Progress in Neuro-Psychopharmacology & Biological Psychiatry 38 (2012) 159–167

Contents lists available at SciVerse ScienceDirect

Progress in Neuro-Psychopharmacology & BiologicalPsychiatry

j ourna l homepage: www.e lsev ie r .com/ locate /pnp

Differential effects of fluoxetine and venlafaxine on memory recognition: Possiblemechanisms of action

Valeria Paola Carlini a,⁎,1, María Belén Poretti a, Mathias Rask-Andersen c,Rohit A. Chavan c, Marina F. Ponzio a,1, Rahul S. Sawant c, Susana Rubiales de Barioglio b,1,Helgi B. Schiöth c, Marta Fiol de Cuneo a,1

a Cátedra de Fisiología Humana, Facultad de Ciencias Médicas, Universidad Nacional de Córdoba, Santa Rosa 1085, X5000ESU, Córdoba, Argentinab Departamento de Farmacología, Facultad de Ciencias Químicas, Universidad Nacional de Córdoba, Haya de la Torre y Medina Allende, Ciudad Universitaria, 5016 Córdoba, Argentinac Department of Neuroscience, Functional Pharmacology, Uppsala University, BMC, Uppsala SE 75124, Sweden

Abbreviations: 5-HT, serotonin; ACT, β-actin; AMPA,4-isoxazolepropionic acid; BDNF, brain-derived neurotrocalmodulin-dependent protein kinase II; cGMP, cyclic guacAMP response element-binding protein; CYCLO, cyclophobject; GAPDH, glyceraldehyde-3-phosphate dehydrogeERK,mitogen-activatedprotein kinases;NE, norepinephrinacid; nO, novel object; NOS, nitric oxide synthase; OCT3,PKC, protein kinases C; RPL19, ribosomal protein 19; SERserotonin-norepinephrine reuptake inhibitors; SSRI, serotor; SUCB, succinate dehydrogenase complex, subunit B;type 2; TST, tail suspension test; TUB, β-tubulin.⁎ Corresponding author. Fax: +54 351 4332019.

E-mail address: vcarlini@live.com.ar (V.P. Carlini).1 Established investigators from CONICET.

0278-5846/$ – see front matter © 2012 Elsevier Inc. Alldoi:10.1016/j.pnpbp.2012.03.004

a b s t r a c t

a r t i c l e i n f o

Article history:Received 27 December 2011Received in revised form 24 February 2012Accepted 8 March 2012Available online 15 March 2012

Keywords:FluoxetineHippocampusMAPK/ERK expressionMolecular memory pathwayMemory formation

Serotonin-specific reuptake inhibitors (SSRI) and serotonin-norepinephrine reuptake inhibitors (SNRI) areantidepressant drugs commonly used to treat a wide spectrum of mood disorders (Wong and Licinio,2001). Although they have been clinically used for more than 50 years, the molecular and cellular basis forthe action of SSRIs and SNRIs is not clear. Considering that the changes in gene expression involved in the ac-tion of antidepressant drugs on memory have not been identified, in this study we investigated the impact ofchronic treatment with a SSRI (fluoxetine) and a SNRI (venlafaxine) on the mRNA expression of genes relatedto memory cascade in the mouse hippocampus, namely, α-amino-3-hydroxy-5-methyl-4-isoxazolepropionicacid (AMPA), nitric oxide synthase 1 (NOS1), neurotrophic tyrosine kinase receptor type 2 (TrKB), mitogen-activated protein kinases (MAPK/ERK) and serotonin transporter (SERT). Animals treated with fluoxetine10 mg/Kg/day for 28 days showed a significant decrease in the percentage of time spent in the novel objectrecognition test (p≤0.005) and induced MAPK1/ERK2 down-regulation (p=0.005). Our results suggestthat the effect on cognition could probably be explained by fluoxetine interference in the MAPK/ERK memorypathway. In contrast, chronic treatment with venlafaxine did not reduce MAPK1/ERK2 expression, suggestingthat MAPK1/ERK2 down-regulation is not a common effect of all antidepressant drugs.Further studies are needed to examine the effect of chronic fluoxetine treatment on the ERK-CREB system,and to determine whether there is a causal relationship between the disruption of the ERK-CREB systemand the effect of this antidepressant on memory performance.

© 2012 Elsevier Inc. All rights reserved.

1. Introduction

Serotonin-specific reuptake inhibitors (SSRI) and serotonin-norepinephrine reuptake inhibitors (SNRI) are antidepressant drugscommonly used to treat a wide spectrum of mood disorders (Wong

α-amino-3-hydroxy-5-methyl-phic factor; CAMK II, calcium/nosine monophosphate; CREB,ilin; DA, dopamine; fO, familiarnase; H3, histone H3; MAPK/e; NMDA,N-Methyl-D-asparticorganic cationic transporter 3;T, serotonin transporter; SNRI,tonin-specific reuptake inhibi-TrKB, tyrosine kinase receptor

rights reserved.

and Licinio, 2001). It is well known that the main mechanism ofaction of antidepressant drugs is the inhibition of neurotransmitterreuptake, by which the extraneuronal monoamine concentrationsare increased. From this early biochemical change, the clinical anti-depressant effects develop gradually over weeks through neuronaladaptation; this process, at a molecular level, may be based on anew pattern of gene expression (Alfonso et al., 2005; Tardito et al.,2006). Additionally, numerous studies have shown that these drugsproduce a variety of adverse side effects, such as sexual dysfunction,anxiety, memory impairment and reduction in body weight (Csokaand Shipko, 2006; Flament et al., 1999). Although they have beenclinically used for more than 50 years, no consensus has been reachedabout their specific molecular actions in the brain.

The formation and storage of long-term memory is believed toresult from transient changes in neuronal efficiency followed bylong-lasting functional and morphological modifications in severalareas of the brain, including the hippocampus, related corticalregions, and perhaps different nuclei of the amygdala (Dudai, 2002;Izquierdo et al., 2006; McGaugh, 2000).

160 V.P. Carlini et al. / Progress in Neuro-Psychopharmacology & Biological Psychiatry 38 (2012) 159–167

The molecular events involved in memory formation and consoli-dation have been characterized. They involve the activation of differ-ent neurotransmitter systems and intracellular signaling pathways,which regulate the cellular mechanisms that control gene expressionand subsequently the synthesis of new proteins (Bekinschtein et al.,2007). These modifications occur as a result of a protein synthesis-dependent process named consolidation, during which memories be-come progressively stabilized (Izquierdo et al., 2006; McGaugh, 2000;Reymann and Frey, 2007).

The biochemical cascade of memory has been mainly studied inthe hippocampus. Several reports suggested that the earlier eventsof this cascade involve glutamate release from presynaptic neuronsand subsequent activation of the postsynaptic α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) and the N-Methyl-D-aspartic acid (NMDA) receptors, followed by an increase in Ca2+

influx mediated by NMDA, plus a pre- and post-synaptic activationof calcium/calmodulin-dependent protein kinase II (CAMK II) andprotein kinases G and C (PKC). Furthermore, some reports describechanges in nitric oxide synthase (NOS) and cyclic guanosine mono-phosphate (cGMP) levels (Izquierdo et al., 2008). PKC mediatesfurther phosphorylation of the glutamate receptor and possible phos-phorylation of the cAMP response element-binding protein (CREB).These events are associated with increased protein levels of brain-derived neurotrophic factor (BDNF) and activation of neurotrophictyrosine kinase receptor type 2 (TrKB) (Hansen et al., 2007; Yamadaand Nabeshima, 2003), coupled to mitogen-activated protein kinases(MAPK/ERK), which also regulate the phosphorylation of CREB(Sweatt, 2001). Additionally, BDNF is involved in the pathophysiologyof mood disorders and plays a critical role in the mechanism of actionof antidepressant drugs (Duman and Monteggia, 2006).

The aim of the present study was to investigate the impact ofchronic treatment with two different serotonin (5-HT) and/or norepi-nephrine (NE) reuptake inhibitors, fluoxetine and venlafaxine, onmRNA expression of some genes related to the biochemical memorycascade.

Considering the peptides that participate in the molecular cascadeof memory in the hippocampus, we chose to study the expression ofthe following genes in this structure: AMPA type 1, NOS type 1,MAPK type 1 (also know ERK type 2), MAPK type 3 (also know ERKtype 1), TrKB and serotonin transporter (SERT).

2. Material and methods

2.1. Animals

This study was conducted using inbred intact adult male mice(Albino Swiss-SWR/J (q)) (60 to 80 days old, weighing 25–35 g),maintained on a 12:12 h light:dark regimen at 20±3 °C with waterand food ad-libitum. Animals were handled daily for 7 days beforethe experiments. All experiments were conducted in accordancewith the Animal Care and Use Guidelines of the Medical School —National University of Cordoba, Argentina and taking into accountthe recommendations of the Guide for the Care and Use of LaboratoryAnimals published by the US National Institutes of Health (NIH;publication 85–23, revised 1996). Every attempt was made to mini-mize the number of animals used and their suffering.

2.2. Drugs

Fluoxetine and venlafaxine (Bagó Laboratory, Argentina) weresuspended in sterile saline powder (0.9%) immediately before admin-istration to provide final concentrations of 10 mg/ml. To preventvariations due to circadian rhythms, the drugs were administeredbetween 10:00 AM and noon. All drugs were orally administered for28 days by intubation with a stainless steel ball-tipped gavage needleattached to an appropriate syringe. The animals were habituated to

this form of administration for 7 days before treatment, using sterilesaline solution.

2.3. Experimental protocol

First set of experiments: the animals were divided into threegroups: saline solution, fluoxetine (10 mg/Kg/day) or venlafaxine(10 mg/Kg/day). The doses of venlafaxine and fluoxetine were select-ed according to bibliographical references (Kulkarni and Dhir, 2007)and to pilot studies to determine the lowest dose able to decrease im-mobility time in the tail suspension test (TST), suggesting a predictiveantidepressant-like effect.

The animals were tested in the open-field test under basal condi-tions (basal) and 7 days after habituation to oral administration (pre-treatment period). Between the 26th day and 28th day of drug adminis-tration, the object recognition test was performed (26th habituation,27th training and 28th test) and in the afternoon of the 28th day, theanimals were tested in the open-field test (post-treatment period)and then in the TST. The animals were killed and the hippocampifrom both hemispheres were collected by dissection and preserved inRNAlater solution (Ambion, Austin, TX, USA), and stored at −80 °C.The total number of animals used was 42.

Second set of experiments: taking into account that acute stressmodifies gene expression in the hippocampus (Melia et al., 1994)other experimental groups were included in the study without thetests. In this set, the animals were divided into three groups: salinesolution, fluoxetine (10 mg/Kg/day) or venlafaxine (10 mg/Kg/day).At the 28th day of administration, the animals were killed and thehippocampi from both hemispheres were collected by dissectionand preserved. The total number of animals used was 23.

2.4. Behavioral test

2.4.1. Open–field testIncreased exploration in an enclosed arena such as the open-field

apparatus is one of the earliest and most widely accepted indices ofdepressive-like behavior (Klein and Brown, 1969; van Riezen andLeonard, 1990). Therefore, locomotor activity was recorded beforehabituation to the administration route (under basal conditions),again 7 days later (saline pre-treatment period) and at the 28th day(post-treatment).

Mice were individually placed in a wooden box (40×60×50 cm)with the floor of the arena divided into 12 equal squares. The numberof squares crossed with all paws (crossing) was registered during a6 min period. The floor of the open-field apparatus was cleanedwith 10% ethanol between tests.

Comparisons between experimental and control groups wereperformed by repeated measures analysis of variance (times: basal,pre-treatment and post-treatment conditions), followedwhen appro-priate by a Tukey's HSD test. P values lower than 0.05 were consid-ered statistically significant.

2.4.2. Spontaneous object recognitionObject recognition is a particularly useful way of studying declar-

ative memory in rodents because it makes use of their innate prefer-ence for novel over familiar objects. This task was similar to thatdescribed by Ennaceur and Aggleton (1997) to assess the ability ofmice to recognize a novel object compared to a familiar one in awell-known environment. Non-amnesic animals usually spend moretime exploring the novel object, reflecting the use of learning andmemory processes. The absence of any differences in the explorationof the objects can be interpreted as a memory deficit. The apparatusconsisted of a wooden box, 25 cm wide×50 cm long×30 cm high,painted in beige. The object recognition task included two trials: thefirst was the acquisition phase, also called training phase, and thesecond was the testing phase. All mice underwent one habituation

Table 1Real-time PCR primers. RPL19: ribosomal protein 19; CYCLO: cyclophilin; GAPDH:glyceraldehyde-3-phosphate dehydrogenase; SERT: serotonin transporter; NOS1:nitric oxide synthase; MAPK1/ERK2: mitogen-activated protein kinases type 1;MAPK3/ERK1: mitogen-activated protein kinases type 3; TrKB: tyrosine kinase recep-tor type 2.

Primer Forward (5′–3′) sequency Reverse (5′–3′) sequency

RPL19 aatcgccaatgccaactc ggaatggacagtcacaggCYCLO tttgggaaggtgaaagaagg acagaaggaatggtttgatggGAPDH gccttccgtgttcctacc gcctgcttcaccaccttcSERT tatatcgcctcctactataac cagtgttccaagagttctAMPA1 gcttcatggacattgactta tgtagttcaccagttggaNOS1 tcaacaacccgtattcag gaaggactgccattcttgMAPK1/ERK2 gctctgcttatgataatct atctctcttagggttcttMAPK3/ERK1 taattgcatcattaacatg ctttggagtcagatttagTRKB aggctagaaatcatcaatg ttcagaaacgctttgtaa

161V.P. Carlini et al. / Progress in Neuro-Psychopharmacology & Biological Psychiatry 38 (2012) 159–167

session in which they were allowed to explore the device for 5 min(without objects). In the training phase, in order to get familiarwith the objects, mice were placed in the box, with two identicalobjects (familiar object: fO) located at a specific distance from eachother (15 cm), and allowed to explore them for 3 min (training).The time spent in exploring each object was measured and onlyanimals that explored each object for approximately 50% of the totaltime were tested in the next phase.

Twenty-four hours later, the mice were placed in the apparatus forthe retention test (testing phase) and allowed to explore the twoobjects for 3 min: one object was the one used for training (fO) andthe other was a novel object (nO). The time spent in exploring eachobject was measured. It is important to point out that we usedthree identical familiar objects (brown glass square), two of whichwere used during the training phase (t1 and t2) and the third one(t3) was used as the familiar object during the retention test; there-fore the odor cues left during previous exploration were not presentin the testing phase. The novel object (tnovel) used in the testingphase was a pink plastic ball.

Object exploration was defined as when the mice directed thenose to the object at a distance closer than 2 cm; turning around orsitting on the object were not considered exploratory behaviors. Thefollowing parameters were measured: time spent in exploring identi-cal objects during training (fO), time spent in exploring the novelobject (nO) and the familiar object in the retention test, and totalexploration time. The percentage of time spent in novel object explo-ration was considered as an index of memory retention.

The datawere expressed asmean of the percentage of familiar objectexploration time during the training phase (t2-familiar/[t2-familiar+t1-familiar]×100)±standard error (SEM) and mean of percentage ofnovel object exploration time in the retention phase (tnovel/[tnovel+t3-familiar]×100)±standard error (SEM). The results were evaluatedwith a repeated measures analysis of variance (times: training andtest) followed when appropriate by a Tukey's HSD test; p values≤0.05were considered statistically significant.

2.4.3. Tail-suspension testThe tail suspension test has become one of the most widely used

models for assessing antidepressant-like activity in mice. The test isbased on the fact that if animals are suspended by their tail, theyare subjected to short-term inescapable stress and will develop animmobile posture. The total duration of immobility induced by thetail suspension test was measured according to the method describedby Steru et al. (1985). Briefly, mice, acoustically and visually isolated,were suspended 50 cm above the floor with an adhesive tape placedat approximately 1 cm from the tail tip. Immobility time was recordedduring a 6 min period. Mice were considered immobile only whenthey hung passively and completely motionless. The immobility timewas then recorded by an observer blind to the drug treatment(Binfaré et al., 2009; Machado et al., 2007).

Comparisons between experimental and control groups wereperformed by a one-way ANOVA test, followed when appropriate bya Tukey's HSD test. P values lower than 0.05 were considered statisti-cally significant.

2.5. Gene expression

2.5.1. RNA isolation and cDNA synthesisTissue sampleswere homogenized by sonication in TRIzol (Invitrogen,

Sweden) using a sonicator. Chloroform was added to the homogenate,which was then centrifuged at 10,000×g at 4 °C for 15 min. The aqueousphasewas then transferred into a new tube and the RNAwas precipitatedwith isopropanol. Pellets were washed with 75% ethanol, air-dried atroom temperature and dissolved in RNAse-freewater. DNAwas removedby treatment with DNAse I (Roche Diagnostics, Sweden) at 37 °C for 4 hand the enzyme was thereafter inactivated by heating the samples at

75 °C for 15 min. The absence of genomic DNA was determined by PCRanalysis with primers for mouse glyceraldehyde-3-phosphate dehydro-genase (GAPDH; NM_017008; forward TCCCTCAAGATTGTCAGCAA andreverse CACCACCTTCTTGATGTCATC). RNA concentrations were mea-sured using a NanoDrop1 ND-1000 spectrophotometer (NanoDrop1Technologies, Delaware, USA). cDNA was synthesized with M-MLV re-verse transcriptase using random hexamers as primers, according to themanufacturer's recommendations (GE Healthcare, Sweden).

2.5.2. Real-time PCRThe cDNA was analyzed with a MyIQ thermal cycler (Bio-Rad

Laboratories, Sweden). Each real-time PCR reaction with a totalvolume of 20 ml contained cDNA synthesized from 25 ng total RNA,0.25 M of each primer, 20 mM Tris/HCl (pH 8.4), 50 nM KCl, 4 mMMgCl2, 0.2 mM dNTP, SYBR Green (1:50,000). A real-time PCR reac-tion was performed with 0.02 U/l Taq DNA polymerase (Invitrogen,Sweden) under the following conditions: initial denaturation for4 min at 95 °C followed by 50 cycles of 15 s each at 95 °C, 30 s at55–62 °C (i.e. at the optimal annealing temperature for each primerpair), and 30 s at 72 °C. This step was followed by 1 min at 55–62 °C(optimal annealing temperature) and a melting curve with 84 cyclesof 10 s at 55 °C, increased by 0.5 °C per cycle. All experiments wereperformed in duplicate. Measurements in which the threshold cycle(Ct) values between the duplicates had a difference equal to or great-er than 0.9 were repeated. A negative control for a given primer pairand a positive control with 25 ng of genomic DNA was included ineach plate. The following housekeeping genes were used to defineexpression normalization factors: GAPDH, β-tubulin (TUB), ribosomalprotein 19 (RPL19), histone H3 (H3), cyclophilin (CYCLO), β-actin(ACT) and succinate dehydrogenase complex, subunit B (SUCB).Normalization factors were calculated using the GeNorm methoddescribed by Vandesompele et al. (2002). The primers RPL19, Cyclo,GAPDH and the primers studied (SERT, AMPA1, NOS1, MAPK 1/ERK2, MAPK3/ERK1 and TrKB) were designed using Beacon PrimerDesign 4.0 software (Premier Biosoft, USA) (Table 1).

Comparisons between experimental and control groups wereperformed by a one-way ANOVA test, followed when appropriate byTukey's HSD test. P values lower than 0.05 were considered statisti-cally significant.

3. Results

3.1. First set of experiments

3.1.1. Effects of fluoxetine and venlafaxine on crossing numbers in theopen-field test

The effects of fluoxetine and venlafaxine on the open-field test areshown in Fig. 1. The animals treated with saline showed significantdifferences between basal condition, pre-treatment period and post-

Basa l

pre-tr

eatm

ent

post-tr

eatm

ent

0

50

100

150 SHAM (S)SHAM (F)SHAM (V)

Cro

ssin

g n

um

ber

s

* *

Fig. 1. Effect of oral fluoxetine and venlafaxine administration on crossing numbersin the open-field test. Animals were treated with saline (control), fluoxetine (10 mg/Kg/day) or venlafaxine (10 mg/Kg/day) for 28 days. The test was carried out beforehabituation to the administration route (under basal conditions), again 7 days later(saline pre-treatment period) and at the 28th day (post-treatment). Results areexpressed as mean±SEM. n=12–15 animals in each group. *p≤0.05 vs. control.

162 V.P. Carlini et al. / Progress in Neuro-Psychopharmacology & Biological Psychiatry 38 (2012) 159–167

treatment period (p≤0.05). The treatment with fluoxetine or venla-faxine inhibited habituation to the context.

The repeated measures ANOVA showed a significant interaction be-tween treatments (saline, fluoxetine or venlafaxine) and time (basal,pre-treatment and post-treatment) (F=6.88, df=4, p≤0.05); no signif-icant effects of time (F=0.81, df=2, p>0.05) and no significant effect oftreatment (F=0.04, df=2, p≤0.05) were detected.

100

3.1.2. Effects of fluoxetine and venlafaxine on memory performance inthe object recognition task

In order to evaluate the effects of fluoxetine and venlafaxine(at the dose here employed) on memory performance, the objectrecognition test was applied.

Fig. 2 shows the effect of oral administration of fluoxetine andvenlafaxine on memory performance. Animals treated with fluoxe-tine 10 mg/Kg/day for 28 days showed a significant decrease in thepercentage of time spent in the novel object recognition test, indicat-ing a reduction in memory retention of previously explored objects.Mice treated with venlafaxine at the same dose, however, did notexhibit changes in the percentage of time spent exploring the novelobject compared to animals treated with saline.

0

25

50

75

100 Saline

Fluoxetine

Venlafaxine

*

fO nO

Exp

lora

tio

n T

ime

(%)

Fig. 2. Effect of oral fluoxetine and venlafaxine administration on memory performancein the object recognition test. Animals were treated with saline (control), fluoxetine(10 mg/Kg/day) or venlafaxine (10 mg/Kg/day) for 28 days. The training test wascarried out on the 27th day of treatment and the retention test was performed 24 hlater. Results are expressed as mean±SEM. n=12–15 animals in each group. fO:familiar object, nO: novel object. *p≤0.05 vs. control.

The repeated measures ANOVA test revealed a significant interac-tion between treatment (saline, fluoxetine or venlafaxine) and time(training and test) (F=12.59, df=(2, 38), p≤0.05) and a significanteffect of time (F=84.63, df=(1, 38), p≤0.05). No significant effectwas noted on total exploration time (familiar+novel object, a mea-surement of animal motivation).

3.1.3. Effects of fluoxetine and venlafaxine on TST immobility timeIn order to evaluate the effects of fluoxetine and venlafaxine at

the dose studied here on the predictive antidepressant effect, thetail suspension test was applied.

Animals treated with fluoxetine or venlafaxine (both 10 mg/Kg/day) for 28 days showed decreased immobility time in the TSTcompared to animals treated with saline (F=8.57, df=2, p≤0.05)(Fig. 3).

3.1.4. Effects of fluoxetine and venlafaxine on gene expression related tomemory processes in the hippocampus

Fig. 4 shows the effects of oral fluoxetine and venlafaxine admin-istration on memory-related gene expression. Only animals treatedwith fluoxetine 10 mg/Kg/day for 28 days showed a significant de-crease in the relative expression of MAPK1/ERK2 (F=6.65, df=2,p=0.005). No significant effects were detected on the relative geneexpression of SERT (F=0.35, df=2, p>0.05), AMPA1 (F=1.85,df=2, p>0.05), NOS1 (F=0.12, df=2, p>0.05), MAPK3/ERK1(F=0.36, df=2, p>0.05) and TrKB (F=3.72, df=2, p>0.05).

3.2. Second set of experiments

3.2.1. Effects of fluoxetine and venlafaxine on gene expression relatedto memory processes in the hippocampus: evaluation without priorbehavioral tests

Fig. 5 shows the effects of oral fluoxetine and venlafaxine admin-istration on memory-related gene expression. Only animals treatedwith fluoxetine 10 mg/Kg/day for 28 days showed a significant de-crease in the relative expression of MAPK1/ERK2 (F=7.80, df=2,p=0.004). No significant effects were detected on the relative geneexpression of SERT (F=0.34, df=2, p>0.05), AMPA1 (F=0.87,df=2, p>0.05), NOS1 (F=1.49, df=2, p>0.05), MAPK3/ERK1(F=0.59, df=2, p>0.05) or TrKB (F=1.23, df=2, p>0.05).

Saline

Fluoxe

tine

Venlaf

axin

e0

20

40

60

80

* *

Imm

ob

ility

Tim

e (s

ec)

Fig. 3. Effect of oral fluoxetine and venlafaxine administration on immobility time inthe tail suspension test. Animals were treated with saline (control), fluoxetine(10 mg/Kg/day) or venlafaxine (10 mg/Kg/day) for 28 days. The test was carried outon day 28. Results are expressed as mean±SEM. n=12–15 animals in each group.*p≤0.05 vs. control.

TrkB

0.0

0.5

1.0

1.5

MAPK1

0.0

0.5

1.0

1.5

*

AMPA1

0.0

0.5

1.0

1.5

2.0

2.5

Rel

ativ

e ex

pre

ssio

n (

AU

)

Rel

ativ

e ex

pre

ssio

n (

AU

)

Rel

ativ

e ex

pre

ssio

n (

AU

)

Rel

ativ

e ex

pre

ssio

n (

AU

)

Rel

ativ

e ex

pre

ssio

n (

AU

)

Rel

ativ

e ex

pre

ssio

n (

AU

)

NOS1

0.0

0.5

1.0

1.5MAPK3

0.0

0.5

1.0

1.5

SERT

0.0

0.5

1.0

1.5

A B

C D

E F

Saline

Fluoxe

tine

Venlaf

axin

e

Saline

Fluoxe

tine

Venlaf

axin

e

Saline

Fluoxe

tine

Venlaf

axin

e

Saline

Fluoxe

tine

Venlaf

axin

e

Saline

Fluoxe

tine

Venlaf

axin

e

Saline

Fluoxe

tine

Venlaf

axin

e

Fig. 4. Effect of oral fluoxetine and venlafaxine administration on relative gene expression related to memory processes. Animals were treated with saline (control), fluoxetine(10 mg/Kg/day) or venlafaxine (10 mg/Kg/day) for 28 days. After behavioral test, the animals were killed and the hippocampus removed. Results are expressed as mean±SEM.n=12–14 animals in each group. SERT: serotonin transporter; MAPK1: mitogen-activated protein kinases type 1; MAPK3: mitogen-activated protein kinase type 3; TrKB: neuro-trophic tyrosine kinase receptor type 2; AMPA type 1: α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor; and NOS1: neuronal nitric oxide synthase. *p≤0.05 vs.control.

163V.P. Carlini et al. / Progress in Neuro-Psychopharmacology & Biological Psychiatry 38 (2012) 159–167

4. Discussion

The results of the present study provide evidence of a MAPK1/ERK2-down regulation in the hippocampus and a deficit in memoryperformance in response to prolonged treatment with the antide-pressant fluoxetine. In contrast, venlafaxine did not alter MAPK1/ERK2 expression or hippocampus-dependent memory performance.These results suggest that different classes of antidepressants show

different regulation of MAPK1/ERK2 expression. Moreover, the lackof effect of venlafaxine points to the specificity of the effect producedby fluoxetine, possibly reflecting the different side effects of these an-tidepressants. Our results are similar to those from other studieswhich demonstrate that phospho-ERK2 is markedly reduced afterchronic fluoxetine administration, suggesting that such treatmentmay decrease the activity of this signaling pathway (Fumagalli et al.,2005). However, they are in contrast to another report in which

*

0.0

0.5

1.0

1.5

2.0

Rel

ativ

e ex

pre

ssio

n (

AU

)

A

Saline

Fluoxe

tine

Venlaf

axin

e0.0

0.5

1.0

1.5

Rel

ativ

e ex

pre

ssio

n (

AU

)

B

Saline

Fluoxe

tine

Venlaf

axin

e

Rel

ativ

e ex

pre

ssio

n (

AU

)

0.0

0.5

1.0

1.5C

Saline

Fluoxe

tine

Venlaf

axin

e

Rel

ativ

e ex

pre

ssio

n (

AU

)

0.0

0.5

1.0

1.5E

Saline

Fluoxe

tine

Venlaf

axin

e

Rel

ativ

e ex

pre

ssio

n (

AU

)

0.0

0.5

1.0

1.5F

Saline

Fluoxe

tine

Venlaf

axin

e

0.0

0.5

1.0

1.5

2.0

Rel

ativ

e ex

pre

ssio

n (

AU

)

D

Saline

Fluoxe

tine

Venlaf

axin

e

TrkB

AMPA1

MAPK3

MAPK1

NOS1

SERT

Fig. 5. Effects of fluoxetine and venlafaxine on gene expression related to memory processes in the hippocampus: evaluation without prior behavioral tests. Animals were treatedwith saline (control), fluoxetine (10 mg/Kg/day) or venlafaxine (10 mg/Kg/day) for 28 days. Results are expressed as mean±SEM. n=12–14 animals in each group. SERT: seroto-nin transporter; MAPK1: mitogen-activated protein kinases type 1; MAPK3: mitogen-activated protein kinase type 3; TrKB: neurotrophic tyrosine kinase receptor type 2; AMPAtype 1: α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor; and NOS1: neuronal nitric oxide synthase. *p≤0.05 vs. control.

164 V.P. Carlini et al. / Progress in Neuro-Psychopharmacology & Biological Psychiatry 38 (2012) 159–167

fluoxetine significantly increased hippocampal phospho-ERK2 levels(Qi et al., 2008).

It is interesting to note that inhibition of the ERK pathway pro-duces antidepressant-like behavior (Einat et al., 2003) and that defi-cits in BDNF and MAPK/ERK signaling have been previouslyassociated with memory impairment in aging brains (Gooney et al.,2004; Mattson et al., 2004). Many studies suggest that the consolida-tion of object recognition memory involves an increase in ERKphosphorylation in the dentate gyrus/CA1 region, suggesting the

participation of the hippocampal formation (Kelly et al., 2003).Despite the close link between the MAPK/ERK pathway and BDNF,the present data are in apparent contrast with those reporting anenhancement of BDNF expression by antidepressant treatment (Diaset al., 2003; Nibuya et al., 1995).

Our results also show behavioral evidence suggesting that onlychronic fluoxetine treatment decreases memory retention, reinfor-cing previous findings about the deleterious effect of this drug onmemory recognition (Bangs et al., 1994; de Oliveira et al., 2004;

A

B

Fig. 6. Hypothetical mechanism of action of fluoxetine, a SSRI, on memory recognition. The molecular events that participate in memory formation and consolidation involve theactivation of intracellular signaling pathways. The earlier events of memory cascade involve glutamate release from the presynaptic neurons and subsequent activation of the post-synaptic α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) and the N-Methyl-D-aspartic acid (NMDA) receptors, followed by an increase in Ca2+ influx, mediatedby the latter. Calcium activates calcium/calmodulin-dependent protein kinase II (CAMK II) and protein kinases A (PKA) and C (PKC). The latter memory cascade events are asso-ciated with mitogen-activated protein kinases (MAPK/ERK) activated by CAMKII, and then MAPK/ERK induces phosphorylation of the cAMP response element-binding protein(CREB) (Sweatt, 2001), consequently increasing protein synthesis involved in memory persistence. In addition, the increase in Ca2+ influx induces neuronal nitric oxide synthase(NOS1) activation and nitric oxide (NO) synthesis (Izquierdo et al., 2008). The molecular events that participate in memory formation and consolidation also involve the activationof different neurotransmitter systems. Panel A: fluoxetine increases serotonin (5-HT) levels. The activation of 5HT1 receptors inhibits CaMKII activity (Moyano et al., 2004). Inaddition, the effect of fluoxetine on memory could be also mediated by additional cerebral mechanisms besides monoamine reuptake inhibition, for example, by direct down-regulation on MAPK/ERK gene expression. Perhaps the low expression of MAPK/ERK induces a decrease of CREB phosphorylation and protein synthesis, blocking the persistenceof the recognition trace; consequently the memory is labile. Panel B: venlafaxine inhibits norepinephine (NE), serotonin (5-HT) and dopamine (DA) reuptake, enhancing theseneurotransmitter levels (de Oliveira et al., 2004; Dhir and Kulkarni, 2008). The D1 DA receptor activation stimulates glutamate release in the presynapsis (Bouron and Reuter,1999) and induces phosphorylation and activation of MAPK and CREB in the postsynaptic neuron (Yan et al., 1999); hippocampal β1-NE (Winder et al., 1999) activates NOS1and the MAPK/ERK pathway; 5HT1 receptors inhibit CaMKII activity (Moyano et al., 2004). It is conceivable that the increase in dopaminergic or/and noradrenergic levels producedby venlafaxine could counteract the effect on memory recognition induced by an increase in 5-HT levels, and in consequence induce persistence of memory recognition.

165V.P. Carlini et al. / Progress in Neuro-Psychopharmacology & Biological Psychiatry 38 (2012) 159–167

Huang et al., 2004; Joss et al., 2003) and the absence of influence ofvenlafaxine at the dose employed here on cognitive functions(Siepmann et al., 2008; Valluzzi and Chan, 2007). In addition, our

results also support the hypothesis about hippocampus participationin the central effects of these antidepressants. However, this contrastswith results reported previously by other authors, who suggest that

166 V.P. Carlini et al. / Progress in Neuro-Psychopharmacology & Biological Psychiatry 38 (2012) 159–167

fluoxetine improves performance in some memory tasks (Bradleyand Kulik, 1993; Flood and Cherkin, 1987; Friedman, 1994; Mirow,1991; Nowakowska and Kus, 2005). Although this discrepancyneeds further research, the differences may be attributed to differ-ences in the experimental models; i.e., doses employed, duration oftreatment (acute, sub-acute or chronic), subjects (rats or mice),state of the subjects (normal or depressive) and/or memory testsused.

The differences found in our work between the results obtainedfrom treatment with fluoxetine and venlafaxine could probably be at-tributed to the fact that fluoxetine is a SSRI, while venlafaxine is astrong SNRI and a moderate inhibitor of dopamine (DA) reuptake(Ellingrod and Perry, 1994). However, some discrepancies havebeen previously reported in relation to the effect of venlafaxine onthe inhibition of NE and DA reuptake. In vitro and in vivo studieshave shown that venlafaxine has dose-dependent effects on the inhi-bition of 5-HT and NE reuptake. Studies in mice have shown that ven-lafaxine doses of 8, 16 and 32 mg/kg affect 5-HT reuptake inhibition,while the 32 mg/kg dose has an apparent effect on 5-HT as well ason NE reuptake inhibition (Redrobe et al., 1998). However, chronicintraperitoneal administration of venlafaxine (16 mg/kg) has beenreported to increase levels of NE and 5-HT (Dhir and Kulkarni,2008); on the other hand, chronic oral venlafaxine (10 mg/Kg) wasshown to increase DA levels (de Oliveira et al., 2004).

It is well-known that the noradrenergic, serotoninergic and dopa-minergic systems play a significant role in associative learning. It hasbeen demonstrated that activation of the 5-HT receptors induces adecrease in memory performance, probably due to differential actionupon receptors in the hippocampus. On the one hand, 5-HT exertsmemory impairment by 5-HT1A or 5HT3 and 5-HT1B receptor activa-tion and, on the other hand, the activation of 5HT1A receptors inhibitsCaMKII activity (Meeter et al., 2006; Mendelson et al., 1993; Moyanoet al., 2004). As regards the dopaminergic system, it has beenreported that DA stimulates the phosphorylation and activation ofMAPK and CREB, two molecules that are crucial for the induction oflong-term remodeling of synapses, which is believed to underliememory consolidation and neuronal plasticity (Yan et al., 1999). Inaddition, it has been demonstrated that the activation of D1-DA inthe glutamatergic presynapsis induces glutamate release (Bouronand Reuter, 1999). In the noradrenergic system, a recent study dem-onstrated that NE may facilitate LTP induction in the hippocampus(Hu et al., 2007), suggesting that an increase in NE concentration de-creases the threshold to LTP generation, facilitating memory forma-tion. Thus, the MAPK/ERK pathway is activated by hippocampal β-adrenoreceptors in CA1 (Winder et al., 1999).

In consequence, it is conceivable that the increase in dopaminergicand/or noradrenergic levels produced by the SNRI venlafaxine maycounteract the effect induced by an increase in 5-HT levels. Neverthe-less, the effect of fluoxetine on memory could be also mediated byother cerebral mechanisms besides monoamine reuptake inhibition.With the above evidence, we hypothesize a differential mechanismof action for fluoxetine and venlafaxine on memory recognition (seeFig. 6).

Our results also show that fluoxetine and venlafaxine do not in-duce changes in SERT gene expression. The results of in vivo studiesof the SSRI's long-term effect on SERT are controversial. Numerousstudies related to the effect of antidepressant treatment on mRNASERT content have yielded contradictory conclusions, some reportingincreases and others reporting decreases or no change (Iceta et al.,2007).

In addition, both fluoxetine and venlafaxine at the doses used inthis study have shown predictive antidepressant-like responses inthe tail suspension test and convergence of their neural actions atsome place in the brain, impacting on various structures, such asthe hippocampus, dorsal raphe nucleus, amygdala and hypothalamus,which also participate in memory behavior (Izquierdo et al., 2008).

The TST is widely used for screening potential antidepressants. Anti-depressants reduce the immobility time in this test. The immobilitybehavior displayed in rodents subjected to unavoidable stress hasbeen hypothesized to reflect behavioral despair, which could be auseful model for the study of depressive disorders in humans. Thereis, indeed, a significant correlation between the clinical potency andthe effectiveness of antidepressants in this model (Cryan et al.,2002; Porsolt et al., 1977; Steru et al., 1985).

It is important to acknowledge that the present work has somelimitations, such as evaluating the gene expression of CREB andBDNF, the ERK1/2 and CREB phosphorylation and the effects of SSRIand SNRI on the uptake mechanism that involves organic cationictransporter 3 (OCT3). These molecular aspects may be addressed infuture studies. In fact, studies are being conducted to explore the ef-fects of fluoxetine and venlafaxine in an animal model of depression,such as bilateral olfactory bulbectomy in mice.

Undoubtedly, knowledge about the processes involved in themechanism/s of action of these antidepressant drugs would consti-tute a useful tool for their therapeutic use.

5. Conclusion

To our knowledge, this is the first study demonstrating that fluox-etine, a SSRI, is able to induce MAPK1/ERK2 down-regulation. Our re-sults suggested that the effect on cognition could probably beexplained by its interference in the MAPK/ERK memory pathway. Incontrast to fluoxetine, chronic treatment with venlafaxine did not re-duce MAPK1/ERK2 expression, suggesting that MAPK1/ERK2 down-regulation is not a feature common to all antidepressant drugs.

Policy and ethics

All authors certify that the experiments were carried out in accor-dance with the National Institutes of Health Guide for the Care andUse of Laboratory Animals (NIH Publications No. 80–23) revised1996, and every attempt to minimize the number of animals usedand their suffering was made.

Contributors

Valeria P Carlini designed the study and wrote the first draft of thispaper. Valeria P. Carlini, María Belén Poretti and Marina Ponzio car-ried out the behavioral experiment and performed the analysis ofthis data. Valeria P. Carlini, Mathias Rask-Andersen, Rohit A. Chavan,and Rahul S. Sawant carried out the real time PCR experiments andperformed the analysis of this data. Helgi B. Schiöth, Susana Rubialesde Barioglio and Marta Fiol de Cuneo contributed to the design of thestudy and reviewed the manuscript. All the above-mentioned authorscontributed equally and have approved the final version of themanuscript.

Acknowledgments

This work was supported by grants from CONICET (Consejo Nacio-nal de Investigación Científica y Técnica), SECyT-UNC (Secretaría deCiencia y Técnica de la Universidad Nacional de Córdoba) and theSwedish Research Council (VR, Medicine). The authors thank EstelaSalde (CONICET's technician) for her assistance in animal histology.Fluoxetine and venlafaxine were a generous gift from the Bagó Labo-ratory (Argentina).

References

Alfonso J, Frasch AC, Flugge G. Chronic stress, depression and antidepressants: effectson gene transcription in the hippocampus. Rev Neurosci 2005;16:43–56.

Bangs ME, Petti TA, Janus MD. Fluoxetine-induced memory impairment in an adolescent.J Am Acad Child Adolesc Psychiatry 1994;33:1303–6.

167V.P. Carlini et al. / Progress in Neuro-Psychopharmacology & Biological Psychiatry 38 (2012) 159–167

Bekinschtein P, Cammarota M, Igaz LM, Bevilaqua LRM, Izquierdo I, Medina JH. Persis-tence of long-term memory storage requires a late protein synthesis- and BDNF-dependent phase in the hippocampus. Neuron 2007;53:261–7.

Binfaré RW, Rosa AO, Lobato KR, Santos AR, Rodrigues AL. Ascorbic acid administrationproduces an antidepressant-like effect: evidence for the involvement of monoam-inergic neurotransmission. Prog Neuropsychopharmacol Biol Psychiatry2009;33(3):530–40.

Bouron A, Reuter H. The D1 dopamine receptor agonist SKF-38393 stimulates therelease of glutamate in the hippocampus. Neuroscience 1999;94(4):1063–70.

Bradley SJ, Kulik L. Fluoxetine and memory impairment. J Am Acad Child AdolescPsychiatry 1993;32:1078–9.

Cryan JF, Markou A, Lucki I. Assessing antidepressant activity in rodents: recent develop-ments and future needs. Trends Pharmacol Sci 2002;23:238–45.

Csoka AB, Shipko S. Persistent sexual side effects after SSRI discontinuation. PsychotherPsychosom 2006;75(3):187–8.

de Oliveira RA, Cunha GMA, Borges KDM, de Bruin GS, dos Santos-Filho EA, VianaGlauce SB, et al. The effect of venlafaxine on behavior, body weight and striatalmonoamine levels on sleep-deprived female rats. Pharmacol Biochem Behav2004;79(3):499–506.

Dhir A, Kulkarni SK. Venlafaxine reverses chronic fatigue-induced behavioral, bio-chemical and neurochemical alterations in mice. Pharmacol Biochem Behav2008;89(4):563–71.

Dias BG, Banerjee SB, Duman RS, Vaidya VA. Differential regulation of brain derivedneurotrophic factor transcripts by antidepressant treatments in the adult ratbrain. Neuropharmacology 2003;45:553–63.

Dudai. The neurobiology of consolidations or, how stable is the engram? Annu RevPsychol 2002;55:51–86.

Duman RS, Monteggia LM. A neurotrophic model for stress-related mood disorders.Biol Psychiatry 2006;59(12):1116–27.

Einat H, Yuan P, Gould TD, Li J, Du J, Zhang L, et al. The role of the extracellular signal-regulated kinase signaling pathway in mood modulation. J Neurosci 2003;23(19):7311–736.

Ellingrod VL, Perry PJ. Venlafaxine: a heterocyclic antidepressant. Am J Hosp Pharm1994;51(24):3033–46. (Review).

Ennaceur A, Aggleton JP. The effects of neurotoxic lesions of the perirhinal cortex com-bined to fornix transection on object recognition memory in the rat. Behav BrainRes 1997;88:181–93.

Flament MF, Lane RM, Zhu R, Ying Z. Predictors of an acute antidepressant response tofluoxetine and sertraline. Int Clin Psychopharmacol 1999;14(5):259–75.

Flood JF, Cherkin A. Fluoxetine enhances memory processing inmice. Psychopharmacology(Berl) 1987;93(1):36–43.

Friedman EH. Fluoxetine and memory impairment. J Am Acad Child Adolesc Psychiatry1994;33:763.

Fumagalli F, Molteni R, Calabrese F, Frasca A, Racagni G, Riva MA. Chronic fluoxetineadministration inhibits extracellular signal-regulated kinase 1/2 phosphorylationin rat brain. J Neurochem 2005;93(6):1551–60.

Gooney M, Messaoudi E, Maher FO, Bramham CR, Lynch MA. BDNF-induced LTP indentate gyrus is impaired with age: analysis of changes in cell signaling events.Neurobiol Aging 2004;25(10):1323–31.

Hansen HH, Rantamäki TP, Larsen MH, Woldbye DP, Mikkelsen JD, Castrén EH. Rapidactivation of the extracellular signal-regulated kinase 1/2 (ERK1/2) signaling path-way by electroconvulsive shock in the rat prefrontal cortex is not associated withTrkB neurotrophin receptor activation. Cell Mol Neurobiol 2007;27(5):585–94.

Hu H, Real E, Takamiya K, KangMG, Ledoux J, Huganir RL, et al. Emotion enhances learningvia norepinephrine regulation of AMPA-receptor trafficking. Cell 2007;131(1):160–73.

Huang SC, Tsai SJ, Chang JC. Fluoxetine-induced memory impairment in four familymembers. Int J Psychiatry Med 2004;34:197–200.

Iceta R, Mesonero JE, Alcalde AI. Effect of long-term fluoxetine treatment on the humanserotonin transporter in Caco-2 cells. Life Sci 2007;80(16):1517–24.

Izquierdo I, Bevilaqua LRM, Rossato JI, Bonini J, Medina JH, Cammarota M. Differentmolecular cascades in different sites of the brain control consolidation. TrendsNeurosci 2006;29:496-505Y.

Izquierdo I, Bevilaqua LR, Rossato JI, da Silva WC, Bonini J, Medina JH, et al. The molecularcascades of long-term potentiation underlie memory consolidation of one-trialavoidance in the CA1 region of the dorsal hippocampus, but not in the basolateralamygdala or the neocortex. Neurotox Res 2008;14(2–3):273–94. (Review).

Joss JD, Burton RM, Keller CA. Memory loss in a patient treated with fluoxetine. AnnPharmacother 2003;37:1800–3.

Kelly A, Laroche S, Davis S. Activation of mitogen-activated protein kinase/extracellularsignal-regulated kinase in hippocampal circuitry is required for consolidation andreconsolidation of recognition memory. J Neurosci 2003;23(12):5354–60.

Klein D, Brown TS. Exploratory behavior and spontaneous alternation in blind andanosmic rats. J Comp Physiol Psychol 1969;68(1):107–10.

Kulkarni SK, Dhir A. Effect of various classes of antidepressants in behavioral paradigmsof despair. Prog Neuropsychopharmacol Biol Psychiatry 2007;31:1248–54.

Machado DG, KasterMP, Binfaré RW, DiasM, Santos AR, Pizzolatti MG, et al. Antidepressant-like effect of the extract from leaves of Schinus molle L. inmice: evidence for the involve-ment of the monoaminergic system. Prog Neuropsychopharmacol Biol Psychiatry2007;31(2):421–8.

Mattson MP, Maudsley S, Martin B. BDNF and 5-HT: a dynamic duo in age-relatedneuronal plasticity and neurodegenerative disorders. Trends Neurosci2004;27(10):589–94.

McGaugh JL. Memory — a century of consolidation. Science 2000;287:248–51.Meeter M, Talamini L, Schmitt JA, Riedel WJ. The effects of 5-HT on memory and the

hippocampus: model and data. Neuropsychopharmacology 2006;31:712–20.Melia KR, Ryabinin AE, Schroeder R, Bloom FE, Wilson MC. Induction and habituation of

immediate early gene expression in rat medial prefrontocortical dendrites: impli-cations for stress-related brain by acute and repeated restraint stress. J Neurosci1994;14:5929–38.

Mendelson SD, Quartermain D, Francisco T, Sherrer A. 5-HT1A receptor agonists induceanterograde amnesia in mice. Eur J Pharmacol 1993;236:177–82.

Mirow S. Cognitive dysfunction associated with fluoxetine. Am J Psychiatry 1991;148:948–9.

Moyano S, Del Río J, Frechilla D. Role of hippocampal CaMKII in serotonin 5-HT (1A)receptor-mediated learning deficit in rats. Neuropsychopharmacology 2004;29:2216–24.

Nibuya M, Morinobu S, Duman RS. Regulation of BDNF and trkB mRNA in rat brain bychronic electroconvulsive seizure and antidepressant drug treatments. J Neurosci1995;15:7539–47.

Nowakowska E, Kus K. Antidepressant and memory affecting influence of estrogen andvenlafaxine in ovariectomized rats. Arzneimittelforschung 2005;55(3):153–9.

Porsolt RD, Bertin A, Jalfre M. Behavioral despair in mice: a primary screening test forantidepressants. Arch Int Pharmacodyn Ther 1977;229:327–36.

Qi X, Lin W, Li J, Li H, Wang W, Wang D, et al. Fluoxetine increases the activity ofthe ERK-CREB signal system and alleviates the depressive-like behavior in ratsexposed to chronic forced swim stress. Neurobiol Dis 2008;31(2):278–85.

Redrobe JP, Bourin M, Colombel MC, Baker GB. Dose-dependent noradrenergic andserotonergic properties of venlafaxine in animal models indicative of antidepressantactivity. Psychopharmacology (Berl) 1998;138(1):1–8.

Reymann KG, Frey JU. The late maintenance of hippocampal LTP: requirements, phases,‘synaptic tagging’, ‘late associativity’ and implications. Neuropharmacology2007;52:24–40.

Siepmann T, Mueck-Weymann M, Oertel R, Kirch W, Pittrow D, Siepmann M. Theeffects of venlafaxine on cognitive functions and quantitative EEG in healthyvolunteers. Pharmacopsychiatry 2008;41(4):146–50.

Steru L, Chermat R, Thierry B, Simon P. The tail suspension test: a new method forscreening antidepressants in mice. Psychopharmacology 1985;85:367–70.

Sweatt JD. The neuronal MAP kinase cascade: a biochemical signal integration systemsubserving synaptic plasticity and memory. J Neurochem 2001;76(1):1-10.(Review).

Tardito D, Perezm J, Tiraboschi E, Musazzi L, Racagni G, Popoli M. Signaling pathwaysregulating gene expression, neuroplasticity, and neurotrophic mechanisms in theaction of antidepressants: a critical overview. Pharmacol Rev 2006;58:115–34.

Valluzzi JA, Chan K. Effects of fluoxetine on hippocampal-dependent and hippocampal-independent learning tasks. Behav Pharmacol 2007;18(5–6):507–13.

Van Riezen H, Leonard BE. Effects of psychotropic drugs on the behaviour and neuro-chemistry of olfactory bulbectomized rats. Pharmacol Ther 1990;47:21–34.

Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, et al. Accuratenormalization of real-time quantitative RT-PCR data by geometric averaging ofmultiple internal control genes. Genome Biol 2002;3(7). (RESEARCH0034).

Winder DG, Martin KC, Muzzio IA, Rohrer D, Chruscinski A, Kobilka B, et al. ERK plays aregulatory role in induction of LTP by theta frequency stimulation and its modula-tion by beta-adrenergic receptors. Neuron 1999;24(3):715–26.

Wong ML, Licinio J. Research and treatment approaches to depression. Nat RevNeurosci 2001;2(5):343–51. (Review).

Yamada K, Nabeshima T. Brain-derived neurotrophic factor/TrkB signaling in memoryprocesses. J Pharmacol Sci 2003;91(4):267–70.

Yan Z, Feng J, Fienberg AA, Greengard P. D2 dopamine receptors induce mitogen-activated protein kinase and cAMP response element-binding protein phosphory-lation in neurons. Neurobiology 1999;96:11607–12.