steps of benzyl Cu4: start of esterification (left), end of esterification (middle) and substitution (right)

Figure 20 TLC of purification of benzyl

TLC of synthesis steps of benzyl Cu4: start of esterification (left), end of esterification (middle) and substitution (right)

(A) and UV 366 nm (B).

TLC of purification of benzyl-Cu4 (detection on UV 366 nm).

TLC of synthesis steps of benzyl Cu4: start of esterification (left), end of esterification (middle) and substitution (right) on UV 254 nm

Cu4 (detection on UV 366 nm).

Figure 21

21 1H (up) and

13C (down) NMR spectra of 7-benzoxy-4-MU



Figure 22 TLC of purification of DBCC and BCC (detection UV 366 nm).

TLC of purification of DBCC and BCC (detection UV 366 nm).

TLC of purification of DBCC and BCC (detection UV 366 nm).

Figure


13C (down) NMR spectra of BCC.



Figure


13C (down) NMR spectra of DBCC.

Figure 25



Figure 26

Figure 27


O O

O

O

-O O O

O

O

HO

+ H

- H

O O

OH

O

-O O O

ONa

O

HO+ H

- H

+ H

- H

O O

OH

O

HO

Figure 28

5. Development of ultra high throughput screening system based on flow

cytometry and double emulsions for directed evolution of Cyt P450 BM3

6. Screening the metagenome libraries using flow cytometry and double

emulsions: the source of novel P450 activity

Flow Cytometry Based Sc and Improving Bioindustr

Documents

Transcript of Flow Cytometry Based Sc and Improving Bioindustr