Diversity of dictyostelid social amoebae in high latitudehabitats of Northern Sweden

Allison L. Perrigo & Sandra L. Baldauf & Maria Romeralo

Received: 17 July 2012 /Accepted: 10 September 2012 /Published online: 27 September 2012# Mushroom Research Foundation 2012

Abstract The dictyostelid social amoebae (Dictyostelia)occur in terrestrial habitats worldwide. It has been ob-served previously that their diversity decreases withincreasing latitude and altitude. Here we look at dic-tyostelid diversity in the high latitude habitats ofNorthern Sweden. Dictyostelids were recovered fromsoil samples using traditional plating methods and thenidentified using morphological characters and molecularsequence (small subunit ribosomal RNA) data. In total,nine species were recovered, including two new species,described herein as Dictyostelium barbibulus andPolysphondylium fuscans. The species diversity foundhere is discussed in relation to previous findings inthe area as well as other high-latitude studies, andbiogeographical patterns are examined. The total numberof species found in Northern Sweden is lower than thenumbers recorded for regions further south in Europe, afinding consistent with a latitudinal gradient of speciesdiversity. Our findings highlight the benefit of usingmolecular data for accurate species identification inDictyostelia and the need for a continued samplingeffort to better understand their diversity and distribu-tion, especially in high latitude habitats.

Keywords Cellular slime mold .Dictyostelium . Molecularidentification . New species . Protist biogeography . Sweden

Introduction

The dictyostelid cellular slime molds (Dictyostelia) are aubiquitous group of social amoebae found in terrestrialhabitats. They feed selectively on bacteria and will aggre-gate by the hundreds of thousands under starvation condi-tions to form a unique, spore-forming multicellular stage. Inaddition to this multicellular mode of asexual reproduction,dictyostelid amoebae can also reproduce asexually by fis-sion. Under certain environmental conditions some speciesare also known to form macrocysts, the sexual phase in thedictyostelid life cycle (Raper 1984).

Records of dictyostelid diversity began with the firstspecies description by Brefeld in 1869. Roughly 100 yearslater, in the 1960s, several researchers began studying dic-tyostelid distribution and abundance in the wild, resulting ina greatly improved understanding of the group’s diversityand ecology (outlined in Raper 1984; Swanson et al. 1999).Dictyostelid species diversity and distribution have beenattributed to a number of factors, such as associated plantspecies diversity, temperature, humidity, pH, altitude andlatitude (Raper 1984; Hagiwara 1989; Romeralo et al.2011b).

There are currently around 150 described species ofdictyostelid, and this number has been steadily increas-ing with increased sampling efforts (Bonner 2009).However, it appears likely that a significant componentof dictyostelid diversity still remains to be described(Romeralo et al. 2012). This is suggested by the largenumber of newly described species and the discovery ofa host of poorly delimited species (Norberg 1971;Romeralo et al. 2011a) as well as the surprising depthof the molecular phylogeny (Schaap et al. 2006) and theestimated antiquity of the group as a whole (Heidel etal. 2011; Sucgang et al. 2011).

A. L. Perrigo (*) : S. L. Baldauf :M. RomeraloProgram in Systematic Biology,Department of Organismal Biology, Evolutionary Biology Center,Uppsala University,Norbyvägen 18D,752 36 Uppsala, Swedene-mail: allison.perrigo@ebc.uu.se

Fungal Diversity (2013) 58:185–198DOI 10.1007/s13225-012-0208-3

In contrast to the dozens of species commonly found intropical habitats (Swanson et al. 1999), very few species ofdictyostelid have been recorded in terrestrial habitats above58°N. In total, fifteen identified species, as well as fourunidentified species, have previously been recorded fromlocalities above 58°N latitude. Of these species, only sevenhave been recorded from more than one region (Table 1).The majority of these high-latitude distribution studies havefocused on Alaska (Cavender 1978; Cavender et al. 1979;Landolt et al. 1992; Stephenson et al. 1991, 1997; Romeraloet al. 2010). However, there have been several additionalreports from Russia (Stephenson et al. 1997), Iceland(Cavender unpublished data), Norway (Frøyen andLangvad 1984b) and Sweden (Kawabe 1995).

The latitudinal gradient of species diversity is a well-recognized pattern in ecology, especially in macroorganismssuch as plants, animals and fungi, although the underlyingcauses are a matter of considerable debate (reviewed inWillig et al. 2003). It is also not well-known if or how thistrend extends to microorganisms. One meta-analysis com-piled over 600 published reports of latitudinal gradients ofspecies diversity in various organisms and found that thestrength of the gradient is positively correlated with organ-ism body size (Hillebrand 2004). Based on Hillebrand’sfindings, Fenchel and Finlay (2004) argued that organismsunder one micrometer in length, including amoebae, do not

exhibit biogeographic patterns. However, the same authorsnote that fewer cosmopolitan microorganisms are found insimilar water samples from tropical versus temperate envi-ronment, which seems to support the idea that microorga-nismal diversity is greater towards the tropics (Fenchel andFinlay 2004).

Despite the relatively small size of dictyostelids, usually10–20 μm in diameter in the predominant, single-celledamoeba phase, there is reason to believe that they exhibitbiogeographic patterns (Swanson et al. 1999). In fact, alatitudinal gradient of species diversity has been noted an-ecdotally in various surveys and reviews on dictyosteliddistribution (Cavender 1973; Raper 1984; Hagiwara 1990;Swanson et al. 1999). These observations suggest thatNorthern Sweden should have relatively low species diver-sity, similar to other high-latitude environments that havebeen assessed.

The first report of dictyostelids in Sweden was an unin-tentional find of Dictyostelium mucoroides growing in aculture of beetroot (Beta vulgaris) from Halland, SouthernSweden (Palm 1935). The second report, and the onlyprevious survey of dictyostelids in Sweden, assessed eightlocalities spanning the length of the country (Kawabe 1995).Four species were recovered, identified as D. mucoroides,D. purpureum, Polysphondylium violaceum and P. pallidum(Table 2). A more extensive survey was undertaken in

Table 1 Dictyostelid species recovered from localities north of 58°Nlatitude, listed by region. Species observations are denotes as either ‘wide-spread’ (occurring in more than one country/region north of 58°N) or‘restricted’ (known from only a single country/region north of 58°N).

Species denoted with an asterisk (*) are new records for Sweden fromthe present study. Isolates that were not identified to species level areexcluded from the table

Eastern Russia Alaska, USA Iceland Norway Sweden

Widespread species

Dictyostelium aureostipes D. aureostipes D. aureostipes D. aureostipes*

D. fasciculatum D. fasciculatum*

D. minutum D. minutum D. minutum D. minutum

D. mucoroides D. mucoroides D. mucoroides D. mucoroides D. mucoroides

D. sphaerocephalum D. sphaerocephalum D. sphaerocephalum

Polysphondylium pallidum P. pallidum P. pallidum P. pallidum*

P. violaceum P. violaceum P. violaceum

Restricted species

D. boreale Acytostelium leptosomuma D. purpureum

D. septentrionale D. implicatum*

D. ammophilum D. leptosomopsis

D. giganteum D. leptosomum*

D. lacteum D. barbibulus*

P. fuscans*

Data compiled from: Cavender 1978, Cavender personal communication, Frøyen and Langvad 1984b, Kawabe 1995, Landolt et al. 1992, Romeraloet al. 2010, Stephenson et al. 1991, and Stephenson et al. 1997.aA. leptosomum was recovered in Norway, but the authors indicate that the isolate was not recovered from a natural habitat (Frøyen and Langvad1984b).

186 Fungal Diversity (2013) 58:185–198

neighboring Norway, where ten species were recoveredfrom 28 localities (Frøyen and Langvad 1984b). In addition,a recent study assessing the dispersal potential of dictyos-telids by anthropogenic vectors recovered four species fromfootwear most recently worn in Sweden (Perrigo et al.2012). The species recovered in the latter assay were D.leptosomopsis, D. minutum, D. sphaerocephalum and P.fuscans (denoted then as ‘P. sp. 1”). There are currently nopublished records of dictyostelids in Denmark or Finland.

Sweden is divided latitudinally by the biological northernboarder or Limes Norrlandicus (Arnborg 1990). This lineruns roughly along the 60° parallel. It follows a naturaldivide of the country into two climatic zones and denotesthe shift in habitat type from mixed temperate broadleafforest in the south to boreal forest, or taiga, in the north.Changes between the two climatic zones are considered bythe Köppen climate classification system to reflect a collec-tive shift in several factors including vegetation, precipita-tion and temperature (Kottek et al. 2006). The current studyuses the Limes Norrlandicus as a southern boundary forsampling.

We aim to develop a more comprehensive picture ofdictyostelid diversity in high-latitude northern hemi-sphere localities, beginning here by assessing the diver-sity of dictyostelids in northern Sweden. Species wereidentified using both morphological characteristics andmolecular markers. This strategy alleviates the commonproblem of ambiguous species identification due topoorly defined species complexes, which are commonthroughout the Dictyostelia. Descriptions include twonew species, which are formally described here. The

species diversity found is discussed in relation to previ-ous findings and biogeographical patterns.

Methods

Collection, culture & morphological identification

Soil samples were collected in the northern part of Sweden(from Uppsala to Gällivare kommun) during July 2008. Atotal of twenty-nine samples were collected, with at leasttwo samples collected from the substrate associated witheach vegetation type at each locality. The flora associatedwith the sampled substrates included Acer, Betula, Corylus,Equisetum, Picea, Pinus, Sorbus and Vaccinium (Table 3).All samples were geo-referenced by GPS. The samplearea ranges from 59°29′N (at the Limes Norrlandicus)to 67°44′N and 20°43′E to 13°35′E, and sampling alti-tudes range from 20 to 470 m above sea level(Table 3). The sampling range extends north of theArctic Circle, which lies at 66°33′N.

At each collection locality, two to three twenty-gramsamples of the top three centimeters of O-layer soil werecollected and stored in Whirl Pak® plastic bags. Sampleswere stored at 4 °C until processing. The sample process-ing procedure for isolation and culture of individual cloneswas adapted from Cavender and Raper (1965) as outlinedbelow.

Soil samples were diluted 9:1 by adding 90 mL of ddH2Oto ten grams wet weight of soil. Diluted samples wereagitated to suspend amoebae and spores, and the pH was

Table 2 Records of dictyostelids in Sweden prior to 2012 including species name, collection locality (town, county), associated vegetation and thereference

Species Locality Associated Vegetation Reference

Dictostelium mucoroides Bref. Unknown, Halland Beta vulgaris Palm 1935

Kiruna, Norrland Betula Kawabe 1995

Jukkasjärvi, Norrland Picea Kawabe 1995

Mora, Dalarna Pinus Kawabe 1995

Sollerön, Dalarna Betula Kawabe 1995

Uppsala, Upland Pinus Kawabe 1995

Stockholm Pinus Kawabe 1995

Malmö, Skåne Fagus, Quercus Kawabe 1995

Torup, Skåne Fagus, Quercus Kawabe 1995

D. purpureum Olive Mora, Dalarna Pinus Kawabe 1995

Sollerön, Dalarna Betula Kawabe 1995

Uppsala, Upland Pinus Kawabe 1995

Polysphondylium pallidum Olive Uppsala, Upland Pinus Kawabe 1995

P. violaceum Bref. Mora, Dalarna Pinus Kawabe 1995

Uppsala, Upland Pinus Kawabe 1995

Torup, Skåne Fagus, Quercus Kawabe 1995

Fungal Diversity (2013) 58:185–198 187

Tab

le3

Alldictyo

stelid

isolates

recoveredin

NorthernSweden

during

thisstud

ywith

thesampleincubatio

ntemperature,collectionmun

icipality,GPScollectionlocalityinform

ation,

altitud

e,associated

vegetatio

ntypesandsamplepH

.Allspeciesidentifications

wereconfirmed

bymorph

olog

yandmolecular

metho

ds

Species

T°

Mun

icipality,Region

Coo

rdinates

Alt.

(m)

AssociatedVegetation

Sam

plepH

Dictyosteliu

mau

reostip

esvar.helveticum

17Sala,Västm

anland

60°01′17

″N16

°22′37

″E13

4Picea

abies

5.1

23Gagnef,Dalarna

60°24′23

″N15

°04′03

″E43

8Pinus

sylvestris

5.5

17Ström

sund

,Jämtland

63°59′47

″N15

°54′11″E

295

Picea

abies

4.7

D.ba

rbibulus

17Karlstad,

Värmland

59°34′49

″N13

°45′26

″E10

2Pinus

sylvestris,Picea

abies,Betulasp.,Equ

isetum

sp.

5.7

D.fasciculatum

17Upp

sala,Upp

land

59°53′06

″N17

°21′15

″E39

Corylus

avellana

,Picea

abies,Pinus

sylvestris,Betulasp.

4.6

D.implicatum

17Gagnef,Dalarna

60°24′23

″N15

°04′03

″E43

8Pinus

sylvestris

5.5

D.leptosom

um17

Gagnef,Dalarna

60°24′23

″N15

°04′03

″E43

8Pinus

sylvestris

5.5

23Kirun

a,Lappland

67°44′08

″N20

°43′41

″E43

2Betulasp.,Picea

abies,Va

ccinium

myrtillus

5.1

17Örnsköldsvik,

Ång

ermanland

63°07′43

″N18

°31′28

″E30

Picea

abies,So

rbus

sp.

5.4

17Kramfors,Ång

ermanland

62°57′09

″N18

°20′53

″E23

Acerpseudo

platan

us,Pinus

sylvestris,Picea

abies,Corylus

sp.

6.0

D.minutum

23Gagnef,Dalarna

60°24′23

″N15

°04′03

″E43

8Pinus

sylvestris

5.5

D.mucoroides

17Karlstad,

Värmland

59°34′49

″N13

°45′26

″E10

2Pinus

sylvestris,Picea

abies,Betulasp.,Equ

isetum

sp.

5.7

23Sala,Västm

anland

60°01′15

″N16

°22′46

″E10

7Betulasp.,Picea

abies

3.9

23Gagnef,Dalarna

60°24′34

″N15

°04′14

″E46

7Betulasp.,Equ

isitu

msp.,Picea

abies

5.0

23Kirun

a,Lappland

67°44′08

″N20

°43′41

″E43

2Betulasp.,Picea

abies,Va

ccinium

myrtillus

4.3

17Örnsköldsvik,

Ång

ermanland

63°07 ′43

″N18

°31′28

″E30

Picea

abies,So

rbus

sp.

5.4

Polysph

ondyliu

mfuscan

s17

Karlstad,

Värmland

59°29′22

″N13

°36′00

″E80

Picea

abies,Betulasp.

4.7

23Gagnef,Dalarna

60°24′23

″N15

°04′03

″E42

8Pinus

sylvestris

5.5

P.tenu

issimum

23Sala,Västm

anland

60°01′15

″N16

°22′46

″E10

7Betulasp.,Picea

abies

3.9

17Sala,Västm

anland

60°01′17

″N16

°22′37

″E13

4Picea

abies

5.1

188 Fungal Diversity (2013) 58:185–198

measured. Five mL of the suspension were then diluted withan additional 7.5 mL of ddH2O, for a final plating dilutionof 1:50. A 0.50 mL aliquot of this dilution was added toeach of three Petri dishes containing hay infused agar (adap-ted from Raper 1984: 1000 ml ddH2O infused with 8.0 gdried Poa sp., then strained, 1.75 g KH2PO4, 0.68 gNa2HPO4, 17.5 g bactoagar), along with 0.25 mL of a heavysuspension of the bacterium Klebsiella aerogenes as a foodsource.

The plates were divided into two groups and incubatedat either 17°C or 23°C under diffuse light. Plates werechecked starting three days after inoculation and examinedat least once daily for two weeks. As dictyostelid colo-nies appeared they were subcultured to facilitate identi-fication. The resulting isolates were cultured on 1.5 %non-nutrient agar (adapted from Raper 1984: 1000 mlddH2O, 1.20 g KH2PO4, 0.48 g Na2HPO4, 15 g bactoa-gar) in similar light and temperature conditions to thoseof the plates from which they were recovered. Isolateswith characteristics consistent with yellow-pigmentedspecies, specifically Dictyostelium aureostipes, weregrown in darkness for 48 hours before reexaminationbecause this diagnostic coloration is stronger in dark-grown isolates. Morphological characteristics were ex-amined using a Leica M125 dissecting microscope anda Leitz ENT859 compound microscope. Species identi-fication followed the taxonomic protocol outlined inRaper (1984).

Spores of all unique isolates were suspended in HL5media (Coccuci and Sussman 1970) and frozen at −80 °Cat Uppsala University, Department of Organismal Biologyfor future reference. Type specimens have also been depos-ited at the Dicty Stock Center at Northwestern University(Chicago, IL, USA).

DNA isolation, amplification and sequencing

For DNA extraction, isolates were grown on standard me-dium (SM) plates (adapted from Raper 1984: 1000 mlddH2O, 20 g peptone, 2 g yeast extract, 20 g glucose, 2 gMgSO4, 3.8 g KH2PO4, 1.2 g K2HPO4, 20 g bactoagar).Amoebae from the plaque edges were collected with asterile tip, mixed with MasterAmp Buccal Swab DNAExtraction Solution from Epicentre (Madison, WI, USA)and heated for 30 min at 60 °C followed by 8 minat 98 °C. Cell lysates were used directly for PCRamplification. 18S rDNA was amplified using primers18S-FA (5′AACCTGGTTGATCCTGCCAG 3′) and 18S-RB (5′ TGATCCTTCTGCAGGTTCAC 3′) (described inMedlin et al. 1988 as ‘Primer A’ and ‘Primer B’,respectively) with an initial denaturation step of 5 minat 95 °C, followed by 30 cycles of 30 sec at 95 °C,1 min at 56 °C, and 2 min at 72 °C, with a final

elongation step of 10 min at 72 °C. Sequencing wasperformed at Macrogen (Korea or Amsterdam) using theaforementioned primers along with internal sequencingprimers D542F and D1340R (Schaap et al. 2006).Sequences were edited using Sequencher version 3.0(Gene Codes Corporation Inc.) or the Staden package(Staden 1996).

Molecular analysis

All sequences were identified by BLASTn searches againstthe NCBI nr database. Morphological species identificationwas considered confirmed if the top BLAST hit had ≥90 %coverage, 99–100 % identity to the query sequence, andcorresponded to a species with a morphological descriptionconsistent with that of the query.

In cases where the BLAST top hit sequence identitywas <99 % or the morphological identification of thequery was not consistent with that of the top hit, aphylogeny was constructed. The phylogenetic data setincluded all ambiguous sequences from the presentstudy plus their top BLAST hit sequence and a set ofsequences from other closely related species accordingto Romeralo et al. (2011a). The recovered rDNA SSUsequences were added by hand to existing alignmentsfor Dictyostelid Group 1, 2, 3, 4 or the violaceum-complex, as appropriate based on their top BLAST hitidentity (Romeralo et al. 2011a). Phylogenetic analyseswere conducted using Bayesian inference with MrBayes3.1.2 (Ronquist and Huelsenbeck 2003). Analyses uti-lized the MC3 search algorithm with two independentsets of four chains and were run until the two sets ofchains converged (split frequency ≤0.01). All analysesused the general time reversible nucleotide substitutionmodel corrected for the proportion of invariant sites(GTR+γ+ I model) as indicated by MrModelTest 2.3(Nylander 2004), with four gamma rate categories tocorrect for evolutionary rate variation among sites. Theoptimality and robustness of the resulting trees wereevaluated with posterior probabilities (biPP), excludinga 20 % burn-in. In all cases except two (correspondingto the two new species described below), this methodconfirmed the morphological identification.

To confirm the phylogenetic positions of the two newspecies, additional analyses were performed with maxi-mum likelihood (ML) using RAxML version 7.0.4(Stamatakis et al. 2008), again using the GTR+γ+ Isubstitution model. Branch support was determined with100 bootstrap replicates (mlBP). The alignment wasdeposited at TreeBase (Submission ID: 13035), and thenew species SSU rDNA sequences were submitted toGenBank (NCBI) with the accession numbers JX173877and JX173878.

Fungal Diversity (2013) 58:185–198 189

Results

We assessed soil samples from northern Sweden whichwere collected from localities between 59°29′N (LimesNorrlandicus) and 67°44′N latitude. Nine dictyostelidspecies were isolated from these samples, all but threeof which, Dictyostelium minutum, D. mucoroides andPolysphondylium fuscans, are new records for Sweden(Table 3). Seven of these are previously described speciesor species complexes: Dictyostelium aureostipes var helve-ticum, D. fasciculatum, D. implicatum, D. leptosomum,D. minutum, D. mucoroides (sensu D. mucoroides isolateS28b, GenBank accession number AM168054), andP. tenuissimum (Table 3). The remaining two isolates arenew species described herein as D. barbibulus (Figs. 1 and2) and P. fuscans (Figs. 3 and 4).

Phylogenetic analysis of nuclear SSU rDNA confirms theassignment ofDictyostelium barbibulus andPolysphondyliumfuscans to Dictyostelid Group 4 and the violaceum-complex,respectively (Fig. 5). Dictyostelid Group 4 species are typi-cally large, unbranched or irregularly branched and rarelypigmented (Romeralo et al. 2011a), all characteristics consis-tent with D. barbibulus. The new species P. fuscans isassigned to the violaceum-complex (Fig. 5), which appearsas the sister group to Group 4 in SSU rDNA trees (Schaap etal. 2006; Romeralo et al. 2011a). These species are character-ized by purple pigmentation of the sori and repeating whorlsof side branches, or occasionally irregular branching.

The nine species recovered from Northern Sweden in-clude representatives from all four of the originally de-scribed major groups of Dictyostelia, plus one of the threemore recently recognized species complexes (Fig. 5;

Fig. 1 Line drawings of diagnostic features ofDictyostelium barbibulus.a. Radiatemucoroides-type aggregations. b. Clavate tips. c. Myxamoebaewith vacuoles. d. Oval spores with homogenous content. e. Conical to

round bases. f. Early sorocarps. g. Sorophores with basal disks. Bars:A00.5 mm, B020 um, C-D010 um, E020 um, F-G00.5 mm

190 Fungal Diversity (2013) 58:185–198

Romeralo et al, 2011a). In addition, D. implicatum and D.leptosomum were recovered for the first time in high-latitude environments, extending the northern limits of theirknown ranges (Table 1).

Taxonomy

Dictyostelium barbibulus Perrigo et Romeralo, sp.nov.(Figs. 1 and 2)

MycoBank: MB 800884

Type Sweden. Karlstads kommun: 3 km south of Molkom,along route 240. 59°34′49″N 13°45′26″E, 102 m, under Pinussylvestris, Picea abies, Betula sp. and Equisetum sp., 04-VII-2008. Sweden-4R (holotype deposited at UU and the DictyStock Center, Northwestern University, Chicago, IL, USA).

Description Sorocarps solitary to clustered and unbranching,ranging from 1.0 to 2.5 mm in height when grown on non-nutrient agar with K. aerogenes at 22 °C. Aggregations aremucoroides-type commonly 0.75 to 2.1 mm in diameter. Earlysorogens coniform to fusiform and 300–600 μm in length,forming fruiting bodies without migration. Spores oval, 6.0–8.5×3.0–5.0 μm, without polar granules. Tips clavate, 5–15 μm wide, bearing globose, white-hyaline terminal sori140–240μm in diameter, exhibiting a stoloniferous habit whencollapsed. Bases conical to round (50–80 μm), with a distinctbasal disk. Myxamoebae 9–16×7–14 μm. Illustrations of mor-phological features are shown in Figs. 1 and 2.

Distribution and ecology This species was isolated in cen-tral Sweden from mildly acidic (pH05.65) soil in a conif-erous forest comprised mainly of Pinus sylvestris and Piceaabies, with understory species including Betula sp. andEquisetum sp.

Etymology This species is named after a character from theFrench children’s book series, Barbapapa. The characters inthis series have the ability to take on different shapes, just asthis species can exhibit a solitary or clustered habit.

Additional specimens examined (paratype) Sweden.Karlstads kommun: 3 km south of Molkom, along route240. 59°34′49″N 13°45′26″E, 102 m, under Pinus sylvest-ris, Picea abies, Betula sp. and Equisetum sp., 04-VII-2008.Sweden-4B (paratype deposited at UU).

Remarks This species belongs to Dictyostelid Group 4(Schaap et al. 2006). It forms a clade together with D.chordatum and D. implicatum (Fig. 5). D. barbibulus andD. implicatum are known to exhibit the distinctive stolonif-erous habit, and D. chordatum also exhibits this trait in someisolates, but not all (Perrigo, personal observation).Morphologically, D. barbibulus can be differentiated fromD. chordatum and D. implicatum by its unique clusteredgrowth pattern, spore size and lower optimal growth tem-perature. D. barbibulus is morphologically most similar toD. septentrionalis. However, D. barbibulus differs from D.septentrionalis in that it has significantly smaller sorocarps,clustered growth and a conspicuous basal disk.

Frøyen and Langvad (1984a) recovered a species from eightlocalities in Norway that is referred to as “D. sp. 1.,” and thedescription of this isolate is quite similar to D. barbibulus. D.sp. 1 is described as having solitary or clustered growth, andlarge spores (7–10x4.9–5.5) with no polar granules and anoptimal growth temperature around 21 °C. The only notabledifferences are that the isolates described by Frøyen andLangvad were recovered only from soils of deciduous forests,and the spore size of D. barbibulus is smaller than that of

Fig. 2 Photos of diagnostic features of Dictyostelium barbibulus. a.Solitary sorocarps. b. Oval spores with homogenous content. c. Basaldisks. d. Conical to round base. e. Complex clavate tip. f. Earlysorogen. g. Radiate mucoroides-type aggregations. Bars: A00.5 mm,B010 um, C00.2 mm, D020 um, E010 um, F00.5 mm, G01.0 mm

Fungal Diversity (2013) 58:185–198 191

Frøyen and Langvad’s isolates. Based on this information it ispossible that a variant of D. barbibulus has been isolatedbefore, also in Scandinavia, although it had not been described.

The SSU rDNA sequence for D. barbibulus is availableat GenBank, accession number JX173878.

Polysphondylium fuscans Perrigo et Romeralo sp.nov.(Figs. 3 and 4)

MycoBank: MB 800885

Type Sweden. Gagnets kommun: 3 km east of Lake Tansen,60°24′23″N 15°04′03″E, 438 m, under Pinus sylvestris, 09-VII-2008. Isolate: Sweden-11D deposited at UU and the DictyStock Center (Northwestern University, Chicago, IL, USA).

Description Sorocarps solitary, 3.0–6.0 mm in height whencultivated on non-nutrient agar with K. aerogenes at 22 °C.1–3 whorls per sorocarp, irregularly placed along the sor-ophore but usually on the upper half of the stalk, with 2–6branches (150–350 μm in length) per whorl. Terminal sori130–240 μm in diameter, turning purple after 1–2 days anddarkening with age. Lateral sori purple, 40–130 μm indiameter. Bases round or occasionally conical, 20–70 μmwide. Tips clavate and 10–20 μm. Aggregations violaceum–type, 1.5–4.5 mm in diameter, colorless. Early sorogensfusiform to coniform, migrate with stalk formation, 300-700 μm in length. Spores elliptical with unconsolidatedpolar granules, 6.0–8.5×3.0–4.0 μm. Myxamoebae 9–12×7–10 μm. Illustrations of morphological features are shownin Figs. 3 and 4.

Fig. 3 Line drawings of diagnostic features of Polysphondylium fus-cans. a. Violaceum-type aggregations. b. Complex clavate tips. c.Myxamoebae. d. Elliptical spores with unconsolidated polar granules.

e. Round to conical bases. f. Early sorogens. g. Sorocarps with irreg-ular whorls and dark purple coloration. Bars: A01.0 mm, B-D010 um,E050 um, F-G01.0

192 Fungal Diversity (2013) 58:185–198

Distribution and ecology This species is typical of acidicsoils in central and southern Sweden, where it has beenfrequently recovered. It has been found in both deciduousand coniferous forests.

Etymology Fuscans, meaning ‘darkening’ in Latin refers tothe sori, which start out colorless and develop violate col-oration that darkens with age.

Additional specimens examined (paratype) Sweden.Karlstads kommun: 3 km north of Lake Alsten, 59°29′22″N 13°36′00″E, 80 m, under Pinus sylvestris andPicea abies, 04-VII-2008. Isolate: Sweden 3-2. (para-type deposited at UU).

Remarks This species was recovered from mildly acidic soil(pH05.5) from a coniferous forest in central Sweden. P.fuscans is commonly recovered from soils in central andsouthern Sweden (Perrigo, unpublished data) and has also

been recovered from boots most recently worn in centralSweden in an assay of dictyostelid dispersal (Perrigo, et al2012).

SSU rDNA phylogeny places P. fuscans in a highlysupported clade together with the undescribed isolate ‘P.tibet’ (Fig. 5). This clade is well supported as a member ofthe violaceum-complex (Bayesian posterior probability01.0, maximum likelihood bootstrap support0100 % for bothnodes, Fig. 5), although the precise position of this cladewithin the violaceum-complex is not yet well resolved.Morphologically, P. fuscans is most similar to P. violaceum,but differs primarily in the lighter initial pigmentation of thesori, smaller number of whorls and larger spore size.

The SSU rDNA sequence for P. fuscans is available atGenBank, accession number JX173877.

Discussion

Previous records of dictyostelids in Sweden

The only previous survey of dictyostelids in Swedenreported four species (Table 2, Kawabe 1995). In the presentstudy we found nine species, only one of which overlapswith Kawabe’s findings. In our survey, no isolates ofPolysphondylium pallidum, P. violaceum or Dictyosteliumpurpureum were recovered (Table 3), despite all three beingfrequently recovered by Kawabe (1995). While it may bethat we simply found different species, considering that wefound over twice as many species as Kawabe, and that someof our species are included in previously delimited speciescomplexes (e.g. D. mucoroides, P. pallidum and P. viola-ceum), we consider it more likely that his species are asubset of ours. Thus we expect that some of Kawabe’sspecies were misidentified due to differences in morpholog-ical (species) interpretation and lack of molecular data. Inparticular, we believe that the isolate identified by Kawabeas P. pallidum (1995) was in fact P. tenuissimum, and thespecies he identified as D. purpureum and P. violaceum areboth in fact P. fuscans.

P. pallidum and P. tenuissimum are clearly separate spe-cies, as indicated by molecular phylogeny (Schaap et al.2006, Romeralo et al. 2011a), but their classification basedon morphological characters has been controversial sincethe beginning (Raper 1984). P. pallidum was the first whitepolysphondyliid to be described (Olive 1901) and it sharesmany morphological characteristics with P. tenuissimum(Hagiwara 1979). In fact in 1982 Hagiwara introduced theterm “Polysphondylium pallidum complex”, defined as“Polysphondylia with white sori and elliptical spores butwithout lengthened terminal segments of sorophores”. Thus

Fig. 4 Photos of diagnostic features of Polysphondylium fuscans.a. Violaceum-type aggregation. b. Sorocarps showing the characteristicfew whorls. c. Elliptical spores with unconsolidated polar granules.d. Complex clavate tip. e. Conical base. f. Aggregations, early soro-gens and sorocarps. Bars: A-B01.0 mm, C-D010 um, E050 um,F00.5 mm

Fungal Diversity (2013) 58:185–198 193

isolates of both P. pallidum and P. tenuissimum were includ-ed in the complex. The main morphological differencesbetween these species are sorophore thickness (the soro-phore is about twice as thick in P. pallidum as in P. tenuis-simum) and number of whorls along the sorophore (up to 8–10 in P. pallidum and up to 21 in P. tenuissimum) but eventhese features may overlap (see Table 4). In fact, in his 1984monograph Raper states that several species he [Raper] hadinitially described as P. pallidum in fact better match thedescription of P. tenuissimum. This confusion has extendedto the isolate P. pallidum PN500, whose full genome wasrecently sequenced (Heidel et al. 2011). Molecular phylog-eny places isolate PN500 as sister to P. tenuissimum andin a completely different subgroup from the other exam-ined P. pallidum isolate, TNSC98 (Schaap et al. 2006;Romeralo et al 2011a). Some genetic variation amongseveral isolates associated with the species P. pallidumwas already reported in an early study from Eisenbergand Francis (1977).

Unfortunately Kawabe’s isolate of P. pallidum was notmaintained and therefore its identification cannot be con-firmed with molecular data. Frøyen and Langvad similarlyreported P. pallidum from Norway (1984b), but likewisehave not retained specimen vouchers. The latter did, how-ever, note key morphological characters of the isolates,which seem more similar to P. tenuissimum in the numberof branches per whorl (1–11) and terminal sorus size (30–70μm) (Frøyen and Langvad 1984a). As with many speciescomplexes in the Dictyostelia, a taxonomic revision of theunpigmented polysphondyliids is needed. A more detailedmorphological study of these species might also revealadditional characteristics to differentiate them, as the currentcharacters are often insufficient and ambiguous (Table 4).

In terms of D. purpureum and P. violaceum, althoughKawabe (1995) reported finding each in three localities, twoof them overlapping, we didn’t find either of these species inany locality we sampled (Table 2). This is despite the factthat all of the regions where Kawabe reporting finding these

Fig. 5 Phylogenetic position of the new species Dictyostelium barbi-bulus and Polysphondylium fuscans. The tree shown is the optimaltopology found by both Bayesian inference (BI) and maximum likeli-hood (ML) of small subunit ribosomal DNA (SSU rDNA) nucleotidesequences from two proposed new species of Dictyostelia. The tree

includes a representative set of taxa from Dictyostelid Group 4 andviolaceum-complex. ML bootstrap support values over 70 % and BIposterior probabilities over 0.80 are shown to the left and right of theslash, respectively. Nodes with PP01.00 or BS0100 % are denotedwith a star (*). The phylogeny is rooted following Schaap et al. (2006)

194 Fungal Diversity (2013) 58:185–198

species are well sampled in the present study (Table 3).Therefore, we suggest that both of these species reportedby Kawabe were in fact instances of P. fuscans. P. fuscansfits well with the broad original morphological definition ofP. violaceum (Brefeld 1884). The finding of D. purpureumin Sweden seems especially unlikely. This is partly because,while there are only a few recorded observations of thisspecies in temperate habitats, all of which come from eitherNorth America or Japan (Swanson et al. 1999),D. purpureumis more common towards the equator (Cavender 1973) and isconsidered ubiquitous in tropical habitats. In fact, apart fromKawabe (1995), the only other possible report of D. purpur-eum in Europe is an unpublished observation from Mallorca(Traub, personal communication with Swanson, fromSwanson et al. 1999). Molecular data clearly indicate that P.fuscans is a species distinct from both P. violaceum and D.purpureum (Fig. 5). However, on purely morphologicalgrounds it can be confused with D. purpureum or membersof the violaceum-complex due to its robust sporophores andviolet sori (Figs. 3 and 4). Again, since no voucher remains, itis not possible to confirm or reject this speculation.

It should be noted that until recently several of the spe-cies recovered in the present study were considered to fallwithin the poorly defined “D. mucoroides complex,”(Norberg 1971; Raper 1984). This complex could be inter-preted to include D. aureostipes, D. implicatum, D. lepto-somum and D. minutum, as well as the newly described D.barbibulus, among others. Thus, by lumping these speciestogether, under this earlier definition of D. mucoroides s.lat.,the diversity of Sweden would have appeared significantlylower and overwhelmingly dominated by D. mucoroides, aswas indicated in by Kawabe (1995; Table 2).

Species concept in Dictyostelia

Like many protist groups, the species concept in Dictyosteliais poorly defined and increasingly dynamic. This is partlybecause it is difficult to use the biological species concept.Although dictyostelids have a sexual phase, whereby theamoebae fuse to form a macrocyst (Erdos et al. 1973,reviewed in Raper 1984), and at least in D. discoideum thereare three mating types (Bloomfield et al. 2010), macrocystsare difficult to induce in the lab and unknown for most species(Raper 1984). Therefore very few studies have used sexualreproduction as a criterion to delimit species of Dictyostelia.Notable exceptions have used macrocyst formation to-gether with other lines of evidence, such as molecularphylogeny, to assess species complexes (Mehdiabadi etal. 2009; Mehdiabadi et al. 2010). Because of the diffi-culty of using sexual reproduction as a criterion forspecies delimitation, the species concept in Dictyosteliahas traditionally relied solely on morphology, primarilyof the fruiting bodies (see Raper 1984).

It has been suggested that due to the diversity of protists,species concepts should be defined on a group-by-groupbasis (Boenigk et al. 2012). For dictyostelids, the impor-tance of molecular data for species definition has becomeabundantly clear in recent years. The first molecular phy-logeny of the group (Schaap et al. 2006) showed that at leasttwo, and quite possibly all three of the morphologicallydefined genera are para- or polyphyletic, and indicated thepossible presence of some species complexes. Thus, thenuclear SSU rDNA and internal transcribed spacer (ITS)have been employed in many recent attempts to identifyand delimit dictyostelid species (Mehdiabadi et al. 2009,

Table 4 A comparison of the morphological characteristics of Polysphondylium pallidum and P. tenuissimum based on the original speciesdescriptions (Olive 1901; Hagiwara 1979) as well as the widely used taxonomic revision of the dictyostelids (Raper 1984)

Characteristic P. pallidum (Olive 1901) P. pallidum (Raper 1984) P. tenuissimum (Hagiwara 1979)

Habit – Solitary or small clusters Solitary or grouped

Height – 3–8 mm, sometimes more 3.6–9.3 mm

Number of whorls 1–10a 3–8, sometimes more 3–21

Branches per whorl 1–6a 3–6 3–10

Spore shape Oval to spherical Ellipsoid to reniform Ellipsoid

Spore size 2.5–3×5–6.5 μm, or 7–8 μm when spherical 2.5–3×5–7 μm, sometimes 4x8 2.7–3.5×5–6.2 μm

Granule formation – Unconsolidated Unconsolidated

Aggregation – Radiate Radiate

Terminal sori size 50–80 μm 75–150 μm 30–80 μm

Sorophore thickness (base) – 12–30 μm 6–15 μm

Sorophore thickness (tip) – 5–8 μm 1.5–5 μm

a The number of whorls and branches per whorl as defined by Olive (1901) is given for the genus Polysphondylium. These measurements are notexplicitly stated for the species, but instead the genus description is referenced.

Fungal Diversity (2013) 58:185–198 195

2010; Romeralo et al. 2007, 2009, 2010; Vadell et al. 2011;and Perrigo et al. 2012). Using these markers and morethorough species sampling, subsequent phylogenies indicatethe presence of species complexes throughout the group,including multiple cryptic species, i.e. morphologically in-distinguishable but phylogenetically distinct taxa (Romeraloet al. 2010, 2011a). As a result, the new species conceptemerging for dictyostelids combines the traditional morpho-logical concept with molecular phylogeny, as first imple-mented by Romeralo et al. (2009). Based on this a fulltaxonomic revision of the group is needed.

The latitudinal gradient of species diversity

The number of species recovered in this survey is consistentwith previous observations that a latitudinal gradient ofspecies richness is observed in dictyostelids. The nine spe-cies recovered overlap considerably with the ten speciesrecovered from Norway (Frøyen and Langvad 1984b;Table 1). Meanwhile, there were somewhat fewer speciesfound in this study than in similar surveys of more southerlyEuropean regions. For example, in Germany eighteen spe-cies were found (Cavender et al. 1995), thirteen specieswere recovered in Switzerland (Traub et al. 1981), and inSpain and Portugal fourteen species were recovered(Romeralo and Lado 2006). Despite finding fewer speciesin northern Sweden than in lower latitudes, four of thespecies recovered were previously unrecorded for high-latitude habitats (Table 1), two of them being new speciesto science, indicating that dictyostelid diversity in high-latitude environments is still poorly understood and war-rants further study.

Our results here help emphasize the importance of mo-lecular data as a tool in the continued study of dictyostelidbiogeography in particular and protist biogeography in gen-eral. Due to the large number of poorly defined morpholog-ical species, which are easily delimited with the aide ofmolecular markers, many species that were previouslythought to be cosmopolitan are now turning out to be com-plexes made up of several geographically restricted species.For instance, the most recent revision of dictyostelid bioge-ography (Swanson et al. 1999) indicated P. violaceum as a‘weedy’ cosmopolitan species, occurring in nearly all tem-perate habitats that had been sampled. With the use ofmolecular data it is becoming clear that many of theseisolates, although belonging to the violaceum-complex, arein fact distinct geographically restricted species, for exampleP. patagonicum (Vadell et al. 2011) and P. accuminatum(Vadell and Cavender 1998). One of the new species de-scribed here, P. fuscans, is another example of a violaceum-complex species that is confidently recognized as a uniqueisolate through molecular data, despite its apparent morpho-logical similarities to other species in the complex.

Cases such as this highlight the critical importance ofmolecular data in protist species concepts and thus indifferentiating cosmopolitan versus geographically restrictedspecies. This is a key line of evidence in the debate regardingthe existence of protist biogeographies. Some have argued thatmultiple isolates of distinct morphospecies with unique rRNAsequences may be an artifact of genetic drift, thus showing notrue biogeographic patterns (Fenchel 2005). However, othershave shown substantial and well-supported genetic andgeographic diversity in protist species that were once thoughtto be made up of a single cosmopolitan species (for example,Wilkinson 2001; Foissner 2006; Bass et al. 2007). Based on alarge collection of reports describing the extensive phyloge-netic diversity of ‘cosmopolitan species’ Epstein and Lopez-Garcia (2008) conclude that global protistan richness wassignificantly underestimated in pre-molecular inventories. Itis now imperative that we correct this historical underestima-tion and skewed picture of protist diversity and distribution, inthe case of dictyostelids using both morphological and mo-lecular methods.

Conclusions

Recent molecular studies indicate that morphological iden-tification of many protists, including dictyostelids, can beinaccurate due to convergent evolution and phenotypic plas-ticity (Schaap et al. 2006; Romeralo et al. 2011a; reviewedin Foissner 2006). As a result, it is often difficult to makeaccurate species identifications without the aide of molecu-lar sequence data. This is particularly relevant here for thetwo Polysphondylium species reported by Kawabe but notfound by us (P. pallidum and P. violaceum).

Nine species, some with widespread and other with ap-parently restricted distributions within high latitudes, wererecovered. These include two previously undescribed spe-cies. Thus it appears that there is still a substantial propor-tion of species yet to be described from high-latitude regionsand an ongoing sampling effort is needed. This study cor-roborates previous observations that indicate a latitudinalgradient of species diversity in the dictyostelids. The advan-tage of molecular markers is highlighted, especially in iden-tifying species that belong to species complexes that arepoorly delimited based on morphology and that are in needof taxonomic revision.

Acknowledgments The authors would like to thank Mats Thulin forassistance with species descriptions. We would like to express ourappreciation to the people at the dictyBase Stock Center (NorthwesternUniversity, Chicago, Illinois) for maintaining dictyostelid voucherspecimens, including those described in this paper. Financial supportfrom the foundations Signhild Engkvists Stiftelse and Lars HiertsMinne to ALP is gratefully acknowledged. MR is supported by a MarieCurie Intra-European Fellowship within the 7th European CommunityFramework Programme (PIEF-GA-2009-236501).

196 Fungal Diversity (2013) 58:185–198

References

Arnborg T (1990) Forest types of northern Sweden. Vegetatio 90:1–13Bass D, Richards TA, Matthai L, Marsh V, Cavalier-Smith T (2007)

DNA evidence for global dispersal and probable endemicity ofprotozoa. BMC Evol Biol 7:162. doi:10.1186/1471-2148-7-162

Bloomfield G, Skelton J, Ivens A, Tanaka Y, Kay RR (2010) Sexdetermination in the social amoeba Dictyostelium discoideum.Science 330:1533–1536

Boenigk J, Ereshefsky M, Hoef-Emden K, Mallet J, Bass D (2012)Concepts in protistology: species definitions and boundaries. EurJ Protistol 48:96–102

Bonner JT (2009) The Social Amoebae. Princeton University Press,Princeton, New Jersey

Brefeld O (1869) Dictyostelium mucoroides. Ein neuer Organismusund der Verwandschaft der Myxomyceten. Abh SeckenburgNaturforsch Ges 7:85–107

Brefeld O (1884) Polysphondylium violaceum und Dictyosteliummucoroides nebst Bemerküngen zur Systematik der Schleimpilze.Unters Gesammtgeb Mykol 6:1–34

Cavender JC (1973) Geographical distribution of the Acrasieae. Myco-logia 65:1044–1054

Cavender JC (1978) Cellular slime molds in tundra and forest soils ofAlaska including a new species, Dictyostelium septentrionalis.Can J Bot 56:1326–1332

Cavender JC, Raper KB (1965) The Acrasieae in nature I. Isolation.Am J Bot 52:294–296

Cavender JC, Raper KB, Norberg AM (1979) Dictyostelium aureo-stipes and Dictyostelium tenue: new species of the Dictyostelia-ceae. Am J Bot 66:207–217

Cavender JC, Cavender-Bares J, Hohl HR (1995) Ecological distribu-tion of cellular slime molds in forest soils of Germany. Bot Helv105:199–219

Coccuci SM, Sussman M (1970) RNA in cytoplasmic and nuclearfractions of cellular slime mold amoebae. J Cell Biol 45:399–407

Eisenberg RM, Francis D (1977) The breeding system of Polysphon-dylium pallidum, a cellular slime mold. J Eukaryot Microbiol24:182–183

Epstein S, Lopez-Garcia P (2008) “Missing” protists: a molecularperspective. Biodivers Conserv 17:261–276

Erdos GW, Raper KB, Vogen LK (1973) Mating types and macrocystformation in Dictyostelium discoideum. Proc Nat Acad Sci USA70:1828–1830

Fenchel T, Finlay BJ (2004) The ubiquity of small species: patterns oflocal and global diversity. Bioscience 54:777–784

Fenchel T (2005) Cosmopolitan microbes and their ‘cryptic’ species.Aquat Microb Ecol 41:49–54

Foissner W (2006) Biogeography and dispersal of micro-organisms: areview emphasizing protists. Acta Protozool 45:111–136

Frøyen OJ, Langvad F (1984a) Description of dictyostelid cellularslime mold species in Norway. Nord J Bot 4:503–511

Frøyen OJ, Langvad F (1984b) Occurrence and distribution dictyostelidcellular slime mold species in Norway. Nord J Bot 4:817–821

Hagiwara H (1979) The Acrasiales in Japan. V Bull Natl Sci MuseumSer B (Bot) 5:67–72

Hagiwara H (1982) Altitudinal distribution of dictyostelid cellularslime mold in Gosainkund region of Nepal. In: Otani Y (ed)Reports on the cryptogamic study in Nepal. National ScienceMuseum, Tokyo, pp 105–117

Hagiwara H (1989) The taxonomic study of Japanese dictyostelidcellular slime molds. National Science Museum, Tokyo

Hagiwara H (1990) Altitudinal distribution of dictyostelid cellularslime molds in the Langtang Valley of Central Himalayas. ReptTottori Mycol Inst 28:191–198

Heidel AJ, Lawal HM, Felder M, Schilde C, Helps NR, Tunggal B,Rivero F, John U, Schleicher M, Eichinger L, Platzer M, NoegelAA, Schaap P, Glöckner G (2011) Phylogeny-wide analysis ofsocial amoeba genomes highlights ancient origins for complexintercellular communication. Genome Res 21:1882–1891

Hillebrand H (2004) On the generality of the latitudinal diversitygradient. Am Nat 163:192–211

Kawabe K (1995) Distribution of dictyostelid cellular slime molds inforest soils of Sweden. Bull Jap Soc Microbiol Ecol 10:115–118

Kottek M, Grieser J, Beck C, Rudolf B, Franz R (2006) World map ofthe Köppen-Geiger climate classification updated. Meteorol Z15:259–263

Landolt JC, Stephenson SL, Laursen GA, Densmore R (1992) Distri-bution patterns of cellular slime molds in the Kantishna Hills,Denali National Park and Preserve, Alaska, U.S.A. Arctic AlpineRes 24:244–248

Medlin L, Elwood HJ, Stickel S, Sogin ML (1988) The characteriza-tion of enzymatically amplified eukaryotic 16S-like rRNA-codingregions. Gene 71:491–499

Mehdiabadi NJ, Kronforst MR, Queller DC, Strassmann JE (2009)Phylogeny, reproductive isolation and kin recognition in the so-cial amoeba Dictyostelium purpureum. Evolution 63:542–548

Mehdiabadi NJ, Kronforst MR, Queller DC, Strassmann JE (2010)Phylogeography and sexual macrocyst formation in the socialamoeba Dictyostelium giganteum. BMC Evol Bio 10:17.doi:10.1186/1471-2148-10-17

Norberg AM (1971) The Dictyostelium mucoroides complex. Disser-tation, University of Wisconsin

Nylander JAA (2004) MrModeltest 2.4. Program distributed by theauthor. Evolutionary Biology Center, Uppsala University, Sweden

Olive EW (1901) A preliminary enumeration of the Sorophoreae. ProcAm Acad Arts Sci 34:333–344

Palm BT (1935) Ett fynd av Dictyostelium mucoroides i Sydsverige.Sven Bot Tidskr 29:365–366

Perrigo AL, Romeralo M, Baldauf S (2012) What’s on your boots: aninvestigation into the role we play in protist dispersal. J Biogeogr36:998–1003

Raper KB (1984) The Dictyostelids. Princeton University Press,Princeton

Romeralo M, Lado C (2006) Dictyostelids from Mediterranean forestsof the south of Europe. Mycol Progress 5:231–241

Romeralo M, Fiz-Palacios O, Lado C, Cavender JC (2007) A newconcept for Dictyostelium sphaerocephalum based on morpholo-gy and phylogenetic analysis of nuclear ribosomal internal tran-scribed spacer region sequences. Can J Bot 85:104–110

Romeralo M, Baldauf SL, Cavender JC (2009) A new species ofcellular slime mold from southern Portugal based on morphology,ITS and SSU sequences. Mycologia 101:269–274

Romeralo M, Landolt JC, Cavender JC, Laursen GA, Baldauf SL(2010) Two new species of dictyostelis cellular slime molds fromAlaska. Mycologia 102:588–595

Romeralo M, Cavender JC, Landolt JC, Stephenson SL, Baldauf SL(2011a) An expanded phylogeny of social amoebas (Dictyostelia)shows increasing diversity and new morphological patterns. BMCEvol Biol 11:84. doi:10.1186/1471-2148-11-84

Romeralo M, Moya-Larano J, Lado C (2011b) Social amoebae: envi-ronmental factors influencing their distribution and diversityacross south-western Europe. Microbial Ecol 61:154–165

Romeralo M, Escalante R, Baldauf SL (2012) Evolution and diversityof dictyostelid social amoebae. Protist 163:327–343

Ronquist F, Huelsenbeck JP (2003) MrBayes 3: Bayesian phylogeneticinference under mixed models. Bioinformatics 19:1572–1574

Schaap P, Winckler T, Nelson M, Alvarez-Curto E, Elgie B, HagiwaraH, Cavender J, Milano-Curto A, Rozen DE, Dingermann T,Mutzel R, Baldauf SL (2006) Molecular phylogeny and evolutionof morphology in the social amoebas. Science 314:661–663

Fungal Diversity (2013) 58:185–198 197

Staden R (1996) The Staden sequence analysis package. Mol Biotech-nol 5:233–241

Stamatakis A, Hoover P, Rougemont J (2008) A rapid bootstrapalgorithm for the RAxML web servers. Syst Bio 75:758–771

Stephenson SL, Landolt JC, Laurson GA (1991) Cellular slime moldsin soils of Alaskan tundra, U.S.A. Arctic Alpine Res 23:104–107

Stephenson SL, Landolt JC, Laurson GA (1997) Dictyostelid cellularslime molds from western Alaska, U.S.A. and the Russian FarEast. Arctic Alpine Res 29:222–225

Sucgang R, Kuo A, Tian X, Salerno W, Parikh A, Feasley CL, Dalin E,Tu H, Huang E, Barry K, Lundquist E, Shapiro H, Bruce D,Schmutz J, Salamov A, Fey P, Gaudet P, Anjard C, Babu MM,Basu S, Bushmanova Y, van der Wel H, Katoh-Kurasawa M, DinhC, Coutinho PM, Saito T, Elias M, Schaap P, Kay RR, HenrissatB, Eichinger L, Rivero F, Putnam NH, West CM, Loomis WF,Chisholm RL, Shaulsky G, Strassmann JE, Queller DC, Kuspa A,Grigoriev IV (2011) Comparative genomics of the social amoebae

Dictyostelium discoideum and Dictyostelium purpureum. GenomeBiol 12:R20. doi:10.1186/gb-2011-12-2-r20

Swanson AR, Vadell EM, Cavender JC (1999) Global distribution offorest soil dictyostelids. J Biogeogr 26:133–148

Traub F, Hohl HR, Cavender JC (1981) Cellular slime molds ofSwitzerland. II. Distribution in forest soils. Am J Bot 68:172–182

Vadell EM, Cavender JC (1998) Polysphondylium from forest soils ofTikal, Guatamala. Mycologia 90:715–725

Vadell EM, Cavender JC, Romeralo M, Edwards SM, Stephenson SL,Baldauf SL (2011) New species of dictyostelids from Patagoniaand Tierra del Fuego. Mycologia 103:101–117

Wilkinson DM (2001) What is the upper limit for cosmopolitandistribution in free-living microorganisms? J Biogeogr28:285–291

Willig MR, Kaufman DM, Stevens RD (2003) Latitudinal gradients ofbiodiversity: patterns, processes, scale and synthesis. Annu RevEcol Evol Syst 34:273–309

198 Fungal Diversity (2013) 58:185–198