Cytokine Signaling Plays Central Roles in the Initiation of ...
-
Upload
khangminh22 -
Category
Documents
-
view
2 -
download
0
Transcript of Cytokine Signaling Plays Central Roles in the Initiation of ...
Cytokine Signaling Plays Central Roles in the Initiation of Limb Regeneration
CitationTsai, Stephanie. 2019. Cytokine Signaling Plays Central Roles in the Initiation of Limb Regeneration. Doctoral dissertation, Harvard University, Graduate School of Arts & Sciences.
Permanent linkhttp://nrs.harvard.edu/urn-3:HUL.InstRepos:42029559
Terms of UseThis article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http://nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of-use#LAA
Share Your StoryThe Harvard community has made this article openly available.Please share how this access benefits you. Submit a story .
Accessibility
Cytokine signaling plays central roles in the
initiation of limb regeneration
A dissertation presented
by
Stephanie Tsai
to
The Department of Molecular and Cellular Biology
in partial fulfillment of the requirements
for the degree of
Doctor of Philosophy
in the subject of
Biology
Harvard University
Cambridge, Massachusetts
April 2019
iii
Dissertation Advisor: Professor Douglas A. Melton Stephanie Tsai
Cytokine signaling plays central roles in the initiation of limb regeneration
Abstract
Newts and salamanders possess the unique ability amongst vertebrates to
regenerate their limbs. While mammals respond to limb amputations with a scarring
response, salamanders instead form an undifferentiated cellular structure distal to the
amputation plane known as the blastema, which eventually differentiates into a new
limb. Formation of the blastema is a complex process requiring coordinated migration
and proliferation of progenitors derived from many tissues (muscle, bone, connective
tissue etc.) and the exact molecular mechanisms underlying the initiation of this process
remain unknown.
Here, we have elucidated the distinct transcriptional programs that are active in
blastemal progenitors as well as the surrounding tissues during early stages of
regeneration. These analyses suggested that dividing progenitors selectively establish
an autocrine TGF- signaling network and further revealed the enriched expression of
several cytokines, indicating progenitors may play an immunomodulatory role.
Functional analyses of the role of one such cytokine, interleukin-8 (il-8), indeed led us to
discover that blastemal progenitors are immunomodulators during early stages of
regeneration through interleukin-8/cxcr-1/2 signaling.
We also examined how these gene expression programs change when we
prevented the formation of the wound epidermis, an important epithelial support
structure for blastema formation. Our data suggest that the early wound epidermis plays
iv
a large role in modulating inflammation, ECM degradation, and tissue histolysis. These
analyses further identified the decreased expression of one growth factor cytokine,
midkine (mk), in the absence of the wound epidermis. Gain- and loss-of-function
analyses of mk during limb regeneration revealed that it is a critical regulator of wound
epidermis maturation during blastema formation. Altogether, these studies emphasize
the importance of cytokine signaling in the initiation of limb regeneration and provide the
field with resources that may lead to the discovery of more putative regulators of
blastema formation.
v
Table of Contents Title page………………………………………………................................………………............................ i Copyright………………………………………………................................………………............................ ii Abstract………………………………………………................................……………….............................. iii Table of contents………………………………………………................................………………..............v List of Figures………………………………………………..........................................….........................viii List of Tables………………………………………………................................……………….................... xi Abbreviations………………………………………………............................................…………..............xii Acknowledgements………………………………………………................................…………..............xiii Dedication ………………………………………………........................................................................... xvii Epigraph……………………………………………….............................................................................. xviii Chapter 1 Introduction………………………………………………………………............................ 1 1.1. Introduction to the Mexican axolotl…………………………………………........... 2 1.2. Structure of the axolotl limb………………………………………...…….................. 5 1.3. Stages of limb regeneration………………………………………………….............. 5 1.4. The heterogeneous cellular origins of the blastema……………………...... 8 1.5. Essential components for successful blastema formation………….......10 1.5.1. Nerve dependence……………………………………………………................. 10 1.5.2. Wound epidermis/AEC………………………………………………................. 11 1.5.3. Injury………………………………………………………………….........................14 1.6. Immunological influences on regeneration....................................................... 16 1.7. Topics addressed in this dissertation……………...………..…………….............. 19 1.8. References………………………………………………………........................................... 20 Chapter 2 Transcriptional profiles of early regenerating limb tissues................... 28 2.1. Preface……………………………………………………………………………...................... 29 2.2. Abstract…………………………………………………………………………....................... 29 2.3. Introduction……………………………………………………………………...................… 30 2.4. Results.............................................................................................................................. 32 2.3.1. Transcriptional profiling of dividing cells during the initiation of limb regeneration……………………………………………………................…32 2.3.2. Growth factor signaling pathways are largely repressed within regenerating stump tissues……………………………………….................. 36 2.3.3. The transcriptional landscape of early dividing cells indicates roles in shaping the blastemal niche....................................................... 38 2.5. Discussion...................................................................................................................... 41 2.6. Materials and methods.............................................................................................. 43 2.7. References...................................................................................................................... 48 Chapter 3 Blastemal progenitors modulate immune signaling during early limb regeneration..................................................................................................... 55 3.1. Preface.............................................................................................................................. 56 3.2. Abstract............................................................................................................................ 56
vi
3.3. Introduction.................................................................................................................... 56
3.4. Results.............................................................................................................................. 59 3.4.1. Interleukin-8 (il-8) is expressed in early blastemal progenitors........ 59 3.4.2. IL-8 is sufficient to induce myeloid cell recruitment and proliferation in bone/perichondrium and epidermis in non- regenerating limbs......................................................................................... 61 3.4.3. Knockdown of IL-8 results in delayed blastemal outgrowth and regeneration............................................................................................66 3.4.4. IL-8 knockdown leads to defective retention of myeloid cells during the wound healing transition to blastema formation...............68 3.4.5. CXCR-1/2 signaling is necessary for limb regeneration......................70 3.5. Discussion....................................................................................................................... 74 3.6. Materials and methods................................................................................................76 3.7. References.......................................................................................................................81 Chapter 4 Wound epidermis-dependent transcriptional programs during early limb regeneration.......................................................................................... 86 4.1. Preface.............................................................................................................................. 87 4.2. Abstract............................................................................................................................ 87 4.3. Introduction.....................................................................................................................88 4.4. Results.............................................................................................................................. 90 4.4.1. Full skin flap sutured limbs exhibit divergent transcriptional profiles from normal regenerating limbs................................................... 90 4.4.2. Early dividing cells fail to activate key signaling pathways in the absence of the wound epidermis.................................................... 93 4.4.3. Non-dividing cells in regenerating stump tissues display aberrant inflammation and extracellular matrix (ECM) regulation profiles........................................................................................... 96 4.4.4. Full thickness epidermis exhibits dysregulation of transcripts involved in cell proliferation, inflammation, and ECM regulation.....100 4.5. Discussion.....................................................................................................................103 4.6. Materials and methods.............................................................................................107 4.7. References.................................................................................................................... 108 Chapter 5 Midkine (mk) regulates the wound epidermis-to-AEC transition........112 5.1. Preface............................................................................................................................113 5.2. Abstract..........................................................................................................................113 5.3. Introduction.................................................................................................................. 114 5.4. Results............................................................................................................................ 114 5.4.1. Midkine is strongly expressed in the basal layers of the wound epidermis and connective tissue blastemal progenitors..... 114 5.4.2. Chemical inhibition of mk inhibits limb regeneration..........................119 5.4.3. iMDK-treatment impairs wound epidermis maturation...................... 121 5.4.4. iMDK-treated limbs display persistant inflammatory profiles and dysregulated wound epidermis gene expression.......................124 5.4.5. Midkine F0 mutants have delayed blastemal outgrowth and
vii
impaired wound epidermis maturation...................................................128 5.4.6. Overexpression of mk during regeneration leads to uncontrolled wound epidermis growth................................................... 131
5.4.7. Sdc-1 is expressed in the wound epidermis........................................ 132 5.5. Discussion.................................................................................................................... 135 5.6. Materials and methods.............................................................................................138 5.7. References.................................................................................................................... 143 Chapter 6 Conclusions and future perspectives............................................................147 6.1. Revealing mechanisms of blastema formation is essential to understanding limb regeneration....................................................................148 6.2. Early transcriptional programs of blastemal progenitors...........................150 6.3. Inflammation, ECM regulation, and tissue histolysis are likely regulated by the wound epidermis................................................... 152 6.4. Blastemal progenitors as early immunomodulators................................... 153 6.5. Regulators of early wound epidermis to AEC maturation......................... 155 6.6. New frontiers and future perspectives for the field........................................157 6.6.1. Exploring the roles of unannotated genes in salamander regeneration..................................................................................................157 6.6.2. Cell-type specific roles in blastema formation......................................158 6.6.3. Genetic regulatory mechanisms of key genes.....................................159 6.7. Concluding remarks.................................................................................................. 159 6.8. References.................................................................................................................... 160 Appendix............................................................................................................................................. 165 A.1. Supplemental materials for Chapter 2.............................................................. 166 A.2. Supplemental materials for Chapter 3...............................................................178 A.3. Supplemental materials for Chapter 4...............................................................180 A.4. Supplemental materials for Chapter 5...............................................................189
viii
List of Figures Chapter 1 1.1. Introduction to the axolotl and limb regeneration……………………..................................... 4 1.2. Stages of blastema development………………………………………........................................ 7 Chapter 2 2.1. Technical validation of FACS-method to purify 4N and 2N fractions from regenerating stump tissue………………………………………................................................... 34 2.2. Transcriptional profiles of dividing, non-dividing, and wound epidermal cells reveal fold change enrichment of well-known early regeneration genes.......... 35 2.3. Growth factor signaling pathways are inhibited in regenerating stump tissues........ 37 2.4. Identification of highly enriched transcripts in dividing cells during early regeneration........................................................................................................................40 Chapter 3 3.1. Il-8 is strongly expressed in blastemal progenitors during early stages of limb regeneration......................................................................................................................... 60 3.2. Il-8 induces recruitment of monocytes and granulocytes in intact limbs......................63 3.3. Il-8 is sufficient to induce proliferation of bone/perichondrial cells and epidermis................................................................................................................................65 3.4. Il-8 knockdown results in delayed blastemal outgrowth and regeneration................. 67 3.5. Il-8 knockdown results in defective retention of myeloid cells during the transition from wound healing into blastema formation. .................................................. 69 3.6. Cxcr-1/2 is expressed in subsets of monocytes and granulocytes............................... 70 3.7. Early CXCR-1/2 signaling is necessary for limb regeneration........................................71 3.8. CXCR-1/2 inhibition impacts myeloid cell survival during early limb regeneration.................................................................................................................................. 73
ix
Chapter 4 4.1. Suturing full thickness skin over the amputation plane prevents wound epidermis formation.....................................................................................................................91 4.2. Schematic of transcriptional profiling experiment in the presence and absence of the wound epidermis.............................................................................................................. 92 4.3. PCA analysis of normal and full skin flap sutured limb samples................................... 93 4.4. Early dividing cells exhibit minor differences in transcriptional profiles in the absence of the wound epidermis..................................................................................... 95 4.5. Inflammation and ECM regulation in stump-derived non-dividing cells are heavily affected in the absence of the wound epidermis................................................. 98 4.6. Wound epidermis and full skin flap sutured skin exhibit transcriptional differences in inflammation, ECM regulation, and cell proliferation............................ 106 Chapter 5 5.1. Normalized transcripts per million (TPM) levels of midkine (mk) in regenerating and full skin flap conditions.....................................................................................................115 5.2. Mk is strongly expressed in the basal layers of the wound epidermis/AEC and connective tissue blastemal progenitors.............................................................................116 5.3. MK protein localization during limb regeneration............................................................. 118 5.4. Chemical inhibition of mk prevents limb regeneration.................................................... 120 5.5. iMDK treatment does not affect early induction of proliferation in limb regeneration................................................................................................................................ 122 5.6. iMDK-treated limbs exhibit an abnormally thin wound epidermis and increased levels of cell death.....................................................................................................................123 5.7. Treatment with iMDK leads to dysregulation of wound epidermis gene expression and persistent inflammation............................................................................. 126 5.8. iMDK-treated limbs exhibit higher levels of monocytes................................................. 127 5.9. Mk knockout animals exhibit delayed blastema formation............................................ 129 5.10. Mk mutants exhibit an abnormally thin wound epidermis............................................130
x
5.11. Mk mutants display a mild increase in the levels of monocytes................................ 131 5.12. Overexpression of mk in regenerating limbs leads to uncontrolled growth of the wound epidermis......................................................................................................... 133 5.13. Sdc-1 is expressed in normal skin and the wound epidermis during limb regeneration..............................................................................................................................134 Appendix A.1.1. Immune signaling pathways are predominantly activated in the wound epidermis and non-dividing cells...................................................................................... 177 A.2.1. Validation of the il-8 overexpression construct and il-8 morpholino knockdown.............................................................................................................................. 178 A.2.2. IL-8 morpholino knockdown does not affect blastemal cell or wound epidermis proliferation......................................................................................................... 179 A.4.1. Mk is not expressed in monocytes................................................................................... 193 A.4.2. Validation of custom polyclonal rabbit anti-MK antibody........................................... 193 A.4.3. PCA analysis of DMSO and iMDK samples.................................................................. 194 A.4.4. Mk targeting strategy for mk mutant generation.......................................................... 194 A.4.5. Validation of pCAG-MK overexpression construct...................................................... 195
xi
List of Tables Appendix A.1.1. Table of Ingenuity Pathway Analysis (IPA) Z-scores for Immune Signaling Pathways.................................................................................................................................166 A.1.2. Table of Ingenuity Pathway Analysis (IPA) Z-scores for Developmental Growth Factor and Intracellular Signaling Pathways................................................. 167 A.1.3. Blastemal-progenitor enriched transcripts......................................................................168 A.3.1. Top 100 differentially expressed transcripts in stump-derived dividing cells of full skin flap sutured limbs............................................................................................. 180 A.3.2. Top 100 differentially expressed transcripts in stump-derived non-dividing cells of full skin flap sutured limbs................................................................................... 183 A.3.3. Top 100 differentially expressed transcripts in epithelial cells of full skin flap sutured limbs......................................................................................................... 186 A.4.1. Top 100 differentially expressed genes in DMSO/iMDK treatments...................... 189 A.4.2. Select enriched pathways in iMDK-treated limbs.........................................................192 A.4.3. Select enriched pathways in DMSO-treated limbs...................................................... 192
xii
Abbreviations AAALAC, Assessment and Accreditation of Laboratory Animal Care AEC, apical epithelial cap AER, apical ectodermal ridge AGSC, Ambystoma genetic stock center cxcr-1/2, C-X-C Motif Chemokine Receptor ½ DMSO, Dimethyl sulfoxide
Dpa, Days post-amputation EdU, 5-ethynyl-2'-deoxyuridine ECM, extracellular matrix EMT, Epithelial-mesenchymal transition FACS, Fluorescence-activated cell sorting FSF, Full skin flap
FGF, Fibroblast growth factor GFP, Green fluorescent protein GO, Gene Ontology Hpt, hours post-transfection HUGO, Human Gene Nomenclature Committee IACUC, Institutional Animal Care and Use Committee il-8, interleukin-8 IPA, Ingenuity Pathway Analysis iMDK, 3-(2-(4-Fluorobenzyl)imidazo[2,1-b]thiazol-6-yl)-2H-chromen-2-one mk, midkine MO, morpholino NCAE, Naphthol AS-D Chloroacetate NGF, Nerve growth factor NO, Nitric oxide
NSE, -Naphthyl Acetate ROS, Reactive oxygen species PBS, Phosphate buffered saline PCA, Principal components analysis ptprz, Protein Tyrosine Phosphatase, Receptor Type Z1
PPAR, Peroxisome proliferator-activated receptor
RXR, Retinoic acid receptor RXR-alpha
SB-225002, N-(2-Bromophenyl)-N'-(2-hydroxy-4-nitrophenyl)urea
sgRNA, Single guide RNA shh, Sonic hedgehog sdc-1, Syndecan-1 tdT, tdTomato
TGF-, Transforming growth factor TLR, Toll-like receptor TPM, transcripts per million TUNEL, Terminal deoxynucleotidyl transferase dUTP nick end labeling VEGF, Vascular endothelial growth factor WE, Wound epidermis YFP, Yellow fluorescent protein
xiii
Acknowledgements
I would like to take this opportunity to thank everyone who has supported me
throughout the course of my PhD and scientific career. First and foremost, I would like to
thank Doug for his continued mentorship and guidance over my entire PhD. I have felt
incredibly lucky to have had him as my PhD advisor and could not have asked for a more
supportive mentor. Throughout the course of my PhD, Doug has given me the freedom
to pursue all of my experimental ideas, even if they did not ultimately pan into successful
projects. He has also taught me to think critically about designing and interpreting results
of experiments. I know that throughout the rest of my scientific career, I will always be
asking myself the question: “How can I be wrong? What are alternative explanations for
these results?” With his guidance over the years, I know that I have grown into a more
independent and critical scientist and I can only hope to aspire to one day become as
great of a scientist as him. Science aside, Doug is one of the most compassionate people
that I know, and always cares about the personal well-being of everyone in the lab. I will
definitely miss having regular conversations with him not just about science and my
career, but also about life in general.
I would also like to thank the members of my committee. Cliff has been a mentor
to me since my undergraduate years in his lab, and has been a great advisor in the fields
of limb development and regeneration. Cassandra has also provided valuable career
advice and support throughout the course of my projects. Finally, Jessica has been an
important scientific mentor to me since my years as an MIT undergrad in Cliff’s lab.
Working closely with her as an undergrad on axolotls, she taught me a lot about the limb
regeneration field. Over the years, she has continued to provide valuable career guidance
xiv
and scientific input on my projects over my PhD and her enthusiasm about salamander
limb regeneration and science in general is always energizing.
Next, I was incredibly lucky to have the opportunity to work with a very talented
undergraduate, Clara Baselga-Garriga, over the last two and a half years. Clara always
comes to lab with a smile and ready to work. She has basically been my partner in crime
on the midkine project in particular and I cannot begin to describe what a pleasure it has
been to mentor her during her time in the Melton lab. She has always reminded me that
science is more fun when working with others. Bonding over late nights and early
mornings injecting eggs to make axolotl mutants, getting excited over results, having
intense experimental discussions, and also just talking about life in general. I’ll really miss
working with her. To see her grow scientifically over the time we have spent together has
been really rewarding and I am proud of all of she has achieved. I know she will be a
famous doctor/writer some day! I look forward to the day when I can ask for her autograph.
The Melton lab has also been an incredible environment to work in over the last
five years and I owe a lot of the successes in my PhD to the support from all of the lab
members. Even though I am the only person who works with axolotls, I have always had
immense support from all of the many past and present members of the lab and I’d like
to thank them all. I would like to specially thank several lab mates who helped me a lot
through my PhD. José has been my main go-to person for scientific insight, questions,
and funny anecdotes. Not only is he super knowledgeable about classical methods in
biology, but his daily jesting always brightens my days in the lab. Edwin has been an
amazing bay mate over the years and his laugh ironically always makes me laugh as well.
I always enjoy having scientific and life discussions with him. Jeff in particular has also
xv
been a great friend throughout graduate school and one of the most thorough scientists
that I know. Coffee breaks with both Jeff and Edwin over the years have been one of my
favorite past times. Ronny and I will always be the first to flock to free food as if we have
a special sense of smell if it’s free. I am also looking forward to our future matchups and
trades in Fantasy Football. Joking aside, Ronny has also been an amazing influence on
me as a scientist, and the high standards that he holds himself to as a scientist are
inspirational. Nadav is one of the most critical scientists I know in the lab, and he has
always provided good input on my projects. In addition, I enjoy hearing about all of the
fun facts and anecdotes he has to share. Jenny has also been an amazing help when it
comes to literally anything in the lab whether its ordering or animal-related. Her smile and
laugh is contagious. Elad has also been a great person to talk to about science, life and
our careers. Some past members of the lab who supported me throughout my PhD who
I’d also like to thank are Quinn Peterson, George Kenty, Danny Ben-Zvi, Dani Swain, Chi-
Yang Chen, and David Gonzalez. I am also very grateful to those who have helped me
with setting up the axolotl facility and also caring for the axolotls over the years: Isaac,
Lauren, Eny, Mimi, Sergio, Quang, and Joe Vaughn.
Aside from my lab, I’d like to thank my friends who have been a main block of
support throughout my PhD. In particular, I’d like to thank my graduate classmates in the
MCO program, who have made this an unforgettable experience. In particular, Shristi,
Denise, Haneui, Vika, Jenelle, and Brenda, for their amazing friendship and support over
the years. So many great memories. My long-time roommates, Denise and Jocelyn, have
also been my support beams for my PhD. Grad school would not have been nearly as fun
without my roomies! I’d like to also thank my best friend in college, Sharon, for her support
xvi
and friendship over the years. Lastly, I am grateful to previous members of the Arlotta lab
including Ryoji, for his friendship and guidance in the axolotl field as well as my scientific
career over the years, and Dennis, for a fun first few years working on axolotls together
in the lab.
Importantly, I’d like to thank my mom, dad, and brother, Victor, who have provided
me with every opportunity since I was young and have supported me on this amazing
journey. From driving me to Kentucky to work on axolotls over the summer to now
completing my PhD. Words cannot describe how much their support and love means.
They’ve always inspired me to pursue my dreams and I really owe all of my successes to
them. I hope that I have made them proud.
Finally, I’d like to thank my amazing boyfriend Joe, who has been my superman
throughout my PhD. Not only has he been an inspiration scientifically to me, but I feel as
though we have grown together over the course of our PhDs. Whenever times were
tough, he was my rock and kept me grounded. I could not have asked for a better person
to share this success with.
xviii
“If I set out to prove something I am no real scientist-- I have to learn to follow where the facts lead me-- I have to learn to whip my prejudices...” ― Lazzaro Spallanzani
Chapter 1 Introduction
Since it was first reported in the 18th century by Lazzaro Spallanzani (Spallanzani,
1768), salamander limb regeneration has fascinated scientists for centuries. Why humans
lack the ability to similarly accomplish such a complex biological feat despite the striking
anatomical resemblance between human and salamander limbs remains a longstanding
enigma. While mammals traditionally respond to limb amputation with a scarring
response, salamanders respond by forming a new cellular structure distal to the
amputation plane known as the blastema. How this structure forms lies at the heart of the
limb regeneration field and elucidating the molecular mechanisms underlying the initiation
of blastema formation may direct our efforts to potentially stimulate regenerative potential
in humans.
2
1.1. Introduction to the Mexican axolotl
In the lab, we have utilized the Mexican axolotl (Ambystoma mexicanum) as the
model organism to study salamander limb regeneration. This diploid urodele amphibian
species is endemic to the canals of Lake Xochimilco in the outskirts of the modern-day
Mexico City. Once a staple in the Aztec diet hundreds of years ago, axolotls are now
mostly utilized for research purposes in developmental and regenerative biology. While
most other salamander species undergo metamorphosis and become terrestrial, axolotls
are naturally neotenic, remaining in a larval aquatic state throughout their lifespan and
retaining juvenile bodily features including gills. However, axolotls retain the ability to
undergo metamorphosis experimentally if injected or immersed with the hormone
thyroxine (Page et al., 2008; Page et al., 2009; Khattak et al., 2014a) and others have
applied these methods to study differences in regenerative capabilities pre- versus post-
metamorphosis (Monaghan et al., 2014).
The most commonly used axolotl strain is the white leucistic strain (d/d). White
axolotls contain an unknown recessive mutation that disrupts pigment cell migration and
development during embryogenesis, which leads to a pale pink appearance (Figure 1.1A)
(Woodcock et al., 2017). The lack of pigment cells allows for reduced autofluorescence
and easy visualization in live imaging or immunofluorescence studies. In addition to white
mutants, wild-type pigmented (dark green appearance) and albino (light yellow
appearance) axolotls also exist, however, these strains still harbor various pigment-
producing cell types (known as melanophores, xanthophores, and/or iridophores) that
contribute to autofluorescence throughout the animal, making white axolotls the preferred
strain in research studies.
3
Over the last couple of decades, the axolotl has become the most widely utilized
salamander for research studies due to increased genetic and technical tractability
(Khattak et al., 2014a) compared to other salamander species. Axolotls breed year-round
with ease in the laboratory setting and generate large clutches of fertilized eggs (typically
at least 300 eggs). In fact, the major populations of axolotls in the world are all bred in
captivity, as their numbers in the wild are quickly declining. Moreover, the development
and optimization of germline transgenesis methods in the axolotl over the last decade via
CRISPR (Flowers et al., 2014; Fei et al., 2018), Tol2, and I-sceI meganuclease-mediated
transgenesis (Khattak et al., 2014a), as well as inducible genetic systems (Whited et al.,
2012; Khattak et al., 2014b) has made it an attractive model for research purposes.
Coupled with the recent release of the axolotl genome (Nowoshilow et al., 2018; Smith et
al., 2019), these methods allow for genetic lineage tracing and targeted knock-out/knock-
in studies to functionally test molecular candidates. Moreover, the relatively slow
embryonic development (~6 hours at the 1-cell stage) allows for high penetrance of
mutations via injection of targeted Cas9-ribonucleoprotein (Cas9-RNP) complexes into
fertilized eggs (Fei et al., 2018), allowing phenotyping to occur in the F0 generation and
offsetting the challenges associated with their long generation time (10-12 months).
Various viral infection and plasmid electroporation methods have also been developed
for use in molecular gain-of-function studies (Khattak et al., 2013; Whited et al., 2013;
Oliveira et al., 2018). Altogether, these techniques have opened the doors for detailed
molecular genetic studies in the axolotl.
4
Figure 1.1. Introduction to the axolotl and limb regeneration.
(A) An image of an adult white leucistic (d/d) axolotl adapted from Learn, 2019. (B) A
diagram depicting the anatomy of an axolotl forelimb. The solid lines denote the plane of
amputation used for all experiments within this dissertation. (C) Stages of limb
regeneration depicting the time scale of wound healing, blastema formation, and re-
differentiation stages. This figure was adapted from McCusker et al. (2015).
5
1.2. Structure of the axolotl limb
Axolotls are tetrapod vertebrates with limbs that resemble those of humans
anatomically, containing similar skeletal structures and tissues (e.g. muscle, bone,
cartilage, connective tissues etc.). Fore- and hindlimbs can be divided into three regions
proximodistally based on the residing skeletal structures: the stylopod, zeugopod, and
autopod (Figure 1.1B). The stylopod encompasses the upper-limb long bones, either the
humerus or femur in the fore- or hindlimb, respectively. The zeugopod contains the two
long bones in the forearm or lower leg skeletal structures, known as the radius/ulna or
tibia/fibula in the fore- or hindlimb, respectively. Finally, the autopod is the most distal
segment and contains all of the bones that construct the hands or feet. These include the
carpals, metacarpals, and phalanges in the forelimb and tarsals, metatarsals, and
phalanges in the hindlimb. Axolotl forelimbs and hindlimbs have four and five digits,
respectively. In the salamander limb regeneration field, researchers generally perform
amputations at either the mid-humerus/femur (known as a proximal amputation) or the
mid-radius/ulna or -tibia/fibula (known as a distal amputation). All of the amputations
performed in the studies presented within this dissertation were distal amputations.
1.3. Stages of limb regeneration
Limb regeneration can be divided into three phases: wound healing, blastema
formation, and re-differentiation (Figure 1.1C, Figure 1.2) (McCusker et al., 2015). Briefly,
wound healing occurs during the first 3 to 7 days post-amputation (dpa). Immediately
post-amputation, epithelial cells quickly migrate over the exposed amputation plane to
form a thin wound epidermis in as little as 12 hours post-amputation. Formation of the
6
wound epidermis is followed by immediate inflammatory responses mediated primarily by
the innate immune system in response to injury and the beginnings of extracellular matrix
degradation. Following wound healing, progenitors derived from many different tissues in
the limb (e.g. muscle, connective tissues etc.) (Kragl et al., 2009) re-enter the cell cycle,
migrate to the amputation plane, and proliferate locally to form the blastema, the hallmark
structure of limb regeneration. Blastema formation is tightly coupled with histolysis of
tissues at the amputation plane (e.g. myofibers and bone/cartilage) and deposition of pro-
regenerative extracellular matrix molecules including tenascin (Seifert et al., 2012).
Concomitantly, the wound epidermis thickens to form an epithelial cap structure called
the apical epithelial cap (AEC). This thickening is primarily attributed to proliferation of
epithelial cells in the periphery and subsequent migration towards the amputation plane
(Repesh and Oberpriller, 1978). The AEC is necessary for successful limb regeneration
and secretes mitogens that maintain blastemal cell proliferation (Thornton, 1957; Boilly
and Albert, 1990). Blastema development occurs over 1-4 weeks depending on the age
of the animal and the stage of regeneration is defined by the size of the blastema (e.g.
early, medium, and late bud blastema stages). Over the next several weeks, the blastema
will gradually re-differentiates and re-patterns into a new limb. Complete regeneration
takes approximately 4 weeks in younger juvenile animals and 10 weeks in adults. The
work presented in this dissertation is primarily focused on the earliest stages of
regeneration during the transition from wound healing into blastema formation. Blastema
formation takes approximately 2 weeks to occur in most of the animals utilized in these
studies.
7
Figure 1.2. Stages of blastema development.
Blastema formation occurs through many phases. The first phase is wound healing.
Immediately post amputation, epithelial cells migrate quickly over the exposed amputation
plane to form a thin wound epidermis. Immune cells subsequently invade the injured area
in order to respond to pathogen-associated and/or tissue damage-associated cues.
These characteristic immediate inflammatory responses are also coupled with the
beginnings of extracellular matrix (ECM) degradation and tissue histolysis. During the
later stages of wound healing, progenitors derived from many different tissues
(collectively referred to as blastemal progenitors) begin to re-enter the cell cycle and
migrate towards the amputation plane, while wound healing begins to resolve and
immune cells efflux the damaged area. This is followed by localized proliferation at the
distal amputation plane, which gives rise to the blastema. As the blastema forms, the
wound epidermis continually thickens to form the AEC, which is necessary for
regeneration. AEC, apical epithelial cap.
8
1.4. The heterogeneous cellular origins of the blastema
Much of the complexity of limb regeneration lies in the cellular heterogeneity within
the blastema. Researchers previously thought that the blastema was comprised of
pluripotent stem cells based on their homogenous appearance; however, nuclear transfer
experiments of blastema cell nuclei from regenerating axolotl limbs into enucleated X.
laevis eggs did not give rise to cloned animals and provided support against this theory
(Dasgupta, 1970). Decades later, researchers demonstrated that the blastema is instead
comprised of tissue-lineage restricted progenitors by labeling tissues within the axolotl
limb via different regional embryonic transplantation experiments between GFP+ and
GFP- axolotl embryos (Kragl et al., 2009). For example, by transplanting presomitic
mesoderm from GFP+ to GFP- embryos, they achieved GFP labeling of the muscle in the
axolotl limb. Upon amputation, they discovered that only the muscle in the regenerated
limb was GFP+, suggesting that muscle only regenerates itself and no other tissues. Using
this labeling technique, they showed the same lineage restriction occurred for other
tissues including cartilage tissue, epidermis, and Schwann cells. The only tissue that
displayed a higher level of plasticity was the dermis, which contributed to regenerated
cartilage and tendon tissue as well.
More recent studies have elucidated the specific origins of muscle-derived
blastema cells. Sandoval-Guzmán et al. (2014) utilized genetic lineage tracing of mature
muscle fibers to demonstrate different cellular origins for regenerated muscle between
two salamander species, the axolotl and the Eastern spotted newt (Notophthalmus
viridescens). By genetically labeling mature muscle fibers with YFP in both species, they
observed that YFP+ cells contributed to regenerated muscle in newts, but not in the
9
axolotl. These results interestingly suggested different cellular sources and mechanisms
for muscle regeneration in newts and axolotls: dedifferentiation of mature myofibers in
newts versus activation of the resident muscle stem cell population, known as satellite
cells, in axolotls. By performing embryonic somatic mesoderm transplantations as in Kragl
et al. (2009), they achieved GFP labeling of muscle tissue including both the mature
multinucleated fibers and satellite cells. Examination of the blastema of regenerating
limbs from GFP labeled animals revealed that all of the GFP+ cells in the blastema
expressed pax7, a satellite cell marker (von Maltzahn et al., 2013), suggesting that
axolotls regenerate muscle via activation of satellite cells rather than dedifferentiation of
mature muscle myofibers. Lineage tracing of pax7+ cells during axolotl limb regeneration
also confirmed these conclusions (Fei et al., 2017). These studies collectively determined
that satellite cells are the source of regenerated muscle in axolotl limb regeneration.
Aside from muscle, the specific origins of blastema cells derived from other tissues
remain elusive, due to a lack of reliable markers for different cell types within the axolotl
limb. However, recent single cell studies have begun to shed light on these questions by
assessing the cellular heterogeneity within the mature and regenerating limb (Gerber et
al., 2018; Leigh et al., 2018). Unbiased single cell sequencing and computational
pseudotime lineage reconstruction of cell state trajectories from wound healing, early, and
mid-bud stage regenerates suggest that most cell-types exhibit distinct lineage
trajectories. However, synovial fibroblasts, joint, and cartilage cells appear to arise from
a shared progenitor population (Leigh et al., 2018). Additionally, Gerber et al. (2018)
utilized a driver element of the pan-connective tissue marker prrx-1 to label all connective
tissues (Prrx1:Cre-ER;Caggs:lp-Cherry) including tendons, cartilage, and dermal
10
fibroblasts. Single cell analysis and lineage reconstruction of connective tissue
progenitors revealed that cells derived from different types of connective tissues converge
on a similar molecular blastemal cell identity as the blastema forms, and diverge upon re-
differentiation at the end of regeneration. Brainbow clonal lineage labeling of connective
tissue-derived blastemal cells also suggested that this convergent molecular blastemal
cell state is multipotent and capable of giving rise to both skeletal and non-skeletal
connective tissues. Most notably, these studies provide the field with reliable markers for
cell types present within the axolotl limb to more specifically address questions about the
exact cellular sources of the blastema via genetic experimentation in future studies.
1.5. Essential components of successful limb regeneration
Classical studies have illustrated that salamander limb regeneration requires an
injury, the presence of nerves, and the wound epidermis (Tassava and Mescher, 1975).
Previous studies have suggested that each plays a different role in the process: an injury
is necessary to initiate tissue histolysis and cell cycle re-entry, while nerves and the
wound epidermis are important for the early and later proliferative capacity of blastemal
cells, respectively (Mescher and Tassava, 1975; Tassava and Loyd, 1977). The studies
demonstrating the known roles of each of these components are reviewed below.
1.5.1 Nerve dependence
The nerve dependence of limb blastema formation has been well-known for
centuries (Todd, 1823). Denervation prior to blastema formation hinders regeneration,
whereas denervation post-blastema formation results in normal regeneration,
11
emphasizing the important early influence of nerves on successful regeneration (Singer,
1952; Farkas and Monaghan, 2017). While denervated limbs post-amputation exhibit
many of the same early responses as that of innervated limbs including tissue histolysis
and wound epidermis formation (Schotte and Butler, 1941), they display low levels of
cellular proliferation, which is integral for blastema formation. Moreover, microarray
analyses revealed lower levels of transcripts involved in cell proliferation, axonal
regeneration, and epidermal maturation in denervated limbs (Monaghan et al., 2009). The
importance of nerves on blastema formation led researchers to believe that nerves
secreted a neurotrophic factor crucial for the initial stages of regeneration (Singer, 1952).
To date, some important nerve-derived factors have been identified including Neuregulin-
1 (NRG-1) and Newt Anterior Gradient (NAG) protein (Kumar et al., 2007; Farkas et al.,
2016). Supplementation of NRG-1 or NAG is sufficient to rescue regeneration in
denervated limbs of axolotls or newts, respectively, demonstrating the importance of
these factors. Moreover, this nerve dependence appears to be widely conserved in the
regeneration of many other organ systems in other species as well (Buckley et al., 2012;
Simoes et al., 2014; Mahmoud et al., 2015).
1.5.2. Wound epidermis/AEC
The wound epidermis is a transient epithelial structure that is necessary for
regeneration (Godlewski, 1928; Goss, 1956; Thornton, 1957; Mescher, 1976). The wound
epidermis is distinct from normal skin. Normal non-regenerating skin is comprised of two
layers, the epidermis and dermis (Seifert et al., 2012), and similar to mammalian skin, the
epidermal cells follow an outward differentiation trajectory (Leigh et al., 2018). These two
12
layers are separated by a basement membrane layer called the basal lamina, which acts
as a collagen heavy physical barrier between the skin and the underlying tissues. In
contrast, the wound epidermis is comprised of only an epidermal layer and lacks a basal
lamina. The absence of the basal lamina is thought to allow for signaling between the
wound epidermis and underlying limb tissues, which is necessary for blastema formation
(Mescher, 1976). During wound healing and the initial stages of blastema formation, the
wound epidermis is a thin epithelium, only 1-4 cell layers thick (Salpeter and Singer, 1960;
Singer and Saltpeter, 1961; Campbell and Crews, 2008), formed by proliferating
keratinocytes that migrate radially from the peripheral normal skin to cover the amputation
site. As the blastema forms, the wound epidermis matures into the AEC and thickens
considerably via continued cell proliferation and migration of peripheral keratinocytes.
Considering the major differences in the cellular environment between early and late
stages of limb regeneration, it is likely that the early wound epidermis and the AEC have
discrete functional roles. For instance, the early wound epidermis is exposed to highly
pro-inflammatory conditions associated with early injury-associated immune responses,
in contrast to the AEC, which is not.
Studies during later stages of regeneration post-blastema formation have
demonstrated that the AEC functionally resembles the apical ectodermal ridge (AER)
during limb development by playing similar roles in maintaining cell proliferation and limb
patterning (Boilly and Albert, 1990; Christensen and Tassava, 2000; Han et al., 2001).
Continuous removal of the AEC from the blastema inhibits regeneration (Thornton, 1957)
and co-culturing blastemal cells with protein extract derived from the AEC stimulates
proliferation (Boilly and Albert, 1990). In addition, the AEC expresses important mitogens
13
known to play a role in limb development including FGF-8 (Han et al., 2001; Christensen
et al., 2002), collectively suggesting that the AEC mirrors the developmental roles of the
AER.
While the roles of the AEC have been more defined, the specific functions of the
early wound epidermis are less well known. Preventing the wound epidermis from forming
entirely either by suturing full thickness skin (containing a basal lamina) over the
amputation surface immediately (Godlewski, 1928; Mescher, 1976) or via insertion of the
amputated limb directly into the body cavity (Goss, 1956) inhibits regeneration,
demonstrating the necessity of the early wound epidermis. Interestingly, normal induction
of cell cycle re-entry and some tissue histolysis within non-epidermal stump tissues still
occurs in the absence of the wound epidermis, suggesting that it may not play a major
role in these processes. Nevertheless, signaling molecules secreted from the early wound
epidermis including axolotl MARCKS-like protein (axMLP) (Sugiura et al., 2016) have
been shown to be sufficient to induce cell cycle re-entry in various tissues within axolotl
limbs, indicating it likely still participates in these processes. Furthermore, the early wound
epidermis expresses many matrix metalloproteinases (Yang et al., 1999; Kato et al.,
2003), suggesting it may direct the formation of the pro-regenerative extracellular niche.
The maturation of the early wound epidermis to the AEC is essential for successful
limb regeneration, yet little is known about factors that are important for the maturation
from the early wound epidermis to the AEC. The early wound epidermis becomes heavily
innervated during the first week of regeneration and classical studies suggested that early
innervation was key for the functional maturation to the AEC (Singer, 1949). However,
the demonstration of successful limb regeneration in aneurogenic larvae (Thornton and
14
Steen, 1962) and in limbs in which the innervation of the wound epidermis was prevented
(Sidman and Singer, 1961) suggested that direct innervation may not be important.
Others have suggested that contact between epithelial cells originating from opposing
positions within the limb is key for wound epidermis function and maturation, coined the
positional discontinuity model (Campbell and Crews, 2008). In other words, contact
between epithelial cells from the dorsal and ventral side, or anterior and posterior side of
the limb, is essential for forming a wound epidermis capable of regenerating a limb.
However, contact between epithelial cells from the same position in the limb (ex. anterior
with anterior) will not form a regenerative wound epidermis. This hypothesis was
supported by work that demonstrated that an accessory limb will form in a non-
regenerating limb simply by juxtaposing a generic wound epidermis (from just a skin
wound) on the anterior side of the limb with a posterior piece of skin from the contralateral
limb and deviating a nerve to the wound epidermis. This accessory limb will not form
without the skin graft (Endo et al., 2004), suggesting that positional discontinuity is
important for the generation of a wound epidermis capable of giving rise to a limb.
Understanding the molecular regulation downstream of this discontinuity could help us
gain insights into wound epidermis maturation in future studies.
1.5.3. Injury
Interestingly, the studies delineated above altogether demonstrate that cell cycle
re-entry and tissue dedifferentiation still occur to some extent regardless of the absence
of nerves or wound epidermis (Tassava and Mescher, 1975), suggesting that other more
immediate processes associated with injury are important for initiating regeneration.
15
One such process is hemostasis. Limb amputation is followed by a quick
hemostatic response in which the blood clots in under a minute (Repesh and Oberpriller,
1978). This is a much quicker response than in mammals including humans, which takes
several minutes. Previous in vitro studies determined that newt myotubes re-entered the
cell cycle when cultured in the presence of fetal bovine serum. Co-culturing myotubes in
the presence of a variety of known growth factors such as TGF- and bFGF did not induce
cell cycle re-entry (Tanaka et al., 1997). However, activity-guided fractionation of serum
identified two peaks capable of inducing cell cycle re-entry in newt myotubes: thrombin
and an unidentified thrombin-cleaved product (Tanaka and Brockes, 1998; Tanaka et al.,
1999). Thrombin is an important enzyme that catalyzes the formation of fibrin from
fibrinogen, a necessary step to forming a blood clot. While the cell cycle re-entry activity
of thrombin was serum dependent, the thrombin-cleaved product retained activity without
serum and induced cell cycle re-entry of multinucleated newt myotubes. Furthermore,
murine myotubes did not re-enter the cell cycle in contrast to their newt counterparts
(Tanaka et al., 1997), highlighting potentially fundamental differences between
mammalian and newt responses to injury. To date, researchers have identified two
secreted molecules capable of initiating cell cycle re-entry in the axolotl and newt:
MARCKS-like protein (axMLP) and serum protease cleaved BMP-4/7, respectively
(Sugiura et al., 2016; Wagner et al., 2017).
Others have investigated different aspects of immediate injury-associated
processes in various appendage regeneration models including the production of reactive
oxygen species (ROS) and the dysregulation of natural voltage gradients. Previous
studies have identified the importance of tightly controlled amputation-induced ROS
16
production during the first 24-48 hours post-injury in the zebrafish fin and Xenopus tail
post-amputation (Gauron et al., 2013; Love et al., 2013). These studies demonstrate that
ROS production is essential for proper modulation of important downstream signaling
pathways (ex. Wnt) and cellular processes (ex. apoptosis, leukocyte recruitment). In
addition, researchers have investigated the changes in bioelectric gradients following
amputation in appendage regeneration (McLaughlin and Levin, 2018). Amputation
considerably disrupts the voltage gradient throughout the limb and many studies
perturbing these natural gradients via channel blockers or gradient reversal severely
impaired newt limb regeneration (Borgens, 1982; Jenkins et al., 1996). Altogether, these
studies suggest that more immediate processes associated directly with amputation itself
play important roles in initiating limb regeneration.
1.6. Immunological influences on regeneration Recent decades have elucidated the importance of the immune system on
successful regenerative outcomes across many organ and appendage model systems
(Godwin et al., 2017b). Any injury elicits an immediate immunological response to defend
the organism against potential infectious pathogens that may have entered the body and
to clear cellular debris caused from the damage (Tang et al., 2018). The wound healing
response is common to all vertebrates. However, while mammals typically produce a scar
after wound healing, highly regenerative vertebrates including the salamander exhibit
perfect regeneration. Thus, identifying potential molecular and cellular differences in the
wound healing response between highly- and less- regenerative species may help direct
pro-regenerative outcomes in humans.
17
Wound healing is mediated primarily by the innate immune system, which is
comprised of myeloid cells that circulate throughout the body. Myeloid cells encompass
several different phagocytic cell types including macrophages, which are derived from
precursors known as monocytes, and neutrophils, basophils, and eosinophils, which are
collectively known as granulocytes (Chaplin, 2010). Myeloid cells are most well-known
for their exceptional ability to phagocytose dead cells and debris at the wound. In addition
to the innate immune system, lymphoid cells of the adaptive immune system (T- and B-
cells) also home to the site of injury and mediate specific responses against recognized
antigens as well as the long-term humoral response for future encounters with new
pathogens. While classical immunological roles have been well delineated for both innate
and adaptive immune cells during injury and infection, myeloid cells, T- and B- cells have
been more recently been shown to be important paracrine regulators in development,
regeneration, and tumorigenesis (Aurora and Olson, 2014; Naik et al., 2018).
Furthermore, many of these cell types have also been shown to normally reside in tissues
and mediate homeostatic behaviors of tissues (Naik et al., 2018).
While the axolotl immune system contains all of the myeloid and lymphoid cell-
types present in mammalian species (Lopez et al., 2014), the work of others suggests
that their adaptive immune response is heavily attenuated compared to other amphibians
including Xenopus and fish species (Ching and Wedgwood, 1967). Some have
hypothesized that the complexity of the immune system is inversely correlated with
regenerative capacity (Mescher and Neff, 2005; Mescher et al., 2013), as amphibians
including Xenopus can regenerate their hindlimbs and tails pre-metamorphosis, but lose
their full regenerative capacity post-metamorphosis, once their immune system has
18
matured. Similarly, mammals are capable of regenerating dermal injuries during fetal
stages of development, but also lose this regenerative capacity and form a scar instead
post-natally (Aurora and Olson, 2014). In addition, suppressing the immune system with
immunosuppressants or immune cell depletion is sufficient to stimulate Xenopus tail
regeneration in a non-regenerating developmental period, the refractory period
(Fukazawa et al., 2009), suggesting the immune system is an important mediator of
regeneration. Yet, organisms with highly evolved immune systems including zebrafish are
capable of regenerating many organs and appendages (Trede et al., 2004), suggesting
an added layer of regulatory complexity that may be species-dependent.
Nevertheless, cells from both the innate and adaptive immune system are present
in early regenerating limb tissues and continue to reside within the blastema (Godwin et
al., 2013; Leigh et al., 2018), suggesting active roles in regeneration. Furthermore,
macrophages are necessary for both axolotl limb and heart regeneration (Godwin et al.,
2013; Godwin et al., 2017a) playing roles including induction of the expression of limb
regeneration-associated genes, deposition of pro-regenerative ECM components, and
clearance of senescent cells (Yun et al., 2015). Interestingly, macrophage-depleted
regenerating axolotl limbs and hearts exhibit characteristics of scarring, suggesting that
macrophages are key players in tipping the balance between a non-regenerative and
regenerative outcome. Given the importance of different immune cells in the regeneration
of other systems, it is likely that other innate and adaptive cell types including neutrophils
and T-cells also play regenerative roles that have yet to be elucidated in the axolotl. In
all, it is clear that differences exist between the behavior of immune cells in regenerative
19
and non-regenerative systems. Whether these behaviors are driven by cell autonomous
or non-cell autonomous mechanisms remains to be discovered.
1.7. Topics addressed in this dissertation
My doctoral thesis broadly focused on characterizing the early transcriptional
programs of dividing progenitors and the surrounding tissues during the cell cycle re-entry
stages of axolotl limb regeneration in order to identify new regulators of blastema
formation. To this end, we developed and validated a method to use DAPI cell cycle
analysis to isolate dividing cells in regenerating stump tissues (enriching for blastemal
progenitors) in Chapter 2. We utilized this method to isolate and transcriptionally profile
three distinct populations during early stages of regeneration: stump-derived dividing
cells, stump-derived non-dividing cells, and the wound epidermis. These data allowed us
to identify and differentiate the gene expression programs active in progenitors that likely
give rise to the blastema from those of the surrounding tissues (non-dividing cells and the
wound epidermis) at the beginning stages of cell cycle re-entry. Furthermore, we provided
the field with a list of blastemal progenitor-enriched transcripts that may play important
roles in early blastemal cell biology. Exploration of the functional relevance of one
blastemal progenitor-enriched candidate, a well-known inflammatory cytokine interleukin-
8 (il-8), in Chapter 3 revealed a newly identified role of blastemal progenitors as
immunomodulatory players in the early stages of regeneration. Finally, we were
interested in exploring the functional role of the wound epidermis during early stages of
regeneration. To this end, we expanded upon the regenerating transcriptional dataset
from Chapter 2 and added an additional condition in which we prevented wound
20
epidermis formation in Chapter 4. These data allowed us to ask how the transcriptional
programs of blastemal progenitors and surrounding tissues change when wound
epidermis formation is prevented. Finally, in Chapter 5, we functionally examined the role
of one candidate, a pleiotropic growth factor cytokine midkine (mk), that was down-
regulated in the absence of the wound epidermis. Functional gain- and loss-of-function
experiments collectively suggest that mk is likely a regulator of wound epidermis
maturation to the AEC.
1.8. References
Aurora, A. B. and Olson, E. N. (2014). Immune modulation of stem cells and regeneration. Cell Stem Cell 15, 14-25.
Boilly, B. and Albert, P. (1990). In vitro control of blastema cell proliferation by extracts from epidermal cap and mesenchyme of regenerating limbs of axolotls. Roux Arch Dev Biol 198, 443-447.
Borgens, R. B. (1982). What is the role of naturally produced electric current in vertebrate regeneration and healing. Int Rev Cytol 76, 245-298.
Buckley, G., Wong, J., Metcalfe, A. D. and Ferguson, M. W. (2012). Denervation affects regenerative responses in MRL/MpJ and repair in C57BL/6 ear wounds. J Anat 220, 3-12.
Campbell, L. J. and Crews, C. M. (2008). Wound epidermis formation and function in urodele amphibian limb regeneration. Cell Mol Life Sci 65, 73-79.
Chaplin, D. D. (2010). Overview of the immune response. J Allergy Clin Immunol 125, S3-23.
Ching, Y. C. and Wedgwood, R. J. (1967). Immunologic responses in the axolotl, Siredon mexicanum. J Immunol 99, 191-200.
21
Christensen, R. N. and Tassava, R. A. (2000). Apical epithelial cap morphology and fibronectin gene expression in regenerating axolotl limbs. Dev Dyn 217, 216-224.
Christensen, R. N., Weinstein, M. and Tassava, R. A. (2002). Expression of fibroblast growth factors 4, 8, and 10 in limbs, flanks, and blastemas of Ambystoma. Dev Dyn 223, 193-203.
Dasgupta, S. (1970). Developmental potentialities of blastema cell nuclei of the Mexican Axolotl. J Exp Zool 175, 141-145.
Endo, T., Bryant, S. V. and Gardiner, D. M. (2004). A stepwise model system for limb regeneration. Dev Biol 270, 135-145.
Farkas, J. E., Freitas, P. D., Bryant, D. M., Whited, J. L. and Monaghan, J. R. (2016). Neuregulin-1 signaling is essential for nerve-dependent axolotl limb regeneration. Development 143, 2724-2731.
Farkas, J. E. and Monaghan, J. R. (2017). A brief history of the study of nerve dependent regeneration. Neurogenesis (Austin) 4, e1302216.
Fei, J. F., Lou, W. P., Knapp, D., Murawala, P., Gerber, T., Taniguchi, Y., Nowoshilow, S., Khattak, S. and Tanaka, E. M. (2018). Application and optimization of CRISPR-Cas9-mediated genome engineering in axolotl (Ambystoma mexicanum). Nat Protoc 13, 2908-2943.
Fei, J. F., Schuez, M., Knapp, D., Taniguchi, Y., Drechsel, D. N. and Tanaka, E. M. (2017). Efficient gene knockin in axolotl and its use to test the role of satellite cells in limb regeneration. Proc Natl Acad Sci U S A 114, 12501-12506.
Flowers, G. P., Timberlake, A. T., McLean, K. C., Monaghan, J. R. and Crews, C. M. (2014). Highly efficient targeted mutagenesis in axolotl using Cas9 RNA-guided nuclease. Development 141, 2165-2171.
Fukazawa, T., Naora, Y., Kunieda, T. and Kubo, T. (2009). Suppression of the immune response potentiates tadpole tail regeneration during the refractory period. Development 136, 2323-2327.
22
Gauron, C., Rampon, C., Bouzaffour, M., Ipendey, E., Teillon, J., Volovitch, M. and Vriz, S. (2013). Sustained production of ROS triggers compensatory proliferation and is required for regeneration to proceed. Sci Rep 3, 2084.
Gerber, T., Murawala, P., Knapp, D., Masselink, W., Schuez, M., Hermann, S., Gac-Santel, M., Nowoshilow, S., Kageyama, J., Khattak, S., et al. (2018). Single-cell analysis uncovers convergence of cell identities during axolotl limb regeneration. Science.
Godlewski, E., Jr. (1928). Untersuchungen uber Auslosung und Hemmung der Regeneration beim Axolotl. Wilhelm Roux Arch Entwickl Mech Org 114, 108-143.
Godwin, J. W., Debuque, R., Salimova, E. and Rosenthal, N. A. (2017a). Heart regeneration in the salamander relies on macrophage-mediated control of fibroblast activation and the extracellular landscape. NPJ Regen Med 2.
Godwin, J. W., Pinto, A. R. and Rosenthal, N. A. (2013). Macrophages are required for adult salamander limb regeneration. Proc Natl Acad Sci U S A 110, 9415-9420.
---- (2017b). Chasing the recipe for a pro-regenerative immune system. Semin Cell Dev Biol 61, 71-79.
Goss, R. J. (1956). Regenerative inhibition following limb amputation and immediate insertion into the body cavity. Anat Rec 126, 15-27.
Han, M. J., An, J. Y. and Kim, W. S. (2001). Expression patterns of Fgf-8 during development and limb regeneration of the axolotl. Dev Dyn 220, 40-48.
Jenkins, L. S., Duerstock, B. S. and Borgens, R. B. (1996). Reduction of the current of injury leaving the amputation inhibits limb regeneration in the red spotted newt. Dev Biol 178, 251-262.
Kato, T., Miyazaki, K., Shimizu-Nishikawa, K., Koshiba, K., Obara, M., Mishima, H. K. and Yoshizato, K. (2003). Unique expression patterns of matrix metalloproteinases in regenerating newt limbs. Dev Dyn 226, 366-376.
Khattak, S., Murawala, P., Andreas, H., Kappert, V., Schuez, M., Sandoval-Guzman, T., Crawford, K. and Tanaka, E. M. (2014a). Optimized axolotl (Ambystoma
23
mexicanum) husbandry, breeding, metamorphosis, transgenesis and tamoxifen-mediated recombination. Nat Protoc 9, 529-540.
Khattak, S., Sandoval-Guzman, T., Stanke, N., Protze, S., Tanaka, E. M. and Lindemann, D. (2013). Foamy virus for efficient gene transfer in regeneration studies. BMC Dev Biol 13, 17.
Khattak, S., Schuez, M., Richter, T., Knapp, D., Haigo, S. L., Sandoval-Guzman, T., Hradlikova, K., Duemmler, A., Kerney, R. and Tanaka, E. M. (2014b). Germline Transgenic Methods for Tracking Cells and Testing Gene Function during Regeneration in the Axolotl. Stem Cell Reports 2, 243.
Kragl, M., Knapp, D., Nacu, E., Khattak, S., Maden, M., Epperlein, H. H. and Tanaka, E. M. (2009). Cells keep a memory of their tissue origin during axolotl limb regeneration. Nature 460, 60-65.
Kumar, A., Godwin, J. W., Gates, P. B., Garza-Garcia, A. A. and Brockes, J. P. (2007). Molecular basis for the nerve dependence of limb regeneration in an adult vertebrate. Science 318, 772-777.
Learn, J. R. (2019). Complete Axolotl Genome Could Reveal the Secret of Regenerating Tissues. In Smithsonian: Smithsonian Institution.
Leigh, N. D., Dunlap, G. S., Johnson, K., Mariano, R., Oshiro, R., Wong, A. Y., Bryant, D. M., Miller, B. M., Ratner, A., Chen, A., et al. (2018). Transcriptomic landscape of the blastema niche in regenerating adult axolotl limbs at single-cell resolution. Nat Commun 9, 5153.
Lopez, D., Lin, L., Monaghan, J. R., Cogle, C. R., Bova, F. J., Maden, M. and Scott, E. W. (2014). Mapping hematopoiesis in a fully regenerative vertebrate: the axolotl. Blood 124, 1232-1241.
Love, N. R., Chen, Y., Ishibashi, S., Kritsiligkou, P., Lea, R., Koh, Y., Gallop, J. L., Dorey, K. and Amaya, E. (2013). Amputation-induced reactive oxygen species are required for successful Xenopus tadpole tail regeneration. Nat Cell Biol 15, 222-228.
Mahmoud, A. I., O'Meara, C. C., Gemberling, M., Zhao, L., Bryant, D. M., Zheng, R., Gannon, J. B., Cai, L., Choi, W. Y., Egnaczyk, G. F., et al. (2015). Nerves
24
Regulate Cardiomyocyte Proliferation and Heart Regeneration. Dev Cell 34, 387-399.
McCusker, C., Bryant, S. V. and Gardiner, D. M. (2015). The axolotl limb blastema: cellular and molecular mechanisms driving blastema formation and limb regeneration in tetrapods. Regeneration (Oxf) 2, 54-71.
McLaughlin, K. A. and Levin, M. (2018). Bioelectric signaling in regeneration: Mechanisms of ionic controls of growth and form. Dev Biol 433, 177-189.
Mescher, A. L. (1976). Effects on adult newt limb regeneration of partial and complete skin flaps over the amputation surface. J Exp Zool 195, 117-128.
Mescher, A. L. and Neff, A. W. (2005). Regenerative capacity and the developing immune system. Adv Biochem Eng Biotechnol 93, 39-66.
Mescher, A. L., Neff, A. W. and King, M. W. (2013). Changes in the inflammatory response to injury and its resolution during the loss of regenerative capacity in developing Xenopus limbs. PLoS One 8, e80477.
Mescher, A. L. and Tassava, R. A. (1975). Denervation effects on DNA replication and mitosis during the initiation of limb regeneration in adult newts. Dev Biol 44, 187-197.
Monaghan, J. R., Epp, L. G., Putta, S., Page, R. B., Walker, J. A., Beachy, C. K., Zhu, W., Pao, G. M., Verma, I. M., Hunter, T., et al. (2009). Microarray and cDNA sequence analysis of transcription during nerve-dependent limb regeneration. BMC Biol 7, 1.
Monaghan, J. R., Stier, A. C., Michonneau, F., Smith, M. D., Pasch, B., Maden, M. and Seifert, A. W. (2014). Experimentally induced metamorphosis in axolotls reduces regenerative rate and fidelity. Regeneration (Oxf) 1, 2-14.
Naik, S., Larsen, S. B., Cowley, C. J. and Fuchs, E. (2018). Two to Tango: Dialog between Immunity and Stem Cells in Health and Disease. Cell 175, 908-920.
Nowoshilow, S., Schloissnig, S., Fei, J. F., Dahl, A., Pang, A. W. C., Pippel, M., Winkler, S., Hastie, A. R., Young, G., Roscito, J. G., et al. (2018). The axolotl genome and the evolution of key tissue formation regulators. Nature 554, 50-55.
25
Oliveira, C. R., Lemaitre, R., Murawala, P., Tazaki, A., Drechsel, D. N. and Tanaka, E. M. (2018). Pseudotyped baculovirus is an effective gene expression tool for studying molecular function during axolotl limb regeneration. Dev Biol 433, 262-275.
Page, R. B., Monaghan, J. R., Walker, J. A. and Voss, S. R. (2009). A model of transcriptional and morphological changes during thyroid hormone-induced metamorphosis of the axolotl. Gen Comp Endocrinol 162, 219-232.
Page, R. B., Voss, S. R., Samuels, A. K., Smith, J. J., Putta, S. and Beachy, C. K. (2008). Effect of thyroid hormone concentration on the transcriptional response underlying induced metamorphosis in the Mexican axolotl (Ambystoma). BMC Genomics 9, 78.
Repesh, L. A. and Oberpriller, J. C. (1978). Scanning electron microscopy of epidermal cell migration in wound healing during limb regeneration in the adult newt, Notophthalmus viridescens. Am J Anat 151, 539-555.
Salpeter, M. M. and Singer, M. (1960). Differentiation of the submicroscopic adepidermal membrane during limb regeneration in adult Triturus, including a note on the use of the term basement membrane. Anat Rec 136, 27-39.
Schotte, O. E. and Butler, E. G. (1941). Morphological effects of denervation and amputation of limbs in urodele larvae. J. Exptl. Zool. 87, 279-322.
Seifert, A. W., Monaghan, J. R., Voss, S. R. and Maden, M. (2012). Skin regeneration in adult axolotls: a blueprint for scar-free healing in vertebrates. PLoS One 7, e32875.
Sidman, R. L. and Singer, M. (1961). Limb regeneration without innervation of the apical epidermis in the adult newt, Triturus. Journal of Experimental Zoology 144, 105-111.
Simoes, M. G., Bensimon-Brito, A., Fonseca, M., Farinho, A., Valerio, F., Sousa, S., Afonso, N., Kumar, A. and Jacinto, A. (2014). Denervation impairs regeneration of amputated zebrafish fins. BMC Dev Biol 14, 49.
Singer, M. (1949). The invasion of the epidermis of the regenerating forelimb of the urodele, Triturus, by nerve fibers. J Exp Zool 111, 189-209.
26
---- (1952). The influence of the nerve in regeneration of the amphibian extremity. Q Rev Biol 27, 169-200.
Singer, M. and Saltpeter, M. M. (1961). Regeneration in vertebrates: The role of the wound epithelium. In Growth in Living Systems (ed. M. X. Zarrow): Basic Books, New York.
Smith, J. J., Timoshevskaya, N., Timoshevskiy, V. A., Keinath, M. C., Hardy, D. and Voss, S. R. (2019). A chromosome-scale assembly of the axolotl genome. Genome Res 29, 317-324.
Sugiura, T., Wang, H., Barsacchi, R., Simon, A. and Tanaka, E. M. (2016). MARCKS-like protein is an initiating molecule in axolotl appendage regeneration. Nature 531, 237-240.
Tanaka, E. M. and Brockes, J. P. (1998). A target of thrombin activation promotes cell cycle re-entry by urodele muscle cells. Wound Repair Regen 6, 371-381.
Tanaka, E. M., Drechsel, D. N. and Brockes, J. P. (1999). Thrombin regulates S-phase re-entry by cultured newt myotubes. Curr Biol 9, 792-799.
Tanaka, E. M., Gann, A. A., Gates, P. B. and Brockes, J. P. (1997). Newt myotubes reenter the cell cycle by phosphorylation of the retinoblastoma protein. J Cell Biol 136, 155-165.
Tang, D., Kang , R., Coyne, C. B., Zeh, H. J. and Lotze, M. T. (2018). PAMPs and DAMPs: Signal 0s that Spur Autophagy and Immunity. Immunol Rev. 249, 158-175.
Tassava, R. A. and Loyd, R. M. (1977). Injury requirement for initiation of regeneration of newt limbs which have whole skin grafts. Nature 268, 49-50.
Tassava, R. A. and Mescher, A. L. (1975). The roles of injury, nerves, and the wound epidermis during the initiation of amphibian limb regeneration. Differentiation 4, 23-24.
Thornton, C. S. (1957). The effect of apical cap removal on limb regeneration in Amblystoma larvae. J Exp Zool 134, 357-381.
27
Thornton, C. S. and Steen, T. P. (1962). Eccentric blastema formation in aneurogenic limbs of Ambystoma larvae following epidermal cap deviation. Dev Biol 5, 328-343.
Todd, J. T. (1823). On the process of reproduction of the members of the aquatic salamander. Quart. J. Sci., Lit., Arts 16, 84-96.
Trede, N. S., Langenau, D. M., Traver, D., Look, A. T. and Zon, L. I. (2004). The use of zebrafish to understand immunity. Immunity 20, 367-379.
von Maltzahn, J., Jones, A. E., Parks, R. J. and Rudnicki, M. A. (2013). Pax7 is critical for the normal function of satellite cells in adult skeletal muscle. Proc Natl Acad Sci U S A 110, 16474-16479.
Wagner, I., Wang, H., Weissert, P. M., Straube, W. L., Shevchenko, A., Gentzel, M., Brito, G., Tazaki, A., Oliveira, C., Sugiura, T., et al. (2017). Serum Proteases Potentiate BMP-Induced Cell Cycle Re-entry of Dedifferentiating Muscle Cells during Newt Limb Regeneration. Dev Cell 40, 608-617 e606.
Whited, J. L., Lehoczky, J. A. and Tabin, C. J. (2012). Inducible genetic system for the axolotl. Proc Natl Acad Sci U S A 109, 13662-13667.
Whited, J. L., Tsai, S. L., Beier, K. T., White, J. N., Piekarski, N., Hanken, J., Cepko, C. L. and Tabin, C. J. (2013). Pseudotyped retroviruses for infecting axolotl in vivo and in vitro. Development 140, 1137-1146.
Woodcock, M. R., Vaughn-Wolfe, J., Elias, A., Kump, D. K., Kendall, K. D., Timoshevskaya, N., Timoshevskiy, V., Perry, D. W., Smith, J. J., Spiewak, J. E., et al. (2017). Identification of Mutant Genes and Introgressed Tiger Salamander DNA in the Laboratory Axolotl, Ambystoma mexicanum. Sci Rep 7, 6.
Yang, E. V., Gardiner, D. M., Carlson, M. R., Nugas, C. A. and Bryant, S. V. (1999). Expression of Mmp-9 and related matrix metalloproteinase genes during axolotl limb regeneration. Dev Dyn 216, 2-9.
Yun, M. H., Davaapil, H. and Brockes, J. P. (2015). Recurrent turnover of senescent cells during regeneration of a complex structure. Elife 4.
29
2.1. Preface
The work presented in this chapter was modified and adapted to fit the guidelines
of this dissertation from the following publication: Tsai S.L., Baselga-Garriga C., and
Melton D.A. (2019). Blastemal progenitors modulate immune signaling during early limb
regeneration. Development:146(1). The conceptualization and experimental design was
performed in collaboration with Doug. I performed all of the experiments and the data
analysis.
2.2. Abstract
Blastema formation, a hallmark of limb regeneration, requires proliferation and
migration of progenitors to the amputation plane. While blastema formation has been well-
described, the transcriptional programs that drive blastemal progenitors remain unknown.
Here, we devised a method to utilize the cell cycle as a marker to enrich for early
blastemal progenitors. To investigate the gene expression signatures within blastemal
progenitors apart from the surrounding tissues, we transcriptionally profiled dividing and
non-dividing cells in regenerating stump tissues, as well as the wound epidermis, during
early stages of axolotl limb regeneration. Surprisingly, pathway analysis of differentially
expressed transcripts from each population indicated the suppression of several core
developmental signaling pathways including FGF signaling in early regenerating stump
tissues. Furthermore, the transcriptional profiles of early dividing cells suggest selective
establishment of an autocrine TGF- signaling network and roles in shaping the
regenerative niche. Finally, our analysis reveals a candidate list of blastemal progenitor-
30
enriched transcripts that may provide new insights into blastemal cell biology during the
initiation of regeneration.
2.3. Introduction
Salamanders, including newts and axolotls, possess the ability to fully regenerate
their limbs throughout their lifespan. This regenerative capacity requires the formation of
a transient cellular structure distal to the amputation plane known as the blastema which
is comprised of progenitors derived from multiple different tissues (Kragl et al., 2009;
Sandoval-Guzman et al., 2014; Currie et al., 2016). While salamanders can perform this
process regularly, mammals are incapable of forming a blastema that can give rise to an
entire limb. Understanding the mechanisms underlying the initiation of blastema formation
may provide important insights into unlocking human regenerative potential.
Blastema formation requires coordinated proliferation and migration of progenitors
derived from muscle, bone, dermal fibroblasts, connective tissue, and other tissues (Kragl
et al., 2009). Researchers have shown that while the blastema itself is transcriptionally
similar to the limb bud during development, regenerating limbs exhibit unique
transcriptional profiles during early stages of regeneration before the blastema has
formed (Knapp et al., 2013). Elucidating these signals, as well as their specific activities,
is crucial for understanding why and how salamanders respond to amputations with
blastema formation. Several important signaling molecules and pathways have already
been identified during early stages of appendage regeneration. For instance, axolotl
MARCKS-like protein (axMLP) is a secreted molecule from the wound epidermis required
for the induction of tail regeneration and capable of inducing cell proliferation in intact
31
limbs (Sugiura et al., 2016). Moreover, several core developmental signaling pathways
including FGF and Wnt are required for appendage regeneration in axolotls and other
species (McCusker et al., 2015; Haas and Whited, 2017; Stocum, 2017).
Several studies have investigated bulk transcriptional changes during different
stages of axolotl limb regeneration and successfully identified genes that may play
important roles in blastema formation and maintenance (Monaghan et al., 2009; Campbell
et al., 2011; Knapp et al., 2013; Stewart et al., 2013; Wu et al., 2013; Voss et al., 2015;
Bryant et al., 2017; Gerber et al., 2018). More recently, single cell analysis specifically in
the connective tissue lineage has elucidated the molecular transitional states during
dedifferentiation of mature connective tissue to a progenitor state during limb
regeneration (Gerber et al., 2018). Additionally, unbiased single cell sequencing in
regenerating limbs has provided the field with novel markers for different cell types within
the limb to begin to examine regeneration at finer resolution (Leigh et al., 2018).
In the present study, we sought to investigate the distinct transcriptional programs
active within blastemal progenitors irrespective of lineage, as well as the surrounding
tissues, to better understand the genetic programs and signaling interactions that govern
the initiation of blastema formation. We reasoned that blastemal progenitors would be
among early proliferating cells in stump tissues following amputation. Therefore, to enrich
for blastemal progenitors, we transcriptionally profiled dividing cells from regenerating
stump tissues during early stages of axolotl limb regeneration. This approach allowed us
to examine the transcriptional signature of early dividing cells, inclusive of blastemal
progenitors, and identify potential novel modulators of early blastemal cell induction and
maintenance. We additionally profiled non-dividing cells in regenerating stump tissues
32
and the wound epidermis at similar stages for comparison. Pathway analysis of the
discrete transcriptional programs of all three subpopulations revealed differential patterns
of signaling pathway activation/inhibition and unexpectedly uncovered the repression of
several core developmental signaling pathways throughout regenerating stump tissues.
2.4. Results
2.4.1. Transcriptional profiling of dividing cells during the initiation of limb regeneration
Cell cycle re-entry is an integral event for the initiation of limb regeneration prior to
blastema formation. We therefore reasoned that we would be able to exploit differences
in the cell cycle, such as DNA content, as a means of enriching for blastemal progenitors
during early stages of regeneration. We developed and optimized a protocol to perform
DAPI staining in conjunction with FACS to separate 4N and 2N cells in the regenerating
stump during early regeneration (Figure 2.1). Intact limb tissue is referred to as the 0 dpa
timepoint which was collected to serve as a non-regenerating control. Utilizing this
method, we transcriptionally profiled three total cellular populations at 0, 4, and 5 days
post-amputation (dpa): stump-derived dividing (4N) and non-dividing (2N) cells, as well
as the whole wound epidermis (Figure 2.3A).
Principal component analysis (PCA) of the transcriptional profiles of all samples
revealed four clusters representing tissue type (stump-derived or epidermis) and
regeneration status (Figure 2.2A). Differential expression analysis of transcripts between
the 4N (proliferating) and 2N (non-dividing) fractions at all three timepoints showed the
expected enrichment of cell cycle gene expression in the proliferating fraction (Figure
2.2B). Moreover, known blastemal cell markers, including prrx-1 (Satoh et al., 2011;
33
Gerber et al., 2018) and kazd1 (Bryant et al., 2017), were enriched in the stump dividing
cells. Genes known to be up-regulated early upon amputation but more likely to be
modulating the extracellular matrix degradation rather than marking progenitor cells, such
as mmp9 and mmp3 (Vinarsky et al., 2005; Monaghan et al., 2012; Stewart et al., 2013),
were enriched in non-dividing stump tissues (Figure 2.2C). To investigate the specificity
of our strategy to enrich for blastemal progenitors rather than other dividing cell types,
such as immune cell infiltrates, we examined the predicted activation and inhibition of
immune signaling pathways by applying Ingenuity Pathway Analysis (IPA) software to the
differentially expressed transcripts in each cell population relative to the non-regenerating
limb. Most innate immune signaling pathways were inhibited within dividing cells (Figure
A.1.1, Table A.1.1), while activated in the other fractions, suggesting that we did not
preferentially enrich for dividing immune cells. In all, these observations validated the
enrichment of dividing blastemal progenitors using this protocol and allowed us to
examine unique gene expression patterns of these cells.
Overall, a total of 21,077 transcripts (19,417 genes at 4 dpa) and 16,510 transcripts
(15,205 genes at 5 dpa) were differentially expressed across all three fractions during
early regeneration (Figure 2.3B-C). Of these, only a strikingly small percentage were
commonly up- or down-regulated across all tissues relative to non-regenerating tissue at
0 dpa (1.51% at 4 dpa and 0.58% at 5 dpa), strongly suggesting that all three
subpopulations initiate distinct transcriptional programs following amputation. Lists of
differentially expressed transcripts for all analyses are deposited on GEO (accession
number: GSE111213). The most highly expressed and commonly upregulated transcripts
corresponded to enzymes involved in modulating extracellular matrix (ECM) degradation
34
Figure 2.1. Technical validation of FACS-method to purify 4N and 2N fractions from
regenerating stump tissue. (A) Representative FACS plot and gating for 2N (P3) and
4N (P5) populations in dissociated stump tissue based on DAPI staining. (B)
Representative Bioanalyzer traces of RNA isolated from sorted stump-derived 2N and 4N
fractions and non-sorted, but dissociated epidermis. (C) RT-PCR of cDNA generated from
sorted 2N and 4N fractions for cell cycle genes enriched in the actively dividing cells.
35
Figure 2.2. Transcriptional profiles of dividing, non-dividing, and wound epidermal
cells reveal fold change enrichment of well-known early regeneration genes. (A)
Principal component analysis (PCA) plot of individual samples based on top 500 most
highly expressed transcripts. Colors denote the specific sample and shapes denote the
replicate of the sample. (B) Graph demonstrating high fold change enrichment of 20 cell
cycle genes in 4N vs. 2N across all three timepoints. (C) Fold change enrichment of well-
known genes involved in early limb regeneration in either the 4N or 2N fraction.
Transcripts for blastemal cell markers such as kazd1 and prrx-1 were correctly enriched
in the dividing cells.
36
(mmp18, mmp2, timp1, tena, adam8) and transcription factors involved in limb
development and regeneration including sall4 (Neff et al., 2005; Akiyama et al., 2015;
Erickson et al., 2016) and runx-1 (Umansky et al., 2015; Deltcheva and Nimmo, 2017),
indicating that they may play a role in orchestrating regeneration across all tissues.
2.4.2. Growth factor signaling pathways are largely repressed within regenerating stump
tissues
We examined signaling interactions between regenerating subpopulations through
IPA analysis of differentially expressed transcripts in each fraction at both timepoints. IPA
software utilizes algorithms that account for the expression levels of signaling
components, activators, and inhibitors of well-known signaling pathways to predict
whether a particular pathway is activated or inhibited. Surprisingly, pathway analysis
revealed that several growth factor (e.g. FGF, Notch) (Figure 2.3D) and intracellular (e.g.
calcium and mTOR) signaling pathways implicated in regeneration were strongly inhibited
in regenerating stump tissues during these early timepoints (Table A.1.2). Notable
exceptions include a handful of pathways: Hippo, canonical Wnt, and TGF- signaling.
Among the repressed pathways were neurovascular signaling pathways (CNTF, NGF,
Neuregulin, VEGF signaling) that were activated in the wound epidermis and suppressed
in stump tissues. These data further suggest that the wound epidermis orchestrates early
neurovascular regeneration and that early repression of these pathways in regenerating
stump tissues may be required. In all, these results show that exact spatiotemporal
modulation of growth factor signaling pathways in specific tissues occurs during early
stages of regeneration.
37
Figure 2.3. Growth factor signaling pathways are inhibited in regenerating stump
tissues. (A) Schematic of transcriptomic profiling experiment. Limbs were amputated and
2-3 mm of tissue proximal to the amputation site was collected at 0, 4, or 5 days post-
amputation (dpa). Three fractions were isolated from each sample for sequencing: stump-
derived dividing cells, non-dividing cells, and the whole wound epidermis. DAPI cell cycle
analysis and FACS was performed to isolate dividing and non-dividing cells in the stump
tissue. (B, C) Venn diagrams of the distribution of differentially expressed transcripts at 4
38
Figure 2.3. (Continued) or 5 dpa are shown in B and C, respectively. (D) Ingenuity
Pathway Analysis of differentially expressed transcripts in stump-derived dividing, non-
dividing, or wound epidermal cells. Positive Z-scores depict predicted activation whereas
negative Z-scores depict predicted inhibition of the respective pathway. Color coding of
labels for each fraction of tissue as follows: stump-derived 2N, blue, stump-derived 4N,
green, wound epidermis, purple.
2.4.3. The transcriptional landscape of early dividing cells indicates roles in shaping the
blastemal niche
We next utilized our dataset to identify transcripts enriched in dividing cells at both
regenerating timepoints (see Materials and Methods for filtering criteria). A total of 1,217
transcripts (1,181 genes) were enriched in dividing cells and of these, only 298 transcripts
(265 genes) were annotated. A heatmap representing the top 75 annotated and most
highly expressed enriched transcripts, with little to no expression in the wound epidermis,
is shown in Figure 2.4A. A complete list of all annotated enriched transcripts identified
can be found in Table A.1.3. The small fraction of annotated enriched transcripts suggests
that many key modulators of early regenerative events might be novel genes or at least
may not have identifiable orthologous genes in other species present in existing datasets.
Among the most highly expressed and enriched transcripts in dividing cells were
regenerative ECM components including tenascin (tena), collagens (co5a2, co5a1,
co1a2, coba1, coca1), emilin1 (emil1), and fibrillin-2 (fbn2), suggesting that dividing cells
play an early role in building the blastemal niche. Most notably, the transcriptional
signatures of early dividing cells suggest that they may be directly regulated by TGF-
signaling. Pathway analysis revealed that TGF- signaling was specifically activated in
early dividing cells (Figure 2.3D). Further examination of TGF- signaling components
39
revealed upregulation of both up- and down-stream regulators (tgf-1, tgf-1r, smad2,
ltbp1, inhba) as well as direct targets of TGF- signaling associated with epithelial-to-
mesenchymal transition (EMT) such as snail1 and twist1 (Figure 2.4B). These data
indicate that an auto-regulatory TGF- signaling network is established both intra- and
extracellularly in dividing cells, including blastemal progenitors, during early stages of
regeneration.
To validate our differential-gene expression findings and to learn more about
where these transcripts are expressed, we performed time course RNA in situ
hybridization on two candidates with high enrichment in dividing cells, transmembrane
protein 119 (tm119) and E3 ubiquitin-protein ligase (lin41) (Figure 2.4C-H). In situ
hybridization confirmed that these transcripts were specific to early dividing cells and
likely expressed in blastemal progenitors during early stages of regeneration. Tm119 has
been shown to play a role in bone development and osteoblast proliferation (Kanamoto
et al., 2009; Mizuhashi et al., 2012; Mizuhashi et al., 2015), whereas lin41 has a highly
conserved role in stem cell maintenance as well as cellular reprogramming (Slack et al.,
2000; Worringer et al., 2014). Both candidates showed little to no expression in uninjured
limbs (Figure 2.4C, F). Co-expression of tm119 and lin41 with a dividing cell marker,
top2a, via double in situ hybridization at 7 dpa validated that these transcripts were
expressed within dividing cells (Figure 2.4D, G). Moreover, in situ hybridization of tm119
and lin41 at 21 dpa revealed strong expression of tm119 across the blastema, and lower,
but pan-blastemal expression of lin41 as well (Figure 2.4E, H), suggesting that they were
indeed expressed within blastemal progenitors at earlier stages.
40
Figure 2.4. Identification of highly enriched transcripts in dividing cells during early
regeneration. (A) Heatmap of the expression levels (log2TPM) of the top 75 transcripts
enriched in regenerating dividing cells in wound epidermis and non-dividing cells in the
stump tissue. Green arrows denote transcripts for the blastemal markers kazd1 and prrx-
1; red arrows point to tm119 and lin41. (B) Heatmap of expression levels of select TGF-
signaling pathway regulators, targets, and downstream effectors. Color coding of labels
in A and B for each fraction of tissue as follows: stump-derived 2N, blue, stump-derived
4N, green, epidermis or wound epidermis, purple. (C-E) In situ hybridization of tm119 at
0, 7, and 21 dpa. Double in situ hybridization of tm119 with top2a is depicted in panel D.
WE2N4N
A BZ-score
ltbp1
inhba
snail1
twist1
tgfb1
smad-2
tgfr1
0 d
pa e
pi
4 d
pa
WE
5 d
pa
WE
0 d
pa
2N
0 d
pa
4N
4 d
pa
2N
5 d
pa
2N
4 d
pa
4N
5 d
pa
4N
epidermis intactstump
reg.stump
2N
reg.stump
4N
log2(TPM)
0 dpa
tm119C E21 dpa
tm119D top2a tm119
7 dpa
21 dpalin41Htop2a lin41
7 dpaGF
0 dpalin41
41
Figure 2.4. (Continued) Arrowheads in D demarcate co-positive tm119+top2a+ cells. (F-
H) In situ hybridization of lin41 at 0, 7, and 21 dpa. Double in situ hybridization of tm119
and top2a is depicted in panel G. Arrowheads denote co-positive lin41+top2a+ cells. Scale
bars represent 20 µm. Images were taken at 40x magnification. Insets in the bottom left
corner denote where in the overall section the higher magnification image was taken. WE,
wound epidermis.
2.5. Discussion
Elucidating the molecular mechanisms underlying the initiation of regeneration is
key to understanding the difference in responses to tissue loss between regenerative and
non-regenerative organisms. Here we transcriptionally profiled distinct regenerating
subpopulations during early pre-blastemal stages of limb regeneration to differentiate
gene expression changes that occur in early dividing cells, inclusive of blastemal
progenitors, from those of surrounding tissues. Using this dataset, we have gained
insights into the patterns of suppression and activation of signaling pathways present
within subsets of early regenerating limb tissues. Notably, our examination of the
expression profiles of early dividing cells revealed an immunomodulatory role for
blastemal progenitors during early stages of regeneration.
The transcriptional signatures of early dividing cells and blastemal progenitors
suggest that the formation of the early blastemal niche may be regulated by canonical
Wnt, Hippo, and TGF- signaling. Dividing cells showed enriched expression of
regenerative ECM components, many of which are important for regeneration (Calve et
al., 2010; Godwin et al., 2014), suggesting that they are drivers of the transition to a
regenerative ECM. In addition, Hippo, Wnt, and TGF- signaling pathways were activated
within dividing cells. As down-stream effectors of all three pathways interact in
42
development and tumorigenesis (McNeill and Woodgett, 2010; Attisano and Wrana,
2013), it is likely that synergy between these pathways is essential for early blastemal cell
establishment and maintenance. Interestingly, TGF- signaling, which is necessary for
axolotl limb regeneration (Levesque et al., 2007; Denis et al., 2016), was specifically
active in dividing cells. Our data further suggest that TGF- signaling is sustained through
autocrine feedback in early dividing cells, which exhibit exclusive up-regulation of tgf-1,
tgf-1r, and smad-2 as well as regulators and direct targets including ltbp1, twist1, and
snail1. Snail-1 directs epithelial-to-mesenchymal transition (EMT) behaviors (Fuxe et al.,
2010) and activates expression of both regenerative ECM components and twist family
members, which are expressed in limb blastemal cells (Kragl et al., 2013; Bryant et al.,
2017). Moreover, dividing cells highly expressed ECM components such as emilin-1 and
fibrillin-2, which modulate TGF- signaling through interactions with ltbp1 (Neptune et al.,
2003; Randell and Daneshtalab, 2017), indicating that both an intra- and extra-cellular
TGF- signaling network is established.
Surprisingly, we observed the strong repression of many growth factor signaling
pathways in early regenerating stump tissues. FGF, Notch, IGF-1, PDGF, and non-
canonical Wnt signaling pathways (PCP and Wnt/Ca+) all appear to be inhibited, yet many
of these signaling pathways are necessary and/or sufficient for appendage regeneration
in amphibians as well as zebrafish (Poss et al., 2000; Yokoyama et al., 2000; Yokoyama
et al., 2001; Stoick-Cooper et al., 2007; Chablais and Jazwinska, 2010; Satoh et al., 2011;
Grotek et al., 2013; Makanae et al., 2014; Rodrigo Albors et al., 2015; Currie et al., 2016;
Nacu et al., 2016; Shibata et al., 2016). Furthermore, signaling pathways involved in
neuronal (e.g. Neuregulin) and vascular (e.g. VEGF) regeneration (Yu et al., 2014; Farkas
43
et al., 2016; Farkas and Monaghan, 2017; Ritenour and Dickie, 2017) were active in the
wound epidermis, yet suppressed in regenerating stump tissues, signifying that early
neurovascular regeneration is coordinated by the wound epidermis and that repression
of these pathways within regenerating stump tissues may be important. A potential
explanation for this apparent dichotomy lies in the timing of activation. Premature
activation of signaling pathways such as Notch (Grotek et al., 2013) or non-canonical Wnt
signaling (Stoick-Cooper et al., 2007) inhibits blastemal growth during zebrafish fin
regeneration. Therefore, our findings suggest that repression of these pathways in early
stages of regeneration may be necessary and that precise, timely release of inhibition
ensures successful regeneration. It is interesting to note that the analysis did not reveal
strong predictions for activation or repression of other pathways essential for limb
regeneration such as sonic hedgehog (shh) signaling (Singh et al., 2015). These other
pathways may be downstream and act at later stages of regeneration (or are regulated
post-transcriptionally). Nevertheless, these findings could provide targetable insights for
improving regenerative outcomes.
2.6. Materials and Methods
Animal procedures
Axolotl (Ambystoma mexicanum) husbandry and surgeries were performed in
accordance with the Association for Assessment and Accreditation of Laboratory Animal
Care (AAALAC) and Institutional Animal Care and Use Committee (IACUC) guidelines at
Harvard University. Sub-adult white and albino axolotls (15-18 cm) provided by the
44
Ambystoma Genetic Stock Center (AGSC, University of Kentucky, KY) were used for the
RNA-sequencing experiment.
FACS and RNA isolation
Briefly, animals were anesthetized in 0.1% Tricaine (Sigma-Aldrich, St. Louis, MO)
and all four limbs were amputated at the mid-radius/ulna level. Bone was trimmed back
to facilitate wound closure and regeneration. Approximately 2-3 mm of tissue directly
proximal to the amputation plane was collected at either 0, 4, or 5 dpa. We chose to
transcriptionally profile regenerating limbs at 4 and 5 dpa because preliminary
experiments showed a distinct increase in cellular proliferation in the regenerating stump
beginning at 3 dpa (data not shown here) and we wanted to capture the transcriptional
signatures of dividing cells during the duration of cell-cycle re-entry. In order to obtain
enough material for the sorting and sequencing protocol, we chose to perform the
experiments at 4 and 5 dpa. Twelve limbs were pooled for each biological replicate per
timepoint and the experiment was performed in biological triplicate.
To prep the tissue for FACS, the intact epidermis or wound epithelium was micro-
dissected off and placed into 0.25% Trypsin-EDTA for 15 minutes with agitation at room
temperature to dissociate epithelial cells from the dermal layer. The remaining stump
tissues were micro-dissected further into small pieces with dissecting scissors and
chemically dissociated in a solution composed of 5 mg/mL collagenase (Sigma-Aldrich),
7.3 mg/mL dispase II (Roche Diagnostics, Indianapolis, IN), and 1.36 mg/mL D-Glucose
in 80% PBS (Kumar and Brockes, 2007) for 15 minutes with agitation at room
temperature. In order to obtain representation of dermal cells in the stump tissue fraction,
45
we also chemically dissociated micro-dissected intact epidermis or wound epithelia along
with the stump tissues. For regenerating samples, the wound epidermis portion, which is
visibly transparent, was carefully removed to isolate adjacent full thickness skin with both
epidermal and dermal layers and then dissociated with the stump tissue fraction.
Dissociated cells were then transferred to a new tube (non-dissociated chunks of tissue
were left behind) and the dissociation was serum-inactivated. The following protocol for
staining, FACS, and RNA isolation was optimized and adapted from Hrvatin et al. 2014.
The cell suspension was pelleted, re-suspended, passed through a 70 uM cell strainer,
washed twice with 80% PBS, and fixed in 4% paraformaldehyde/0.1% saponin with a
1:50 dilution of RNasin plus RNase Inhibitor (Promega, Madison, WI) for 30 minutes at
4C. Fixed cells were then washed twice with a 1% BSA/ 0.1% saponin (1:40 dilution
RNasin plus RNase Inhibitor, Promega) in PBS wash buffer and DAPI staining (10 ug/mL)
of cells was performed for 30 minutes at 4C in a 0.1% saponin solution (1:20 RNasin
plus RNase Inhibitor, Promega). The stump fraction of DAPI-stained cells were
immediately sorted into 2N and 4N fractions using FACS, whereas the corresponding
epithelial fraction was subjected to the same staining treatment, but not sorted. Cells were
sorted into RNAlater solution (Invitrogen, Carlsbad, CA) and RNA was isolated with the
RecoverAll Total Nucleic Acid Isolation Kit for FFPE (Invitrogen). The quality of the RNA
samples was assessed using the Agilent RNA 6000 Pico kit on the Bioanalyzer 2100
(Agilent Technologies, Santa Clara, CA).
cDNA library preparation and sequencing
46
cDNA was synthesized from RNA samples using the NuGEN Ovation RNA-seq
System V2 protocol (Integrated Sciences, Sydney, Australia) according to the
manufacturer’s instructions using 10 ng of RNA as starting material. The quality and
concentration of cDNA preps was then assessed using the Agilent DNA 1000 kit on the
Bioanalyzer 2100 (Agilent Technologies). RT-PCR for cell cycle markers ccnb3, ccna2,
and cdk1b was then performed on the cDNA generated from 4N and 2N cells to check
for proper enrichment of dividing cells. Primer sequences are as follows:
ccnb3-For, 5’-CACAAGAATCCAGTGCCACA-3’
ccnb3-Rev, 5’-CCTCCTTTGCAACAGTGTCC-3’
ccna2-For, 5’-GAACGTACAGCCTGGCAAG-3’
ccna2-Rev, 5’-CTGACGGCTGCTCCTTTG-3’
cdk1b-For, 5’-GCCAAACAACGAAATCTGGC-3’
cdk1b-Rev, 5’-AGGGTGGTTCAATGCCTCTT-3’
To prepare cDNA sequencing libraries, 200 ng of cDNA was first sheared to a peak
size of 200 bp using the Covaris S220 (Covaris, Woburn, MA) according to the
manufacturer’s protocol. Good quality and correct size distribution of sheared DNA
fragments was assessed with the Agilent DNA High Sensitivity kit on the Bioanalyzer
2100 (Agilent Technologies). Sequencing libraries were then generated using the
Wafergen PrepX Complete ILMN DNA Library kit (Takara Bio, Mountainview, CA)
protocol on the Apollo 324 NGS Library Prep System (Takara Bio). Quality of the DNA
sequencing libraries was performed with the Agilent DNA High Sensitivity kit on the
Bioanalyzer 2100 (Agilent Technologies). Concentration of the DNA libraries was doubly
confirmed using the Qubit dsDNA HS Assay kit (ThermoFisher Scientific, Waltham, MA)
47
and Kapa Illumina Library Quantification kit (Kapa Biosystems, Wilmington, MA). Libraries
were multiplexed and sequenced on either the Illumina Hiseq 2500 system (125 bp reads)
or Nextseq 500 (150 bp reads) (Illumina, San Diego, CA) at the Harvard Bauer Core
Sequencing Facility.
Sequencing analysis
Reads were trimmed using Trimmomatic (Bolger et al., 2014) to a minimum length
of 100 bp and poor quality reads were removed from the sequencing analysis. Alignment
was performed on the trimmed reads using Kallisto (Bray et al., 2016) and the previously
published well-annotated axolotl transcriptome (Bryant et al., 2017). Raw read data and
the processed data matrix containing TMM-normalized TPM values for each sample are
accessible on the NCBI GEO database: accession GSE111213. Differential expression
analysis of genes and transcripts relative to the non-regenerating timepoint (0 dpa) for
each fraction was performed using DESeq2 (Love et al., 2014) with an adjusted p-value
cutoff of 0.05. Core and comparison analysis of differentially expressed transcript lists for
each cellular population was performed using Ingenuity Pathway Analysis software
(Qiagen, Hilden, Germany). Uniprot IDs of transcript blast hits (extracted using the
associated Trinotate file in Bryant et al. (2017) were converted to human IDs for IPA
analysis. We focused on strongly activated or inhibited growth factor signaling pathways
i.e. absolute value of the Z-score > 1 and signal detected across at least 3 differentially
expressed analyses out of the 6 total.
To identify transcripts enriched within dividing cells at both timepoints, we first
compared dividing and non-dividing cells averaged at both regenerating timepoints (4 and
48
5 dpa) and identified 6,834 differentially expressed transcripts (3,510 of which were up-
regulated within dividing cells). Transcripts that were normally differentially expressed in
non-regenerating dividing and non-dividing cells (at 0 dpa), such as cell cycle-associated
transcripts, were filtered out. Of these, 628 total transcripts (583 genes) were
regeneration-specific, annotated, and had at least a 2-fold change between dividing and
non-dividing cells and only 298 transcripts in this list were up-regulated in dividing cells.
In situ hybridization and quantification
Tissue was collected at 0, 7 and 21 dpa and fixed in 4% paraformaldehyde
overnight at 4C, washed in PBS, brought up a sucrose gradient to 30% sucrose, and
embedded in OCT. The blocks were serially sectioned and 16 um sections were collected.
Custom RNAscope probes for the axolotl orthologs of top2a, tm119, and lin41 were
generated (Advanced Cell Diagnostics, Newark, CA) in either the C1 or C2 channels.
Double chromogenic section in situ hybridization was performed using the RNAscope 2.5
HD Duplex Detection Kit (Advanced Cell Diagnostics) according to the manufacturer’s
instructions on frozen cryosections.
2.7. References
Akiyama, R., Kawakami, H., Wong, J., Oishi, I., Nishinakamura, R. and Kawakami, Y. (2015). Sall4-Gli3 system in early limb progenitors is essential for the development of limb skeletal elements. Proc Natl Acad Sci U S A 112, 5075-5080.
Attisano, L. and Wrana, J. L. (2013). Signal integration in TGF-beta, WNT, and Hippo pathways. F1000Prime Rep 5, 17.
Bolger, A. M., Lohse, M. and Usadel, B. (2014). Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics 30, 2114-2120.
49
Bray, N. L., Pimentel, H., Melsted, P. and Pachter, L. (2016). Near-optimal probabilistic RNA-seq quantification. Nat Biotechnol 34, 525-527.
Bryant, D. M., Johnson, K., DiTommaso, T., Tickle, T., Couger, M. B., Payzin-Dogru, D., Lee, T. J., Leigh, N. D., Kuo, T. H., Davis, F. G., et al. (2017). A Tissue-Mapped Axolotl De Novo Transcriptome Enables Identification of Limb Regeneration Factors. Cell Rep 18, 762-776.
Calve, S., Odelberg, S. J. and Simon, H. G. (2010). A transitional extracellular matrix instructs cell behavior during muscle regeneration. Dev Biol 344, 259-271.
Campbell, L. J., Suarez-Castillo, E. C., Ortiz-Zuazaga, H., Knapp, D., Tanaka, E. M. and Crews, C. M. (2011). Gene expression profile of the regeneration epithelium during axolotl limb regeneration. Dev Dyn 240, 1826-1840.
Chablais, F. and Jazwinska, A. (2010). IGF signaling between blastema and wound epidermis is required for fin regeneration. Development 137, 871-879.
Currie, J. D., Kawaguchi, A., Traspas, R. M., Schuez, M., Chara, O. and Tanaka, E. M. (2016). Live Imaging of Axolotl Digit Regeneration Reveals Spatiotemporal Choreography of Diverse Connective Tissue Progenitor Pools. Dev Cell 39, 411-423.
Deltcheva, E. and Nimmo, R. (2017). RUNX transcription factors at the interface of stem cells and cancer. Biochem J 474, 1755-1768.
Denis, J. F., Sader, F., Gatien, S., Villiard, E., Philip, A. and Roy, S. (2016). Activation of Smad2 but not Smad3 is required to mediate TGF-beta signaling during axolotl limb regeneration. Development 143, 3481-3490.
Erickson, J. R., Gearhart, M. D., Honson, D. D., Reid, T. A., Gardner, M. K., Moriarity, B. S. and Echeverri, K. (2016). A novel role for SALL4 during scar-free wound healing in axolotl. NPJ Regen Med 1.
Farkas, J. E., Freitas, P. D., Bryant, D. M., Whited, J. L. and Monaghan, J. R. (2016). Neuregulin-1 signaling is essential for nerve-dependent axolotl limb regeneration. Development 143, 2724-2731.
50
Farkas, J. E. and Monaghan, J. R. (2017). A brief history of the study of nerve dependent regeneration. Neurogenesis (Austin) 4, e1302216.
Fuxe, J., Vincent, T. and Garcia de Herreros, A. (2010). Transcriptional crosstalk between TGF-beta and stem cell pathways in tumor cell invasion: role of EMT promoting Smad complexes. Cell Cycle 9, 2363-2374.
Gerber, T., Murawala, P., Knapp, D., Masselink, W., Schuez, M., Hermann, S., Gac-Santel, M., Nowoshilow, S., Kageyama, J., Khattak, S., et al. (2018). Single-cell analysis uncovers convergence of cell identities during axolotl limb regeneration. Science.
Godwin, J., Kuraitis, D. and Rosenthal, N. (2014). Extracellular matrix considerations for scar-free repair and regeneration: insights from regenerative diversity among vertebrates. Int J Biochem Cell Biol 56, 47-55.
Grotek, B., Wehner, D. and Weidinger, G. (2013). Notch signaling coordinates cellular proliferation with differentiation during zebrafish fin regeneration. Development 140, 1412-1423.
Haas, B. J. and Whited, J. L. (2017). Advances in Decoding Axolotl Limb Regeneration. Trends Genet 33, 553-565.
Hrvatin, S., Deng, F., O'Donnell, C. W., Gifford, D. K. and Melton, D. A. (2014). MARIS: method for analyzing RNA following intracellular sorting. PLoS One 9, e89459.
Kanamoto, T., Mizuhashi, K., Terada, K., Minami, T., Yoshikawa, H. and Furukawa, T. (2009). Isolation and characterization of a novel plasma membrane protein, osteoblast induction factor (obif), associated with osteoblast differentiation. BMC Dev Biol 9, 70.
Knapp, D., Schulz, H., Rascon, C. A., Volkmer, M., Scholz, J., Nacu, E., Le, M., Novozhilov, S., Tazaki, A., Protze, S., et al. (2013). Comparative transcriptional profiling of the axolotl limb identifies a tripartite regeneration-specific gene program. PLoS One 8, e61352.
Kragl, M., Knapp, D., Nacu, E., Khattak, S., Maden, M., Epperlein, H. H. and Tanaka, E. M. (2009). Cells keep a memory of their tissue origin during axolotl limb regeneration. Nature 460, 60-65.
51
Kragl, M., Roensch, K., Nusslein, I., Tazaki, A., Taniguchi, Y., Tarui, H., Hayashi, T., Agata, K. and Tanaka, E. M. (2013). Muscle and connective tissue progenitor populations show distinct Twist1 and Twist3 expression profiles during axolotl limb regeneration. Dev Biol 373, 196-204.
Kumar, A. and Brockes, J. P. (2007). Preparation of cultured myofibers from larval salamander limbs for cellular plasticity studies. Nat Protoc 2, 939-947.
Leigh, N. D., Dunlap, G. S., Johnson, K., Mariano, R., Oshiro, R., Wong, A. Y., Bryant, D. M., Miller, B. M., Ratner, A., Chen, A., et al. (2018). Transcriptomic landscape of the blastema niche in regenerating adult axolotl limbs at single-cell resolution. Nat Commun 9, 5153.
Levesque, M., Gatien, S., Finnson, K., Desmeules, S., Villiard, E., Pilote, M., Philip, A. and Roy, S. (2007). Transforming growth factor: beta signaling is essential for limb regeneration in axolotls. PLoS One 2, e1227.
Love, M. I., Huber, W. and Anders, S. (2014). Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol 15, 550.
Makanae, A., Mitogawa, K. and Satoh, A. (2014). Co-operative Bmp- and Fgf-signaling inputs convert skin wound healing to limb formation in urodele amphibians. Dev Biol 396, 57-66.
McCusker, C., Bryant, S. V. and Gardiner, D. M. (2015). The axolotl limb blastema: cellular and molecular mechanisms driving blastema formation and limb regeneration in tetrapods. Regeneration (Oxf) 2, 54-71.
McNeill, H. and Woodgett, J. R. (2010). When pathways collide: collaboration and connivance among signalling proteins in development. Nat Rev Mol Cell Biol 11, 404-413.
Mizuhashi, K., Chaya, T., Kanamoto, T., Omori, Y. and Furukawa, T. (2015). Obif, a Transmembrane Protein, Is Required for Bone Mineralization and Spermatogenesis in Mice. PLoS One 10, e0133704.
Mizuhashi, K., Kanamoto, T., Ito, M., Moriishi, T., Muranishi, Y., Omori, Y., Terada, K., Komori, T. and Furukawa, T. (2012). OBIF, an osteoblast induction factor, plays an essential role in bone formation in association with osteoblastogenesis. Dev Growth Differ 54, 474-480.
52
Monaghan, J. R., Athippozhy, A., Seifert, A. W., Putta, S., Stromberg, A. J., Maden, M., Gardiner, D. M. and Voss, S. R. (2012). Gene expression patterns specific to the regenerating limb of the Mexican axolotl. Biol Open 1, 937-948.
Monaghan, J. R., Epp, L. G., Putta, S., Page, R. B., Walker, J. A., Beachy, C. K., Zhu, W., Pao, G. M., Verma, I. M., Hunter, T., et al. (2009). Microarray and cDNA sequence analysis of transcription during nerve-dependent limb regeneration. BMC Biol 7, 1.
Nacu, E., Gromberg, E., Oliveira, C. R., Drechsel, D. and Tanaka, E. M. (2016). FGF8 and SHH substitute for anterior-posterior tissue interactions to induce limb regeneration. Nature 533, 407-410.
Neff, A. W., King, M. W., Harty, M. W., Nguyen, T., Calley, J., Smith, R. C. and Mescher, A. L. (2005). Expression of Xenopus XlSALL4 during limb development and regeneration. Dev Dyn 233, 356-367.
Neptune, E. R., Frischmeyer, P. A., Arking, D. E., Myers, L., Bunton, T. E., Gayraud, B., Ramirez, F., Sakai, L. Y. and Dietz, H. C. (2003). Dysregulation of TGF-beta activation contributes to pathogenesis in Marfan syndrome. Nat Genet 33, 407-411.
Poss, K. D., Shen, J., Nechiporuk, A., McMahon, G., Thisse, B., Thisse, C. and Keating, M. T. (2000). Roles for Fgf signaling during zebrafish fin regeneration. Dev Biol 222, 347-358.
Randell, A. and Daneshtalab, N. (2017). Elastin microfibril interface-located protein 1, transforming growth factor beta, and implications on cardiovascular complications. J Am Soc Hypertens 11, 437-448.
Ritenour, A. M. and Dickie, R. (2017). Inhibition of Vascular Endothelial Growth Factor Receptor Decreases Regenerative Angiogenesis in Axolotls. Anat Rec (Hoboken) 300, 2273-2280.
Rodrigo Albors, A., Tazaki, A., Rost, F., Nowoshilow, S., Chara, O. and Tanaka, E. M. (2015). Planar cell polarity-mediated induction of neural stem cell expansion during axolotl spinal cord regeneration. Elife 4, e10230.
Sandoval-Guzman, T., Wang, H., Khattak, S., Schuez, M., Roensch, K., Nacu, E., Tazaki, A., Joven, A., Tanaka, E. M. and Simon, A. (2014). Fundamental
53
differences in dedifferentiation and stem cell recruitment during skeletal muscle regeneration in two salamander species. Cell Stem Cell 14, 174-187.
Satoh, A., makanae, A., Hirata, A. and Satou, Y. (2011). Blastema induction in aneurogenic state and Prrx-1 regulation by MMPs and FGFs in Ambystoma mexicanum limb regeneration. Dev Biol 355, 263-274.
Shibata, E., Yokota, Y., Horita, N., Kudo, A., Abe, G., Kawakami, K. and Kawakami, A. (2016). Fgf signalling controls diverse aspects of fin regeneration. Development 143, 2920-2929.
Singh, B. N., Koyano-Nakagawa, N., Donaldson, A., Weaver, C. V., Garry, M. G. and Garry, D. J. (2015). Hedgehog Signaling during Appendage Development and Regeneration. Genes (Basel) 6, 417-435.
Slack, F. J., Basson, M., Liu, Z., Ambros, V., Horvitz, H. R. and Ruvkun, G. (2000). The lin-41 RBCC gene acts in the C. elegans heterochronic pathway between the let-7 regulatory RNA and the LIN-29 transcription factor. Mol Cell 5, 659-669.
Stewart, R., Rascon, C. A., Tian, S., Nie, J., Barry, C., Chu, L. F., Ardalani, H., Wagner, R. J., Probasco, M. D., Bolin, J. M., et al. (2013). Comparative RNA-seq analysis in the unsequenced axolotl: the oncogene burst highlights early gene expression in the blastema. PLoS Comput Biol 9, e1002936.
Stocum, D. L. (2017). Mechanisms of urodele limb regeneration. Regeneration (Oxf) 4, 159-200.
Stoick-Cooper, C. L., Weidinger, G., Riehle, K. J., Hubbert, C., Major, M. B., Fausto, N. and Moon, R. T. (2007). Distinct Wnt signaling pathways have opposing roles in appendage regeneration. Development 134, 479-489.
Sugiura, T., Wang, H., Barsacchi, R., Simon, A. and Tanaka, E. M. (2016). MARCKS-like protein is an initiating molecule in axolotl appendage regeneration. Nature 531, 237-240.
Umansky, K. B., Gruenbaum-Cohen, Y., Tsoory, M., Feldmesser, E., Goldenberg, D., Brenner, O. and Groner, Y. (2015). Runx1 Transcription Factor Is Required for Myoblasts Proliferation during Muscle Regeneration. PLoS Genet 11, e1005457.
54
Vinarsky, V., Atkinson, D. L., Stevenson, T. J., Keating, M. T. and Odelberg, S. J. (2005). Normal newt limb regeneration requires matrix metalloproteinase function. Dev Biol 279, 86-98.
Voss, S. R., Palumbo, A., Nagarajan, R., Gardiner, D. M., Muneoka, K., Stromberg, A. J. and Athippozhy, A. T. (2015). Gene expression during the first 28 days of axolotl limb regeneration I: Experimental design and global analysis of gene expression. Regeneration (Oxf) 2, 120-136.
Worringer, K. A., Rand, T. A., Hayashi, Y., Sami, S., Takahashi, K., Tanabe, K., Narita, M., Srivastava, D. and Yamanaka, S. (2014). The let-7/LIN-41 pathway regulates reprogramming to human induced pluripotent stem cells by controlling expression of prodifferentiation genes. Cell Stem Cell 14, 40-52.
Wu, C. H., Tsai, M. H., Ho, C. C., Chen, C. Y. and Lee, H. S. (2013). De novo transcriptome sequencing of axolotl blastema for identification of differentially expressed genes during limb regeneration. BMC Genomics 14, 434.
Yokoyama, H., Ide, H. and Tamura, K. (2001). FGF-10 stimulates limb regeneration ability in Xenopus laevis. Dev Biol 233, 72-79.
Yokoyama, H., Yonei-Tamura, S., Endo, T., Izpisua Belmonte, J. C., Tamura, K. and Ide, H. (2000). Mesenchyme with fgf-10 expression is responsible for regenerative capacity in Xenopus limb buds. Dev Biol 219, 18-29.
Yu, L., Yan, M., Simkin, J., Ketcham, P. D., Leininger, E., Han, M. and Muneoka, K. (2014). Angiogenesis is inhibitory for mammalian digit regeneration. Regeneration (Oxf) 1, 33-46.
56
3.1. Preface
The work presented in this chapter was largely modified and adapted to fit the
guidelines of this dissertation from the following publication: Tsai S.L., Baselga-Garriga
C., and Melton D.A. (2019). Blastemal progenitors modulate immune signaling during
early limb regeneration. Development:146(1). The conceptualization and experimental
design was performed in collaboration with Doug. I performed all of the experiments and
the data analysis, except for the blinded counting analysis of the myeloid cells in the il-8
and control morphants, which was performed by Clara.
3.2. Abstract
The list of blastemal progenitor-enriched transcripts during early limb regeneration
generated in Chapter 2 was a rich source of gene candidates that could help us and
others in the field gain further insight into blastema cell biology. In this chapter, we
examined the functional role of one enriched candidate, il-8, in limb regeneration. Through
the experiments detailed within this section, we demonstrate that blastemal progenitors
play an immunomodulatory role during early stages of regeneration via il-8 signaling. In
addition, we also identify and establish the importance of early CXCR-1/2 signaling in
limb regeneration. In all, these results suggest that bi-directional cross-talk between the
blastemal cells and immune system is essential for successful regeneration.
3.3. Introduction
Many advances have been made in the last decades revealing crucial roles that
immune cells play in modulating tissue repair and injury responses. Beyond their
57
canonical functions in debris clearance and preventing infection as a consequence of
injury, immune cells have been shown to actively stimulate progenitor stem cell activation
and differentiation in a variety of organ and tissue regenerative contexts (Aurora and
Olson, 2014).
Out of the entire immune cell repertoire, macrophages are perhaps the most well
studied in regeneration, although others have begun to demonstrate the importance of
other cell types including Tregs and eosinophils (Burzyn et al., 2013; Heredia et al., 2013).
Macrophages can be polarized into two interchangeable functional phenotypes, M1 (pro-
inflammatory) and M2 (pro-regenerative) depending on extracellular cues from the
surrounding environment (Sica and Mantovani, 2012). Various studies have
demonstrated the significance of the shift from M1 to M2 states between early and late
stages of repair or regeneration in different contexts including skeletal muscle (Mounier
et al., 2013) and central nervous system (CNS) regeneration in mice (Miron et al., 2013).
Interestingly, while M1 macrophages have traditionally been thought to be detrimental for
regenerative outcomes, they also play essential early roles in these contexts as well
including progenitor cell activation and debris clearance. In fact, premature activation of
M2 polarization impairs skeletal muscle regeneration (Perdiguero et al., 2011), indicating
that fine temporal modulation of M1/M2 polarization is necessary for successful repair.
The essential roles that macrophages play in organ and tissue injury contexts in
mice have translated to highly regenerative species as well. Macrophages have been
shown to be necessary for initiating appendage, heart, and ear hole regeneration in the
axolotl, zebrafish, and African spiny mouse (Godwin et al., 2013; Petrie et al., 2014;
Godwin et al., 2017; Simkin et al., 2017a). In addition, most of the work in the regenerative
58
models of salamanders and zebrafish has focused on the importance of myeloid cells in
the innate immune system including macrophages and neutrophils. These cells are
among some of the most abundant first responders post-amputation.
We noticed that several inflammatory cytokines were enriched within blastemal
progenitors in the dataset, one of which was interleukin-8 (il-8), a well-known
chemoattractant of neutrophils and macrophages (de Oliveira et al., 2013; Xu et al.,
2018). While many have shown the important paracrine effects that the immune system
has on successful regeneration, less is known about non-immune cell cues that direct
myeloid cell behaviors in these contexts. Our transcriptional data therefore suggested that
blastemal progenitors may directly modulate the immune system during regeneration.
To determine whether this was indeed the case, we investigated the expression of
il-8 throughout the course of limb regeneration and examined its potential role with gain-
and loss-of-function approaches. Il-8 expression was highly induced in blastemal
progenitors of the connective tissue lineages specifically during wound healing stages of
limb regeneration. Ectopic il-8 expression in non-regenerating limbs induced myeloid cell
recruitment, while IL-8 knockdown resulted in defective myeloid cell retention during late
wound healing, delaying regeneration. Furthermore, the il-8 receptor, cxcr-1/2, was
expressed in myeloid cells and inhibition of CXCR-1/2 signaling during early stages of
limb regeneration prevented regeneration. Altogether, our findings suggest that blastemal
progenitors are active, early mediators of immune support and identify CXCR-1/2
signaling as an important early immunomodulatory pathway in limb regeneration.
59
3.4. Results
3.4.1. Interleukin-8 (il-8) is expressed in early blastemal progenitors
Time course in situ hybridization for il-8 during limb regeneration revealed a strong,
transient up-regulation during early stages of regeneration (Figure 3.1). Il-8 was
undetectable in non-regenerating limbs (Figure 3.1A-A’) and highly induced upon
amputation (Figure 3.1B-E’). At 1 dpa, il-8 was expressed in cells lining the bone (Figure
3.1B-B’) and in the dermis. Il-8 expression peaked at 3 dpa in mesenchymal cells within
regenerating stump tissues and began to decrease by 7 dpa (Figure 3.1C-D’). By early
blastemal stages at 14 dpa, il-8 was weakly and sparsely expressed throughout the
blastema and basal layers of the apical epithelial cap (AEC) (Figure 3.1E-E’).
Previous studies have shown that il-8 is highly expressed in invading monocytes
in wound healing and tumorigenic contexts (Fu et al., 2015; Williams et al., 2016). In
contrast, double in situ hybridization of il-8 with two blastemal cell markers prrx-1 and
kazd1, as well as csf1-r, a monocyte marker in mammals and amphibians (Grayfer et al.,
2014; Stanley and Chitu, 2014) confirmed that il-8 was indeed expressed within blastemal
progenitors and not monocytes. At both 3 and 7 dpa, il-8 was co-expressed in a
subpopulation of prrx-1+ cells (Figure 3.1F), and exhibited little to no expression in csf1-
r+ monocytes (Figure 3.1G). Quantification of prrx-1+ and il-8+ populations revealed high
concordance between prrx-1 and il-8 expression. At 3 dpa, 99.0% of prrx-1+ cells
expressed il-8 and 96.6% of il-8+ cells expressed prrx-1. At 7 dpa, only 67.9% of prrx-1+
cells expressed il-8, but 97.5% of il-8+ cells expressed prrx-1, consistent with a decrease
in il-8 expression over time (Figure 3.1H). In contrast, at 3 dpa, only 3.8% of il-8+ cells
were
60
Figure 3.1. Il-8 is strongly expressed in blastemal progenitors during early stages
of limb regeneration. (A-E’) Time course double in situ hybridization of il-8 at 0, 1, 3, 7,
and 14 dpa. Il-8 is not expressed in non-regenerating limbs (0 dpa), begins expression at
1 dpa, peaks at 3 dpa, and remains strongly expressed, but in fewer cells at 7 dpa. By
early blastemal stages,14 dpa, il-8 expression has largely diminished, with weak
expression in sparse blastema cells and in the basal layers of the wound epidermis. The
amputation plane is demarcated with a solid line in panels A-E. Higher 40x magnification
images of the insets are shown in A’-E’. The dotted line in E’ marks the wound epidermis
boundary. (F) Double in situ hybridization of il-8 with the blastemal cell marker prrx-1 at
3 dpa 7 dpa
0
50
100
% o
f to
tal csf1r+ only
csf1r+/il-8+
il-8+ only
0 dpa 1 dpa 3 dpa 7 dpa 14 dpaA B C D E
A’ B’ C’ D’ E’
F G
il-8
prr
x-1
3 dpa 7 dpa 3 dpa 7 dpa
il-8
cs
f-1
r
3 dpa 7 dpa
0
50
100
% o
f to
tal prrx-1+ only
prrx-1+/il-8+
il-8+ only
H I 7 dpa
ka
zd
-1il-8
J
61
Figure 3.1. (Continued) both 3 and 7 dpa shows colocalization between il-8 and prrx-1.
Examples of co-positive cells are denoted with arrowheads. (G) Double in situ
hybridization of il-8 with the monocyte marker csf-1r at both 3 and 7 dpa shows little to no
colocalization between il-8 and csf-1r. Representative single positive csf-1r+ cells are
denoted with arrows, while single positive il-8+ cells are denoted by arrowheads. (H-I)
Quantification of double in situs shown in panels F and G. Graph in H shows percentage
breakdown of total counted il-8 and/or prrx-1 expressing cells (3 dpa, n=298 cells total,
7dpa, n=412 cells total). Graph in I shows percentage breakdown of total counted il-8
and/or csf-1r expressing cells (3 dpa, n= 500 cells total, 7 dpa, n=630 cells total). (J)
Double in situ hybridization of il-8 (blue) and kazd1 (red), a highly expressed blastemal
cell marker reveals co-expression of il-8 in a subset of kazd1+ blastemal cells (denoted
by arrowheads). Image was taken at 40x magnification. Scale bars in A-E, 200 µm, A’-E’,
50 µm, F, G, and J, 50 µm.
csf1r+ and 1.7% of csf1r+ cells were il-8+, while at 7 dpa, 4.4% of il-8+ cells were csf1r+
and 1.5% of csf1r+ cells were il-8+ (Figure 3.1I). Il-8 was also expressed in a subset of
kazd1+ blastemal progenitors at 7 dpa (Figure 3.1J). Altogether, these data provide
evidence that il-8 is strongly expressed within a subset of blastemal progenitors primarily
during early stages of limb regeneration.
3.4.2. IL-8 is sufficient to induce myeloid cell recruitment and proliferation in
bone/perichondrium and epidermis in non-regenerating limbs
Because il-8 was strongly expressed in blastemal progenitors, we examined
whether il-8 expression was sufficient to induce cell behaviors characteristic of the
initiation of blastema formation, such as immune cell recruitment or cellular proliferation.
We designed a myc-tagged il-8 overexpression vector (pCMV-IL8myc-T2A-tdTomato)
and control vector (pCMV-T2A-tdTomato) and validated secretion of myc-tagged IL-8
62
protein in 293T cells (Figure A.2.1). We injected and electroporated either the control
tdTomato vector or the il-8 overexpression vector into intact limbs of non-regenerating
animals, briefly pulsed the animals with EdU at 3 days post-injection, and collected
samples 24 hours later (Figure 3.2A).
As IL-8 is a well-known inflammatory cytokine (Zeilhofer and Schorr, 2000), we
first examined whether ectopic expression of il-8 induced monocyte and granulocyte
recruitment by performing -Naphthol Acetate (NSE) staining and Naphthol AS-D
Chloroacetate (NCAE) staining, respectively. A 2.3-fold increase in NSE+ monocytes
(117.53 vs. 51.94 cells/mm2, p = 0.0041) and a 2.0-fold increase in NCAE+ granulocytes
(121.54 vs. 61.97 cells/mm2, p = 0.0353) was observed in limbs expressing il-8 relative
to controls (Figure 3.2B-D’), indicating that IL-8 is sufficient to recruit myeloid cells.
We also assessed whether IL-8 could induce cellular proliferation by comparing
the percentage of total EdU+ cells between tdTomato and il-8 expressing limbs. We
observed a modest, yet significant increase in the total number of EdU+ cells in limbs
overexpressing il-8 compared to control tdTomato limbs (13.92% vs 11.27%, p = 0.0015)
(Fig 3.3A, C). Quantification of dividing bone/perichondrial, epidermal, endothelial, and
satellite cells revealed that this total increase in dividing cells was primarily due to an
increase in the percentage of dividing bone/perichondrial cells (17.78% vs. 8.71%, p =
0.004), though there is a modest increase in the percentage of dividing epidermal cells
(24.60% vs. 19.70%, p = 0.0146) (Figure 3.3B-E). No increase in proliferation was
observed in CD34+ endothelial cells or pax7+ muscle satellite cells. These data suggest
that ectopic il-8 expression is sufficient to promote proliferation of bone/perichondrial and
epidermal cells in a non-regenerative context, i.e. without amputation.
63
Figure 3.2. Il-8 induces recruitment of monocytes and granulocytes in intact limbs.
(A) Experimental schematic of il-8 overexpression experiment. The left limbs of axolotls
were injected and electroporated with a T2A-tdTomato control construct, whereas the
right limbs were injected and electroporated with an il8myc-T2A-tdTomato construct.
Animals were pulsed with EdU 24 hours prior to tissue collection at 4 days post-injection
(dpi). (B) Quantification of monocytes and granulocytes per mm2 revealed a statistically
significant increase in both monocytes (**pval = 0.0041, n=9) and granulocytes (*pval =
0.0353, n=9) in il-8 overexpression limbs. Statistical analyses were performed using a
two-tailed paired t-test. Error bars represent mean ± SD. (C-D’) Representative 10x
montage images of NSE/NCAE stained limbs in control or il-8 overexpression limbs are
shown in C and D, respectively. Scale bars denote 200 µm. Higher 20x magnification
images of the insets in panels C’ and D’, respectively. NSE+ monocytes are stained in
tdT IL-8 tdT IL-8
0
100
200
300
400
**
*
Monocytes Granulocytes
Cells
/mm
2
C
D
C’
D’
tdTomato
IL8-myc
tdTomato
IL8-myc
0 3 4
Injection
and Electroporation
(pCMV-IL8myc-T2A-tdTomato or
pCMV-T2A-tdTomato)
EdU
Limb
Collection
days post-inj.
(dpi)
BA
64
Figure 3.2. (Continued) black and NCAE+ granulocytes are stained in purple.
Arrowheads point to representative monocytes and arrows point to representative
granulocytes. Scale bar denotes 20 µm and the dotted lines denote bone.
65
Figure 3.3. Il-8 is sufficient to induce proliferation of bone/perichondrial cells and
epidermis. (A-B) Quantification of total EdU+ cells and cell-type specific EdU+ cells in
control vs. il-8 overexpression limbs revealed a mild statistically significant increase in the
total percentage of EdU+ cells (**pval = 0.0015, n=8), a strong significant increase in the
percentage of dividing bone/perichondrial cells (***pval = 0.0004, n=8), and a mild
increase in the percentage of dividing epidermal cells (*pval = 0.0146, n=8). No significant
increase was detected in CD34+ endothelial cells or pax7+ satellite cells. All statistical
analyses were done using a two-tailed paired t-test. Error bars represent mean ± SD. (C)
tdT IL-8
0
5
10
15
20**
To
tal %
Ed
U+
Nu
cle
i0
20
40
60
***
*
ns
ns
% E
dU
+ C
ells p
er
Cell T
yp
e
Bone/Perichondrial
Cells
EpidermalCells
CD34+
Endothelial Cells
Pax7+ Satellite
Cells
IL-8tdT
C tdTomato EdU DAPI EdU
tdTo
mato
IL8
-my
c
A B
D tdT
EdU DAPI
E IL8-myc
EdU DAPI
66
Figure 3.3. (Continued) Representative 10x montage images from control or il-8
overexpression limbs. Scale bars denote 200 µm. (D-E) High magnification images of
insets from C. Representative 20x images of the bone and surrounding perichondrium of
control (D) or il-8 (E) overexpression limbs. Arrowheads denote EdU+ perichondrial cells.
Scale bars denote 20 µm. The yellow dotted lines in panels C-E denote bone within the
tissue. Ns, non-significant.
3.4.3. Knockdown of IL-8 results in delayed blastemal outgrowth and regeneration
We next examined whether loss of function of il-8 may impair limb regeneration.
To this end, we performed a dual pulse morpholino experiment (Figure 3.4A) using
translation-blocking il-8 targeted or control morpholinos, injected into either the right or
left forelimb, at 2 days pre-amputation and 3 dpa. This treatment produced a strong and
transient knockdown of endogenous IL-8 protein levels (Figure A.2.1F). Il-8 morpholino
treated limbs displayed delayed blastemal outgrowth (Figure 3.4B). Quantification at 21
dpa revealed a 37% decrease in blastemal length (572.89 vs. 915.40 µm, p < 0.0001)
and a 32% reduction in blastemal area (491.29 vs. 723.90 µm, p = 0.0005) (Figure 3.4C-
F). In addition, control limbs reached digit stages of differentiation before il-8 morphant
limbs (Figure 3.4B), indicating that transient knockdown of IL-8 delays limb regeneration.
At this time point, there was no defect in cell proliferation in either blastemal cells or the
wound epidermis (Figure A.2.2) and no visible phenotypes with the blastema aside from
the difference in size. These observations in conjunction with the strong expression of il-
8 during early stages of limb regeneration suggested that il-8 morphant limbs were likely
exhibiting defects at earlier timepoints in regeneration.
67
Figure 3.4. Il-8 knockdown results in delayed blastemal outgrowth and
regeneration. (A) Schematic of the dual pulse morpholino experiment. The forelimbs of
an axolotl were injected with either control morpholino (left limb) or translation-blocking il-
8 morpholino (right limb) at 2 days pre-amputation and 3 days post-amputation. Limbs
were then collected at 21 dpa. (B) Representative brightfield images of the delay in
blastemal outgrowth and regeneration. Scalebars denote 1 mm. (C-D) Picromallory
stained sections of control and il-8 MO injected limbs. Scalebars represent 500 µm. The
dotted lines demarcate the amputation plane. (E) Quantification of blastema length in
control vs. il-8 MO injected limbs. Il-8 MO injected limbs exhibited a statistically significant
decrease in blastema length (****pval < 0.0001, n=19). (F) Quantification of blastema area
in control vs. il-8 MO injected limbs. Il-8 MO injected limbs exhibit a significant decrease
in blastemal area (***pval < 0.0005, n=19). Paired two-tailed t-tests were employed for
statistical analyses. Error bars represent mean ± SD.
control MO il-8 MO
0
500
1000
1500
Bla
ste
ma
Len
gth
(um
)****
A
MO Injection
Amputation
-2 0 3 21
Collect Tissue
dpa
(days post-amputation)
MO Injection
B control MO il-8 MO
15
dp
a2
6 d
pa
C D
E
control MO il-8 MO
control MO il-8 MO
0
500
1000
1500
Bla
ste
ma A
rea
(mm
2)
***F
68
3.4.4. IL-8 knockdown leads to defective retention of myeloid cells during the wound
healing transition to blastema formation
Since ectopic il-8 expression was sufficient to recruit immune cells, we
hypothesized that il-8 morphant limbs may exhibit deficiencies in myeloid cell recruitment.
Surprisingly, we observed no significant deficiency in recruitment of either NCAE+
granulocytes or NSE+ monocytes to the amputation site at either 1 dpa or 5 dpa (Figure
3.5A, D). However, the mean density of granulocytes was lower overall than that of
controls at both of these timepoints, suggesting that il-8 may play a minor role in recruiting
granulocytes during wound healing. More interestingly, there was a significant decrease
in both granulocytes (374.16 vs. 483.24 cells/mm2, p < 0.01) and monocytes (198.20 vs.
290.92 cells/mm2, p<0.05) during later stages of wound healing at 7 dpa (Fig 3.5). We did
not observe a difference in overall cell proliferation or cell death at this time point.
Therefore, the data suggest that il-8 likely plays a role in retaining both granulocytes and
monocytes during the transition from wound healing to blastema formation.
To determine whether IL-8 was directly regulating myeloid cell behaviors, we
examined the expression pattern of its cognate receptors, cxcr-1 and cxcr-2, during early
stages of regeneration. While other organisms including mammals have both receptors,
analysis of publicly available transcriptomes for the axolotl (Bryant et al., 2017;
Nowoshilow et al., 2018) revealed only one receptor with homology to both cxcr-1 and
cxcr-2 in different species. We therefore refer to the detectable cognate receptor as cxcr-
1/2. Double in situ hybridization of cxcr-1/2 with csf1r or mpo, a neutrophil marker (Walters
et al., 2010), at 3 dpa revealed co-expression of cxcr-1/2 with subpopulations of csf1r+
and mpo+ cells (Figure 3.6), suggesting that IL-8 likely directly acts on subpopulations of
69
Figure 3.5. Il-8 knockdown results in defective retention of myeloid cells during the
transition from wound healing into blastema formation. (A) Quantification of NCAE+
granulocytes in control or il-8 MO limbs at 1, 5, or 7 dpa revealed a statistically significant
decrease at 7 dpa (**p < 0.01, n=9). Error bars represent mean ± SD. (B-C’)
Representative 10x montage images of control and il-8 MO limbs at 7 dpa are shown in
B and C, respectively. Insets represent 40x magnification images shown in B’ and C’. (D)
Quantification of NSE+ monocytes in control or il-8 MO limbs at 1, 5, or 7 dpa revealed a
statistically significant decrease at 7 dpa (*p < 0.05, n=9). Error bars represent mean ±
SD. (E-F’) Representative 10x montage images of control and il-8 MO limbs at 7 dpa are
shown in E and F, respectively. Insets represent 40x magnification images shown in E’
and F’. Paired two-tailed t-tests were employed for statistical analyses. Scalebars in B-C
and E-F denote 200 um; in B’-C’ and E’-F’ represent 50 µm. Asterisks (*) in B-C and E-F
denote the bone. Dotted lines in B’-C’ and E’-F’ demarcate the boundary of the bone.
0
200
400
600
800
1000
1 dpa 5 dpa 7 dpa
NS
E+
ce
lls/m
m2
ns
ns
*
control MO il-8 MO
B
C
E
F
granulocytes
granulocytes
monocytes
monocytes
il-8 MO
il-8 MO
control MO
control MO
*
* *
*
*
D
B’
C’
E’
F’
0
200
400
600
800
control MO il-8 MO
ns
ns
**
1 dpa 5 dpa 7 dpa
NC
AE
+ c
ells/m
m2
A
70
Figure 3.6. Cxcr-1/2 is expressed in subsets of monocytes and granulocytes.
Double in situ hybridization of cxcr-1/2 and either csf1r, a monocyte marker (A), or mpo,
a neutrophil marker (B). Both co-positive cxcr-1/2+ csf1r+ cells and cxcr-1/2+ mpo+ cells
were apparent at 3 dpa (denoted by orange arrows). However, not all csf1r+ and mpo+
cells were positive, suggesting cxcr-1/2 is expressed in a subset of monocytes and
granulocytes. Insets show where in the section the 63x magnification image was taken.
Scale bar denotes 20 m.
monocytes and granulocytes including neutrophils during wound healing. Altogether,
these data provide one of the first examples of blastemal progenitors as
immunomodulators, specifically as the source of canonical chemokines, during wound
healing and further suggests that retention of myeloid cells during the transition to
blastema formation is critical.
3.4.5. CXCR-1/2 signaling is necessary for limb regeneration
Finally, we asked whether inhibition of CXCR-1/2 signaling would also impair limb
regeneration. We perturbed the pathway by treating regenerating axolotls with a small
molecule inhibitor of CXCR-1/2, SB-225002 (White et al., 1998) (Figure 3.7A). Inhibitor
treatment beginning from the time of amputation (0 dpa) completely inhibited limb
regeneration, while DMSO-treated limbs regenerated normally (Figure 3.7B-E). Due to
cxcr1/2 cxcr1/2csf1r mpoA B
71
Figure 3.7. Early CXCR-1/2 signaling is necessary for limb regeneration. (A)
Experimental schematic of different SB-225002 drug treatments beginning at 0, 3, or 15
dpa. (B-E) SB-225002 treatment beginning from 0 dpa inhibits limb regeneration.
Brightfield images of regenerating limbs treated with DMSO or SB-225002 at 17 dpa are
shown in B and C, respectively. Alcian stained DMSO- or SB-225002-treated limbs at 40
dpa are shown in D and E. (F-I) SB-225002 treatment beginning at 3 dpa prevents limb
regeneration. Brightfield images of DMSO- or SB-225002-treated limbs at 17 or 40 dpa
are shown in panels F-I. (J-K) Limbs regenerate normally if SB-225002 treatment begins
after blastema formation (15 dpa). Brightfield images of DMSO- or SB-225002-treated
limbs at 30 dpa are shown in panels J and K, respectively. Arrows in B-K denote the
amputation plane. Scale bars in B-K represent 1 mm.
72
the well documented role of CXCR-1/2 signaling in immediate wound-associated
inflammatory responses (Ha et al., 2017), we hypothesized that failure to regenerate in
this context was mainly due to prevention of immediate inflammatory responses
stimulated by limb amputation. Therefore, we treated regenerating animals with SB-
225002 beginning at later stages of wound healing (3 dpa) and found that this also
prevented regeneration (Figure 3.7F-I), suggesting that prolonged CXCR-1/2 signaling is
essential. Yet, treatment beginning after blastema formation (15 dpa) led to normal limb
regeneration (Figure 3.7J-K). In all, these data suggest that CXCR-1/2 signaling is
necessary during early stages of regeneration, but dispensable for later stages.
Since il-8 morphants displayed defective retention of myeloid cells during late
wound healing, we examined whether inhibition of CXCR-1/2 signaling affected myeloid
cell behavior similarly during early stages of regeneration. Unexpectedly, monocytes and
granulocytes in SB-225002-treated limbs (from 0 dpa) displayed unhealthy morphologies
at 7 dpa. The majority of NSE+ and NCAE+ cells at the distal amputation site had formed
apoptotic bodies, suggestive of myeloid cell death (Figure 3.8A). Quantification of healthy
NCAE+ and NSE+ myeloid cells revealed statistically significant decreases in both
populations in SB-225002-treated limbs at 7 dpa compared to DMSO controls (Figure
3.8B-C, NCAE+ granulocytes: 128.9 vs. 362.3 cells/mm2, p<0.0001, NSE+ monocytes:
94.71 vs. 240.6 cells/mm2, p=0.0022). In concurrence with these observations, TUNEL
staining of inhibitor treated limbs revealed higher levels of cell death near the amputation
plane at 7 dpa (6.03% vs. 1.47%, p=0.0154) (Figure 3.8D), suggesting that myeloid cells
were likely undergoing apoptosis. Interestingly, increased cell death was not observed in
il-8 morphant limbs, suggesting that other cytokines in addition to il-8 may synergistically
73
Figure 3.8. CXCR-1/2 inhibition impacts myeloid cell survival during early limb
regeneration. (A) Images of NCAE+, NSE+, or TUNEL+ cells in DMSO- or SB-225002-
treated limbs at 7 dpa with treatment beginning from 0 dpa (DMSO, n=4, SB-225002,
n=5). Insets of fully stained sections in bottom left corners show where the higher
magnification image was taken. Scale bars represent 50 µm. Asterisks denote
autofluorescent bone in TUNEL-stained sections. White arrows denote healthy NCAE+ or
NSE+ cells, whereas white arrowheads denote unhealthy NCAE+ or NSE+ cells exhibiting
apoptotic bodies. (B) Quantification of NCAE+ granulocytes with healthy morphology
revealed a statistically significant decrease in SB-225002-treated limbs (362.3 vs. 128.9
cells, ****p<0.0001). (C) Quantification of NSE+ granulocytes with healthy morphology
revealed a statistically significant decrease in SB-225002-treated limbs (240.6 vs. 94.71
cells, **p=0.0022). (D) Quantification of TUNEL+ nuclei revealed higher levels of cell death
in SB-225002-treated limbs (6.033% vs. 1.46%, *p=0.0172). Unpaired two-tailed t-tests
were employed for statistical analyses. All error bars represent mean ± SD.
DMSO SB-225002
0
100
200
300
400
500
NC
AE
+ c
ells/m
m2
****
A Granulocytes Monocytes TUNEL
DM
SO
SB
-22
50
02
DMSO SB-225002
0
100
200
300
400
NS
E+
cells/m
m2
**
DMSO SB-225002
0
5
10
15
% T
UN
EL
+
nu
cle
i *
B C D
74
modulate myeloid cell behaviors. Altogether, these data newly identify CXCR-1/2
signaling as an immunomodulatory pathway that is in part, regulated by IL-8, and crucial
for successful blastema formation.
3.5. Discussion
Here we provide one of the first examples that blastemal progenitors play an early
paracrine immunomodulatory role in appendage regeneration. Others have shown that
IL-8 recruits neutrophils and macrophages in zebrafish organ and appendage
regeneration (de Oliveira et al., 2013; Xu et al., 2018); however, the source of IL-8 was
not examined. Contrary to other injury and tumorigenic contexts, where IL-8 is secreted
from macrophages (Arango Duque and Descoteaux, 2014), we found that the primary
source of IL-8 in early stages of limb regeneration is a subpopulation of blastemal
progenitors. Furthermore, the high concordance of expression between il-8 and prrx-1,
recently demonstrated as a connective tissue blastemal cell marker (Gerber et al., 2018),
suggests that il-8 is primarily expressed in early regenerating connective tissue.
Meanwhile, its receptor cxcr1/2 is expressed in myeloid cells. Our functional data further
shows the importance of signaling between blastemal progenitors and the immune
system. Il-8 knockdown delayed regeneration and CXCR-1/2 inhibition prevented limb
regeneration. We also demonstrate that Il-8 can recruit both myeloid cell-types in non-
regenerating limbs. Thus, while leukocytes have been shown to regulate blastemal cells
in other models (Nguyen-Chi et al., 2017), our findings newly suggest that blastemal
progenitors direct immune support and that this bi-directional signaling is important for
early stages of regeneration.
75
Failure to retain myeloid cells during the transition from wound healing to blastema
formation may account for the regenerative delay in il-8 morphants. Monocyte-derived
macrophages are necessary for successful appendage regeneration in the axolotl and
other model systems, playing roles including directing blastemal outgrowth, clearing
senescent cells, and modulating blastemal cell proliferation (Li et al., 2012; Godwin et al.,
2013; Petrie et al., 2014; Yun et al., 2015; Nguyen-Chi et al., 2017; Simkin et al., 2017b).
Others have demonstrated the importance of pro-regenerative (M2) rather than pro-
inflammatory (M1) macrophage subtypes in regeneration (Pei et al., 2016; Simkin et al.,
2017b). Therefore, it is possible that IL-8 may retain M2 macrophages during the initiation
of blastema formation. The extent of the role of granulocytes in regeneration, however,
seems to be more context dependent (Nakayama et al., 2011; Li et al., 2012; Kurimoto et
al., 2013; Paris et al., 2016; Lindborg et al., 2017). Granulocytes, including neutrophils,
clear debris during wound healing (Wang, 2018). Therefore, low levels of granulocytes in
il-8 morphants may have slowed wound healing, delaying regeneration. Furthermore, in
the zebrafish, IL-8 can act as a potent neutrophil chemoattractant (de Oliveira et al., 2013;
de Oliveira et al., 2016) or a chemokinetic molecule, aiding in neutrophil reverse migration
away from sites of injury through Cxcr2 signaling (Powell et al., 2017). In contrast, our
findings suggest that IL-8 may retain granulocytes including neutrophils during late wound
healing rather than facilitate their exit strategy as in the zebrafish, highlighting potential
species-specific differences in immune responses during regeneration. As IL-8 morphant
limbs eventually regenerate, it is clear that other pathways compensate to ensure wound
healing resolution.
76
Lastly, we show that CXCR-1/2 signaling is necessary during early, but not late,
stages of limb regeneration. CXCR-1/2 inhibitor-treated limbs beginning during early and
late stages of wound healing failed to form a blastema. The high level of myeloid cell
death, which was not observed in il-8 morphants, during early regeneration was likely the
main cause of failure to regenerate, suggesting that CXCR-1/2 signaling may serve as an
important survival pathway for monocytes and granulocytes in early limb regeneration.
Additionally, the difference in severity of phenotypes between IL-8 morphant and CXCR-
1/2 inhibitor-treated limbs is likely attributed to the fact that CXCR-1/2 binds to other
interleukins including IL-1 and IL-6 (Baggiolini et al., 1997). Therefore, it is possible that
other cytokines are acting in concert with IL-8 to control CXCR-1/2 specific myeloid cell
behaviors during early limb regeneration. Altogether, these data highly suggest that
CXCR-1/2 signaling may be key in bridging communication between early blastemal cells
and the immune system during the initiation of regeneration.
3.6. Materials and Methods
Animal procedures
Axolotl (Ambystoma mexicanum) husbandry and surgeries were performed in
accordance with the Association for Assessment and Accreditation of Laboratory Animal
Care (AAALAC) and Institutional Animal Care and Use Committee (IACUC) guidelines at
Harvard University. Juvenile white axolotls (5-8 cm) were used for all morpholino and
overexpression experiments. For CXCR-1/2 inhibitor experiments, animals (3-5 cm) were
immersed in either 500 nM SB-225002 (Tocris Bioscience) or DMSO (Sigma) beginning
at either 0, 3, or 15 dpa and solutions were changed daily.
77
In situ hybridization and quantification
Tissue was collected at 0, 7 and 21 dpa and fixed in 4% paraformaldehyde
overnight at 4C, washed in PBS, brought up a sucrose gradient to 30% sucrose, and
embedded in OCT. The blocks were serially sectioned and 16 um sections were collected.
Custom RNAscope probes for the axolotl orthologs of cxcr-1/2, csf1r, il-8, kazd1, mpo,
and prrx-1 were generated (Advanced Cell Diagnostics, Newark, CA) in either the C1 or
C2 channels. Double chromogenic section in situ hybridization was performed using the
RNAscope 2.5 HD Duplex Detection Kit (Advanced Cell Diagnostics) according to the
manufacturer’s instructions on frozen cryosections.
The total number of prrx-1+only, il-8+ only, csf1r+ only or double positive cells were
quantified by counting cells that exhibited 10 or greater puncta for either probe. These
are categorized as strongly expressing cells according to RNAscope standards (score of
4+). These numbers were used to quantify the percentages of co-positive and single
positive cells.
Generation and validation of the myc-tagged il-8 overexpression construct
To generate an il-8 overexpression construct, the open reading frame for il-8 was
amplified out of cDNA from regenerating limbs at 7 dpa with primers that added on a NheI
site and a kozak sequence directly upstream of the ATG start codon and a HindIII site
directly downstream of the coding sequence. This PCR product was cloned into a pCMV-
TVA-T2A-tdTomato backbone (gift from J. Whited) in place of TVA. An empty pCMV-T2A-
tdTomato vector was used as a control.
78
To validate the expression of the vector, 293T cells were transfected with 50 ug of
either the il-8 overexpression or tdTomato control construct using Lipofectamine 2000.
The media and cells were separately collected at 48 hours post-transfection (hpt). Media
was concentrated with a 15 mL Amicon filter (3K) (Millipore Sigma, Burlington, MA).
Protein was extracted from cells using Trizol (ThermoFisher Scientific). Western blotting
was performed on both il-8 overexpression and control transfected cell lysates and media
using a mouse monoclonal anti-GAPDH (MAB374, Millipore Sigma, 1:2000) and
polyclonal rabbit anti-myc tag antibody (ab9106, Abcam, Cambridge, MA, 1:2000). Cells
were additionally immunostained at 72 hpt for the myc tag (same antibody as above) and
tdTomato using a polyclonal goat anti-tdTomato antibody (LS-C348313, LSBio, Seattle,
WA, 1:1000).
Ectopic expression of il-8 in intact limbs
Intact limbs of axolotls were injected and electroporated with myc tagged il-8
overexpression construct (1 ug/uL in PBS). At three days post-injection, animals were
injected intraperitoneally with EdU (Life Technologies, Carlsbad, CA) at a concentration
of 8 mg/kg four hours prior to tissue collection. Tissue was prepped and embedded in
OCT in a similar manner to previously described above. The blocks were serially
sectioned at a thickness of 16 um. EdU staining was performed using the Click-it EdU
Alexa Fluor 488 Imaging Kit (ThermoFisher Scientific). For immunostaining, mouse anti-
chick Pax7 (DSHB, University of Iowa, IA, 1:200) and rabbit anti-human CD34 (ab81289,
Abcam, 1:200) antibodies were used.
79
The imaging analyses were all conducted blinded. For the quantification of il-8
overexpression limbs, 3-4 sections were imaged per limb and quantified. Total numbers
of EdU+, CD34+, pax7+, CD34+ EdU+, and pax7+ EdU+ cells were counted and
percentages were calculated out of total either DAPI+ nuclei for total EdU percentages,
pax7+ nuclei for dividing satellite cells, and CD34+ cells for dividing endothelium. Dividing
bone/perichondrial or epidermal cells were counted based on EdU+ cells of the cell type
out of DAPI total of the cell type (counted by morphology). A two-tailed paired t-test was
used for statistical analysis.
NSE/NCAE Staining and Analysis of Myeloid Cells
Staining of monocytes and granulocytes was performed using the -Naphthyl
Acetate (Non-specific Esterase) (NSE) kit or Naphthol AS-D Chloroacetate (Specific
Esterase) (NCAE) Kit (Sigma-Aldrich), respectively, according to the manufacturer’s
instructions. The only modification to the protocol was a 10-minute fixation step in citrate-
acetone-methanol fixative. For the overexpression experiment, the area of each cross-
section was measured using ImageJ analysis software. For characterization of the il-8
morphant limbs, tissue was collected and prepared at 1, 5, and 7 dpa. The area of the
section 500 um from the amputation plane was measured and the quantification was
performed blinded. Every effort was made to ensure quantification around the same area
in all limbs using the humerus and ulna as landmarks. A two-tailed paired t-test was used
for all statistical analyses and all of the quantification was performed blinded (averaging
2-3 sections/limb). For characterization of DMSO- or SB-225002-treated limbs, limbs from
80
animals treated from time of amputation were collected at 7 dpa, stained, and analyzed
as described above.
IL-8 morpholino knockdown
Axolotls were anesthetized in 0.1% tricaine and intact forelimbs were injected and
electroporated with either control (left limb) or il-8-targeted morpholino (right limb).
Approximately 3-4 uL of morpholinos were injected at a final concentration of 5 uM in
PBS. At two days post-injection, both forelimbs of axolotls were amputated at the mid-
radius/ulna level and control or il-8 morpholinos were injected again at 3 days post-
amputation into regenerating stump tissue. Both translation-blocking and five-point
mutation control morpholino anti-sense oligonucleotides were designed and generated
by GeneTools LLC (Philomath, OR) against the il-8 ORF with the following sequences:
Control: 5'-CCGATCTTGATGCTCACCTCCTG-3'
il-8: 5'-CCGATGTTCATGGTGACCTGCTG-3'
To validate morpholino knockdown, il-8-targeted and control morpholino injected limbs
from the same animal were collected and protein was extracted using Trizol
(ThermoFisher Scientific). Western blotting was performed on protein extracts using the
anti-GAPDH antibody described above as well as a cross-reacting polyclonal mouse anti-
chick IL-8 antibody (MBS2018201, MyBioSource, San Diego, CA, 1:400).
For analysis at the blastemal stages, animals were injected intraperitoneally with
EdU (Life Technologies) at a concentration of 8 mg/kg four hours prior to tissue collection.
Tissue was collected at 21 dpa and prepped as described above. Picro-mallory staining
was performed on sections for histological analysis to analyze blastema length and area.
81
Cell proliferation was assessed using the Click-it EdU Alexa Fluor 488 Imaging Kit
(ThermoFisher Scientific). All imaging analysis was done in ImageJ and conducted
blinded. A two-tailed paired t-test was used for statistical analysis.
TUNEL staining
TUNEL staining was performed using the In Situ Cell Death Detection Kit (Roche) as
described previously (Zhu et al., 2012). The percentage of TUNEL+ nuclei (out of DAPI
total) were quantified from 2 sections per limb and averaged.
Alcian blue staining
Alcian blue staining of DMSO or SB-225002-treated 40 dpa limbs was performed as
describe previously (Whited et al., 2013).
3.7. References
Arango Duque, G. and Descoteaux, A. (2014). Macrophage cytokines: involvement in immunity and infectious diseases. Front Immunol 5, 491.
Aurora, A. B. and Olson, E. N. (2014). Immune modulation of stem cells and regeneration. Cell Stem Cell 15, 14-25.
Baggiolini, M., Dewald, B. and Moser, B. (1997). Human chemokines: an update. Annu Rev Immunol 15, 675-705.
Bryant, D. M., Johnson, K., DiTommaso, T., Tickle, T., Couger, M. B., Payzin-Dogru, D., Lee, T. J., Leigh, N. D., Kuo, T. H., Davis, F. G., et al. (2017). A Tissue-Mapped Axolotl De Novo Transcriptome Enables Identification of Limb Regeneration Factors. Cell Rep 18, 762-776.
82
Burzyn, D., Kuswanto, W., Kolodin, D., Shadrach, J. L., Cerletti, M., Jang, Y., Sefik, E., Tan, T. G., Wagers, A. J., Benoist, C., et al. (2013). A special population of regulatory T cells potentiates muscle repair. Cell 155, 1282-1295.
de Oliveira, S., Reyes-Aldasoro, C. C., Candel, S., Renshaw, S. A., Mulero, V. and Calado, A. (2013). Cxcl8 (IL-8) mediates neutrophil recruitment and behavior in the zebrafish inflammatory response. J Immunol 190, 4349-4359.
de Oliveira, S., Rosowski, E. E. and Huttenlocher, A. (2016). Neutrophil migration in infection and wound repair: going forward in reverse. Nat Rev Immunol 16, 378-391.
Fu, X. T., Dai, Z., Song, K., Zhang, Z. J., Zhou, Z. J., Zhou, S. L., Zhao, Y. M., Xiao, Y. S., Sun, Q. M., Ding, Z. B., et al. (2015). Macrophage-secreted IL-8 induces epithelial-mesenchymal transition in hepatocellular carcinoma cells by activating the JAK2/STAT3/Snail pathway. Int J Oncol 46, 587-596.
Gerber, T., Murawala, P., Knapp, D., Masselink, W., Schuez, M., Hermann, S., Gac-Santel, M., Nowoshilow, S., Kageyama, J., Khattak, S., et al. (2018). Single-cell analysis uncovers convergence of cell identities during axolotl limb regeneration. Science.
Godwin, J. W., Debuque, R., Salimova, E. and Rosenthal, N. A. (2017). Heart regeneration in the salamander relies on macrophage-mediated control of fibroblast activation and the extracellular landscape. NPJ Regen Med 2.
Godwin, J. W., Pinto, A. R. and Rosenthal, N. A. (2013). Macrophages are required for adult salamander limb regeneration. Proc Natl Acad Sci U S A 110, 9415-9420.
Grayfer, L., Edholm, E. S. and Robert, J. (2014). Mechanisms of amphibian macrophage development: characterization of the Xenopus laevis colony-stimulating factor-1 receptor. Int J Dev Biol 58, 757-766.
Ha, H., Debnath, B. and Neamati, N. (2017). Role of the CXCL8-CXCR1/2 Axis in Cancer and Inflammatory Diseases. Theranostics 7, 1543-1588.
Heredia, J. E., Mukundan, L., Chen, F. M., Mueller, A. A., Deo, R. C., Locksley, R. M., Rando, T. A. and Chawla, A. (2013). Type 2 innate signals stimulate fibro/adipogenic progenitors to facilitate muscle regeneration. Cell 153, 376-388.
83
Kurimoto, T., Yin, Y., Habboub, G., Gilbert, H. Y., Li, Y., Nakao, S., Hafezi-Moghadam, A. and Benowitz, L. I. (2013). Neutrophils express oncomodulin and promote optic nerve regeneration. J Neurosci 33, 14816-14824.
Li, L., Yan, B., Shi, Y. Q., Zhang, W. Q. and Wen, Z. L. (2012). Live imaging reveals differing roles of macrophages and neutrophils during zebrafish tail fin regeneration. J Biol Chem 287, 25353-25360.
Lindborg, J. A., Mack, M. and Zigmond, R. E. (2017). Neutrophils Are Critical for Myelin Removal in a Peripheral Nerve Injury Model of Wallerian Degeneration. J Neurosci 37, 10258-10277.
Miron, V. E., Boyd, A., Zhao, J. W., Yuen, T. J., Ruckh, J. M., Shadrach, J. L., van Wijngaarden, P., Wagers, A. J., Williams, A., Franklin, R. J. M., et al. (2013). M2 microglia and macrophages drive oligodendrocyte differentiation during CNS remyelination. Nat Neurosci 16, 1211-1218.
Mounier, R., Theret, M., Arnold, L., Cuvellier, S., Bultot, L., Goransson, O., Sanz, N., Ferry, A., Sakamoto, K., Foretz, M., et al. (2013). AMPKalpha1 regulates macrophage skewing at the time of resolution of inflammation during skeletal muscle regeneration. Cell Metab 18, 251-264.
Nakayama, E., Shiratsuchi, Y., Kobayashi, Y. and Nagata, K. (2011). The importance of infiltrating neutrophils in SDF-1 production leading to regeneration of the thymus after whole-body X-irradiation. Cell Immunol 268, 24-28.
Nguyen-Chi, M., Laplace-Builhe, B., Travnickova, J., Luz-Crawford, P., Tejedor, G., Lutfalla, G., Kissa, K., Jorgensen, C. and Djouad, F. (2017). TNF signaling and macrophages govern fin regeneration in zebrafish larvae. Cell Death Dis 8, e2979.
Nowoshilow, S., Schloissnig, S., Fei, J. F., Dahl, A., Pang, A. W. C., Pippel, M., Winkler, S., Hastie, A. R., Young, G., Roscito, J. G., et al. (2018). The axolotl genome and the evolution of key tissue formation regulators. Nature 554, 50-55.
Paris, A. J., Liu, Y., Mei, J., Dai, N., Guo, L., Spruce, L. A., Hudock, K. M., Brenner, J. S., Zacharias, W. J., Mei, H. D., et al. (2016). Neutrophils promote alveolar epithelial regeneration by enhancing type II pneumocyte proliferation in a model of acid-induced acute lung injury. Am J Physiol Lung Cell Mol Physiol 311, L1062-L1075.
84
Pei, W., Tanaka, K., Huang, S. C., Xu, L., Liu, B., Sinclair, J., Idol, J., Varshney, G. K., Huang, H., Lin, S., et al. (2016). Extracellular HSP60 triggers tissue regeneration and wound healing by regulating inflammation and cell proliferation. NPJ Regen Med 1.
Perdiguero, E., Sousa-Victor, P., Ruiz-Bonilla, V., Jardi, M., Caelles, C., Serrano, A. L. and Munoz-Canoves, P. (2011). p38/MKP-1-regulated AKT coordinates macrophage transitions and resolution of inflammation during tissue repair. J Cell Biol 195, 307-322.
Petrie, T. A., Strand, N. S., Yang, C. T., Rabinowitz, J. S. and Moon, R. T. (2014). Macrophages modulate adult zebrafish tail fin regeneration. Development 141, 2581-2591.
Powell, D., Tauzin, S., Hind, L. E., Deng, Q., Beebe, D. J. and Huttenlocher, A. (2017). Chemokine Signaling and the Regulation of Bidirectional Leukocyte Migration in Interstitial Tissues. Cell Rep 19, 1572-1585.
Sica, A. and Mantovani, A. (2012). Macrophage plasticity and polarization: in vivo veritas. J Clin Invest 122, 787-795.
Simkin, J., Gawriluk, T. R., Gensel, J. C. and Seifert, A. W. (2017a). Macrophages are necessary for epimorphic regeneration in African spiny mice. Elife 6.
Simkin, J., Sammarco, M. C., Marrero, L., Dawson, L. A., Yan, M., Tucker, C., Cammack, A. and Muneoka, K. (2017b). Macrophages are required to coordinate mouse digit tip regeneration. Development 144, 3907-3916.
Stanley, E. R. and Chitu, V. (2014). CSF-1 receptor signaling in myeloid cells. Cold Spring Harb Perspect Biol 6.
Walters, K. B., Green, J. M., Surfus, J. C., Yoo, S. K. and Huttenlocher, A. (2010). Live imaging of neutrophil motility in a zebrafish model of WHIM syndrome. Blood 116, 2803-2811.
Wang, J. (2018). Neutrophils in tissue injury and repair. Cell Tissue Res 371, 531-539.
White, J. R., Lee, J. M., Young, P. R., Hertzberg, R. P., Jurewicz, A. J., Chaikin, M. A., Widdowson, K., Foley, J. J., Martin, L. D., Griswold, D. E., et al. (1998).
85
Identification of a potent, selective non-peptide CXCR2 antagonist that inhibits interleukin-8-induced neutrophil migration. J Biol Chem 273, 10095-10098.
Whited, J. L., Tsai, S. L., Beier, K. T., White, J. N., Piekarski, N., Hanken, J., Cepko, C. L. and Tabin, C. J. (2013). Pseudotyped retroviruses for infecting axolotl in vivo and in vitro. Development 140, 1137-1146.
Williams, C. B., Yeh, E. S. and Soloff, A. C. (2016). Tumor-associated macrophages: unwitting accomplices in breast cancer malignancy. NPJ Breast Cancer 2.
Xu, S., Webb, S. E., Lau, T. C. K. and Cheng, S. H. (2018). Matrix metalloproteinases (MMPs) mediate leukocyte recruitment during the inflammatory phase of zebrafish heart regeneration. Sci Rep 8, 7199.
Yun, M. H., Davaapil, H. and Brockes, J. P. (2015). Recurrent turnover of senescent cells during regeneration of a complex structure. Elife 4.
Zeilhofer, H. U. and Schorr, W. (2000). Role of interleukin-8 in neutrophil signaling. Curr Opin Hematol 7, 178-182.
Zhu, W., Pao, G. M., Satoh, A., Cummings, G., Monaghan, J. R., Harkins, T. T., Bryant, S. V., Randal Voss, S., Gardiner, D. M. and Hunter, T. (2012). Activation of germline-specific genes is required for limb regeneration in the Mexican axolotl. Dev Biol 370, 42-51.
87
4.1. Preface
The conceptualization and experimental design was performed in collaboration
with Doug for the work presented in this chapter. I performed all of the experiments and
the data analysis presented in this chapter and these data are part of a manuscript in
progress.
4.2. Abstract
The wound epidermis is a transient epithelial structure that is required throughout
limb regeneration. During blastema formation, the wound epidermis matures from a thin
epidermal structure to a thick structure known as the apical epithelial cap (AEC) that is
tightly coupled with the blastema. While the roles of the AEC have been more well-
defined, the specific roles that the early wound epidermis plays in blastema formation
remain largely unknown. In this chapter, we prevented wound epidermis formation by
suturing full skin over the amputation plane and performed transcriptional profiling at 5
dpa of the stump-derived dividing and non-dividing cells, as well as the full thickness skin
epithelial cells in order to investigate which transcriptional programs in the stump tissues
are dependent on the wound epidermis, and which wound epithelial programs are
potentially dependent on signaling from the stump tissues. Surprisingly, the overall
transcriptional profile of early dividing progenitors was quite similar in the absence of the
wound epidermis, while the profiles of the surrounding tissues diverged considerably.
Most of the differentially expressed transcripts in both the non-dividing stump tissues and
full skin flap epithelial cells pertained to genes involved in inflammation, extracellular
matrix (ECM) regulation and tissue histolysis, suggesting that the wound epidermis
88
modulates these processes. In addition, pathway analysis of differentially expressed
transcripts in regenerating stump tissues revealed that dividing progenitors likely fail to
activate key growth factor signaling pathways. In all, these data identify wound epidermis-
dependent processes in early stages of regeneration and elucidate new potential
regulators of the initiation of limb regeneration.
4.3. Introduction
Limb regeneration is an incredibly complicated process. One obvious layer of
complexity lies in the cellular heterogeneity of the limb as it is comprised of many different
tissues (muscle, bone, connective tissue etc.), which can be parsed into sub-tissue cell-
types (Gerber et al., 2018; Leigh et al., 2018). Each of these cell types must execute
tissue-specific regenerative programs in a coordinated manner spatiotemporally. To do
so, cell-cell communication is key and layered on top of the cellular heterogeneity is the
significance of ongoing cross-talk between all of the different regenerating tissues in the
limb, which can be illustrated by notable examples including the nerve dependence of
regeneration (Farkas and Monaghan, 2017) and the requirement of supportive
cells/tissues including macrophages (Godwin et al., 2013) and the wound epidermis/AEC
(Goss, 1956; Thornton, 1957; Mescher, 1976). In addition, the necessity of nerves and
macrophages differs depending on the stage of regeneration, illustrating temporal
dynamics of communication between tissues. These added layers of complexity make it
paramount to deconvolute the important roles that specific tissues may play during limb
regeneration.
89
As mentioned in the introductory chapter, one of the requirements for successful
limb regeneration is the formation of a thin wound epidermis during early wound healing
stages and the subsequent maturation of this epithelial structure into the apical epithelial
cap (AEC) (Campbell and Crews, 2008). While it is known that the AEC plays roles that
mirror that of the AER in limb development, including maintaining blastemal cell
proliferation and likely pattern formation (Boilly and Albert, 1990; Han et al., 2001), less
is known about the roles of the early wound epidermis. Preventing early wound epidermis
formation by suturing full thickness skin over the amputation plane prevents blastema
formation (Mescher, 1976). Yet, early induction of proliferation in progenitors from many
tissues still occurs despite the lack of a wound epidermis, suggesting that it does not play
a major role in inducing cell cycle re-entry in regenerating limbs (Mescher, 1976; Johnson
et al., 2018). Nevertheless, the early wound epidermis expresses signaling molecules
including axMLP that are known to be sufficient to induce proliferation in axolotl tails and
limbs (Sugiura et al., 2016), suggesting that it may still participate in inducing cell cycle
re-entry in the limb.
Here, we investigated the roles of the early wound epidermis by performing
transcriptional profiling of full skin flap sutured limbs. In conjunction with the transcriptional
dataset generated in chapter 2, we compared the gene expression profiles of dividing
cells and the surrounding tissues of regenerating limbs in normal regenerating and full
skin flap sutured limbs at 5 dpa in order to identify 1) wound epidermis-dependent
transcriptional programs in regenerating stump tissues and 2) transcriptional programs in
the wound epidermis that are potentially dependent on signals from regenerating stump
tissues.
90
4.4. Results
4.4.1. Full skin flap sutured limbs exhibit divergent transcriptional profiles from normal
regenerating limbs
In order to investigate the role(s) of the early wound epidermis in limb regeneration,
we wanted to examine the transcriptional differences between regenerating limbs in the
presence and absence of the wound epidermis. We performed full skin flap surgeries
immediately post-amputation to prevent wound epidermis formation (Figure 4.1)
(Mescher et al., 1976). As mentioned in the introductory chapter, suturing full thickness
skin prevents migration of epithelial cells from the periphery over the exposed amputation
plane, in essence preventing formation of the wound epidermis due to the presence of
the dermal layer. Utilizing the protocol that we developed in chapter 2, we expanded our
previous dataset on early regenerating limbs to include full skin flap sutured limbs.
To this end, we performed full skin flap surgeries immediately post-amputation and
collected tissue at 5 dpa in order to isolate and transcriptionally profile three
subpopulations: stump-derived dividing, stump-derived non-dividing, and epidermal cells
(Figure 4.2). Utilizing the previous dataset from regenerating limbs at 0 and 5 dpa, we
compared the transcriptional profiles of all three populations in the presence and absence
of the wound epidermis. Principal component analysis (PCA) of full skin flap and normal
regenerating samples at 5 dpa revealed four clusters separated by tissue type (epidermal
or non-epidermal tissues) and condition (full skin flap sutured or normal regenerating
limbs) (Figure 4.3).
91
Figure 4.1. Suturing full thickness skin over the amputation plane prevents wound
epidermis formation. Picro-mallory stained sections of normal regenerating and full
skin flap sutured non-regenerating limbs at 8 dpa are shown in A and B. Higher
magnification images of insets in A and B are shown in A’ and B’, respectively. A normal
wound epidermis is formed by migration of peripheral epithelial cells (stained red) over
the amputation plane and lacks a collagen-thick dermal layer (stained blue). The direct
contact between the epithelial cells and the underlying stump tissues is thought to
facilitate signaling that is essential for blastema formation. Suturing full thickness skin
(epidermis and dermis) immediately over the amputation plane prevents the formation
of a wound epidermis. The presence of the dermis is thought to be a physical barrier
that prevents signaling between the epithelial cells and the regenerating stump tissues,
inhibiting limb regeneration. dpa, days post-amputation.
92
Figure 4.2. Schematic of transcriptional profiling experiment in the presence and
absence of the wound epidermis. We collected and performed RNA-sequencing on
stump derived-dividing, stump derived-non-dividing, and full thickness skin cells from
full skin flap sutured limbs at 5 dpa utilizing the method developed in Tsai et al. (2019).
We then compared the transcriptional profiles of each subpopulation between normal
regenerating and full skin flap sutured limbs to identify differentially expressed
transcripts.
93
4.4.2. Early dividing cells fail to activate key signaling pathways in the absence of the
wound epidermis
As determined previously in Chapter 2, HIPPO, canonical Wnt, and TGF-
signaling were the only growth factor signaling pathways predicted to be active within
normal regenerating stump tissues, while most other pathways appeared to be repressed.
In order to investigate whether absence of the wound epidermis impacted the activation
of these pathways, we similarly utilized Ingenuity Pathway Analysis (IPA) to examine the
potential activation/suppression of growth factor signaling pathways in stump-derived
dividing and non-dividing cells of full skin flap sutured limbs.
This analysis revealed that similar growth factor signaling pathways (HIPPO and
canonical Wnt) were predicted to be active in non-dividing cells in both conditions,
Figure 4.3. PCA analysis of normal and full skin flap sutured limb samples.
94
suggesting that the activation of these pathways is independent of the wound epidermis.
In contrast, the absence of the wound epidermis led to failed activation of HIPPO,
canonical Wnt, and TGF- signaling in early dividing cells (Figure 4.4A). Analysis of the
transcript levels of components of all three pathways in dividing cells revealed that many
components of TGF- signaling (e.g. inhba, ltbp1, smad2, smad5, pai1, snai1, tgfr1),
canonical Wnt signaling (e.g. lef1, dkk1, pard3, dvl2, ppard), and HIPPO signaling (e.g.
mst1, lats1, tead3) are indeed down-regulated, further suggesting that these pathways
are likely inactive (Figure 4.4B). Notably, our previous data suggested that early
blastemal progenitors selectively establish an autocrine TGF- signaling network during
early stages of limb regeneration based on the enrichment and induction of many TGF-
signaling components in early dividing cells. While many of these components are down-
regulated in full skin flap sutured limbs, some remain induced to similar levels including
the upstream regulator tgfb1 and a downstream target twist1, suggesting that the
induction of these genes in early progenitors is wound epidermis-independent. In all,
these data suggest that the wound epidermis may play a role in the induction of these
pathways in early blastemal progenitors.
The differential activation of growth factor signaling pathways in early dividing cells
was quite surprising given that the overall transcriptional profiles in the absence of the
wound epidermis were relatively similar. Only 596 transcripts were differentially
expressed in dividing cells and of these, 313 of these transcripts were annotated. Some
of the most highly differentially expressed transcripts are shown in Figure 4.4C and the
top 100 transcripts can be found in Table A.3.1. Intriguingly, the top most differentially
expressed hit was an RNA binding protein ews which plays a role in transcriptional
95
Figure 4.4. Early dividing cells exhibit minor differences in transcriptional profiles
in the absence of the wound epidermis. (A) Ingenuity pathway analysis (IPA) of
differentially expressed transcripts in stump-derived dividing and non-dividing cells
suggests that early dividing cells lose predicted activation of Hippo, canonical Wnt, and
TGF- signaling pathways. (B) Heatmap of normalized and averaged TPM values of
differentially expressed transcripts associated with Hippo, canonical Wnt, and TGF-
signaling at 0 dpa, 5 dpa, and 5 dpa full skin flap sutured limbs. (C) Heatmap of
normalized TPM levels of select differentially expressed transcripts in early dividing cells
between both conditions. WE, wound epidermis; dpa, days post-amputation; FSF, full
skin flap.
96
regulation and has been most well-studied in tumorigenic contexts when partially fused
with other transcriptional activators as a result of aberrant chromosomal translocations
(Lee et al., 2018). In addition, blastemal progenitor-enriched transcripts discovered in the
previous regenerating dataset including lin41, mmp13, and k2c8 (Tsai et al., 2019) were
down-regulated in full skin flap sutured limbs, suggesting that the expression of these
genes is wound epidermis-dependent. Altogether, these data suggest that while the
wound epidermis does likely play a role in inducing the activation of key pathways in early
dividing progenitors, it does not seem to strongly impact the overall transcriptional profiles
of these cells.
4.4.3. Non-dividing cells in regenerating stump tissues display aberrant inflammation and
extracellular matrix (ECM) regulation profiles
While the dividing cells displayed similar transcriptional profiles in the absence of
the wound epidermis, the non-dividing cells in regenerating stump tissues exhibited
divergent profiles in full skin flap sutured limbs from their regenerating counterparts. In
total, 3,911 transcripts were differentially expressed and of these, 982 were annotated. A
of the top 100 differentially expressed transcripts can be found in Table A.3.2 of the
Appendix. GO analysis of enriched biological processes of differentially expressed
transcripts revealed an overwhelming overrepresentation of transcripts involved in
immunomodulation, inflammation, and ECM organization (Figure 4.5A). Furthermore, in
conjunction with the expression data from non-regenerating intact limbs in our previous
dataset, we could parse the differentially expressed transcripts into four clusters:
transcripts that either fail to be maintained (cluster 1), fail to be repressed (cluster 2), fail
97
to be induced (cluster 3), or are aberrantly induced in non-dividing cells (cluster 4, Figure
4.5B).
Further analysis of the enriched biological processes in specific clusters revealed
that transcripts involved in ECM regulation were overrepresented in cluster 1, suggesting
that many ECM components and regulators including fbn2, finc (or fn1), mmp2, mmp14,
has2, and comp failed to maintain expression at some level in full skin flap sutured limbs
(Figure 4.5E). In addition, differentially expressed ECM-related transcripts were also
present in the other clusters. Notably, transcripts associated with the important pro-
regenerative ECM component tenascin (tena) (Godwin et al., 2014), along with ECM-
degrading enzymes including catk, mmp14, mmp2, and mmp13 failed to be induced in
the absence of the wound epidermis. Interestingly, co1a1, which is a major collagen
matrix component of differentiated bone and cartilage (Viguet-Carrin et al., 2006) seemed
to aberrantly maintain expression in full skin flap sutured limbs. Coupling this observation
with the lack of induction of the bone matrix-degrading enzyme catk (Troen, 2004), these
data suggest that normal bone resorption that occurs during early stages of limb
regeneration may be inhibited in the absence of the wound epidermis. In all, these data
support the notion that the wound epidermis plays a major role in ECM regulation and
tissue histolysis during early stages of regeneration.
Furthermore, immune-related transcripts were highly overrepresented in cluster 3
(Figure 4.5C) and a subset of the most highly differentially expressed transcripts are
represented in Figure 4.5D. Many of these transcripts were associated with components
of pathogen-associated molecular pathways including toll-like receptor (TLR) and
interferon // signaling (e.g. myd88, tlr3, tlr7, stat1, irf3, ifih5, mx1, mx2, il18), while
98
Figure 4.5. Inflammation and ECM regulation in stump-derived non-dividing cells
are heavily affected in the absence of the wound epidermis. (A) Plot of enriched GO
biological processes from all differentially expressed transcripts in non-dividing cells in
full skin flap sutured limbs. (B) Clustered heatmap of the normalized TPM values of all
differentially transcripts in non-dividing cells between regenerating and full skin flap
sutured limbs at 5 dpa. Four main clusters numbered 1 to 4 (color coded pink, orange,
green, and purple were apparent. (C) Cluster-specific enriched GO biological processes
from cluster 1 (top, pink) and 3 (bottom, green). (D-F) Heatmap of normalized TPM values
99
mypop, an anti-viral transcriptional regulator (Wustenhagen et al., 2018), was over-
expressed in full skin flap sutured limbs. In addition, the macrophage marker mpeg1
(Zakrzewska et al., 2010) was down-regulated in the absence of the wound epidermis,
potentially indicating less macrophage infiltration into the damaged tissue. Finally,
components of the anti-inflammatory PPAR/RXR signaling pathway (e.g. gpda, rras,
adcy7, m4k4, mp2k2) and anxa1, a well-known anti-inflammatory molecule that promotes
wound healing resolution (Sugimoto et al., 2016), were down-regulated. These data
collectively suggest that inflammatory processes are mis-regulated in the absence of the
wound epidermis, and the failure of induction of many immunomodulatory transcripts
suggests that the early wound epidermis plays a large role in directing the inflammatory
response.
Finally, we were able to identify transcription factors and regulators that were
differentially expressed in the absence of the wound epidermis (Figure 4.5F).
Transcription factors including myc, fosl2, stat1, sp4, and prdm1 as well as epigenetic
regulators including setb1 and smyd3 failed to be induced in non-dividing cells of full skin
flap sutured limbs. In addition, transcription factors including nkx2.5, cbx5, klf10, and
gat1b were aberrantly expressed, indicating that the early wound epidermis may play a
role in inducing and/or suppressing these factors.
Figure 4.5. (continued) of differentially expressed transcripts involved in inflammation
(D), ECM regulation (E), or transcriptional regulation. dpa, days post-amputation; FSF,
full skin flap; FDR, false discovery rate; ECM, extracellular matrix.
100
4.4.4. Epithelial cells in Full thickness skin exhibit dysregulation of transcripts involved in
cell proliferation, inflammation, and ECM regulation
Communication between damaged stump tissues and the migratory epithelial cells
that form the wound epidermis is essential for proper blastema formation. Full skin flap
surgeries prevent this communication due to the presence of the collagen-thick dermal
layer. Therefore, we compared the transcriptional profiles between epithelial cells from
the full thickness skin flap and the wound epidermis in order to determine which
transcripts were dysregulated. These transcripts could provide valuable insight into
processes within the wound epidermis that may be dependent on signaling from
regenerating stump tissues during early stages of regeneration.
Overall, 1,060 transcripts were differentially expressed between full skin flap
epithelial cells and the wound epidermis (Figure 4.6). Of these, 480 were annotated and
are shown in Figure 4.6A. A list of the top 100 transcripts can be found in Table A.3.3 of
the Appendix. Clustering of the differentially expressed transcripts revealed three main
clusters: transcripts that failed to be induced (Cluster 1), were aberrantly expressed
(Cluster 2), or failed to be maintained (Cluster 3, Figure 4.6A). Cluster-specific analysis
of overrepresented biological processes and pathways demonstrated that many of the
differentially expressed transcripts in Cluster 1 were involved in cell proliferation (e.g. cell
cycle checkpoint, spindle organization, DNA conformation change), RNA processing, and
pro-inflammatory processes (production of or response to type I interferon and cytokine
stimulus) (Figure 4.6B). In addition, transcripts involved in the anti-fungal immunity C-type
lectin receptor signaling (e.g. irf1, nalp3) were overrepresented in Cluster 3.
101
Figure 4.6. Wound epidermis and full skin flap sutured skin exhibit transcriptional
differences in inflammation, ECM regulation, and cell proliferation. (A) Clustered
heatmap of the normalized TPM levels all differentially expressed transcripts between
normal wound epidermal and full skin flap epidermal cells at 5 dpa. Three main clusters
of transcripts (color coded pink, green, and purple) are apparent. (B) Plot of cluster-
specific enriched GO biological processes and pathways for cluster 1 (top) and cluster 3
(bottom). (C-F) Heatmap of differentially expressed transcripts that are
immunomodulators (C), ECM regulators (D), transcriptional regulators (E), and cell
surface receptors (F). WE, wound epidermis; FSF, full skin flap; FDR, false discovery
rate; ECM, extracellular matrix.
102
Notably, similar to the stump-derived non-dividing cells in full skin flap sutured
limbs, inflammatory processes were also dysregulated in the full skin flap epithelium. A
subset of the highest differentially expressed immune-related transcripts are shown in
Figure 4.6C. Transcripts involved in interferon signaling (e.g. in35, ifi6, ifih1, irf3, stat1,
stat6, tri27, tri56) and cytokine signaling (e.g. ccl4, ccl28) were not induced in full skin flap
epithelial cells. Anti-pathogenic mucins including muc5a and muc5b were also aberrantly
overexpressed. Intriguingly, mpeg1 and anxa1 were also down-regulated in full skin flap
epithelial cells similar to stump-derived non-dividing cells. Altogether, these data indicate
that pro- and anti-inflammatory processes are mis-regulated in the absence of signaling
between the epithelial cells and regenerating stump tissues.
In addition to inflammation, many ECM components were differentially expressed,
indicating differences in ECM regulation in the absence of signaling from underlying
stump tissues (Figure 4.6D). Transcripts corresponding to structural components of intact
skin that maintain expression in the wound epidermis (e.g. otoan, k1c15, k1c19, k2c5,
gpc1, and gpc6) lost expression in the full skin flap epithelia. Moreover, strongly
expressed secreted molecules involved in ECM regulation (e.g. co7a1, finc, and palld,
mmp3) were dysregulated.
Finally, in order to determine potential upstream drivers of these transcriptional
differences, we identified differentially expressed transcription factors and receptors
(Figure 4.6E-F). Several transcription factors (e.g. elf3, zn236, smbt2, hmgb2, htf4, foxp4)
and transcriptional regulators (e.g. smyd3) failed to be induced in full skin flap sutured
epithelial cells, while others (e.g. ctnd1, grsf1, klf11) failed to be maintained or were
overexpressed (e.g. gat1b, brd7, tcf7). Furthermore, many of the differentially expressed
103
receptors were normally expressed in intact skin and wound epidermis, but failed to
maintain expression in the full skin flap (e.g. ndrg2, jag1, avr2a, tsn15, notc3, tsn3, lifr).
Interestingly, fgfr3 expression was ectopically maintained in full skin flap epithelial cells,
and tm100 was overexpressed. These data provide a list of potential candidates that may
help us gain insight into wound epidermis biology.
4.5. Discussion
The wound epidermis is essential for proper limb regeneration (Thornton, 1957;
Mescher, 1976) and exists as a transient epithelial structure that eventually differentiates
into the epidermis of the regenerated limb (Kragl et al., 2009). Throughout regeneration,
the wound epidermis matures from an early thin epithelium during wound healing to the
AEC once the blastema has formed. While more is known about the roles of the AEC
during later stages of regeneration (Campbell and Crews, 2008), little is known about the
functional significance of the early wound epidermis. Here, we investigated how
preventing wound epidermis formation would impact the transcriptional programs of three
distinct subpopulations: stump-derived dividing cells (enriching for blastemal progenitors),
stump-derived non-dividing cells, and epithelial cells. By suturing full thickness skin over
the amputation plane, we simultaneously inhibited formation of the wound epidermis and
prevented signaling between the epithelial cells and the underlying stump tissues,
allowing us to both examine programs in the regenerating stump that are wound
epidermis-dependent and programs in the epidermis that likely require signaling from
underlying stump tissues.
104
Surprisingly, our data suggests that transcriptional programs of early blastemal
progenitors are largely wound epidermis-independent, as the overall transcriptional
profiles of the early dividing cells were not strongly impacted by inhibiting wound
epidermis formation. Given that cell-cycle re-entry of progenitors in regenerating limb
tissues occurs in the absence of the wound epidermis (Mescher, 1976; Johnson et al.,
2018), our data adds transcriptional evidence to further suggest that cell cycle re-entry is
likely directly stimulated by processes inherent to inflicting injury such as blood clotting
(Tanaka and Brockes, 1998; Tanaka et al., 1999). However, dividing progenitors appear
to fail to activate the only growth factor signaling pathways that are active in normal
regenerative contexts (HIPPO, canonical Wnt, and TGF- signaling), suggesting that the
wound epidermis may play a targeted role in directing the cellular behaviors of progenitors
after cell-cycle re-entry (ex. EMT transition, cell migration). In addition, it is interesting to
note that all three, rather than individual, pathways failed to be activated. As previously
mentioned in Chapter 2, these three pathways share many downstream effectors (ex.
smad2, smad5 etc.) and synergize in various processes including tumorigenesis (Attisano
and Wrana, 2013). Therefore, our results lend further evidence to suggest that these three
pathways are likely functionally interconnected and important for early blastemal cell
biology. Determining the specific importance of early activation of these pathways in
blastemal progenitors in future studies will help us gain insight into the molecular
mechanisms that control behaviors of blastemal cells during early stages of limb
regeneration.
While preventing wound epidermis formation did not seem to have a strong impact
on the overall transcriptional profiles of early dividing cells, the surrounding tissues were
105
more heavily affected. In particular, major inflammatory and ECM regulatory processes
were affected in non-dividing regenerating stump tissues and the full skin flap epidermis.
Components of both pro- and anti-inflammatory processes including interferon //, TLR,
and PPAR/RXR signaling either failed to be induced or were aberrantly overexpressed
in full skin flap sutured limbs, suggesting that both the onset and resolution of
inflammation are dysregulated. Interestingly, transcripts corresponding to a key mediator
of wound healing resolution anxa1 and the macrophage marker mpeg1 were commonly
down-regulated in both populations. Anxa1 is known to play a major role in promoting
apoptosis and engulfment of neutrophils by macrophages, a key step in wound healing
resolution which decreases production of pro-inflammatory cytokines and stimulates
production of anti-inflammatory cytokines in mammalian wound healing (Sugimoto et al.,
2016). In addition, anxa1 can promote monocyte recruitment and therefore impact
macrophage infiltration. Therefore, common down-regulation of anxa1 and mpeg1 further
suggests that anti-inflammatory processes may not be occurring properly.
Additionally, transcripts corresponding to ECM regulators and components were
also dysregulated in both non-dividing stump tissues and full skin flap epithelial cells.
Among these, one of the most highly differentially expressed transcripts corresponded to
a collagen-degrading enzyme catk that failed to be induced in non-dividing cells. Catk is
highly expressed in osteoclasts, bone-resorbing cells that play a major part in tissue
histolysis during early stages of regeneration (Fischman and Hay, 1962; Troen, 2004).
Furthermore, the bone matrix marker co1a1 aberrantly maintains expression and a
transcription factor that modulates osteoclast biology, fosl2 (Bozec et al., 2008), is down-
regulated in full skin flap sutured limbs. These results suggest that bone resorption during
106
early stages of regeneration is not occurring properly in regenerating stump tissues in the
absence of the wound epidermis and in turn, that the wound epidermis plays roles in
directing bone resorption. Furthermore, many ECM components failed to be induced
(k1c24, co7a1, and palld) or maintained (otoan, k2c5, k1c15, k1c19) in full skin flap
epidermis, suggesting that signaling from regenerating stump tissues may directly
influence the expression of these genes. In all, these results suggest both that the wound
epidermis plays a major role in immunomodulation and ECM regulation and that ongoing
communication between the wound epidermis and underlying stump tissues is crucial for
these processes.
Most importantly, we identified differentially expressed potential upstream
(secreted molecules and receptors) and downstream (transcription factors and
regulators) modulators that may play a role in controlling or repressing either wound
epidermis-dependent transcriptional programs and/or wound epidermis function and
maturation. Intriguingly, the histone methyltransferase smyd3 was commonly induced in
stump-derived non-dividing cells and the wound epidermis, but down-regulated in full skin
flap sutured limbs. As smyd3 has known roles in both development and tumorigenesis
(Du et al., 2014; Giakountis et al., 2017), our data suggest that it may also be an important
common epigenetic regulator during limb regeneration. Furthermore, while some of these
candidate transcription factors have known roles in development and immunomodulation
(e.g. prdm1, myc, gat1b, nkx2.5, klf10), others are uncharacterized in function (e.g. znfx1,
zn236). These data therefore provide a rich resource of new potential regulators of
regeneration for the field and characterizing the functional roles of these candidates will
help elucidate the molecular mechanisms of limb regeneration.
107
4.6. Materials and Methods
4.6.1. Animal care and husbandry
Axolotl (Ambystoma mexicanum) husbandry and surgeries were performed in
accordance with the Association for Assessment and Accreditation of Laboratory Animal
Care (AAALAC) and Institutional Animal Care and Use Committee (IACUC) guidelines at
Harvard University. Sub-adult white and albino axolotls (15-18 cm) provided by the
Ambystoma Genetic Stock Center (AGSC, University of Kentucky, KY) were used for the
RNA-sequencing experiment. Amputations were performed as previously described in
Tsai et al. (2019) and full skin flap surgeries were performed on all four limbs of nine
animals as detailed in (Mescher, 1976) immediately post-amputation.
4.6.2. RNA isolation and sequencing
Approximately 2-3 mm of tissue directly proximal to the amputation plane was
collected at 5 dpa. Twelve limbs were pooled for each biological replicate per timepoint
and the experiment was performed in triplicate. Dissociation, cell cycle analysis, and RNA
isolation from the samples was performed as described in Tsai et al. (2019).
4.6.3. Differential Expression Analysis
Raw reads were filtered and trimmed using Trimmomatic (Bolger et al., 2014) and
aligned to the axolotl transcriptome (Bryant et al., 2017) using Kallisto (Bray et al., 2016).
Raw TPM values from each sample were analyzed using DESeq2 (Love et al., 2014).
Differentially expressed transcripts were filtered for fold change > 2 and adjusted p-value
< 0.05.
108
For pathway analysis, Uniprot IDs of blastx hits from different species for all
differentially expressed transcripts were converted to human Uniprot IDs using HUGO
Gene Nomenclature Committee (HGNC) and/or Uniprot ID conversion tools online.
Ingenuity pathway analysis (IPA) analysis was performed on differentially expressed
transcripts to determine growth factor signaling pathway activation or inhibition for the
following comparisons: 0dpa 2N vs 5 dpa 2N, 0 dpa 4N vs 5 dpa 4N, 0 dpa epi vs 5 dpa
wound epidermis (WE), 0dpa 2N vs 5 dpa FSF 2N, 0 dpa 4N vs 5 dpa FSF 4N, and 0 dpa
epi vs 5dpa FSF epi. Heatmaps of normalized TPM levels for differentially expressed
transcripts in each fraction (2N, 4N, or epidermis) were generated in RStudio utilizing the
ComplexHeatmap package (Gu et al., 2016) or the gplots package (Gregory R. Warnes,
2015). Clusters of differentially expressed transcripts (5 dpa regenerating vs. 5 dpa FSF)
for each cellular fraction were analyzed using WebGestalt (Wang et al., 2017).
4.7. References
Attisano, L. and Wrana, J. L. (2013). Signal integration in TGF-beta, WNT, and Hippo pathways. F1000Prime Rep 5, 17.
Boilly, B. and Albert, P. (1990). In vitro control of blastema cell proliferation by extracts from epidermal cap and mesenchyme of regenerating limbs of axolotls. Roux Arch Dev Biol 198, 443-447.
Bolger, A. M., Lohse, M. and Usadel, B. (2014). Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics 30, 2114-2120.
Bozec, A., Bakiri, L., Hoebertz, A., Eferl, R., Schilling, A. F., Komnenovic, V., Scheuch, H., Priemel, M., Stewart, C. L., Amling, M., et al. (2008). Osteoclast size is controlled by Fra-2 through LIF/LIF-receptor signalling and hypoxia. Nature 454, 221-225.
109
Bray, N. L., Pimentel, H., Melsted, P. and Pachter, L. (2016). Near-optimal probabilistic RNA-seq quantification. Nat Biotechnol 34, 525-527.
Bryant, D. M., Johnson, K., DiTommaso, T., Tickle, T., Couger, M. B., Payzin-Dogru, D., Lee, T. J., Leigh, N. D., Kuo, T. H., Davis, F. G., et al. (2017). A Tissue-Mapped Axolotl De Novo Transcriptome Enables Identification of Limb Regeneration Factors. Cell Rep 18, 762-776.
Campbell, L. J. and Crews, C. M. (2008). Wound epidermis formation and function in urodele amphibian limb regeneration. Cell Mol Life Sci 65, 73-79.
Du, S. J., Tan, X. and Zhang, J. (2014). SMYD proteins: key regulators in skeletal and cardiac muscle development and function. Anat Rec (Hoboken) 297, 1650-1662.
Farkas, J. E. and Monaghan, J. R. (2017). A brief history of the study of nerve dependent regeneration. Neurogenesis (Austin) 4, e1302216.
Fischman, D. A. and Hay, E. D. (1962). Origin of osteoclasts from mononuclear leucocytes in regenerating newt limbs. Anat. Rec., 329-338.
Gerber, T., Murawala, P., Knapp, D., Masselink, W., Schuez, M., Hermann, S., Gac-Santel, M., Nowoshilow, S., Kageyama, J., Khattak, S., et al. (2018). Single-cell analysis uncovers convergence of cell identities during axolotl limb regeneration. Science.
Giakountis, A., Moulos, P., Sarris, M. E., Hatzis, P. and Talianidis, I. (2017). Smyd3-associated regulatory pathways in cancer. Semin Cancer Biol 42, 70-80.
Godwin, J., Kuraitis, D. and Rosenthal, N. (2014). Extracellular matrix considerations for scar-free repair and regeneration: insights from regenerative diversity among vertebrates. Int J Biochem Cell Biol 56, 47-55.
Godwin, J. W., Pinto, A. R. and Rosenthal, N. A. (2013). Macrophages are required for adult salamander limb regeneration. Proc Natl Acad Sci U S A 110, 9415-9420.
Goss, R. J. (1956). Regenerative inhibition following limb amputation and immediate insertion into the body cavity. Anat Rec 126, 15-27.
110
Gregory R. Warnes, B. B., Lodewijk Bonebakker, Robert Gentleman, Wolfgang Huber Andy Liaw, Thomas Lumley, Martin Maechler, Arni Magnusson, Steffen Moeller, Marc Schwartz and Bill Venables (2015). gplots: Various R Programming Tools for Plotting Data.
Gu, Z., Eils, R. and Schlesner, M. (2016). Complex heatmaps reveal patterns and correlations in multidimensional genomic data. Bioinformatics 32, 2847-2849.
Han, M. J., An, J. Y. and Kim, W. S. (2001). Expression patterns of Fgf-8 during development and limb regeneration of the axolotl. Dev Dyn 220, 40-48.
Johnson, K., Bateman, J., DiTommaso, T., Wong, A. Y. and Whited, J. L. (2018). Systemic cell cycle activation is induced following complex tissue injury in axolotl. Dev Biol 433, 461-472.
Lee, J., Nguyen, P. T., Shim, H. S., Hyeon, S. J., Im, H., Choi, M. H., Chung, S., Kowall, N. W., Lee, S. B. and Ryu, H. (2018). EWSR1, a multifunctional protein, regulates cellular function and aging via genetic and epigenetic pathways. Biochim Biophys Acta Mol Basis Dis.
Leigh, N. D., Dunlap, G. S., Johnson, K., Mariano, R., Oshiro, R., Wong, A. Y., Bryant, D. M., Miller, B. M., Ratner, A., Chen, A., et al. (2018). Transcriptomic landscape of the blastema niche in regenerating adult axolotl limbs at single-cell resolution. Nat Commun 9, 5153.
Love, M. I., Huber, W. and Anders, S. (2014). Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol 15, 550.
Mescher, A. L. (1976). Effects on adult newt limb regeneration of partial and complete skin flaps over the amputation surface. J Exp Zool 195, 117-128.
Sugimoto, M. A., Vago, J. P., Teixeira, M. M. and Sousa, L. P. (2016). Annexin A1 and the Resolution of Inflammation: Modulation of Neutrophil Recruitment, Apoptosis, and Clearance. J Immunol Res 2016, 8239258.
Sugiura, T., Wang, H., Barsacchi, R., Simon, A. and Tanaka, E. M. (2016). MARCKS-like protein is an initiating molecule in axolotl appendage regeneration. Nature 531, 237-240.
111
Tanaka, E. M. and Brockes, J. P. (1998). A target of thrombin activation promotes cell cycle re-entry by urodele muscle cells. Wound Repair Regen 6, 371-381.
Tanaka, E. M., Drechsel, D. N. and Brockes, J. P. (1999). Thrombin regulates S-phase re-entry by cultured newt myotubes. Curr Biol 9, 792-799.
Thornton, C. S. (1957). The effect of apical cap removal on limb regeneration in Amblystoma larvae. J Exp Zool 134, 357-381.
Troen, B. R. (2004). The role of cathepsin K in normal bone resorption. Drug News Perspect 17, 19-28.
Tsai, S. L., Baselga-Garriga, C. and Melton, D. A. (2019). Blastemal progenitors modulate immune signaling during early limb regeneration. Development 146.
Viguet-Carrin, S., Garnero, P. and Delmas, P. D. (2006). The role of collagen in bone strength. Osteoporos Int 17, 319-336.
Wang, J., Vasaikar, S., Shi, Z., Greer, M. and Zhang, B. (2017). WebGestalt 2017: a more comprehensive, powerful, flexible and interactive gene set enrichment analysis toolkit. Nucleic Acids Res 45, W130-W137.
Wustenhagen, E., Boukhallouk, F., Negwer, I., Rajalingam, K., Stubenrauch, F. and Florin, L. (2018). The Myb-related protein MYPOP is a novel intrinsic host restriction factor of oncogenic human papillomaviruses. Oncogene 37, 6275-6284.
Zakrzewska, A., Cui, C., Stockhammer, O. W., Benard, E. L., Spaink, H. P. and Meijer, A. H. (2010). Macrophage-specific gene functions in Spi1-directed innate immunity. Blood 116, e1-11.
113
5.1. Preface
The work presented in this chapter is part of ongoing work for a manuscript in
preparation. All of the experimental design was performed in collaboration with Doug and
Clara Baselga-Garriga. I performed and analyzed all of the in situ hybridizations, the initial
iMDK experiment, genotyping and initial characterization of the mk mutants, and the mk
overexpression experiment. The rest of the experiments including further characterization
of the iMDK phenotype and generating/characterizing the mk mutant phenotype were
performed in collaboration with Clara.
5.2. Abstract
Midkine (mk) is a pleiotropic cytokine involved in many processes including
development, inflammation, and tumorigenesis. In this chapter, we investigated the role
of mk in limb regeneration which exhibited decreased expression in the absence of the
wound epidermis. We demonstrate that mk is strongly expressed throughout regeneration
in the basal layers of the wound epidermis/AEC and in early connective tissue blastemal
progenitors. Chemical and genetic perturbation of mk impairs wound epidermis
maturation, which either completely inhibits or delays regeneration. Sequencing of mk
inhibitor (iMDK) treated limbs further reveals dysregulation of wound epidermis gene
expression and persistent inflammatory profiles. Finally, overexpression of mk in
regenerating limbs leads to uncontrolled growth of the wound epidermis. Altogether, these
results suggest that mk is one of the first identified regulators of early wound epidermis
maturation to the AEC.
114
5.3. Introduction
Midkine (mk) is a pleiotropic growth factor cytokine that modulates a variety of
biological processes including development, inflammation, tumorigenesis, and
regeneration (Muramatsu, 2010; Sorrelle et al., 2017). Most notably, in recent decades
mk has been shown to be a critical mediator of tumor metastasis and growth (Karaman
and Alitalo, 2017; Olmeda et al., 2017), chronic inflammation (Sorrelle et al., 2017), and
neural regeneration (Calinescu et al., 2009; Gramage et al., 2015). Many of these
processes parallel with those that occur during early stages of limb regeneration.
Nevertheless, its potential role in limb regeneration has yet to be described. Interestingly,
we noticed that mk expression was up-regulated in early stages of normal regenerating
limbs and down-regulated in non-regenerating full skin flap sutured limbs, suggesting that
it may play a role in limb regeneration. We therefore decided to examine the function of
mk in limb regeneration through a series of gain- and loss-of-function approaches.
Altogether, our data suggest that mk is a mediator of wound epidermis maturation.
5.4. Results
5.4.1. Midkine is strongly expressed in the basal layers of the wound epidermis and
connective tissue blastemal progenitors
We initially observed that mk appeared to be down-regulated in all three
subpopulations in full skin flap sutured limbs (Figure 5.1), suggesting that it may be
important for regeneration. To determine whether mk was indeed expressed during limb
regeneration, we performed timecourse RNAscope in situ hybridization of mk transcripts
during regeneration. In situ hybridization revealed that mk was lowly expressed in cells
115
Figure 5.1. Normalized transcripts per million (TPM) levels of midkine (mk) in
regenerating and full skin flap conditions. At 0 dpa, mk is lowly expressed in both non-
dividing and dividing cells within stump tissues, but not expressed in homeostatic skin.
Upon amputation, mk expression stays the same in stump-derived non-dividing cells and
increases in dividing cells. Furthermore, mk expression is strongly induced within the
wound epidermis at 5 dpa. In full skin flap conditions, we observed lower expression of
mk in all three populations.
0
50
100
150TPM
*
**
**
*
2N
4N
Epidermis
0 dpa 5 dpa 5 dpaFull Skin Flap
116
Figure 5.2. Mk is strongly expressed in the basal layers of the wound
epidermis/AEC and connective tissue blastemal progenitors. (A-F’) Timecourse
RNAscope in situ hybridization of mk transcripts at 0, 1, 3, 7, 14, and 21 dpa. Higher 20x
magnification insets in A-F are shown in A’-F’, respectively. Arrowhead in C’ denotes the
beginning of the wound epidermis. Dotted lines demarcate the wound epidermis/stump
tissue boundary in B’-D’ and the amputation plane in E-F. (G) In situ hybridization of mk
in full skin flap sutured limbs at 7 dpa. (H) Percentages out of total number of cells counted
of mk+ only, prrx-1+ only, or mk+/prrx-1+ co-positive cells at 5 (n=281 cells total) and 7 dpa
(n=424 cells total). (I-J) Double in situ hybridization of prrx-1 and mk at 5 and 7 dpa.
Images taken at 40x magnification. Arrowheads in I-J denote co-positive cells. Scalebars
are 500 µm in A-F and F, 100 µm in A’-F’, and 50 µm in I-J. FSF, full skin flap; dpa, days
post-amputation.
117
that are interspersed throughout the muscle in non-regenerating intact limbs (0 dpa) and
up-regulated upon amputation beginning at 3 dpa (Figure 5.2A-F’). Specifically, mk is
expressed within the basal layers of the wound epidermis and mesenchymal cells within
regenerating stump tissues at 3 and 7 dpa (Figure 5.2C-D’). By early and late bud
blastema stages (Figure 5.2E-F’), mk remains strongly expressed in the AEC and at lower
levels within the blastemal cells. Furthermore, we confirmed that mk expression remains
at low levels comparable to that of uninjured limbs in full skin flap sutured limbs (Figure
5.2G).
To determine whether mk was expressed within blastemal progenitors of
regenerating stump tissues, we performed double in situ hybridization of mk with the
connective tissue blastemal progenitor marker prrx-1 (Gerber et al., 2018). We observed
co-expression of mk and prrx-1 transcripts at both 5 and 7 dpa (Figure 5.2H-J).
Quantification of the total number of mk and prrx-1 expressing cells revealed that 87.88%
and 67.11% of prrx-1+ cells were co-positive, while 67.70% and 85.28% of mk+ cells were
prrx-1+ at 5 and 7 dpa, respectively. These data suggest that mk is expressed in a subset
of connective tissue blastemal progenitors. However, single-positive mk+ cells were
present at sizeable percentages, indicating that mk may be expressed in blastemal
progenitors from other lineages, or other cell types within the regenerating limb. To
examine whether other cell types such as immune cells may express mk, we performed
double in situ hybridization of mk and csf1r, a monocyte marker (Grayfer et al., 2014;
Stanley and Chitu, 2014), and found little overlap between mk and csf1r transcripts. Only
3.73% of csf1r+ cells were mk+ at 5 dpa (Figure A.4.1), suggesting that mk is not highly
expressed in monocytes. Altogether, these data suggest that mk is highly expressed
118
Figure 5.3. MK protein localization during limb regeneration. (A-C’) Immunostaining
of axolotl MK protein at 0 (A-A’), 5 (B-B’) and 14 dpa (C-C’). (D-D’) Immunostaining of
axolotl MK protein in full skin flap sutured limbs at 7 dpa. Arrowheads denote the
amputation plane in A-D. Higher 20x magnification images of the epidermis A-D are
shown in A’-D’. Dotted lines demarcate full skin flap in D of the wound epidermis/stump
boundary in A’-D’. Scalebars are 500 µm in A-D and 100 µm in A’-D’. FSF, full skin flap;
dpa, days post-amputation.
119
throughout regeneration in the basal layers of the wound epidermis and connective tissue
blastemal progenitors.
We additionally analyzed the MK protein expression pattern by performing
immunostaining with a custom polyclonal antibody against the C-terminus of axolotl MK.
Prior to immunostaining, we validated the specificity of the antibody on regenerating limb
extracts at 10 dpa with and without blocking peptide (detailed in Methods, Figure A.4.2).
Immunostaining of MK at 0, 5, and 14 dpa revealed that the protein expression pattern
mirrors that of the transcripts (Figure 5.3). In particular, MK protein is absent in non-
regenerating skin, and induced in the basal layers of the epidermis at 5 dpa. By 14 dpa,
MK protein is found throughout the AEC and in the blastema, suggesting that MK is
diffusing outwards from basal layers of the AEC (Figure 5.3A-C’). Moreover, MK protein
levels in full skin flap sutured limbs at 7 dpa are comparable to those of non-regenerating
limbs. In all, these data suggest that mk is highly up-regulated during limb regeneration.
5.4.2. Chemical inhibition of mk inhibits limb regeneration
In order to determine whether mk may play a role in limb regeneration, we
performed drug treatments with a small molecule inhibitor of MK, iMDK (Masui et al.,
2016) during limb regeneration (Figure 5.4). Treatment with iMDK beginning from 0 dpa
or 7 dpa completely prevented blastema formation and limb regeneration (Figure 5.4A,
B). In addition, alcian staining of DMSO or iMDK-treated limbs at 60 dpa confirmed that
all skeletal structures regenerated normally in DMSO controls, in contrast to iMDK-treated
limbs, which regenerated none (Figure 5.4C). These data collectively suggest that mk
may play an important role in limb regeneration.
120
Figure 5.4. Chemical inhibition of mk prevents limb regeneration. (A) Schematic of
inhibitor experiments with iMDK. Limbs were amputated and animals were immersed in
10 uM iMDK beginning at either 0 or 7 dpa. (B) Brightfield images of DMSO- and iMDK-
treated limbs at 26 and 40 dpa reveals that iMDK treatment inhibits limb regeneration
(n=4 DMSO and iMDK for each treatment, 4/4 did not regenerate in each iMDK
treatment). The green dotted line denotes the amputation plane. (C) Alcian staining of
DMSO- and iMDK-treated limbs at 60 dpa. Scale bars are 500 µm in B and 1 mm in C-D.
121
5.4.3. iMDK-treatment impairs wound epidermis maturation
We next wanted to determine which cellular processes were affected by iMDK
treatment. We reasoned that it was possible that treatment with iMDK inhibited limb
regeneration by lowering levels of cellular proliferation. In order to address this question,
we examined levels of cellular proliferation in DMSO and iMDK-treated limbs at 5 dpa
and 14 dpa. We observed no differences in the percentage of EdU+ cells at 5 dpa (24.04%
vs 23.27% EdU+ cells) (Figure 5.5A-B), suggesting that iMDK-treatment does not affect
early induction of proliferation. Interestingly, we noticed that EdU+ cells still accumulate
at the amputation plane in iMDK-treated limbs at 14 dpa, yet a blastema does not form.
Furthermore, histological staining of iMDK-treated limbs demonstrated that fibroblastic
blastema-like cells accumulate at the amputation plane even up to 40 dpa, however
regeneration remains inhibited (Figure 5.5C). These data collectively suggest that iMDK
treatment does not affect cellular proliferation, but may affect the development of other
structures necessary for blastema formation, such as the AEC.
To this end, we further examined picro-mallory stained sections from DMSO- or
iMDK-treated limbs at 14 dpa. While DMSO-treated limbs displayed a large blastema with
a thick AEC, iMDK-treated limbs had an abnormally thin wound epidermis (Figure 5.6A-
B’), suggestive of a defect in the transition from the early wound epidermis to the AEC. In
addition, TUNEL staining revealed that iMDK-treated limbs exhibited higher levels of total
cell death (5.451% vs. 1.801% TUNEL+ nuclei, pval=0.0145) (Figure 5.6C-E). Intriguingly,
we noticed that many TUNEL+ cells were present in the wound epidermis in iMDK-treated
limbs and quantification revealed a significant increase in the percentage of TUNEL+
nuclei specifically within the wound epidermis (7.110% vs. 4.384% TUNEL+ nuclei,
122
Figure 5.5. iMDK treatment does not affect early induction of proliferation in limb
regeneration. (A) Representative images of EdU-stained regenerating limbs at 5 and 14
dpa from either DMSO- or iMDK-treated limbs. EdU staining is shown in green.
Arrowheads denote the amputation plane. (B) Quantification of the percentage of EdU+
cells in DMSO- and iMDK-treated limbs revealed no difference (24.04% vs 23.27% EdU+
cells, pval= ns; DMSO, n=6, iMDK, n=7). (C) Picro-mallory staining of iMDK-treated limbs
at 40 dpa. Scale bars in A are 200 µm and C are 500 µm. dpa, days post-amputation.
123
Figure 5.6. iMDK-treated limbs exhibit an abnormally thin wound epidermis and
increased levels of cell death. (A-B’) Picro-mallory stained images of DMSO- and iMDK-
treated limbs at 14 dpa. Higher magnification images of insets in A and B are shown in
A’-B’ respectively. Dotted line denotes the amputation plane. (C-D) Representative
images of TUNEL-stained sections from DMSO and iMDK-treated limbs. (E)
Quantification of total and wound-epidermis specific TUNEL+ nuclei revealed increased
levels of apoptosis both overall (5.451% vs. 1.801% TUNEL+ nuclei, *pval=0.0145) and
specifically within the wound epidermis (7.110% vs. 4.384% TUNEL+ nuclei,
*pval=0.0232) of iMDK-treated limbs (n=6 for both DMSO and iMDK treatments).
Scalebars are 200 µm in A-B and C-D, 100 µm in A’-B’.
124
pval=0.0232) (Figure 5.6E). In all, these data collectively suggest that the defect in wound
epidermis development may be due at least in part, to an increase in cell death.
5.4.4. iMDK-treated limbs display persistant inflammatory profiles and dysregulated
wound epidermis gene expression
In order to determine how iMDK treatment affected the gene expression programs
of regenerating limbs, we transcriptionally profiled DMSO- and iMDK-treated limbs at
early stages of blastema formation (11 dpa). Principal component analysis (PCA) of all
samples revealed that most of the variation in the dataset was due to the treatment
(Figure A.4.3). Overall, 1,403 transcripts (1,011 annotated) were differentially expressed
(Figure 5.7A). Of the annotated transcripts, 575 were enriched in iMDK-treated limbs and
436 were enriched in DMSO control limbs (Table A.4.1).
Ingenuity pathway analysis (IPA) of enriched transcripts in iMDK-treated limbs
revealed an enrichment of transcripts in many pro-inflammatory pathways including toll-
like receptor (TLR) signaling, Th1/2 activation, and Oncostatin M signaling (Figure 5.7B,
Table A.4.2, Table A.4.3). Furthermore, transcripts involved in leukocyte extravasation
and infiltration of granulocytes, monocytes, and lymphocytes into tissues were also
enriched. These data indicate that iMDK-treated limbs exhibit a persistent inflammatory
response, and suggest that wound healing resolution is likely defective in these limbs.
Examination of the enriched transcripts in DMSO-treated limbs revealed that many
of these transcripts were involved in actin cytoskeletal regulation including RhoA and
RhoGDI signaling (Figure 5.7C). These pathways are heavily involved in contexts of cell
migration and invasion (in the case of tumorigenesis) (Newell-Litwa and Horwitz, 2011;
125
Lawson and Ridley, 2018), suggesting that iMDK-treated limbs display potential defects
in cell migration. In addition, many DMSO-enriched transcripts pertained to the cell cycle
and amino acid metabolism, which was less surprising given that the DMSO-treated limbs
were developing blastemas, and likely had higher numbers of highly metabolic dividing
cells.
Interestingly, some of the top most differentially expressed transcripts from the
analysis were genes that are known to be expressed in the wound epidermis including
urom (Campbell et al., 2011; Knapp et al., 2013). Utilizing our dataset as well as published
single cell data from regenerating limbs (Gerber et al., 2018; Leigh et al., 2018), we mined
the data for transcripts that are known to be expressed specifically in skin during
homeostasis or in the wound epidermis during regeneration. Our findings revealed that
many wound epidermis genes were mis-expressed in iMDK-treated limbs (Figure 5.7D).
In particular, wound epidermis genes including s10aa, s10ad, agr2, chs1, natt4, and
k1c17 were overexpressed in the inhibitor treatment, while three genes m1ip1, elf3, and
ptprz were down-regulated. These transcriptional data coupled with our histological data
strongly suggest that iMDK treatment impairs wound epidermis development.
Finally, to corroborate the persistent inflammatory transcriptional profile with
additional experimental evidence, we examined the levels of monocytes in DMSO- and
iMDK-treated limbs at 5 and 14 dpa (Figure 5.8). NSE staining revealed higher levels of
monocytes at both 5 and 14 dpa (Figure 5.8A-D). Furthermore, quantification of NSE+
cells at 5 dpa confirmed an early significant increase in monocyte density in iMDK-treated
limbs (440.0 vs. 234.6 NSE+ cells/mm2, pval = 0.0168) (Figure 5.8E). In all, these data
provide supportive evidence that treatment with iMDK leads to a persistent inflammation.
126
Figure 5.7. Treatment with iMDK leads to dysregulation of wound epidermis gene
expression and persistent inflammation. (A) Heatmap of annotated differentially
expressed transcripts in DMSO- and iMDK-treated limbs reveals two main clusters
(colored pink and orange) of transcripts either enriched in DMSO or iMDK treatments.
Transcript expression was normalized per row and plotted as a Z-score. (B) Plot of
enriched pathways in iMDK-treated limbs. (C) Plot of enriched pathways in DMSO-treated
limbs. (D) Heatmap of mis-regulated wound epidermis genes in DMSO and iMDK-treated
limbs. Transcript expression is plotted as a normalized Z-score.
127
Figure 5.8. iMDK-treated limbs exhibit higher levels of monocytes. (A-D) NSE
staining of DMSO- and iMDK-treated limbs at 5 dpa (A-B’) and 14 dpa (C-D). Higher
magnification images of insets in A and B are shown in A’ and B’, respectively.
Arrowheads denote NSE+ monocytes in A’ and B’. Dotted lines in C-D demarcate the
amputation plane. (E) Quantification of NSE+ monocytes at 5 dpa revealed a significant
increase in the density of monocytes in iMDK-treated limbs (440.0 vs. 234.6 NSE+
cells/mm2, *pval = 0.0168; n=7, DMSO, n=6, iMDK). Scale bars are 200 µm in A-B and
50 µm in A’-B’. Dpa, days post-amputation.
128
5.4.5. Midkine F0 mutants have delayed blastemal outgrowth and impaired wound
epidermis maturation
While iMDK treatment yielded a strong phenotype, the mechanism of the drug
remains unknown (Masui et al., 2016) and we therefore wanted to perturb mk in a more
precise manner genetically. To achieve this, we utilized CRISPR technology and
generated mk F0 knockout animals by targeting the start codon (Figure A.4.4A). The slow
development of the axolotl allows for high penetrance of mutations throughout the animal,
allowing for phenotyping to occur at the F0 stage (Fei et al., 2018). Genotyping of limbs
from these animals via deep-sequencing of PCR amplicons from the mk locus revealed
that many of these mutants were mosaic null, with no wild-type alleles present (Figure
A.4.4B). Mk F0 mutant animals developed normally and had no obvious phenotypic
defects. Furthermore, immunostaining of limbs from tracrRNA non-targeted controls and
mk F0 mutants confirmed a complete loss of staining in these null mutants (Figure 5.9A).
We next wanted to determine whether genetic loss of mk similarly impaired
regeneration. Brightfield imaging of limbs from tracrRNA controls and mk F0 mutants
revealed that mk mutants exhibited delayed blastema formation, but eventually
regenerate normally (Figure 5.9C-D). We measured the blastema lengths from sections
of regenerating limbs of tracrRNA controls and mk F0 mutants at 14 dpa and observed
that the delay in blastema formation segregated based on genotype, with mk null animals
(no detectable wildtype allele) exhibiting the most severe delay (152.06 µm in mk null
mutants vs. 404.8 µm in tracrRNA controls, pval = 0.0043) (Figure 5.9E-H). These data
collectively suggest that blastema formation is impaired during early stages of
regeneration.
129
Figure 5.9. Mk-deficient mutants exhibit delayed blastema formation. (A-B)
Immunostaining of regenerating limbs at 7 dpa of both tracrRNA controls (A) and mk
mutants (B) mk antibody reveals an absence of staining in the mk mutant. (C-D)
Brightfield images of regenerating limbs at 11 dpa of tracrRNA controls or mk F0 mutants
reveals a delay in blastema formation. White dotted line denotes the amputation plane.
(E) Graph of measurements of blastema length at 14 dpa from regenerating tracrRNA
controls, mk null, mk mutants with low % of wildtype alleles, and mk mutants with high %
of wildtype alleles reveals a dose dependence effect of mk on the phenotypic delay. (F-
G) Representative histological stains from sections of either mk null, mk high% wildtype,
and tracrRNA controls at 14 dpa. Scale bars are 500 µm in A-B, 1 mm in C-D, and 200
µm in F-G. wt, wildtype, dpa, days post-amputation.
130
Figure 5.10. Mk-deficient mutants exhibit an abnormally thin wound epidermis.
(A) Representative histological stains of sections from regenerating limbs of tracrRNA
controls and mk mutants at 10 dpa reveals mk mutants. (C) Quantification of wound
epidermis thickness reveals a significant decrease in width of the wound epidermis of mk
mutants (152.06 µm in mk null vs. 404.8 µm in tracrRNA control, **pval = 0.0043; n=8,
DMSO and iMDK). Scale bars are 500 µm in in A-B.
Since chemical inhibition of mk with iMDK led to abnormal wound epidermis
maturation, we decided to examine the wound epidermis of regenerating limbs of control
and mk F0 mutant animals. As the phenotypic delay in blastema formation was most
severe in mk null animals, we focused the rest of our analyses detailed below on animals
with this genotype and refer to them heretofore as mk mutants. Histological staining of
limbs from both controls and mk mutants at 10 dpa revealed a striking difference in the
thickness of the wound epidermis (Figure 5.10). The wound epidermis of control
regenerating limbs had thickened considerably as is natural when maturing into the AEC,
whereas mk mutant limbs exhibited a thin wound epidermis. Quantification further
revealed that this decrease in wound epidermis thickness was statistically significant
(53.64 µm vs. 115.7 µm, pval=0.0084).
131
Figure 5.11. Mk-deficient mutants display a mild increase in the levels of
monocytes. (A-B) Representative NSE stained sections from regenerating limbs of
tracrRNA controls and mk mutants. (C) Quantification of the density of NSE+ monocytes
revealed a mild significant increase in the levels of monocytes in mk mutants (230.5 vs.
160.4 NSE+ cells/mm2, *pval=0.0441; n=8, DMSO and iMDK). Scale bars are 500 µm in
in A-B. dpa, days post-amputation.
In addition, to examine whether there was an increase in the levels of monocytes
similar to that observed in iMDK-treated limbs, we performed NSE staining on limbs at 10
dpa and quantified the number of NSE+ cells. Quantification indicated a mild significant
increase in the density of monocytes in mk mutant regenerating limbs (230.5 vs. 160.4
NSE+ cells/mm2, pval=0.0441), suggesting there may also be a persistent inflammatory
response (Figure 5.11). These results collectively corroborated the chemical inhibition
experiments and therefore strongly suggest that loss of mk leads to impaired wound
epidermis maturation and persistent inflammation.
5.4.6. Overexpression of mk during regeneration leads to uncontrolled wound epidermis
growth
Because genetic loss and inhibition of mk affected the wound epidermis, we next
wanted to determine whether overexpression of mk during regeneration would affect the
132
wound epidermis as well. To this end, we injected and electroporated either a tdTomato
control (pCAG-tdTomato) and/or a mk overexpression construct (pCAG-MK) at 3 dpa and
examined the effects on limb regeneration (Figure 5.12A, Figure A.4.5). Interestingly,
while tdTomato control limbs exhibited nice blastemas by 16 dpa (Figure 5.12B-C), mk-
overexpressing limbs exhibited protruding bone at 7 dpa coupled with abnormal wound
epidermis masses (Figure 5.12D-E), suggesting both aberrant growth and tissue integrity
of the wound epidermis. By 16 dpa, the wound epidermis continues to grow uncontrollably
and histological staining of sections through tdTomato and mk-overexpressing limbs at
16 dpa confirmed that mk overexpression led to uncontrolled expansion of the wound
epidermis (Figure 5.12F-H). Intriguingly, mk-overexpressing limbs also seemed to exhibit
potential defects in bone resorption, as the bone structure still remains intact at the
amputation plane (Figure 5.12G-H). We further noticed the presence of large cells
invading the bone that are reminiscent of osteoclasts, the main bone cells responsible for
resorption. These data collectively suggest that overexpression of mk leads to
uncontrolled growth of the wound epidermis and potential defects in bone resorption.
5.4.7. Sdc-1 is expressed in the wound epidermis
Gain- and loss-of function perturbation experiments determined that one main role
that mk plays during limb regeneration is modulating the development and maturation of
the early wound epidermis to the AEC. In order to determine whether mk may directly
regulate the wound epidermis, we examined whether any mk receptors (Xu et al., 2014)
were up-regulated during limb regeneration in our transcriptional dataset. Of the many
133
Figure 5.12. Overexpression of mk in regenerating limbs leads to uncontrolled
growth of the wound epidermis. (A) Experimental schematic of the mk overexpression
experiment. (B-E) Brightfield images of either tdtomato- or mk-overexpressing limbs at 7
and 16 dpa. Arrowhead in D denotes an abnormal mass of skin forming in mk-
overexpressing limbs. Dotted line denotes the amputation plane. (F-H) Representative
picro-mallory stained sections of tdtomato- or mk-overexpressing limbs at 16 dpa reveals
an abnormally thick wound epidermis. Yellow arrowheads additionally denote the
aberrant presence of osteoclasts in mk-overexpressing limbs. n=5 for tdT and MK
overexpression limbs. Scale bars are 1 mm in B-E and 200 µm in F-H.
134
Figure 5.13. Sdc-1 is expressed in normal skin and the wound epidermis during
limb regeneration. Double RNAscope in situ hybridization of mk and sdc-1 at 0, 7, and
14 dpa. Insets show where the 40x magnification image was taken from in the original
section. Dotted lines denote the boundary between the normal epidermis/wound
epidermis and stump tissues. Scale bars are 50 µm.
receptors, one mk receptor, sdc-1, was the most highly expressed in homeostatic skin at
0 dpa and up-regulated in early dividing cells as well as the wound epidermis at 4 and 5
dpa within our dataset. To validate these transcriptional data, we performed time course
RNAscope double in situ hybridization of mk and sdc-1 at 0, 7, and 14 dpa (Figure 5.13).
As expected, sdc-1 was indeed expressed at low levels in homeostatic skin and up-
regulated within the wound epidermis and mesenchymal cells within regenerating stump
tissues at 7 and 14 dpa. Interestingly, mk was expressed strongly within the basal layers
of the wound epidermis while sdc-1 was expressed more highly in the outer layers at 7
and 14 dpa, suggesting that secreted mk may directly modulate the wound epidermis.
Furthermore, sdc-1 expression overlapped with a subpopulation of mk+ cells within
regenerating stump tissues at 7 dpa, however many single-positive sdc-1+ cells were also
135
present. By 14 dpa, sdc-1 expression persists within blastemal cells at strong levels.
Altogether, these data indicate that mk likely directly modulates the wound epidermis and
the behavior of cells within regenerating stump tissues to regulate blastema formation.
5.5. Discussion
The wound epidermis/AEC is essential for formation of the blastema, yet little is
known about molecules that regulate the maturation of the early wound epidermis to the
AEC during blastema formation. Here, we have identified a novel regulator of wound
epidermis maturation. Genetic loss and chemical inhibition of mk both lead to an
abnormally thin wound epidermis, indicative of impaired wound epidermis maturation. In
addition, iMDK-treated limbs display aberrant wound epidermis gene expression profiles
and overexpression of mk during limb regeneration is sufficient to induce uncontrolled
wound epidermis growth. Finally, the midkine receptor sdc-1 is expressed within outer
layers of the wound epidermis during limb regeneration, suggesting that mk directly
modulates the wound epidermis. Altogether, these data suggest that mk plays a central
role in modulating the wound epidermis.
It is possible that mk is regulating wound epidermis maturation by acting as a
survival factor. One key step to maturation of the wound epidermis is growth in thickness,
which is generally due to proliferation and migration of cells from the peripheral skin (Hay
and Fischman, 1961; Campbell and Crews, 2008). Inhibitor-treated limbs have higher
levels of cell death specifically in the wound epidermis, providing one likely explanation
as to why both inhibitor-treated limbs and mk mutants are unable to form an AEC
correctly. In fact, mk has been shown to act as a survival factor in other contexts including
136
neural crest cell migration in development (Vieceli and Bronner, 2018) and current
experiments are underway to address whether a similar increase in cell death is observed
in mk mutants as well. Furthermore, mk overexpression during regeneration resulted in
aberrant wound epidermis growth, suggesting that mk may be sufficient to induce
epithelial cell proliferation. Therefore, it is possible that mk modulates wound epidermis
maturation by balancing cell death and proliferation rates in the wound epidermis.
Notably, wound epidermis genes were dysregulated in inhibitor-treated limbs.
Surprisingly, many of these genes were found to be normally expressed in the wound
epidermis (ex. urom, s10ad, s10aa, k1c17 and epcam) as detected in publicly available
datasets (Gerber et al., 2018; Leigh et al., 2018; Tsai et al., 2019), and highly
overexpressed in iMDK-treated limbs. Notably, chs1 was overexpressed in iMDK-treated
limbs. Chs1 is expressed in the wound epidermis specifically during wound healing stages
of regeneration (Leigh et al., 2018). Therefore, overexpression of chs1 in inhibitor-treated
limbs further suggests that the wound epidermis fails to transition to the AEC. Finally, the
midkine receptor ptprz (Xu et al., 2014) failed to be induced in the presence of the
inhibitor, suggesting that ptprz may be a wound epidermis-specific receptor mediating the
effects of mk in addition to sdc-1. Experiments are currently underway to determine the
expression pattern of ptprz and whether small molecule inhibition of ptprz can phenocopy
mk inhibition.
Finally, while the strongest phenotype we observed was impaired wound epidermis
maturation, it is likely that mk plays more than one functional role during limb regeneration
given its widespread expression in connective tissue blastemal progenitors and other as
of yet unidentified cell types within regenerating stump tissues. Furthermore, the receptor
137
sdc-1 is also expressed in many cells within regenerating stump tissues as well, lending
further evidence to a pleiotropic role for mk in limb regeneration. In addition to a defect in
wound epidermis development, inhibitor-treated limbs and mk mutant limbs both have
higher levels of monocytes. Moreover, inhibitor-treated limbs display persistent
inflammatory profiles and overexpress many transcripts associated with pro-inflammatory
pathways that are triggered in response to pathogen and tissue damage-related cues.
These results suggest the possibility that mk may directly modulate the immune response.
As the mk receptor sdc-1 is expressed in many cells within regenerating stump tissues
that are not mk+, mk may likely also act as a paracrine immunomodulator as it is known
to be involved in regulating inflammation (Weckbach et al., 2011). Another explanation
for the observed persistent inflammation is that this is a secondary effect of impaired
wound epidermis maturation. As our full skin flap transcriptional data in chapter 4
suggests that the early wound epidermis plays heavy roles in coordinating inflammation,
it is conceivable that keeping the wound epidermis in a perpetually early state would
impede the resolution of wound healing, leading to persistent inflammation. Finally, we
observed higher levels of osteoclasts and aberrant tissue histolysis of the bone in mk-
overexpressing limbs. Furthermore, we also observed that catk, a collagen-degrading
enzyme expressed by osteoclasts (Troen, 2004) was down-regulated in iMDK-treated
limbs as well. Others have shown that mk plays a large role in skeletal remodeling and
bone resorption (Liedert et al., 2014), and therefore it is likely that mk may also play a
role in bone resorption as well. In all, these data suggest that mk may play pleiotropic
roles within limb regeneration and regulate many other aspects of blastema formation.
138
5.6. Materials and Methods
Animal care and husbandry
Axolotl (Ambystoma mexicanum) husbandry and surgeries were performed in
accordance with the Association for Assessment and Accreditation of Laboratory Animal
Care (AAALAC) and Institutional Animal Care and Use Committee (IACUC) guidelines at
Harvard University. Juvenile white axolotls (3-5 cm animals) were utilized for the midkine
inhibitor (iMDK) experiments and mk overexpression experiments. For drug experiments,
limbs of animals were amputated and the animals were immersed in DMSO or 10 uM
iMDK solution beginning at either 0 or 7 dpa. Drug solution was changed daily for the
duration of the experiments and animals were fed normally.
Imaging analysis
All imaging analysis was conducted randomized and blinded. For most analyses,
we utilized a two-tailed unpaired t-test to test for statistical significance unless otherwise
stated.
In situ hybridization
Limb tissue was collected and processed as described above. Custom RNAscope
probes were generated either the C1 or C2 channel for csf1r, mk, prrx-1, and sdc-1. In
situ hybridization was performed using the RNAscope 2.5HD Duplex Detection Kit
according to the manufacterer’s instructions. For quantification of single mk+, csf1r+, prrx-
1+, double positive mk+/prrx-1+ and double mk+/csf1r+ cells, we only counted strongly
139
positive cells (greater than 10 puncta per cell). These numbers were utilized to calculate
the percentage of single and co-positive cells.
RNA-sequencing and analysis of iMDK-treated limbs
We isolated RNA from DMSO or iMDK-treated limbs at 11 dpa. For the RNA
isolation, we homogenized the tissue in Trizol and purified RNA using the Qiagen RNeasy
mini kit. We collected the samples in triplicate for each condition. Quality and quantity of
RNA was assessed using the Agilent RNA 6000 pico kit and run on a BioAnalyzer 2100
(Agilent). Sequencing libraries were then synthesized and sequenced on a Nextseq 500
at the Biopolymers Facility at Harvard Medical School.
Fastq data from the RNA-sequencing was filtered and trimmed using Trimmomatic
(Bolger et al., 2014). The data was then aligned to the previously published axolotl
transcriptome (Bryant et al., 2017) and analyzed with DESeq2 (Love et al., 2014). For the
differential expression analysis, we set the cutoff at an adjusted p-value < 0.05 and fold
change > 2. K-means clustering of the transcripts was performed using the Complex
Heatmap package (Gu et al., 2016) and pathway analysis of DMSO- or iMDK-enriched
transcripts was performed on differentially expressed transcripts using Ingenuity Pathway
Analysis (IPA) (Qiagen) software.
-Naphthyl Acetate Esterase (NSE) staining
NSE staining was performed using the -Naphthyl Acetate Esterase staining kit
(Sigma) according to the manufacturer’s instructions.
140
TUNEL staining
TUNEL staining was performed according to the manufacturer’s instructions and
as described in (Zhu et al., 2012).
Generation of mk mutants and genotyping
In order to generate the mk mutants, we utilized CRISPR-cas9 technology and
targeted the start codon of the mk locus with a single guide RNA (sgRNA) (ATG start is
bolded): 5’AAGCCCCCACAACTGCATCC -3’. This sequence was also a unique within
the axolotl genome. The mk gRNA and generic tracrRNA were ordered from IDT and
reconstituted according to their instructions. We injected embryos at the one-cell stage
with cas9 ribonucleoprotein (cas9 RNP) complexes. To generate the cas9 RNP
complexes, we annealed the sgRNA and tracrRNA as described in Bryant et al. (2017).
We then mixed the mk gRNA (final concentration 200-400 ng/uL) with concentrated cas9
(final concentration 500 ng/uL) (PNA Bio Inc.) and incubated for 10 minutes at 37ºC to
generate the cas9 ribonucleoprotein (RNP) complex. For each fertilized egg, we injected
2-3 nl of injection mix and performed the injections as described in (Khattak et al., 2014).
To genotype the animals, we collected genomic DNA from limbs of regenerating
tracrRNA controls and mk mutants. Tissue was incubated in 50 mM NaOH for 20 min. at
94ºC and neutralized with TE buffer pH 7.5. The supernatant was then PCR purified using
the Qiagen PCR purification kit according to the manufacturer’s instructions. We then
performed genomic PCR to amplify the area surrounding the cut site with the following
primers:
For 5’-TTGCTTATTCCTTGTGATCATGC-3
141
Rev 5’- GGCACATTATTACACAGAAAGCTC-3’
Next, we performed two rounds of additional PCRs to generate DNA sequencing libraries
as described in (Gagnon et al., 2014). One round of nested PCR was performed using
the following gene specific primers with universal overhangs:
For 5’- tctttccctacacgacgctcttccgatctGAGGTTTGATTGGACCCTGA-3’
Rev 5’- tggagttcagacgtgtgctcttccgatctGGCACATTATTACACAGAAAGCTC-3’
The next round of PCR was performed to add on i7 indices and P5/P7 sequences to
generate DNA sequencing libraries. We pooled up to 24 libraries together and sequenced
the pool on a department owned Miseq using the Miseq reagent nano kit v2 (300 cycle)
(Illumina). Fastq data was then analyzed utilizing CRISPResso (Pinello et al., 2016). For
the analysis, mutants in which we detected no wildtype alleles were deemed null, with up
to 10-15% wildtype alleles deemed low % wildtype, and greater than 15% deemed high
% wildtype (most of these animals were actually closer to 80-90% wildtype).
Characterization of mk mutants
Brightfield images of regenerating limbs were taken of tracrRNA controls and mk
mutants during regeneration using an Olympus SZX16 dissecting microscope. Tissue
was collected at 10 and 14 dpa for analyses. For the blastema length measurement
analysis, we performed picro-mallory staining on sections and measured the length at 14
dpa. A similar analysis was performed when measuring the wound epidermis thickness.
Immunostaining and EdU staining
142
Limb tissue was collected and fixed overnight in 4% paraformaldehyde, brought
up a sucrose gradient, and embedded in OCT. Tissue was cryosectioned at a thickness
of 12 m. For EdU analysis, animals were injected as described in Tsai et al. (2019) and
the Click-it EdU A488 Imaging Kit was utilized (Thermofisher Scientific) according to the
manufacturer’s instructions. For MK immunostaining, we first generated a custom
polyclonal rabbit antibody against the C-terminus (amino acids 125-142) of axolotl MK
and validated it with a peptide blocking assay. We performed western blots on 20 ug of
10 dpa protein extracts and blocked with increasing concentrations of the peptide used
to generate the antibody and saw a depletion of signal from the anti-MK staining (Figure
A.4.2).
Overexpression of mk in regenerating limbs
To generate the mk overexpression vector, we cloned in the open reading frame
of mk by excising out tdTomato from the pCAG-tdTomato backbone using EcoRI and NotI
(Addgene plasmid #83029) to generate the pCAG-MK overexpression vector. To validate
the expression and secretion of mk, we transfected 293T cells with either pCAG-tdTomato
or pCAG-MK vectors and collected the transfected cells and media at 72 hours post-
transfection (hpt). Protein lysates from the transfected 293T cells were collected using
RIPA buffer and western blots were performed on each of the protein lysates and media
samples using anti-tdTomato (1:1000) (LS Bio LS-C340696), our custom generated anti-
MK (1:2000), and anti-GAPDH (1:2000) (Millipore AB2302) antibodies. The presence of
axolotl mk was detected in both pCAG-MK transfected 293T cell lysates and media
(Figure A.4.5).
143
Limbs of regenerating animals were injected and electroporated at 3 dpa with
either the pCAG-MK overexpression vector and/or the pCAG-tdTomato vector. The
electroporation settings were the same as previously described in Tsai et al. (2019).
Approximately 1 ug total was injected into each limb. Brightfield images of regenerating
limbs were taken at 7 and 16 dpa using an Olympus SZX16 dissecting microscope.
Alcian staining
Alcian blue staining of DMSO or iMDK-treated limbs at 60 dpa was performed as
described previously (Whited et al., 2013).
5.7. References
Bolger, A. M., Lohse, M. and Usadel, B. (2014). Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics 30, 2114-2120.
Bryant, D. M., Johnson, K., DiTommaso, T., Tickle, T., Couger, M. B., Payzin-Dogru, D., Lee, T. J., Leigh, N. D., Kuo, T. H., Davis, F. G., et al. (2017). A Tissue-Mapped Axolotl De Novo Transcriptome Enables Identification of Limb Regeneration Factors. Cell Rep 18, 762-776.
Calinescu, A. A., Vihtelic, T. S., Hyde, D. R. and Hitchcock, P. F. (2009). Cellular expression of midkine-a and midkine-b during retinal development and photoreceptor regeneration in zebrafish. J Comp Neurol 514, 1-10.
Campbell, L. J. and Crews, C. M. (2008). Wound epidermis formation and function in urodele amphibian limb regeneration. Cell Mol Life Sci 65, 73-79.
Campbell, L. J., Suarez-Castillo, E. C., Ortiz-Zuazaga, H., Knapp, D., Tanaka, E. M. and Crews, C. M. (2011). Gene expression profile of the regeneration epithelium during axolotl limb regeneration. Dev Dyn 240, 1826-1840.
Fei, J. F., Lou, W. P., Knapp, D., Murawala, P., Gerber, T., Taniguchi, Y., Nowoshilow, S., Khattak, S. and Tanaka, E. M. (2018). Application and
144
optimization of CRISPR-Cas9-mediated genome engineering in axolotl (Ambystoma mexicanum). Nat Protoc 13, 2908-2943.
Gagnon, J. A., Valen, E., Thyme, S. B., Huang, P., Akhmetova, L., Pauli, A., Montague, T. G., Zimmerman, S., Richter, C. and Schier, A. F. (2014). Efficient mutagenesis by Cas9 protein-mediated oligonucleotide insertion and large-scale assessment of single-guide RNAs. PLoS One 9, e98186.
Gerber, T., Murawala, P., Knapp, D., Masselink, W., Schuez, M., Hermann, S., Gac-Santel, M., Nowoshilow, S., Kageyama, J., Khattak, S., et al. (2018). Single-cell analysis uncovers convergence of cell identities during axolotl limb regeneration. Science.
Gramage, E., D'Cruz, T., Taylor, S., Thummel, R. and Hitchcock, P. F. (2015). Midkine-a protein localization in the developing and adult retina of the zebrafish and its function during photoreceptor regeneration. PLoS One 10, e0121789.
Grayfer, L., Edholm, E. S. and Robert, J. (2014). Mechanisms of amphibian macrophage development: characterization of the Xenopus laevis colony-stimulating factor-1 receptor. Int J Dev Biol 58, 757-766.
Gu, Z., Eils, R. and Schlesner, M. (2016). Complex heatmaps reveal patterns and correlations in multidimensional genomic data. Bioinformatics 32, 2847-2849.
Hay, E. D. and Fischman, D. A. (1961). Origin of the blastema in regenerating limbs of the newt Triturus viridescens. An autoradiographic study using tritiated thymidine to follow cell proliferation and migration. Dev Biol 3, 26-59.
Karaman, S. and Alitalo, K. (2017). Midkine and Melanoma Metastasis: A Malevolent Mix. Dev Cell 42, 205-207.
Khattak, S., Murawala, P., Andreas, H., Kappert, V., Schuez, M., Sandoval-Guzman, T., Crawford, K. and Tanaka, E. M. (2014). Optimized axolotl (Ambystoma mexicanum) husbandry, breeding, metamorphosis, transgenesis and tamoxifen-mediated recombination. Nat Protoc 9, 529-540.
Knapp, D., Schulz, H., Rascon, C. A., Volkmer, M., Scholz, J., Nacu, E., Le, M., Novozhilov, S., Tazaki, A., Protze, S., et al. (2013). Comparative transcriptional profiling of the axolotl limb identifies a tripartite regeneration-specific gene program. PLoS One 8, e61352.
145
Lawson, C. D. and Ridley, A. J. (2018). Rho GTPase signaling complexes in cell migration and invasion. J Cell Biol 217, 447-457.
Leigh, N. D., Dunlap, G. S., Johnson, K., Mariano, R., Oshiro, R., Wong, A. Y., Bryant, D. M., Miller, B. M., Ratner, A., Chen, A., et al. (2018). Transcriptomic landscape of the blastema niche in regenerating adult axolotl limbs at single-cell resolution. Nat Commun 9, 5153.
Liedert, A., Schinke, T., Ignatius, A. and Amling, M. (2014). The role of midkine in skeletal remodelling. Br J Pharmacol 171, 870-878.
Love, M. I., Huber, W. and Anders, S. (2014). Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol 15, 550.
Masui, M., Okui, T., Shimo, T., Takabatake, K., Fukazawa, T., Matsumoto, K., Kurio, N., Ibaragi, S., Naomoto, Y., Nagatsuka, H., et al. (2016). Novel Midkine Inhibitor iMDK Inhibits Tumor Growth and Angiogenesis in Oral Squamous Cell Carcinoma. Anticancer Res 36, 2775-2781.
Muramatsu, T. (2010). Midkine, a heparin-binding cytokine with multiple roles in development, repair and diseases. Proc Jpn Acad Ser B Phys Biol Sci 86, 410-425.
Newell-Litwa, K. A. and Horwitz, A. R. (2011). Cell migration: PKA and RhoA set the pace. Curr Biol 21, R596-598.
Olmeda, D., Cerezo-Wallis, D., Riveiro-Falkenbach, E., Pennacchi, P. C., Contreras-Alcalde, M., Ibarz, N., Cifdaloz, M., Catena, X., Calvo, T. G., Canon, E., et al. (2017). Whole-body imaging of lymphovascular niches identifies pre-metastatic roles of midkine. Nature 546, 676-680.
Pinello, L., Canver, M. C., Hoban, M. D., Orkin, S. H., Kohn, D. B., Bauer, D. E. and Yuan, G. C. (2016). Analyzing CRISPR genome-editing experiments with CRISPResso. Nat Biotechnol 34, 695-697.
Sorrelle, N., Dominguez, A. T. A. and Brekken, R. A. (2017). From top to bottom: midkine and pleiotrophin as emerging players in immune regulation. J Leukoc Biol 102, 277-286.
146
Stanley, E. R. and Chitu, V. (2014). CSF-1 receptor signaling in myeloid cells. Cold Spring Harb Perspect Biol 6.
Troen, B. R. (2004). The role of cathepsin K in normal bone resorption. Drug News Perspect 17, 19-28.
Tsai, S. L., Baselga-Garriga, C. and Melton, D. A. (2019). Blastemal progenitors modulate immune signaling during early limb regeneration. Development 146.
Vieceli, F. M. and Bronner, M. E. (2018). Leukocyte receptor tyrosine kinase interacts with secreted midkine to promote survival of migrating neural crest cells. Development 145.
Weckbach, L. T., Muramatsu, T. and Walzog, B. (2011). Midkine in inflammation. ScientificWorldJournal 11, 2491-2505.
Whited, J. L., Tsai, S. L., Beier, K. T., White, J. N., Piekarski, N., Hanken, J., Cepko, C. L. and Tabin, C. J. (2013). Pseudotyped retroviruses for infecting axolotl in vivo and in vitro. Development 140, 1137-1146.
Xu, C., Zhu, S., Wu, M., Han, W. and Yu, Y. (2014). Functional receptors and intracellular signal pathways of midkine (MK) and pleiotrophin (PTN). Biol Pharm Bull 37, 511-520.
Zhu, W., Pao, G. M., Satoh, A., Cummings, G., Monaghan, J. R., Harkins, T. T., Bryant, S. V., Randal Voss, S., Gardiner, D. M. and Hunter, T. (2012). Activation of germline-specific genes is required for limb regeneration in the Mexican axolotl. Dev Biol 370, 42-51.
148
6.1. Revealing mechanisms of blastema formation is essential to understanding
limb regeneration
Salamander limb regeneration is an incredibly complex phenomenon that has
fascinated biologists for centuries (Spallanzani, 1769). Upon limb amputation,
salamanders are remarkably capable of re-initiating limb developmental programs, unlike
most mammals, which initiate fibrotic scarring responses. Why salamanders can
accomplish such a feat in contrast to humans is therefore a question that has driven
regenerative biologists for many years.
Successful limb regeneration hinges on the formation of a transient
dedifferentiated cellular structure distal to the amputation plane known as the blastema,
which later re-differentiates and patterns into mature tissues of the regenerated limb. The
blastema is comprised of lineage-restricted progenitors derived from many different
tissues within the limb including muscle, bone, and connective tissue (Kragl et al., 2009;
Gerber et al., 2018; Leigh et al., 2018) and therefore blastema formation requires precise
coordination across a variety of cell-types both through space and time. Naturally, the
blastema itself has been likened to the limb bud during development through its
morphological resemblance. In fact, studies have shown that the blastema
transcriptionally resembles the limb bud during later stages of regeneration (Knapp et al.,
2013; Gerber et al., 2018) and re-activates similar pathways necessary for limb
development (Torok et al., 1999; Han et al., 2001; Christensen et al., 2002; Nacu et al.,
2016). Furthermore, the apical epithelial cap (AEC) that is tightly coupled with the
blastema has been likened to the apical ectodermal ridge (AER) in limb development
149
based on similar gene expression patterns and roles in maintaining cell proliferation
(Boilly and Albert, 1990; Han et al., 2001; Christensen et al., 2002).
While later stages of regeneration post-blastema formation seem to resemble limb
development, earlier stages during wound healing and the initiation of blastema formation
display highly divergent transcriptional profiles (Knapp et al., 2013). The beginning stages
of limb regeneration are exceptionally intricate involving many concurrent processes
including the onset and resolution of inflammation, ECM degradation and tissue histolysis,
wound epidermis formation, as well as the induction of proliferation and migration of
different lineage-derived progenitors to the amputation plane (Kawasumi et al., 2013).
Therefore, understanding how each of these processes is controlled and coordinated
molecularly will help us gain further insight into the mechanisms that drive blastema
formation. To this end, many advances have been made in the field to delineate tissues
and cell-types that are necessary for blastema formation during early stages. Specifically,
it has been shown that the presence of nerves, the wound epidermis, and macrophages
are each required for successful blastema formation (Thornton, 1957; Mescher, 1976;
Godwin et al., 2013; Farkas and Monaghan, 2017). Of these, the influence of early
innervation has been the most well-studied and to date, several important neurotrophic
molecules have been described (Kumar et al., 2007; Farkas et al., 2016). Yet, much
remains to be discovered about the molecular regulation of immune cells and the wound
epidermis during regeneration. Altogether, these studies make it imperative to further
dissect the transcriptional programs of the initial stages of regeneration.
Building off of the important work of others in the field, we have made several
important contributions to the limb regeneration field in the work presented in this
150
dissertation. Briefly, using the method that we developed to enrich for dividing cells during
early stages of regeneration, we separately identified the gene expression programs that
are active within blastemal progenitors and the surrounding tissues (non-dividing cells in
regenerating stump tissues and the wound epidermis) (Tsai et al., 2019). We further
leveraged our dataset to ask how these transcriptional programs change in the absence
of the wound epidermis. These datasets collectively provided insight into early blastemal
cell biology as well as the influence of the early wound epidermis. Additionally, these
datasets are rich resources of potentially novel regulators of limb regeneration for the field
to investigate. Utilizing these datasets, we have elucidated the roles of two cytokines,
interleukin-8 (il-8) and midkine (mk), during blastema formation.
6.2. Early transcriptional programs of blastemal progenitors
One of the significant contributions we have made is elucidating the early
transcriptional programs of blastemal progenitors in bulk irrespective of lineage during
limb regeneration in the presence and absence of the wound epidermis. During normal
regeneration, we revealed that early dividing progenitors likely selectively establish an
autocrine TGF- signaling network, which is further supported by the work of others in the
field that have shown that TGF- signaling is necessary for blastema formation and
regeneration (Levesque et al., 2007; Denis et al., 2016). Blastemal progenitors appear to
also activate both HIPPO and canonical Wnt signaling in conjunction with TGF-
signaling, suggesting these three pathways may synergize to orchestrate global
blastemal cell behaviors such as epithelial-to-mesenchymal transition (EMT)-related
processes. When we prevent wound epidermis formation, we demonstrate that the
151
activation of not one, but all three of these pathways is lost, suggesting both that these
pathways are functionally interlinked and that the wound epidermis plays a role in
activating these pathways in dividing progenitors. As these pathways synergize in
tumorigenesis (Attisano and Labbe, 2004; Attisano and Wrana, 2013), it is likely that
similar mechanisms are at play during early stages of regeneration.
As these data were generated from bulk sequencing datasets, it is also possible
that different progenitors activate various combinations of these pathways, which would
not be discerned from the resolution of our transcriptional dataset. Therefore, it will be
key to validate which cell-types specifically activate these pathways in future work. With
the release of the genome, it is also now possible to perform targeted knock-ins to
potentially generate transgenic reporters for the activation of each of these pathways.
These animals could help further delineate the upstream regulatory mechanisms that
regulate these pathways within limb regeneration and could be an exciting avenue to
identify new signaling molecules that initiate progenitor activation/cell-cycle re-entry.
Despite the difference in pathway activation profiles in the presence and absence
of the wound epidermis, we observed that dividing cells in both contexts had overall
relatively similar transcriptional profiles. These data suggest that the wound epidermis
does not heavily influence the overall gene expression programs of progenitors. Indeed,
several studies have described the induction of proliferation in the absence of the wound
epidermis (Mescher, 1976; Johnson et al., 2018), and others have suggested that
proliferation is primarily induced in response to injury-related cues such as blood clotting
(Tanaka and Brockes, 1998; Tanaka et al., 1999). Our research therefore lends further
transcriptional evidence to support that the wound epidermis is likely not necessary for
152
directing the initial cues for progenitor cell activation, i.e. cell cycle re-entry, in limb
regeneration. However, the wound epidermis may be essential for directing targeted
responses including activating certain signaling pathways that may direct later behaviors
including migration and sustained cycling.
6.3. Inflammation, ECM regulation, and tissue histolysis are likely regulated by the
wound epidermis
Despite the importance of the wound epidermis, little is known about its functional
role(s) during early stages of limb regeneration (Thornton, 1957; Mescher, 1976).
Transcriptional profiling of dividing progenitors and the surrounding tissues in limbs where
we prevented wound epidermis formation by suturing full thickness skin over the
amputation plane suggested that the early wound epidermis likely plays large roles in
regulating inflammation, ECM regulation, and tissue histolysis. Transcripts involved in
both pro- and anti-inflammatory pathways were heavily dysregulated in limbs where we
prevented wound epidermis formation, suggesting that the wound epidermis may regulate
both the onset and resolution of wound healing during the first stages of limb regeneration.
Furthermore, many transcripts involved in ECM regulation and tissue histolysis
were also differentially expressed. Notably, we noticed that several genes involved in
osteoclast differentiation and function including catk and fosl2 were amongst the most
down-regulated transcripts. This was inherently interesting since osteoclasts are
important bone-matrix degrading cells that are heavily involved in skeletal remodeling and
bone resorption (Troen, 2004), processes that occur during the earliest stages of limb
regeneration. Therefore, down-regulation of these genes coupled with the higher
153
expression of the bone matrix marker co1a1 in full skin flap sutured limbs highly suggests
that the wound epidermis may play a role in directing bone resorption.
6.4. Blastemal progenitors as early immunomodulators
The identification of blastemal progenitor-enriched transcripts provided us with the
opportunity to learn about new aspects of early blastemal cell biology. An interesting
observation that we made from our dataset was the expression of several inflammatory
cytokines in blastemal progenitors, suggesting that early progenitors may play a role in
immunomodulation. Indeed, further examination of the functional role of one enriched
inflammatory cytokine il-8 through a series of gain- and loss- of function approaches
revealed that il-8 is a connective tissue blastemal progenitor-derived molecule that
modulates myeloid cell retention during the transition from wound healing to blastema
formation. We further demonstrate that signaling through its receptor, cxcr-1/2, during
early stages of regeneration is necessary for blastema formation. While others have
nicely shown that myeloid cells including macrophages are necessary for limb
regeneration (Godwin et al., 2013), our results newly suggest that bi-directional signaling
from the blastemal progenitors is equally important. It is therefore likely that the continual
communication between the cells that give rise to the blastema and supportive immune
cells is crucial for building a permissive blastemal niche.
These results open up several intriguing lines of questioning for future studies.
Many have described that immune cells play important roles in promoting growth and
healing in the contexts of tissue homeostasis, regeneration, and tumorigenesis (Aurora
and Olson, 2014; Williams et al., 2016; Godwin et al., 2017b; Naik et al., 2018). Yet,
154
others have described that immune cells play roles in promoting fibrotic scarring
responses as opposed to regeneration (Lupher and Gallatin, 2006). It has therefore come
to light in the last decade or so, that the response of the immune system is highly
dependent on the micro-environment (Williams et al., 2016; Naik et al., 2018). Virtually all
injuries in different organisms are immediately followed by the activation of common pro-
inflammatory pathways from the immune system. The major differences lie in the
response of the immune cells during wound healing resolution. Will they promote
regeneration? Or will they promote fibrosis? Since immune cells are integral for blastema
formation in a variety of natural organ and appendage regenerative contexts beyond just
salamander limb regeneration (Aurora et al., 2014; Petrie et al., 2014; Godwin et al.,
2017a; Simkin et al., 2017a; Simkin et al., 2017b), it is conceivable that intrinsic
differences may exist in the way that tissues from regenerating organisms respond to
injury that in turn direct pro-regenerative immune responses. It would therefore be
interesting to examine whether il-8 is similarly expressed in blastemal progenitors of
regenerating organisms including zebrafish or the African spiny mouse and determine
whether it may also direct the behaviors of cells within the immune system. Furthermore,
comparing the inflammatory transcriptional profiles during late stages of wound healing
between non-regenerative and regenerative organisms may provide further insights into
inherent inflammation-related differences in the response of non-immune tissues to injury.
Finally, many questions remain about the overall regulation of early cxcr-1/2
signaling during early stages of limbs regeneration. Treatment with a cxcr-1/2 inhibitor
completely prevented blastema formation, suggesting that the mechanisms modulating
this pathway play an important role in regeneration. As CXCR-1/2 is known to bind many
155
other inflammatory cytokines including IL-6 (Russo et al., 2014), it would be interesting to
determine whether functionally perturbing these other ligands similarly affects limb
regeneration. Additionally, future experiments identifying the transcriptional differences
as a result of inhibition of CXCR-1/2 signaling will help us gain further insight into the
down-stream processes that are affected in blastema formation.
6.5. Regulators of early wound epidermis to AEC maturation
The wound epidermis is a transient structure that matures from an early thin
epithelial structure to the thicker AEC during blastema formation. While many have
described the morphological steps occurring during this process (Campbell and Crews,
2008), little is known about the molecular regulation of wound epidermis maturation during
regeneration. Our gain- and loss-of-function studies have collectively identified the
pleiotropic growth factor cytokine mk as a regulator of wound epidermis maturation from
the early stages to the AEC. We demonstrate that inhibition or genetic loss of mk impairs
wound epidermis maturation to the AEC while overexpression during regeneration leads
to aberrant overgrowth of the wound epidermis. Furthermore, the mk receptor sdc-1 is
up-regulated and expressed within the wound epidermis during limb regeneration,
suggesting that mk may likely directly modulate the wound epidermis. Altogether, these
results suggest that mk is a critical regulator of wound epidermis maturation during limb
regeneration.
However, many questions remain regarding the exact processes of wound
epidermis maturation that mk affects. Our data suggest that mk may act as a survival
factor, as inhibitor-treated limbs have higher levels of cell death in the wound epidermis.
156
Furthermore, overexpression of mk is sufficient to induce abnormal expansion of the
wound epidermis. As such, it would be interesting to determine whether mk modulates
the cell growth/death rates of the wound epidermis during regeneration. Ongoing
experiments are underway determining both whether mk mutants also exhibit increased
cell death and whether there are differences specifically in wound epidermis proliferation.
We additionally identified two mk receptors that are expressed in the wound
epidermis, sdc-1 and ptprz, that may mediate mk signaling. We have currently only
validated the expression of sdc-1, which is expressed within both the wound epidermis
and regenerating stump tissues. Interestingly, ptprz is expressed specifically within the
wound epidermis (Leigh et al., 2018) and was down-regulated in the mk inhibitor-treated
limbs, suggesting that it may be a wound epidermis specific mediator of mk signaling.
Current experiments are now underway to also validate the expression of ptprz and
determine whether functional perturbation of ptprz and/or sdc-1 can phenocopy that of
inhibitor-treated limbs or mk mutants.
Finally, while the most severe phenotype we observed when perturbing mk was
pertaining to the wound epidermis, it likely plays other roles in limb regeneration based
on its expression in other cell types including connective tissue blastemal progenitors in
the regenerating stump tissues. In addition, the mk receptor sdc-1 is also expressed in
stump tissues, lending additional supportive evidence to this hypothesis. Given the
persistent inflammatory response and higher density of monocytes observed in
regenerating limbs of inhibitor-treated and mk mutant animals, it is possible that mk may
directly or indirectly modulate immune cell responses. Additionally, mk may play a role in
bone resorption as well during early stages of regeneration as we observed that mk-
157
overexpressing limbs exhibited morphological defects in bone histolysis and osteoclast
presence. These are all interesting additional prospective processes that mk may
participate in and future experimentation will help to delineate the potential significance
of these roles in limb regeneration.
6.6. New frontiers and future perspectives for the field
Looking towards the future of the limb regeneration field, I believe there are many
exciting potential lines of research that stem from our work presented here along with
recent advances including the release of the axolotl genome (Nowoshilow et al., 2018;
Smith et al., 2019), the optimization of CRISPR targeting strategies (Fei et al., 2018), and
the elucidation of cell-type specific markers (Gerber et al., 2018; Leigh et al., 2018).
Several of these potential directions are discussed in more detail in the following sections.
6.6.1. Exploring the roles of unannotated genes in salamander regeneration
While the focus of many studies in the limb regeneration field has been on
identifying roles for genes that have known orthologs within other species, our dataset
along with the publicly available datasets of others have uncovered that the majority of
differentially expressed transcripts during early stages of regeneration are unannotated.
Oftentimes, these were the most highly differentially expressed transcripts, suggesting
that these may be salamander specific genes that are critical regulators of limb
regeneration. In addition, the axolotl genome is large (~32 gigabases), yet contains
approximately the same number of genes as humans, further indicating that there may
be important salamander-specific non-coding elements regulating limb regeneration.
158
Therefore, an exciting future line of research would be to utilize CRISPR or morpholino
knockdown strategies to perturb these unannotated genes and determine whether they
play important roles in regeneration.
6.6.2. Cell-type specific roles in blastema formation
While we focused primarily on examining the functional roles of blastemal-
progenitor enriched transcripts, there were many differentially expressed transcripts
within the regenerating non-dividing stump tissues that potentially also play important
paracrine roles in regeneration. Future studies investigating where these transcripts are
expressed and functionally testing whether they are relevant could uncover novel roles
that supportive cell-types play in limb regeneration. For example, one potential such cell-
type could be the vasculature, as endothelial cells have been shown to play roles in
induction of liver regeneration (Ding et al., 2010). In addition, it is interesting to speculate
on whether these non-dividing cells, for example mature myofibers at the site of
amputation, actually play functional paracrine roles in regeneration and this remains an
unexplored area of limb regenerative biology.
Another more targeted approach to address the importance of different cell types
on blastema formation would be to generate reporters for various cell types and
transcriptionally profile a preferred cell type to ask how it responds during early stages of
regeneration. Recent single cell studies have uncovered many potential cell-type specific
markers that may be utilized for these studies (Leigh et al., 2018) and others have already
begun to combine these approaches with single cell analysis to identify gene expression
programs present within specific tissue lineages (Gerber et al., 2018).
159
6.6.3. Genetic regulatory mechanisms of key genes
The release of the genome opens up the possibility of understanding genetic
regulatory mechanisms of various genes in limb regeneration including key blastemal
markers such as prrx-1 and kazd-1. In addition, the important roles that enhancer
regulation plays in the regeneration of other organisms (Kang et al., 2016) have yet to be
uncovered in the field of limb regeneration. Examining these elements may uncover
important core regulatory circuits driven by key transcription factors (ex. sall4) (Erickson
et al., 2016) for various cell types during the course of limb regeneration.
6.7. Concluding remarks
In all, my doctoral research began as an examination of the transcriptional
programs in blastemal progenitors and the surrounding tissues during early stages of limb
regeneration both in the presence and absence of the wound epidermis. In doing so, we
uncovered the roles of the early wound epidermis and further identified blastemal
progenitor-enriched as well as wound epidermis-dependent transcripts. Utilizing this
resource, we further elucidated the important roles that two cytokines, il-8 and mk, play
in regulating blastema formation. Altogether, these data provide the field with resources
for new gene candidates that may regulate the initiation of blastema formation and in turn
reveal new aspects of limb regenerative biology.
160
6.8. References
Attisano, L. and Labbe, E. (2004). TGFbeta and Wnt pathway cross-talk. Cancer Metastasis Rev 23, 53-61.
Attisano, L. and Wrana, J. L. (2013). Signal integration in TGF-beta, WNT, and Hippo pathways. F1000Prime Rep 5, 17.
Aurora, A. B. and Olson, E. N. (2014). Immune modulation of stem cells and regeneration. Cell Stem Cell 15, 14-25.
Aurora, A. B., Porrello, E. R., Tan, W., Mahmoud, A. I., Hill, J. A., Bassel-Duby, R., Sadek, H. A. and Olson, E. N. (2014). Macrophages are required for neonatal heart regeneration. J Clin Invest 124, 1382-1392.
Boilly, B. and Albert, P. (1990). In vitro control of blastema cell proliferation by extracts from epidermal cap and mesenchyme of regenerating limbs of axolotls. Roux Arch Dev Biol 198, 443-447.
Campbell, L. J. and Crews, C. M. (2008). Wound epidermis formation and function in urodele amphibian limb regeneration. Cell Mol Life Sci 65, 73-79.
Christensen, R. N., Weinstein, M. and Tassava, R. A. (2002). Expression of fibroblast growth factors 4, 8, and 10 in limbs, flanks, and blastemas of Ambystoma. Dev Dyn 223, 193-203.
Denis, J. F., Sader, F., Gatien, S., Villiard, E., Philip, A. and Roy, S. (2016). Activation of Smad2 but not Smad3 is required to mediate TGF-beta signaling during axolotl limb regeneration. Development 143, 3481-3490.
Ding, B. S., Nolan, D. J., Butler, J. M., James, D., Babazadeh, A. O., Rosenwaks, Z., Mittal, V., Kobayashi, H., Shido, K., Lyden, D., et al. (2010). Inductive angiocrine signals from sinusoidal endothelium are required for liver regeneration. Nature 468, 310-315.
Erickson, J. R., Gearhart, M. D., Honson, D. D., Reid, T. A., Gardner, M. K., Moriarity, B. S. and Echeverri, K. (2016). A novel role for SALL4 during scar-free wound healing in axolotl. NPJ Regen Med 1.
161
Farkas, J. E., Freitas, P. D., Bryant, D. M., Whited, J. L. and Monaghan, J. R. (2016). Neuregulin-1 signaling is essential for nerve-dependent axolotl limb regeneration. Development 143, 2724-2731.
Farkas, J. E. and Monaghan, J. R. (2017). A brief history of the study of nerve dependent regeneration. Neurogenesis (Austin) 4, e1302216.
Fei, J. F., Lou, W. P., Knapp, D., Murawala, P., Gerber, T., Taniguchi, Y., Nowoshilow, S., Khattak, S. and Tanaka, E. M. (2018). Application and optimization of CRISPR-Cas9-mediated genome engineering in axolotl (Ambystoma mexicanum). Nat Protoc 13, 2908-2943.
Gerber, T., Murawala, P., Knapp, D., Masselink, W., Schuez, M., Hermann, S., Gac-Santel, M., Nowoshilow, S., Kageyama, J., Khattak, S., et al. (2018). Single-cell analysis uncovers convergence of cell identities during axolotl limb regeneration. Science.
Godwin, J. W., Debuque, R., Salimova, E. and Rosenthal, N. A. (2017a). Heart regeneration in the salamander relies on macrophage-mediated control of fibroblast activation and the extracellular landscape. NPJ Regen Med 2.
Godwin, J. W., Pinto, A. R. and Rosenthal, N. A. (2013). Macrophages are required for adult salamander limb regeneration. Proc Natl Acad Sci U S A 110, 9415-9420.
---- (2017b). Chasing the recipe for a pro-regenerative immune system. Semin Cell Dev Biol 61, 71-79.
Han, M. J., An, J. Y. and Kim, W. S. (2001). Expression patterns of Fgf-8 during development and limb regeneration of the axolotl. Dev Dyn 220, 40-48.
Johnson, K., Bateman, J., DiTommaso, T., Wong, A. Y. and Whited, J. L. (2018). Systemic cell cycle activation is induced following complex tissue injury in axolotl. Dev Biol 433, 461-472.
Kang, J., Hu, J., Karra, R., Dickson, A. L., Tornini, V. A., Nachtrab, G., Gemberling, M., Goldman, J. A., Black, B. L. and Poss, K. D. (2016). Modulation of tissue repair by regeneration enhancer elements. Nature 532, 201-206.
162
Kawasumi, A., N., S., S., H., Yokoyama, H. and K., T. (2013). Wound healing in mammals and amphibians: towards limb regeneration in mammals. In New Perspectives on Regeneration (ed. E. Heber-Katz & D. L. Stocum), pp. 33-49. Berlin, Heidelberg: Springer.
Knapp, D., Schulz, H., Rascon, C. A., Volkmer, M., Scholz, J., Nacu, E., Le, M., Novozhilov, S., Tazaki, A., Protze, S., et al. (2013). Comparative transcriptional profiling of the axolotl limb identifies a tripartite regeneration-specific gene program. PLoS One 8, e61352.
Kragl, M., Knapp, D., Nacu, E., Khattak, S., Maden, M., Epperlein, H. H. and Tanaka, E. M. (2009). Cells keep a memory of their tissue origin during axolotl limb regeneration. Nature 460, 60-65.
Kumar, A., Godwin, J. W., Gates, P. B., Garza-Garcia, A. A. and Brockes, J. P. (2007). Molecular basis for the nerve dependence of limb regeneration in an adult vertebrate. Science 318, 772-777.
Leigh, N. D., Dunlap, G. S., Johnson, K., Mariano, R., Oshiro, R., Wong, A. Y., Bryant, D. M., Miller, B. M., Ratner, A., Chen, A., et al. (2018). Transcriptomic landscape of the blastema niche in regenerating adult axolotl limbs at single-cell resolution. Nat Commun 9, 5153.
Levesque, M., Gatien, S., Finnson, K., Desmeules, S., Villiard, E., Pilote, M., Philip, A. and Roy, S. (2007). Transforming growth factor: beta signaling is essential for limb regeneration in axolotls. PLoS One 2, e1227.
Lupher, M. L., Jr. and Gallatin, W. M. (2006). Regulation of fibrosis by the immune system. Adv Immunol 89, 245-288.
Mescher, A. L. (1976). Effects on adult newt limb regeneration of partial and complete skin flaps over the amputation surface. J Exp Zool 195, 117-128.
Nacu, E., Gromberg, E., Oliveira, C. R., Drechsel, D. and Tanaka, E. M. (2016). FGF8 and SHH substitute for anterior-posterior tissue interactions to induce limb regeneration. Nature 533, 407-410.
Naik, S., Larsen, S. B., Cowley, C. J. and Fuchs, E. (2018). Two to Tango: Dialog between Immunity and Stem Cells in Health and Disease. Cell 175, 908-920.
163
Nowoshilow, S., Schloissnig, S., Fei, J. F., Dahl, A., Pang, A. W. C., Pippel, M., Winkler, S., Hastie, A. R., Young, G., Roscito, J. G., et al. (2018). The axolotl genome and the evolution of key tissue formation regulators. Nature 554, 50-55.
Petrie, T. A., Strand, N. S., Yang, C. T., Rabinowitz, J. S. and Moon, R. T. (2014). Macrophages modulate adult zebrafish tail fin regeneration. Development 141, 2581-2591.
Russo, R. C., Garcia, C. C., Teixeira, M. M. and Amaral, F. A. (2014). The CXCL8/IL-8 chemokine family and its receptors in inflammatory diseases. Expert Rev Clin Immunol 10, 593-619.
Simkin, J., Gawriluk, T. R., Gensel, J. C. and Seifert, A. W. (2017a). Macrophages are necessary for epimorphic regeneration in African spiny mice. Elife 6.
Simkin, J., Sammarco, M. C., Marrero, L., Dawson, L. A., Yan, M., Tucker, C., Cammack, A. and Muneoka, K. (2017b). Macrophages are required to coordinate mouse digit tip regeneration. Development 144, 3907-3916.
Smith, J. J., Timoshevskaya, N., Timoshevskiy, V. A., Keinath, M. C., Hardy, D. and Voss, S. R. (2019). A chromosome-scale assembly of the axolotl genome. Genome Res 29, 317-324.
Spallanzani, L. (1769). An essay on animal reproductions. pp. 68-82. London: Becket and de Hondt.
Tanaka, E. M. and Brockes, J. P. (1998). A target of thrombin activation promotes cell cycle re-entry by urodele muscle cells. Wound Repair Regen 6, 371-381.
Tanaka, E. M., Drechsel, D. N. and Brockes, J. P. (1999). Thrombin regulates S-phase re-entry by cultured newt myotubes. Curr Biol 9, 792-799.
Thornton, C. S. (1957). The effect of apical cap removal on limb regeneration in Amblystoma larvae. J Exp Zool 134, 357-381.
Torok, M. A., Gardiner, D. M., Izpisua-Belmonte, J. C. and Bryant, S. V. (1999). Sonic hedgehog (shh) expression in developing and regenerating axolotl limbs. J Exp Zool 284, 197-206.
164
Troen, B. R. (2004). The role of cathepsin K in normal bone resorption. Drug News Perspect 17, 19-28.
Tsai, S. L., Baselga-Garriga, C. and Melton, D. A. (2019). Blastemal progenitors modulate immune signaling during early limb regeneration. Development 146.
Williams, C. B., Yeh, E. S. and Soloff, A. C. (2016). Tumor-associated macrophages: unwitting accomplices in breast cancer malignancy. NPJ Breast Cancer 2.
166
A.1. Supplemental materials for Chapter 2
Table A.1.1. Table of Ingenuity Pathway Analysis (IPA) Z-scores for Immune
Signaling Pathways.
Pathway 4dpa 4N 5dpa 4N 4dpa 2N 5dpa 2N 4dpa WE 5dpa WE Activation of IRF by Cytosolic Pattern Recognition Receptors
0.377964473 1 2.323790008 2.110579412 2.121320344 0.816496581
Role of RIG1-like Receptors in Antiviral Innate Immunity
0 0 2.333333333 1.889822365 2.449489743 1
TREM1 Signaling 1.414213562 0 2.449489743 1.963961012 1.133893419 2.121320344 Interferon Signaling
-1.807392228 -1.732050808 -1.876629727 -1.705605731 1.941450687 0
Inflammasome pathway
-1.807392228 -1.732050808 -1.876629727 -1.705605731 1.941450687 0
Acute Phase Response Signaling
0.774596669 0.577350269 1.060660172 0.784464541 1.290994449 0.707106781
Oncostatin M Signaling
1.341640786 0 1.414213562 0.632455532 2.645751311 0
Complement System
1.341640786 0 1.414213562 0.632455532 2.645751311 0
Fc-gamma Receptor-mediated Phagocytosis in Macrophages and Monocytes
-0.25819889 -1.290994449 1.80838886 1.671258044 1.889822365 2.236067977
Leukocyte Extravasation Signaling
-1.133893419 -0.962250449 1.832541665 1.483239697 2.523573073 1.732050808
Role of Pattern Recognition Receptors in Recognition of Bacteria and Viruses
-0.534522484 -2.333333333 2.057983022 1.616447718 2.840187787 2.333333333
Role of IL-17F in Allergic Inflammatory Airway Diseases
0 0 1.666666667 1.889822365 0 0
B Cell Activating Factor Signaling
0 0 1.507556723 1.632993162 0 0
April Mediated Signaling
0 0 1.507556723 1.133893419 -1 0
"Role of JAK1, JAK2 and TYK2 in Interferon Signaling"
0 0 -1 -0.447213595 1 0
IL-22 Signaling 0 0 0.707106781 1.133893419 0.447213595 0
Coagulation System
0 -0.707106781 0.301511345 0.333333333 0 0
TNFR1 Signaling 0 0 0 1.133893419 -1.264911064 -1.341640786 TNFR2 Signaling 0 0 0 0.816496581 -2.449489743 -2
STAT3 Pathway -3.16227766 -2.309401077 -3.528211425 -3.265986324 0 -0.447213595 Calcium-induced T Lymphocyte Apoptosis
-3.16227766 -2.309401077 -3.528211425 -3.265986324 0 -0.447213595
iCOS-iCOSL Signaling in T Helper Cells
-2.309401077 -0.707106781 -1.299867367 -0.816496581 1 0
167
Table A.1.1. (Continued)
Pathway 4dpa 4N 5dpa 4N 4dpa 2N 5dpa 2N 4dpa WE 5dpa WE
Role of NFAT in Regulation of the Immune Response
-2.840187787 -1.632993162 -1.299867367 -1.224744871 0.832050294 0
Th1 Pathway -1.290994449 -0.904534034 -0.784464541 0.185695338 -0.904534034 -0.447213595 Th2 Pathway -1.290994449 -1.290994449 0.19245009 0 0.577350269 0
CD28 Signaling in T Helper Cells
-2.529822128 -0.707106781 -0.707106781 -0.39223227 0 -1.341640786
IL-9 Signaling -1.133893419 -0.816496581 -1.069044968 -1.386750491 0 0 JAK/Stat Signaling
-0.301511345 -0.301511345 -1.279204298 -1.788854382 0.25819889 -0.816496581
CD40 Signaling -1.414213562 -1.133893419 0 -0.5 -0.707106781 -0.447213595
PKC_ Signaling in T Lymphocytes
-3.050851079 -1.666666667 -0.755928946 -0.6 0 -1.632993162
LPS-stimulated MAPK Signaling
-3.050851079 -2.529822128 -0.942809042 -1 0 -1
NF-kB Activation by Viruses
-2.110579412 -2.110579412 -0.852802865 -1.091089451 1.154700538 0.377964473
fMLP Signaling in Neutrophils
-2.523573073 -1.807392228 -0.522232968 -1.347150628 2.110579412 1
Tec Kinase Signaling
-1.697749375 -1.5 0 0 0.832050294 1.133893419
Role of PI3K/AKT Signaling in the Pathogenesis of Influenza
-1 -0.377964473 -1.069044968 -1.941450687 1.133893419 0
GM-CSF Signaling
-0.632455532 -0.301511345 -0.447213595 -0.654653671 1.154700538 1.341640786
Production of Nitric Oxide and Reactive Oxygen Species in Macrophages
-1.632993162 -2.064741605 -1.154700538 -0.333333333 0 0.301511345
Chemokine Signaling
-2.828427125 -0.816496581 0 -0.727606875 0.377964473 0
Macropinocytosis Signaling
-2.529822128 -1.897366596 -1.414213562 -1.603567451 1.133893419 0
NF-kB Signaling -0.471404521 -1.290994449 -0.832050294 -0.589767825 1.527525232 1.264911064
IL-6 Signaling -1.697749375 -1.386750491 -0.648885685 -0.353553391 0.25819889 -0.377964473 Fc_RIIB Signaling in B Lymphocytes
-1.414213562 -1.341640786 -1.5 -1.807392228 1.666666667 0
IL-2 Signaling -1.133893419 -1.632993162 -2.138089935 -1.941450687 0.632455532 -1 HMGB1 Signaling -1.414213562 -1.807392228 -1.767766953 -2.2 0 0
Table A.1.2. Table of Ingenuity Pathway Analysis (IPA) Z-scores for Developmental
Growth Factor and Intracellular Signaling Pathways.
Pathway 4dpa 4N 5dpa 4N 4dpa 2N 5dpa 2N 4dpa WE 5dpa WE
CXCR4 Signaling -3.299831646 -2.828427125 -2.030258905 -2.197401062 0.301511345 1
Ephrin Receptor Signaling
-2.121320344 -3 0.755928946 0.208514414 1.133893419 1
HIPPO signaling 0.707106781 1 2.309401077 2.529822128 1.133893419 0 Wnt/Ca+ pathway -2.645751311 -2 -2.523573073 -2.110579412 0 0
Wnt/Beta-catenin Signaling
0.25819889 0.577350269 0.948683298 0.755928946 -2 -1
TGF-Beta Signaling
0.632455532 1.414213562 -1 -1.069044968 -0.447213595 0
CNTF Signaling -1 -1.414213562 -1.147078669 -1.414213562 1.154700538 0 NGF Signaling -1.941450687 -2.333333333 -1.347150628 -0.625543242 1.603567451 0
FGF Signaling -2.110579412 -1 -2.132007164 -2.523573073 0 0
168
Table A.1.2. (Continued)
Pathway 4dpa 4N 5dpa 4N 4dpa 2N 5dpa 2N 4dpa WE 5dpa WE
VEGF Signaling -1.507556723 -1.133893419 -2.857738033 -3.299831646 1.414213562 0
ErbB4 Signaling -1.897366596 -2.121320344 -2.323790008 -2.713602101 1.133893419 0 Neuregulin Signaling
-1.897366596 -2.828427125 -2.5 -3.207134903 1.341640786 0
Notch Signaling -2 -2 -0.816496581 -1.133893419 0 0
IGF-1 Signaling -0.904534034 -1.264911064 -2.293658555 -2.449489743 0 -0.447213595
Neurotrophin/TRK Signaling
-1.507556723 -0.816496581 -2.132007164 -1.414213562 0.904534034 0
PDGF Signaling -0.577350269 -1.154700538 -1 -1.459600898 0.534522484 -0.816496581 HGF Signaling -2.713602101 -2.110579412 -1.732050808 -1.963961012 0.277350098 -0.816496581
ErbB2-ErbB3 Signaling
-1.666666667 -1.632993162 -1.603567451 -2.323790008 1.133893419 0
EGF Signaling -0.904534034 -0.707106781 -1.459600898 -1.147078669 0.301511345 0 Growth Hormone Signaling
-1.732050808 -1.507556723 -2.2 -1.885618083 0 -1
mTOR signaling -1.212678125 -2.182820625
-0.89802651
-0.6
1.414213562
0.377964473
Calcium signaling -1.507556723
0.447213595
-1.04257207
-0.447213595
0
N/A
Table A.1.3. Blastemal-progenitor enriched transcripts. Negative fold change
indicates enrichment in blastemal progenitors.
Transcript ID/Blastx hit log2(FC) padj
c1081013_g5 TENA_HUMAN -1.62815405 8.49E-18
c1082828_g4 TTK_MACFA -1.964713877 7.57E-13
c1063668_g1 FHDC1_HUMAN -2.049134955 2.17E-12
c1088332_g1 TENA_CHICK -1.628989579 2.17E-12
c1088332_g1 TENA_CHICK -1.891231003 6.82E-10
c1085526_g1 SHD_HUMAN -1.842004233 2.00E-09
c1084875_g3 RSMN_RAT -1.480592796 2.22E-09
c1069546_g2 PRD16_HUMAN -3.235269881 2.88E-09
c1088917_g3 ASAP3_HUMAN -1.84283593 2.92E-09
c1054335_g2 CTK2_XENLA -3.352475926 4.13E-09
c1092373_g1 AIM1_HUMAN -1.219467611 1.33E-08
c1088332_g3 TENA_CHICK -1.421019508 2.23E-08
c1091712_g2 PKHH2_HUMAN -1.639626647 2.50E-08
c1086898_g3 GLI3_CHICK -1.585874373 2.95E-08
c1086150_g5 CO5A1_HUMAN -1.338292607 3.22E-08
c1031898_g1 HAS2_HUMAN -1.63755093 3.32E-08
c1067239_g7 RCN1_MOUSE -1.559643023 3.87E-08
c1088332_g1 TENA_CHICK -1.435037885 4.99E-08
c1070536_g3 CO5A1_MOUSE -2.123463542 5.11E-08
169
Table A.1.3. (Continued)
Transcript ID/Blastx hit log2(FC) padj
c1090290_g1 EMIL1_MOUSE -1.542007837 6.79E-08
c1076079_g1 GP1_CHLRE -1.201822658 7.06E-08
c1086236_g7 GLI2_HUMAN -2.896206816 9.30E-08
c1088332_g1 TENA_CHICK -1.894540705 1.09E-07
c1075841_g1 RABP2_HUMAN -2.003202312 1.37E-07
c1080761_g4 CO1A2_CHICK -1.544792872 1.53E-07
c1088664_g5 MAP1B_HUMAN -1.494007131 1.61E-07
c1088922_g4 MAP1B_HUMAN -1.556997542 1.62E-07
c1039642_g1 PTRF_RAT -1.555315423 1.62E-07
c1091175_g9 CD248_HUMAN -1.453305223 2.04E-07
c1062836_g4 LEP_SMICR -1.637221897 2.66E-07
c1032646_g1 SRAP_STAHJ -1.352291119 3.65E-07
c1077000_g1 SALL4_HUMAN -1.753022515 4.58E-07
c1089148_g2 G3ST4_BOVIN -1.384775945 5.46E-07
c1089394_g5 CO5A2_HUMAN -1.449369473 6.57E-07
c1090227_g2 FKBP9_HUMAN -2.083684231 6.63E-07
c1086257_g1 K0754_HUMAN -1.391754216 7.41E-07
c1091199_g1 CO5A2_MOUSE -1.27661545 7.41E-07
c1083713_g1 CALD1_CHICK -1.495252853 7.63E-07
c1060273_g2 SIA4B_PANTR -1.531992957 1.24E-06
c1092028_g1 KCP_XENLA -1.501640661 1.26E-06
c1082369_g3 TEN3_HUMAN -1.676491772 1.29E-06
c1086150_g5 CO5A1_HUMAN -1.205919238 1.33E-06
c1078376_g4 HTRA1_BOVIN -1.502864308 1.52E-06
c1055997_g1 SDC1_BOVIN -1.391595493 1.55E-06
c1078833_g1 INHBA_SHEEP -1.295455008 1.94E-06
c1086874_g10 CTHR1_RAT -1.707535666 2.19E-06
c1076723_g2 NFAC4_MOUSE -1.094884328 2.62E-06
c1060722_g1 ANGL2_HUMAN -1.188802927 3.49E-06
c1088743_g1 MXRA5_HUMAN -1.310755008 3.73E-06
c1088332_g1 TENA_CHICK -1.537700614 5.70E-06
c1080758_g1 RAI14_HUMAN -1.417754519 5.89E-06
c1066962_g3 SYNPO_MOUSE -1.386359684 6.01E-06
c1058708_g1 PTK7_CHICK -1.21218312 6.54E-06
c1075291_g1 IGS10_HUMAN -1.384157953 8.48E-06
170
Table A.1.3. (Continued)
Transcript ID/Blastx hit log2(FC) padj
c1090482_g1 TANC2_MOUSE -1.408588194 1.01E-05
c1068056_g1 MAMC2_HUMAN -1.729013746 1.04E-05
c1067239_g7 RCN1_HUMAN -1.558808307 1.09E-05
c1091370_g1 LTBP1_HUMAN -1.34600726 1.12E-05
c1064348_g8 FBN2_HUMAN -1.341511901 1.12E-05
c1088087_g4 GPC6_MOUSE -1.621957635 1.18E-05
c1070536_g3 CO5A1_CRILO -1.085109475 1.38E-05
c1070223_g2 CCD80_CHICK -1.174462926 1.41E-05
c1077695_g7 DDR2_HUMAN -1.540640808 1.46E-05
c1088518_g8 COCA1_HUMAN -1.591215323 1.73E-05
c1090227_g2 FKBP9_HUMAN -1.019973238 2.02E-05
c1087294_g1 DCTN1_XENLA -2.776940233 2.24E-05
c1068194_g2 LAMA1_MOUSE -1.522410716 2.43E-05
c1082616_g4 AEBP1_MOUSE -1.437518031 2.48E-05
c1057474_g1 MKA_XENLA -1.30457236 2.65E-05
c1089533_g3 CP1B1_HUMAN -1.755299095 2.72E-05
c1082616_g4 AEBP1_MOUSE -1.983425604 2.87E-05
c1090597_g4 ROA1_PANTR -1.027611182 3.18E-05
c1076561_g4 KAZD1_MOUSE -1.696488986 3.55E-05
c1080519_g6 STC1_RAT -1.735927259 3.57E-05
c1052564_g1 IPO4_HUMAN -1.062056765 3.80E-05
c1075231_g15 GLIS2_HUMAN -1.649615892 4.27E-05
c1092042_g1 HMCN1_HUMAN -1.112403764 4.41E-05
c1083713_g1 CALD1_CHICK -2.334999933 4.44E-05
c1069073_g1 GLIS3_HUMAN -1.712537 5.28E-05
c1078917_g3 TSP2_CHICK -1.305427235 5.47E-05
c1079712_g5 EFNB1_CHICK -1.703324035 5.50E-05
c1081670_g1 CO1A1_CYNPY -1.57164569 5.57E-05
c1079703_g4 MUC16_HUMAN -1.253184834 6.28E-05
c1042639_g3 EGR1_XENTR -1.041987165 6.41E-05
c1087063_g1 PEBP1_BOVIN -1.600667726 6.51E-05
c1064163_g1 LRRC4_RAT -1.436487075 6.60E-05
c1087698_g2 LIN41_MOUSE -1.510269801 7.12E-05
c1091365_g1 PTRF_RAT -1.548737242 7.30E-05
c1077160_g2 HIPL1_MOUSE -1.43063085 7.30E-05
171
Table A.1.3. (Continued)
Transcript ID/Blastx hit log2(FC) padj
c1057844_g1 HMGB3_CHICK -1.628060528 7.91E-05
c1086236_g7 GLI3_CHICK -1.473774244 9.48E-05
c1080793_g1 AOC3_MOUSE -1.524666452 9.67E-05
c1091081_g5 FLNA_MOUSE -1.128819808 9.79E-05
c1085559_g2 TPM2_CHICK -1.465327966 0.000100445
c1084310_g1 K1614_HUMAN -1.028435563 0.000102714
c1092253_g2 CRLD2_XENTR -1.147183901 0.000112876
c1067676_g1 KIRR1_HUMAN -2.58051131 0.000126195
c1092042_g2 HMCN1_HUMAN -1.002732419 0.000137448
c1086285_g2 K1C24_HUMAN -1.458029516 0.000151273
c1081277_g3 MDR1_CRIGR -1.357249752 0.000151307
c1088518_g9 COCA1_CHICK -1.295865793 0.000173138
c1070827_g2 PA24C_HUMAN -1.337615424 0.00017585
c1081345_g2 SYNE2_HUMAN -1.329285938 0.000188196
c1080761_g5 CO1A2_CHICK -1.107198956 0.000199213
c1092516_g4 K2C8_XENLA -1.059194038 0.000229186
c1088518_g10 COCA1_CHICK -1.365162947 0.000237354
c1074886_g4 STXB1_RAT -1.889097538 0.000245851
c1083301_g5 GPX7_HUMAN -1.436887108 0.000255386
c1089244_g1 FA76B_XENTR -2.491127615 0.000255386
c1086707_g4 IF4G1_HUMAN -1.15642966 0.000287863
c1086497_g1 CXB3_HUMAN -2.094376979 0.000297996
c1057320_g1 POL2_MOUSE -1.379174899 0.000358954
c1091395_g2 NOTC2_HUMAN -1.032055635 0.000369935
c1087193_g2 AF1L1_XENTR -1.59785317 0.000399431
c1080761_g7 CO1A2_CHICK -1.412147931 0.000404478
c1084248_g3 EPHB2_MOUSE -1.781330213 0.000404845
c1083151_g6 F18A1_HUMAN -1.187103625 0.000422371
c1085297_g4 CO3A1_CHICK -1.085065106 0.000437783
c1086150_g4 CO5A1_RAT -1.247982041 0.000449281
c1072542_g2 EHD3_RAT -1.562299354 0.000475464
c1089750_g2 CO6A2_CHICK -1.065074859 0.000475464
c1085057_g1 TSP3_HUMAN -1.215648117 0.000557248
c1080761_g5 APP1_SCHPO -1.08430152 0.000629249
c1318008_g1 YI31B_YEAST -1.573965262 0.00067379
172
Table A.1.3. (Continued)
Transcript ID/Blastx hit log2(FC) padj
c1070561_g6 KI67_HUMAN -1.526526937 0.000725726
c1084054_g3 TRIL_HUMAN -1.410432037 0.000776707
c1082616_g4 AEBP1_MOUSE -1.205965588 0.000848867
c1053631_g1 RHG10_HUMAN -1.142115997 0.000849154
c1076669_g1 P3H1_CHICK -1.060979131 0.000871103
c1072608_g3 TGFB2_CHICK -1.491070906 0.00107799
c1076995_g1 PGFRB_CANFA -1.086249241 0.00107865
c1087698_g2 LIN41_MOUSE -1.314847573 0.001083247
c779314_g2 SLIK6_HUMAN -1.351817869 0.001086423
c1092212_g1 GULP1_HUMAN -1.815522249 0.001143186
c1081287_g2 F198A_HUMAN -2.055296761 0.001146918
c1090747_g1 CR3L2_HUMAN -1.1380815 0.001194214
c1067690_g1 TPC1_RAT -1.319430595 0.001332518
c1091062_g2 K2C5_RAT -1.240429022 0.001358011
c1011988_g1 APCDL_HUMAN -1.118233255 0.001421737
c1075918_g14 FBN2_MOUSE -1.164880596 0.001487003
c1092110_g2 TEAD1_HUMAN -1.215462796 0.001502114
c1071771_g2 IL11_HUMAN -1.471694465 0.001583637
c1090056_g2 PGBM_HUMAN -1.045555121 0.001612064
c1080288_g3 LIN1_NYCCO -1.164300756 0.001719395
c1084795_g1 CEAM6_HUMAN -1.251503463 0.001876703
c1065468_g2 VKORL_RAT -1.146114231 0.001983796
c1086384_g12 IE2_HHV6Z -1.175657735 0.002008734
c1085297_g4 CO3A1_RAT -1.501636138 0.00206446
c1084565_g2 CTHR1_RAT -1.6966408 0.002095306
c1066349_g1 2A5B_RABIT -1.238348394 0.002098311
c1086150_g1 CO5A1_HUMAN -1.101897245 0.002144871
c1091062_g2 K2C5_RAT -1.245582316 0.002258554
c1079936_g2 MUC1_YEAST -1.43729237 0.002268624
c1090326_g2 CAD26_HUMAN -1.414996452 0.002320877
c1090048_g1 ASPH_BOVIN -1.336562405 0.002439065
c1053070_g2 HXDBA_TAKRU -1.210625764 0.002532294
c1086597_g2 ITA11_MOUSE -1.232702654 0.002537417
c1077260_g1 IL8_CHICK -1.445967548 0.002568126
c1088332_g1 TENA_CHICK -1.245028019 0.002685534
173
Table A.1.3. (Continued)
Transcript ID/Blastx hit log2(FC) padj
c1089394_g5 CO5A2_MOUSE -1.139360785 0.002845216
c1085414_g1 PERP_HUMAN -1.263960198 0.002918138
c1088743_g1 MXRA5_HUMAN -1.219450939 0.003025128
c1076392_g2 S5A2_MACFA -1.353615963 0.003142404
c1080761_g5 CO1A2_CHICK -1.389868532 0.003271336
c1068344_g3 CLCF1_HUMAN -1.553161092 0.003639362
c1073265_g1 PINLY_HUMAN -1.446070187 0.00365578
c1077640_g1 TM119_MOUSE -1.354265805 0.003711084
c1067201_g1 DKK3_CHICK -1.06951219 0.003735079
c1078588_g4 FZD2_MOUSE -1.169583636 0.003740425
c1082413_g5 ITB8_HUMAN -1.151239335 0.003810041
c1091311_g1 NCKX3_HUMAN -1.171755343 0.003946259
c1080550_g10 POSTN_HUMAN -1.049576007 0.003991044
c1080690_g6 WNT5B_AMBME -1.750254437 0.00404423
c1079703_g6 MUC16_HUMAN -1.460211479 0.004115024
c1087877_g3 BKRB2_RABIT -2.080319717 0.004123495
c1063943_g2 ANXA1_HUMAN -1.222079461 0.004148759
c1090220_g1 ANK2_MOUSE -1.751250542 0.004173209
c1075239_g2 PRIC2_HUMAN -1.173102687 0.004277638
c1091168_g1 NATT4_THANI -1.272113053 0.004312634
c1068090_g7 PICK1_RAT -2.057270373 0.004762796
c1080320_g1 CLIC3_HUMAN -1.572361944 0.004961711
c1067510_g1 EDNRA_HUMAN -1.084910964 0.005289689
c1079263_g1 ATN1_MOUSE -1.05283968 0.006292201
c1077896_g1 LRIG3_HUMAN -1.52298402 0.0063786
c1079594_g5 SOX7_XENTR -1.8931725 0.006434241
c1035197_g1 IOD3_LITCT -1.230023884 0.006480243
c964270_g2 SFRP5_BOVIN -1.557930273 0.006579446
c1081670_g1 CO1A1_CYNPY -1.276296739 0.006751355
c1067048_g2 PRRX1_RAT -1.176106213 0.006990471
c1077344_g4 ATS6_HUMAN -1.982280391 0.007264198
c1075751_g2 GOLI4_HUMAN -1.027959779 0.007314435
c1078917_g3 TSP2_CHICK -1.493058243 0.007443144
c1072351_g2 FKBP7_PONAB -1.14546987 0.007733289
c1064028_g3 CHRD_XENLA -1.466052856 0.007809942
c1076187_g1 PKD1_MOUSE -1.236770571 0.008174066
174
Table A.1.3. (Continued)
Transcript ID/Blastx hit log2(FC) padj
c1072068_g2 FAAA_HUMAN -1.255799793 0.008889508
c1089199_g1 PTPRS_HUMAN -1.02539146 0.009038492
c1080585_g1 TTC36_DANRE -1.272513258 0.009063231
c1077344_g4 ATS6_HUMAN -1.595138396 0.009777646
c1071990_g3 PEAK1_HUMAN -1.550446575 0.009786975
c1091343_g2 PCD16_HUMAN -1.218092115 0.010041898
c1060840_g1 TSN6_MOUSE -1.124805091 0.010418034
c1064516_g1 HXD10_CHICK -1.099147158 0.010446283
c1075159_g3 DCNL4_HUMAN -1.918577159 0.010571858
c1078136_g3 PLOD2_HUMAN -1.607874636 0.010631286
c1084384_g1 TF3A_HUMAN -1.913373809 0.010736089
c1059195_g1 UBE2C_XENLA -1.768332576 0.010783089
c1091062_g2 K2C5_RAT -1.032193232 0.010843835
c1068714_g1 TGFB1_HUMAN -1.065374877 0.011093989
c1072538_g10 ZFHX3_HUMAN -1.010426264 0.011157654
c1086374_g1 PALLD_HUMAN -1.569493276 0.01157875
c1090567_g1 HRPX_PLALO -1.231395804 0.011581652
c1080550_g10 POSTN_HUMAN -1.441992866 0.012119946
c1090056_g2 PGBM_HUMAN -1.070785001 0.012243491
c1085540_g2 LIN1_NYCCO -1.171341624 0.012749929
c1090567_g1 GTAN_DICDI -1.172953412 0.012975785
c1088267_g2 GIT1_HUMAN -1.862776613 0.013317992
c1087228_g1 PARD3_HUMAN -1.655498788 0.01355353
c1054023_g1 HOME1_HUMAN -1.655985123 0.014418856
c1088364_g2 POLR_DROME -1.107477007 0.014607394
c1562183_g1 Y8592_DICDI -1.72743958 0.014955866
c1057994_g4 S10A4_MOUSE -1.120691799 0.014975013
c1609543_g1 ZC3HD_HUMAN -1.360463358 0.015011296
c1084104_g1 ANKR1_XENLA -1.250347951 0.015936228
c1092516_g5 K2C5_PANTR -1.498116687 0.016009704
c1082602_g2 EMIL2_HUMAN -1.097912059 0.016038048
c1076922_g10 PXDN_HUMAN -1.184837546 0.016301542
c1081684_g3 RGS8_DANRE -1.822644086 0.016385821
c1091081_g5 FLNA_HUMAN -1.628838209 0.016803259
c512704_g1 POL2_MOUSE -1.490774095 0.016948713
c1085979_g1 TB15A_COTJA -1.004730221 0.017796681
175
Table A.1.3. (Continued)
Transcript ID/Blastx hit log2(FC) padj
c1089316_g1 KI26A_MOUSE -1.810912029 0.017848806
c1082235_g1 RFC2_BOVIN -1.003890612 0.017940271
c1086652_g2 MPP2_MOUSE -1.578352643 0.018425321
c1065609_g1 DEN_GAHVM -1.741577691 0.01925478
c1071270_g3 CERS2_BOVIN -1.544916924 0.019787062
c1090284_g2 INSR_XENLA -1.0219355 0.019949055
c1060102_g1 CA051_HUMAN -1.63541411 0.020226855
c1089919_g4 CP27B_HUMAN -1.061371127 0.020624008
c1082458_g3 CR3L1_HUMAN -1.039923496 0.020783986
c1069159_g1 HXA3_CHICK -1.237184226 0.021293166
c1089220_g1 NCAM1_CHICK -1.229882628 0.02168676
c1090056_g1 PGBM_HUMAN -1.208347529 0.021919659
c1088272_g1 BMP1_HUMAN -1.396991405 0.023210412
c1071958_g2 ANXA6_HUMAN -1.710590635 0.023765726
c1081900_g1 S100P_HUMAN -1.03261438 0.023944888
c1089272_g1 SH3B4_HUMAN -1.013793913 0.023967299
c1076561_g4 KAZD1_MOUSE -1.381228821 0.024519327
c1091343_g3 PCD16_HUMAN -1.2809168 0.024611682
c1070469_g3 CAMP_GORGO -1.188002015 0.025303941
c1071878_g3 MAP6_HUMAN -1.665448719 0.025303941
c1068736_g1 CKAP4_HUMAN -1.12741589 0.025590395
c1087705_g1 ELF3_MOUSE -1.380699729 0.026930308
c1070593_g11 COPZ2_MOUSE -1.756403551 0.02693712
c1075841_g1 RABP2_RAT -1.473641701 0.027043261
c1070839_g1 TBX4_MOUSE -1.146268465 0.027327461
c1092545_g3 GT251_HUMAN -1.055627508 0.028028006
c1075851_g1 SPICE_BOVIN -1.392611027 0.028299796
c1077247_g1 SPTN2_HUMAN -1.295101686 0.028299796
c1239849_g1 RBM25_HUMAN -1.064340795 0.02931604
c1741796_g1 POL_GALV -1.192998664 0.030794864
c1088332_g2 TENA_CHICK -1.043152377 0.031542868
c1079613_g7 MATN2_HUMAN -1.083938907 0.031904477
c1085540_g1 COBA1_HUMAN -1.075106813 0.031973336
c1075197_g2 MRCKA_HUMAN -1.031965297 0.032400105
c1506666_g1 LIN1_NYCCO -1.613582534 0.032853189
c1079879_g3 DESP_HUMAN -1.164657262 0.032935412
176
Table A.1.3. (Continued)
Transcript ID/Blastx hit log2(FC) padj
c958434_g1 LIN1_NYCCO -1.241811913 0.032986956
c1087929_g5 ZMIZ1_MOUSE -1.644034935 0.03343453
c1086762_g2 PRDM1_MOUSE -1.037159595 0.033468811
c1082499_g1 TT21B_HUMAN -1.657809837 0.033873062
c1083541_g2 FLIP1_HUMAN -1.57123845 0.035281919
c1086999_g4 BNC1_HUMAN -1.688718942 0.035404541
c1086859_g1 EPHA2_HUMAN -1.504068199 0.035864674
c1089895_g1 DREB_HUMAN -1.564965924 0.0375888
c1079879_g3 DESP_MOUSE -1.033903421 0.037974347
c1090571_g2 TBX5_CHICK -1.581788487 0.038612838
c874462_g1 VTCN1_MOUSE -1.462808989 0.038779132
c1072235_g1 K118A_XENLA -1.421259515 0.040136708
c959265_g1 CYGB2_DANRE -1.456092206 0.040343855
c1089316_g1 KI26A_MOUSE -1.30167432 0.04074388
c1075231_g16 GLIS2_XENLA -1.597640513 0.041175045
c1076361_g2 UPK2_MOUSE -1.145928797 0.041343099
c1064174_g2 ATLA2_MOUSE -1.625825936 0.041405604
c1091668_g2 ANR35_HUMAN -1.060149427 0.042035152
c1248822_g1 CSP_PLARE -1.15171914 0.042573582
c1086285_g2 K1C24_HUMAN -1.043333024 0.042818789
c1088042_g1 MMP13_XENLA -1.454817898 0.042956529
c1078665_g1 MB212_MOUSE -1.1239959 0.045511497
c1087883_g1 IGSF3_HUMAN -1.102264552 0.045539183
c1083946_g1 PMEPA_HUMAN -1.053759928 0.045719696
c1084637_g1 SARG_RAT -1.367127717 0.047513781
c1074252_g1 BORG4_HUMAN -1.405534456 0.048348856
c1080374_g3 XBP1_MOUSE -1.401671465 0.048881237
c568518_g1 LIN1_NYCCO -1.445656027 0.04910916
c1089812_g1 NAV2_HUMAN -1.427049397 0.049180296
c1060685_g1 PRRX2_HUMAN -1.18884741 0.049512451
c1076625_g1 CSRN2_HUMAN -1.269708601 0.049918573
177
Figure A.1.1. Immune signaling pathways are predominantly activated in the wound
epidermis and non-dividing cells. (A) Heatmap depicting the predicted activation or
inhibition of many immune signaling pathways detected using the IPA software. The
isolated dividing cellular fraction exhibits predicted activation of very few and inhibition of
a majority of immune signaling pathways.
178
A.2. Supplemental materials for Chapter 3
Figure A.2.1. Validation of the il-8 overexpression construct and il-8 morpholino
knockdown. (A) Western blot validation of cells transfected with either the il-8
overexpression vector or control vector (T2A-tdTomato). Cell lysate and media was
collected 48 hpt. Myc-staining is specific to 293T cell lysate and media. (B-E)
Immunostaining of 293T cells transfected with the il-8 overexpression vector (IL8myc-
T2A-tdT) 48 hours post-transfection (hpt). (F) Western blot validation of knockdown of IL-
8 expression in limbs injected with il-8 translation blocking morpholino (MO) vs. control
MO. All four limbs were taken from one animal. FL, forelimb, HL, hindlimb.
179
Figure A.2.2. IL-8 morpholino knockdown does not affect blastemal cell or wound
epidermis proliferation. (A-B) Representative images of EdU-stained sections of control
or il-8 morpholino treated limbs. Scale bars represent 200 µm and white dotted line
demarcates the amputation plane. (C-D) Quantification of the percentage of EdU+ cells in
either the blastema (C) or apical epithelial cap (AEC) (D).
180
A.3. Supplemental materials for Chapter 4
Table A.3.1. Top 100 differentially expressed transcripts in stump-derived dividing
cells of full skin flap sutured limbs. Negative fold change indicates enrichment in full
skin flap sutured limbs.
transcript id blastx hit logFC padj
c1087956_g9_i4 EWS_HUMAN 5.599435134 4.00E-11
c1090300_g1_i1 CNN2_MOUSE 10.17192719 2.07E-10
c1090687_g2_i3 PTBP1_BOVIN 10.4881593 5.69E-10
c1091001_g2_i3 CDCA2_HUMAN 8.62454394 1.60E-09
c1083454_g6_i2 ZBTB3_HUMAN 9.266583269 4.48E-08
c1086809_g3_i3 BI1_BOVIN 9.377086079 4.48E-08
c1082127_g2_i6 HERC1_HUMAN 7.825040137 6.60E-08
c1090706_g8_i5 STAM2_HUMAN 9.331682098 2.98E-07
c1049691_g1_i1 MPI1B_XENLA -9.111045299 3.28E-07
c1091340_g1_i3 K0317_MOUSE 8.893277374 5.17E-07
c1091444_g2_i5 MPP5_HUMAN -9.410160283 1.24E-06
c1083468_g1_i3 ELYS_HUMAN 8.934284289 1.46E-06
c1078658_g1_i1 RS10_HUMAN 8.959774488 1.60E-06
c1075582_g1_i3 NU155_HUMAN -9.187643789 2.42E-06
c1089782_g7_i2 PPARD_CANFA 8.784970234 2.66E-06
c1070268_g1_i5 ZC3HF_HUMAN 7.374405656 2.92E-06
c1088530_g5_i1 WNK1_HUMAN 8.4471637 3.17E-06
c1074527_g1_i10 EXOC3_MOUSE -8.752858773 3.17E-06
c1083410_g1_i2 PDCD4_MOUSE 8.499494561 3.17E-06
c1080761_g5_i1 CO1A2_CHICK 7.998227333 4.01E-06
c1077444_g4_i5 UNC5B_XENLA 8.428399454 4.01E-06
c1066045_g1_i3 DPOD1_RAT 8.36478719 4.92E-06
c1091174_g4_i4 LIN1_NYCCO -9.244637259 4.92E-06
c1079168_g1_i1 POL2_MOUSE -8.398669414 4.92E-06
c1080282_g1_i3 OSBL5_HUMAN 8.415537213 5.43E-06
c1089852_g4_i6 ADCY2_HUMAN 8.240339587 6.72E-06
c1065086_g1_i1 SPAG1_HUMAN -8.766342421 6.86E-06
c1088974_g4_i1 DSEL_HUMAN -8.526652263 6.87E-06
c1046138_g1_i1 Y8359_DICDI -3.260881536 7.83E-06
c1082570_g3_i2 CCNL2_HUMAN 8.274528644 8.83E-06
c1075167_g1_i4 MOT2_HUMAN -8.287112996 9.45E-06
181
Table A.3.1. (Continued)
transcript id blastx hit logFC padj
c1089216_g3_i4 SBNO2_BOVIN 9.001641319 1.08E-05
c1068424_g1_i4 EP15R_HUMAN 8.610848855 1.14E-05
c1077195_g2_i9 KC1A_XENLA 8.160667469 1.30E-05
c1067524_g1_i2 TNKS2_HUMAN 8.324102287 1.30E-05
c1090731_g2_i1 SHC1_XENLA 8.635804203 1.30E-05
c1081414_g1_i1 RB11A_RAT 8.132589277 1.39E-05
c1087547_g1_i1 DDR1_HUMAN 8.126206952 1.50E-05
c1083389_g1_i4 KLH11_MOUSE 6.35467149 1.59E-05
c1082905_g1_i4 PAR1_XENLA 8.272930557 1.62E-05
c1082925_g1_i6 S43A3_HUMAN -8.226900742 1.63E-05
c1070268_g1_i4 ZC3HF_HUMAN -6.145289331 1.72E-05
c1078260_g1_i5 PSS_HELPY -8.540663466 2.20E-05
c1086010_g2_i2 RAB4B_DANRE 8.225840078 2.33E-05
c1087417_g3_i1 IGF1R_HUMAN 8.496420151 2.71E-05
c1083067_g2_i1 CTR3_HUMAN 7.929698021 2.72E-05
c1074527_g1_i5 EXOC3_MOUSE 7.972740647 2.75E-05
c1071883_g2_i2 ITCH_MOUSE 8.012113684 2.75E-05
c1069151_g3_i1 MTMR5_MOUSE 8.62794095 3.20E-05
c1065062_g2_i2 S39AB_HUMAN 8.194534133 3.26E-05
c1086079_g1_i3 OBRG_RAT 8.10255092 3.36E-05
c1091771_g2_i1 LPIN2_HUMAN 8.203973099 3.39E-05
c1088042_g1_i3 MMP13_XENLA 8.432317627 3.66E-05
c1082633_g1_i2 LCAP_HUMAN 7.871333047 3.80E-05
c1081108_g2_i7 DDX5_PANTR 7.891088664 4.60E-05
c1055766_g1_i1 SEC13_BOVIN 8.524152917 6.15E-05
c1078442_g1_i2 LMCD1_HUMAN 7.987588424 6.31E-05
c1092570_g1_i1 HBA_TARGR -2.795007509 6.31E-05
c1080139_g3_i3 LIPA1_HUMAN 8.105917572 6.31E-05
c1078109_g9_i1 MEX3A_HUMAN 8.268070969 7.18E-05
c1055916_g2_i2 IKBZ_HUMAN 7.779741488 9.45E-05
c1078671_g2_i2 ALDOC_MACFA 8.521236252 9.47E-05
c1089493_g4_i2 ACK1_BOVIN 7.65273966 9.78E-05
c1077442_g1_i5 LYST_HUMAN 8.606270434 9.96E-05
c1083480_g1_i4 RGPA2_HUMAN -8.006862207 0.000101
c1080217_g1_i4 F172B_HUMAN 7.877170173 0.000104099
c1061180_g1_i2 IDE_BOVIN 7.673554829 0.000104099
182
Table A.3.1. (Continued)
transcript id blastx hit logFC padj
c1060498_g3_i1 NSL1_HUMAN -7.720681223 0.000104099
c1084240_g1_i4 S35B2_HUMAN 7.645495842 0.000105373
c1086935_g5_i1 SV422_XENLA -8.6390291 0.000108966
c1092563_g1_i3 YRD6_CAEEL 8.225508631 0.000126173
c1048841_g2_i1 LATS1_HUMAN 7.997389594 0.000129076
c1077756_g2_i7 PB1_HUMAN 7.289072999 0.000159256
c1080236_g3_i1 UBP4_HUMAN 7.79291751 0.000159256
c1089887_g2_i7 CJ012_HUMAN -8.160417673 0.000159256
c1089781_g1_i1 SPTC3_HUMAN 5.257520628 0.000163181
c1088438_g6_i2 DBF4B_HUMAN 8.028075621 0.000169023
c1089051_g1_i2 FUS_MOUSE 8.053062297 0.000171054
c1077796_g2_i2 CUL1_PONAB -8.547478627 0.000175025
c1089919_g4_i6 CP27B_HUMAN 5.65582147 0.000179832
c1085398_g1_i3 THEM4_XENLA 8.343035603 0.000187545
c1081108_g2_i8 DDX5_MACFA 8.264902784 0.000201884
c1089782_g7_i1 PPARD_CANFA 7.782377673 0.000203002
c1088063_g1_i2 RTJK_DROME 8.287448625 0.00021605
c1077943_g7_i1 NCOAT_HUMAN 7.457875205 0.000251284
c1073023_g3_i1 2A5E_HUMAN 8.033322571 0.000280192
c1088647_g1_i3 CAMP2_HUMAN 7.810268326 0.00030595
c1088902_g3_i1 LIN1_NYCCO -8.143726303 0.000319549
c1090534_g5_i2 ANR50_HUMAN 8.007365897 0.000327285
c1087639_g3_i1 SNX25_HUMAN 7.781326171 0.000327285
c1081183_g1_i1 SYRC_BOVIN -8.084362594 0.000338457
c1089348_g4_i3 KCC1A_RAT 7.542828134 0.000366421
c1083426_g7_i1 PRS35_MACMU -7.922666539 0.00037533
c1085289_g4_i3 TRI39_RAT 8.014620313 0.000393626
c1087211_g2_i3 MARF1_CHICK 8.422928762 0.000395116
c1073562_g2_i1 OSBL7_HUMAN 5.335409111 0.000404568
c1077195_g2_i1 KC1A_XENLA 7.338799444 0.000414958
c1084191_g3_i2 SMBT2_HUMAN 7.283901338 0.00058118
c1046138_g1_i2 GTAN_DICDI -3.035935157 0.000708374
c1086426_g1_i2 PO2F1_XENTR -7.385910348 0.000710994
183
Table A.3.2. Top 100 differentially expressed transcripts in stump-derived non-
dividing cells of full skin flap sutured limbs. Negative fold change indicates
enrichment in full skin flap sutured limbs.
transcript id blastx hit logFC padj
c1092764_g1_i2 RTJK_DROFU -5.539683228 1.07E-21
c1078994_g2_i6 CATK_RABIT 5.224015138 1.23E-20
c1088639_g4_i1 RRT15_YEAST -8.318969996 3.08E-20
c1078994_g2_i3 CATK_HUMAN 4.597527523 1.46E-19
c1680103_g1_i1 GP1_CHLRE -6.476805339 5.17E-18
c1082906_g1_i2 POL2_MOUSE 11.00237365 6.48E-15
c1057214_g1_i1 SN_HUMAN 3.32015022 2.91E-14
c1090300_g1_i1 CNN2_MOUSE 10.00028264 5.73E-12
c1092690_g1_i4 SACS_MOUSE 3.431589474 6.27E-12
c1082885_g1_i2 NSF_MOUSE 9.582646445 1.86E-10
c1081515_g3_i1 WNK3_HUMAN 9.292561444 4.09E-10
c1070626_g1_i3 ANO6_HUMAN 9.272540715 4.11E-10
c1065747_g3_i2 KCRB_CHICK 2.211294235 4.80E-10
c1086010_g2_i2 RAB4B_DANRE 9.425222703 4.80E-10
c1092570_g1_i1 HBA_TARGR -2.861455759 7.58E-10
c1053472_g1_i1 GBP1_CHLAE 2.242707772 8.03E-10
c1091277_g1_i5 LIN1_NYCCO 3.234902668 1.76E-09
c1052471_g1_i1 ELP1_HUMAN 8.993267195 1.76E-09
c1072152_g3_i2 HERC3_HUMAN 5.891029939 2.18E-09
c1078351_g1_i1 TP53B_HUMAN 5.722295876 3.28E-09
c1086318_g1_i3 SOAT1_HUMAN 9.226651468 3.36E-09
c1084683_g5_i2 N42L2_HUMAN 8.992956384 4.67E-09
c1090167_g1_i3 S38A3_HUMAN 8.922998113 4.88E-09
c1088436_g1_i3 BPHL_MOUSE -2.509414817 6.42E-09
c1079951_g1_i3 CL16A_HUMAN 9.064970347 6.60E-09
c1082738_g2_i2 IF2_KINRD -5.601338329 7.84E-09
c1076922_g10_i1 PXDN_HUMAN 9.024373475 8.91E-09
c1086644_g3_i11 CNOT1_HUMAN 8.914952716 9.34E-09
c1088054_g3_i1 LAMB2_HUMAN -8.743758423 1.68E-08
c1082693_g1_i3 PTPRE_HUMAN 9.126244302 1.70E-08
c1072251_g4_i1 NGAP_HUMAN 8.418655407 2.30E-08
c1078580_g2_i2 TT39A_XENTR 2.331938095 2.36E-08
c1077756_g2_i6 PB1_HUMAN 8.56969585 2.72E-08
184
Table A.3.2. (Continued)
transcript id blastx hit logFC padj
c1089216_g3_i4 SBNO2_BOVIN 8.983518514 2.72E-08
c1086263_g1_i1 LEMD2_MOUSE 8.696770124 4.56E-08
c1052471_g1_i3 ELP1_HUMAN -8.599629492 5.26E-08
c1089211_g9_i2 NDUS1_HUMAN 8.487125145 5.39E-08
c1085700_g1_i4 F107B_HUMAN 8.503133082 8.20E-08
c1085723_g3_i4 VATA_HUMAN 8.479739414 8.78E-08
c1075582_g1_i1 NU155_HUMAN 8.539617693 1.45E-07
c1086079_g1_i3 OBRG_RAT 5.712703792 1.57E-07
c1085524_g4_i1 SPTB2_HUMAN -8.575696084 1.57E-07
c1088042_g1_i2 MMP13_XENLA 3.849037515 1.74E-07
c1085700_g1_i1 F107B_HUMAN -8.480194288 1.74E-07
c1088299_g3_i11 HNRPU_HUMAN 8.35027298 1.75E-07
c1089084_g5_i1 TRHY_HUMAN 3.10660932 1.84E-07
c1090758_g5_i4 WDR82_CHICK 8.240547603 1.91E-07
c1064056_g1_i1 GP350_EBVB9 -8.414324826 2.56E-07
c1089084_g4_i1 PAR14_MOUSE 3.357960967 2.58E-07
c1090897_g2_i5 POLG_PVCV2 8.280234978 3.03E-07
c1081415_g2_i1 HERC5_HUMAN 2.719380072 3.14E-07
c1086799_g1_i3 SPT2_XENTR 8.399002755 3.30E-07
c1597296_g1_i1 POLY_DROME 3.287948164 3.31E-07
c1042145_g2_i2 UBL7_MOUSE -8.317234547 3.57E-07
c1085065_g1_i1 SETX_HUMAN -7.607067309 3.90E-07
c1081540_g4_i1 SPX2_XENLA 1.91882721 4.16E-07
c1084184_g1_i4 GMPBA_XENLA 8.356331549 4.17E-07
c1083484_g4_i1 SYWC_PONAB -6.427921108 4.28E-07
c1082127_g2_i4 HERC1_HUMAN 8.144953545 4.65E-07
c1089402_g2_i3 IRF3_CHICK 3.467059588 4.87E-07
c1084654_g3_i1 2AAA_PIG 8.33089139 5.35E-07
c1090770_g1_i3 HARB1_HUMAN -4.684961605 6.50E-07
c1085660_g2_i4 RXRBA_DANRE 8.586893266 6.54E-07
c1084500_g2_i5 PRAM_HUMAN 8.361954934 6.59E-07
c1084053_g1_i4 LRRK1_HUMAN 8.205707988 7.06E-07
c1090476_g2_i1 HCDH_PIG 8.052051755 8.20E-07
c979896_g1_i1 043R_FRG3G -8.693499665 8.45E-07
c1052055_g2_i1 RTJK_DROME 2.662018488 8.85E-07
c1085660_g2_i5 RXRBA_DANRE 7.173467873 8.85E-07
185
Table A.3.2. (Continued)
transcript id blastx hit logFC padj
c1080270_g3_i4 ZBT46_HUMAN 8.590389418 9.17E-07
c1078218_g3_i2 H4_XENTR -4.220526388 9.25E-07
c1089828_g2_i1 SMTN_HUMAN 6.234509963 9.25E-07
c1071943_g2_i1 MX1_MACMU 8.215122108 9.30E-07
c1091771_g2_i3 LPIN2_HUMAN 7.831749739 9.54E-07
c1092844_g1_i2 RTBS_DROME -2.102780869 1.03E-06
c1082664_g1_i4 ZO1_CANFA 8.392339556 1.12E-06
c1071771_g2_i1 IL11_HUMAN 2.919327428 1.13E-06
c1082749_g2_i5 RHG23_MOUSE -8.098960826 1.23E-06
c1085800_g1_i3 FA96A_HUMAN 7.954996382 1.33E-06
c1081560_g1_i1 EPDR1_MACFA 6.008417753 1.59E-06
c1064539_g2_i1 CCD93_CHICK 8.037942279 1.65E-06
c1042145_g2_i1 UBL7_MOUSE 7.862532113 1.65E-06
c1085431_g1_i4 DOCK9_HUMAN 6.382680704 1.75E-06
c1090666_g1_i1 PLEC_MOUSE 7.857563979 1.87E-06
c1089338_g4_i2 ST38L_HUMAN 7.987019409 2.35E-06
c1075965_g1_i3 GPR17_HUMAN 8.029837418 2.47E-06
c1081290_g1_i4 IF4G3_HUMAN -8.402370312 2.55E-06
c1072497_g2_i2 DEFI8_HUMAN 8.012857777 2.69E-06
c1084774_g1_i3 SEPT7_XENLA 7.957131692 2.69E-06
c1067485_g1_i1 HARB1_HUMAN -2.304221293 2.85E-06
c1082633_g1_i2 LCAP_HUMAN 7.539546147 2.86E-06
c1063882_g2_i1 MAST3_XENLA 7.967450769 2.87E-06
c1078350_g2_i1 SC31A_HUMAN 8.172470312 2.89E-06
c1086389_g2_i1 ARF1_RAT 7.836321346 3.59E-06
c1061972_g1_i1 ACTZ_RAT 7.886894718 3.83E-06
c1084682_g4_i3 ZN326_PONAB 7.724498639 3.94E-06
c1087610_g1_i1 DIA1_HUMAN 8.071491831 4.35E-06
c1073648_g4_i6 UBP2L_MOUSE 7.946903484 4.35E-06
c1085800_g1_i1 FA96A_HUMAN -8.062908379 4.64E-06
c1052724_g1_i2 CDK12_RAT -7.806816947 4.69E-06
186
Table A.3.3. Top 100 differentially expressed transcripts in epithelial cells of full
skin flap sutured limbs. Negative fold change indicates enrichment in full skin flap
sutured limbs.
transcript id blastx hit logFC padj
c1090257_g1_i2 TSN15_MOUSE 10.65357538 4.18E-12
c1090300_g1_i1 CNN2_MOUSE 10.72497754 1.18E-11
c1086285_g2_i3 K1C24_HUMAN 10.4413052 1.89E-11
c1092690_g1_i3 SACS_MOUSE 9.00189591 1.89E-11
c1088639_g4_i1 RRT15_YEAST -4.508234683 7.17E-11
c1084101_g1_i2 TB182_MOUSE 11.34428408 1.69E-10
c1090687_g2_i3 PTBP1_BOVIN 11.51147751 3.14E-10
c1058430_g3_i1 K1C15_RAT 3.821635653 3.90E-10
c1090600_g1_i6 GCSH_CHICK 5.628028962 3.42E-09
c1090064_g1_i3 RN5A_HUMAN 2.473571913 3.54E-09
c1088810_g1_i3 CO7A1_HUMAN 9.872322957 3.92E-09
c1068399_g1_i2 LAMB3_HUMAN 9.327438602 4.22E-09
c1084191_g3_i2 SMBT2_HUMAN 7.030765253 1.18E-08
c1075471_g2_i4 TOP2A_CHICK 2.78171849 1.92E-08
c1086457_g2_i4 PKN2_MOUSE 9.674315484 2.29E-08
c972758_g1_i1 POLR_DROME 9.317001622 3.06E-08
c1083705_g1_i2 UN13D_HUMAN -9.054962123 3.79E-08
c1091613_g1_i2 TNR6A_HUMAN 8.994633953 5.36E-08
c1086872_g4_i3 CYTC_RABIT -9.452696071 6.09E-08
c1092079_g1_i2 PANX1_MOUSE -9.668498735 8.97E-08
c1461347_g1_i1 MUC5A_HUMAN -4.201898825 1.03E-07
c1066879_g2_i1 TRI33_HUMAN 8.731716605 1.11E-07
c1087857_g1_i1 MYO1C_CHICK 9.293334538 1.13E-07
c1082467_g1_i2 ZBT11_HUMAN 8.730748092 1.15E-07
c1087476_g1_i1 MUC5B_HUMAN -3.227012641 1.22E-07
c1081555_g1_i5 ETUD1_HUMAN -8.823319198 1.22E-07
c1091235_g1_i5 PRRT3_HUMAN 8.90666019 1.57E-07
c1090681_g1_i3 FREM2_HUMAN 5.254949056 1.60E-07
c1085139_g1_i4 PRDX4_HUMAN 8.727004412 2.18E-07
c1090393_g1_i4 HMGN2_PONAB 1.820350319 2.18E-07
c1092564_g1_i4 JADE2_MOUSE -9.225665615 2.24E-07
c1079364_g6_i4 BRD7_CHICK -9.498102575 2.24E-07
c1091539_g2_i2 POL_WDSV 9.100413462 3.02E-07
187
Table A.3.3. (Continued)
transcript id blastx hit logFC padj
c1086995_g1_i2 FDFT_PONAB -8.895810454 5.76E-07
c1075095_g5_i2 MCATL_HUMAN 8.831980129 7.18E-07
c1090795_g1_i1 MSPD1_MOUSE 8.813490009 9.40E-07
c1088527_g2_i2 NOC2L_BOVIN 8.329759162 1.04E-06
c1082467_g1_i1 ZBT11_HUMAN -8.569030977 1.28E-06
c1086350_g2_i3 LMA2L_HUMAN 8.681389279 1.56E-06
c1092813_g3_i1 ANXA1_PANTR 6.826599362 1.70E-06
c1085797_g1_i1 PKH4B_HUMAN 8.441934763 2.97E-06
c1070684_g6_i4 TM100_BOVIN -9.407323215 3.22E-06
c1091969_g1_i2 ATPD_MOUSE 9.182073868 3.23E-06
c1085994_g1_i2 SMAP2_CHICK -8.670961134 3.45E-06
c1082222_g1_i3 RBM14_PONAB -8.422111345 3.51E-06
c1073835_g3_i1 PLEK2_MOUSE 2.672156028 3.59E-06
c1081608_g4_i3 CO2_BOVIN 4.629448203 3.63E-06
c1074983_g4_i1 HID1_HUMAN 8.108459398 5.23E-06
c1083368_g1_i1 RENBP_PIG 8.173149933 8.67E-06
c1088538_g2_i2 PCDH9_HUMAN 7.921943784 9.61E-06
c1049724_g1_i1 DYL1_RAT 3.453071342 1.04E-05
c1081071_g2_i3 CNTLN_HUMAN 7.984604595 1.44E-05
c1090670_g1_i1 GPD1L_XENTR 9.3193441 1.59E-05
c1082738_g2_i2 IF2_KINRD -4.807542884 2.02E-05
c1079696_g1_i2 GAPD1_HUMAN 8.199232592 2.11E-05
c1085156_g5_i2 TGM3_MOUSE 5.789571912 2.14E-05
c1064453_g2_i3 CSKP_HUMAN 8.024329933 2.14E-05
c1078208_g3_i7 AF17_HUMAN 8.662035048 2.21E-05
c1064716_g4_i2 P66A_HUMAN 9.047977398 2.26E-05
c1079507_g1_i2 STAT1_HUMAN 8.728821489 2.70E-05
c1090558_g1_i3 SZT2_HUMAN 8.458554452 2.86E-05
c1089406_g2_i1 SOGA2_MOUSE 5.810787769 2.87E-05
c1081498_g2_i1 HOOK2_XENLA 8.075631981 2.90E-05
c1088192_g4_i4 OASL2_RAT 2.150590569 3.02E-05
c1091613_g1_i3 TNR6A_HUMAN -2.628152433 3.02E-05
c1089983_g3_i1 I20RA_HUMAN 8.317687135 3.08E-05
c1075955_g1_i3 FBX28_HUMAN 7.833857986 3.48E-05
c1078595_g4_i3 DRAM1_MOUSE 5.349510356 4.25E-05
c1082870_g1_i3 COR2A_HUMAN 8.101613637 4.36E-05
188
Table A.3.3. (Continued)
transcript id blastx hit logFC padj
c1080135_g1_i1 IBP2_HUMAN 3.279577401 4.45E-05
c1083265_g7_i3 CAV1_DIDVI -8.159187434 4.74E-05
c1080732_g6_i1 TPC11_CHICK 8.131283847 5.46E-05
c1041958_g1_i2 LIN1_NYCCO 8.510829891 5.94E-05
c1085634_g3_i5 DYN2_MOUSE 8.010511729 6.54E-05
c1084825_g1_i7 RFXK_HUMAN -7.753124731 6.73E-05
c1045890_g1_i3 CPE1B_XENLA 8.051298363 6.94E-05
c1066879_g2_i2 TRI33_HUMAN -6.891767024 7.58E-05
c1086414_g4_i3 RBL2_HUMAN -7.893663368 7.68E-05
c1087059_g7_i1 PP1B_XENTR 8.272181411 8.00E-05
c1065332_g1_i4 MUC1_YEAST 8.21653022 8.00E-05
c1091000_g1_i3 RAD17_HUMAN 8.057187637 8.00E-05
c1085670_g3_i4 C1GLC_HUMAN 8.709107806 8.15E-05
c1072053_g1_i1 UH1BL_XENLA 7.79363608 8.75E-05
c1091852_g2_i2 LAMA5_HUMAN 3.302416849 9.10E-05
c1062596_g1_i1 CP135_HUMAN -7.709965269 9.19E-05
c1081740_g1_i2 AGAP3_HUMAN 7.198650411 9.40E-05
c1043485_g1_i1 BCL3_HUMAN 7.974986889 9.60E-05
c1074926_g1_i1 HTF4_MOUSE 7.989655032 9.71E-05
c1080285_g4_i4 TXIP1_MOUSE 7.934141155 0.000100146
c1079147_g1_i1 ENPP4_HUMAN 7.907390328 0.000101543
c1068313_g1_i1 AT7L3_HUMAN 8.237068526 0.000101597
c1075036_g3_i9 PKN1_THETN 7.689978039 0.000103994
c1069508_g1_i1 CAN15_MOUSE 8.101987358 0.000118447
c1079985_g4_i3 GFPT1_RAT 9.059151021 0.000122688
c1092764_g1_i2 RTJK_DROFU -3.598426273 0.0001239
c1076698_g3_i9 HNRH3_HUMAN 1.745882183 0.000126679
c1057236_g1_i2 IF2M_BOVIN 6.340511482 0.000128845
c1086934_g2_i4 CTL1_XENLA 1.927666798 0.000151422
c1069931_g5_i2 SORT_HUMAN 2.810402884 0.000161274
c1082163_g1_i1 SIAE_HUMAN 2.341915853 0.000162676
189
A.4. Supplemental materials for Chapter 5
Table A.4.1. Top 100 differentially expressed genes in DMSO/iMDK treatments.
Negative fold change indicates overexpression in iMDK, while positive fold change
indicates overexpression in DMSO.
transcript id blastx hit logFC padj
c1069619_g1_i1 UROM_BOVIN -3.219397053 3.78156E-63
c1067192_g2_i1 GILT_BOVIN -10.19916006 9.33083E-60
c1068735_g2_i3 S10AA_CHICK -10.77421892 3.56393E-52
c1070122_g1_i1 CP2J6_MOUSE -6.199446518 2.68918E-41
c1088042_g1_i4 MMP13_XENLA -9.385904463 1.80146E-38
c1074092_g3_i8 FRI1_LITCT -5.871716127 1.39528E-35
c1078497_g1_i1 CTNA1_HUMAN 2.071273079 4.98319E-35
c1078879_g1_i2 PORIM_HUMAN -2.634626841 4.05581E-32
c1091411_g5_i2 MMP18_XENLA -14.95597225 4.37216E-31
c1083466_g1_i2 C560_HUMAN 1.632854145 5.6542E-28
c1053558_g1_i2 LYSC_RABIT 4.610939561 1.58403E-25
c1076999_g1_i4 SC61G_MOUSE 10.35400803 1.06845E-24
c1090676_g2_i2 TSN_CHICK 13.39554876 1.06845E-24
c1079944_g4_i2 CS052_HUMAN 3.867207416 1.03408E-23
c1067192_g2_i2 GILT_BOVIN 12.71681457 1.45775E-22
c1084825_g1_i8 RFXK_HUMAN -6.347781905 1.78437E-22
c1083302_g7_i1 DCNL3_XENTR -2.035811211 6.34729E-22
c1076874_g1_i2 RTBS_DROME 8.987582433 1.30276E-21
c1083265_g7_i2 CAV1_DIDVI -13.37500174 3.28467E-21
c1084989_g2_i2 M1IP1_HUMAN 12.33780997 1.23983E-20
c1073457_g2_i1 EMD_MOUSE 12.0649769 4.90699E-20
c1085679_g4_i1 MSS4_HUMAN 6.42551468 2.68107E-19
c1089923_g1_i2 SNED1_MOUSE 5.665457024 8.04772E-19
c1089890_g4_i3 MMP18_XENLA -3.711999065 1.0831E-18
c1075788_g1_i2 XPO5_HUMAN 11.41163528 1.55131E-18
c1077954_g1_i2 ABCB9_HUMAN -1.034214966 3.00419E-18
c1086055_g1_i6 DHE3_HUMAN -11.86856518 7.84699E-18
c1080065_g1_i3 LEG8_HUMAN -11.36980653 1.92933E-17
c1088757_g3_i5 TM131_HUMAN -11.45019448 6.8566E-17
c1085204_g1_i3 KDEL2_HUMAN -11.20444188 9.65964E-17
190
Table A.4.1. (Continued)
transcript id blastx hit logFC padj
c1091725_g1_i1 URP2_BOVIN -2.053239703 9.75928E-17
c1089244_g1_i4 FA76B_XENTR -10.90772373 1.01134E-16
c1081121_g1_i1 FA98A_RAT -10.98267709 1.19553E-16
c1082824_g3_i4 ITA6_CHICK 11.36884087 1.35983E-16
c1068880_g1_i2 MYPT1_HUMAN 11.44610513 1.35983E-16
c1071947_g1_i1 CDN1A_HUMAN -1.98396188 2.6498E-16
c1088286_g4_i10 PAQR3_HUMAN -10.84476358 2.76186E-16
c1083894_g1_i1 M17L2_XENTR 1.931352877 4.38619E-16
c1089291_g1_i2 WAP1_PHIOL -10.81864107 4.38619E-16
c1079790_g3_i6 CCNC_XENLA -10.87727809 4.98414E-16
c1084825_g1_i11 RFXK_HUMAN -7.557935763 4.98414E-16
c1090907_g1_i7 NCPR_HUMAN -10.61632445 8.8038E-16
c1084227_g2_i6 BIRC5_BOVIN -10.76925458 2.49203E-15
c1085389_g6_i4 LECT2_BOVIN -10.54025637 2.77683E-15
c1089123_g1_i3 IF44L_HUMAN -11.02802577 3.53209E-15
c1077347_g1_i3 CYSP2_HOMAM -10.74070124 4.0995E-15
c1083836_g2_i1 CATK_PIG 10.48632805 4.10968E-15
c1085967_g1_i3 SELN_XENTR 11.12599873 6.71498E-15
c1085376_g2_i1 CNFN_DANRE -10.23908817 8.94011E-15
c1081919_g1_i2 YAP1_HUMAN -10.34615329 9.42223E-15
c1088286_g4_i11 PAQR3_HUMAN 10.32537503 9.63016E-15
c1075330_g2_i1 PSB6_BOVIN 8.060955837 1.08778E-14
c1086071_g1_i5 CT027_XENTR 11.10453444 1.08778E-14
c1088175_g1_i2 PIGS_HUMAN 10.39762999 1.15038E-14
c1083925_g7_i1 UVS2_XENLA -1.94637579 1.18334E-14
c1070847_g1_i7 TM154_HUMAN -10.39651616 1.49751E-14
c1089890_g2_i1 MMP3_RABIT -4.621387099 1.61894E-14
c1090167_g1_i2 S38A3_HUMAN -10.69160638 1.90694E-14
c1080762_g13_i1 CWC15_PONAB -10.29209096 2.58901E-14
c1088267_g2_i14 GIT1_HUMAN -10.14817849 2.85131E-14
c1053012_g1_i6 NR2CA_XENLA -10.31585894 3.17019E-14
c1071002_g3_i4 JAK2_PIG -10.38363307 3.53309E-14
c1068761_g1_i1 AKA10_HUMAN -10.70341903 3.549E-14
c1081431_g2_i2 GPBL1_PONAB -3.034868233 4.68409E-14
c1053012_g1_i1 NR2CA_XENLA 10.46561074 7.51441E-14
191
Table A.4.1. (Continued)
transcript id blastx hit logFC padj
c1088059_g1_i6 EIF1_PONAB -10.53258588 8.90044E-14
c1089890_g5_i1 MMP18_XENLA -3.916075813 1.13595E-13
c1084227_g2_i2 BIRC5_BOVIN 9.938323162 1.94034E-13
c1078066_g1_i2 DPOE3_MOUSE -10.09161797 2.16255E-13
c1088852_g2_i3 NO66_DANRE 1.495251756 2.31134E-13
c1088814_g1_i5 AP3D1_MOUSE 10.39222766 2.95368E-13
c1069931_g5_i1 SORT_HUMAN -10.75369787 3.53546E-13
c1077291_g1_i1 CMLO_XENLA 10.12525054 4.05188E-13
c1091849_g1_i5 HBA2_TRICR 9.708006092 5.77383E-13
c1076139_g2_i1 SPT5H_HUMAN 5.691303182 6.57351E-13
c1067457_g2_i1 RCD1_RAT 10.5666141 6.83102E-13
c1081877_g1_i2 VASP_BOVIN -9.776314241 8.51358E-13
c1084443_g4_i3 S10AD_HUMAN -1.863345078 9.01461E-13
c1084825_g1_i3 MF2NB_DANRE 9.642926766 1.07715E-12
c1075515_g1_i8 NRBP_MACFA -9.766074109 1.21711E-12
c1084478_g4_i7 FANCL_HUMAN -9.669065633 1.61304E-12
c1072722_g1_i8 HYEP_RABIT -11.65799646 1.81998E-12
c1075002_g1_i2 DDAH1_MOUSE -9.647187847 2.02255E-12
c1071544_g1_i2 MOT7_MOUSE 9.809284959 3.11762E-12
c1089890_g4_i1 MMP18_XENLA -1.824314992 3.162E-12
c1065650_g1_i3 WDR3_HUMAN -11.00469068 3.87903E-12
c1090907_g1_i8 NCPR_HUMAN 1.081226169 4.43617E-12
c1067048_g2_i2 PRRX1_RAT -1.942357961 5.51735E-12
c1089079_g2_i2 ADPRH_MOUSE -1.513490616 6.32262E-12
c1085444_g1_i1 ZBT34_HUMAN 2.203222094 7.08975E-12
c1089402_g2_i3 IRF3_CHICK 10.07652743 8.62822E-12
c1076882_g1_i6 CV039_XENLA 2.927742586 8.91177E-12
c1088124_g1_i2 RS21_PIG 10.48571745 9.9563E-12
c1075515_g1_i4 NRBP_MACFA 9.464209578 1.03413E-11
c1088097_g2_i7 TX1B3_HUMAN -9.379024741 1.14552E-11
c1077595_g1_i2 FUND2_HUMAN 2.941866219 1.25903E-11
c1076557_g4_i1 FMO3_CANFA -9.588270973 1.53042E-11
c1081781_g1_i3 HYES_PIG -9.334678354 1.81735E-11
c1089079_g2_i1 ADPRH_MOUSE 9.666861008 1.9689E-11
c1075822_g5_i3 CP2C8_HUMAN -4.056441733 2.43533E-11
192
Table A.4.2. Select enriched pathways in iMDK-treated limbs.
Enriched pathways -log(p-value)
HIF1α Signaling 4.51
IL-8 Signaling 3.79
Leukocyte Extravasation Signaling 3.61
Agranulocyte Adhesion and Diapedesis 3.47
Granulocyte Adhesion and Diapedesis 3.14
Integrin Signaling 2.93
Th1 Pathway 2.89
TREM1 Signaling 2.51
Th1 and Th2 Activation Pathway 2.48
STAT3 Pathway 2.41
Production of Nitric Oxide and Reactive Oxygen Species in Macrophages
2.34
Oncostatin M Signaling 2.16
T Cell Exhaustion Signaling Pathway 2.07
Toll-like Receptor Signaling 1.82
Table A.4.3. Select enriched pathways in DMSO-treated limbs.
Enriched pathways -log(p-value)
β-alanine Degradation I 3.54
Valine Degradation I 2.48
RhoA Signaling 2.29
Protein Kinase A Signaling 2.06
Actin Cytoskeleton Signaling 1.75
Regulation of Actin-based Motility by Rho 1.75
Calcium Signaling 1.6
Cell Cycle: G1/S Checkpoint Regulation 1.57
Thrombin Signaling 1.55
RhoGDI Signaling 1.52
193
Figure A.4.1. Mk is not expressed in monocytes. (A) Double RNAscope in situ
hybridization of mk and csf1r at 5 dpa reveals discrete expression patterns. Arrowheads
denote mk+ only cells and arrows denote csf1r+ only cells. (B) Quantification of mk+ only,
csf1r+ only, and co-positive cells. Scale bar in A denotes 50 µm.
Figure A.4.2. Validation of custom polyclonal rabbit anti-MK antibody. Western
blotting was performed with increasing volumetric ratios of MK antibody: blocking peptide
ratios (1:0, 1:0.5, 1:1, and 1:10) on 10 dpa extracts revealed lower levels of staining with
increased levels of peptide.
194
Figure A.4.3. PCA analysis of DMSO and iMDK samples.
Figure A.4.4. Mk targeting strategy for mk mutant generation. The targeting gRNA is
shown in pink. The exon is denoted in yellow. An example genotyping result from deep
sequencing of PCR amplicons of an mk null mutant reveals no wildtype alleles present.