Cytokine expression during the outcome of canineexperimental infection by Leishmania infantum

Gabriela M. Santos-Gomesa,*, Ricardo Rosaa, Clara Leandroa,Sofia Cortesa, Pedro Romaoa, Henrique Silveirab

aUnidade de Leishmanioses, Centro de Malaria e outras Doencas Tropicais, Instituto de Higiene e Medicina Tropical (IHMT),

Universidade Nova de Lisboa, Rua da Junqueira 96, 1349-008 Lisbon, PortugalbUnidade de Malaria, Centro de Malaria e outras Doencas Tropicais, Instituto de Higiene e Medicina Tropical (IHMT),

Universidade Nova de Lisboa, Rua da Junqueira 96, 1349-008 Lisbon, Portugal

Received 28 November 2001; received in revised form 7 March 2002; accepted 7 March 2002

Abstract

In this study, the cytokines, interferon-gamma (IFN-g), interleukin-2 (IL-2), IL-12 p40, IL-6 and IL-10, expressed by

peripheral blood mononuclear cells of 13 beagle dogs inoculated with Leishmania infantum amastigotes, were analysed during a

period of up to 23 months. The course of infection was monitored through clinical and parasitological examinations,

haematological alterations and serum antileishmania antibody levels. Dogs developed symptomatic infections with haema-

tological alterations, humoral immune response and reduced specific lymphoproliferative response. Parasite presence was

detected in bone marrow, popliteal lymph node and skin. Specifically stimulated cytokine transcripts were generally observed in

a low proportion of dogs, except at months 9, 10 and 11 post-infection where there was a considerable increase in the proportion

of dogs expressing IFN-g and IL-2 mRNA. IL-12 p40 and IL-10 transcripts were sporadically detected in few animals. In non-

infected animals, IFN-g mRNA was the only detectable cytokine but only in cells cultured in the presence of concanavalin A

(ConA). The low proportion of animals expressing specific cytokines, during the first 8 months of infection associated with

evidences of parasite dispersion without clinical signs of disease, suggests the occurrence of a relatively ‘‘silent establishment’’

of the parasite avoiding adverse host-cell-mediated immunological reactions. The humoral immune response displayed in these

animals, the cell-mediated immunosuppression, nor the disease severity could be related with the expression of IL-10. The

predominance of a Th1 type response for a relatively short period indicates that these cytokines are required to control the

infection delaying the appearance of progressive disease. # 2002 Elsevier Science B.V. All rights reserved.

Keywords: L. infantum; Dogs; Experimental infection; PBMC; Cytokine expression

1. Introduction

In south-western Europe, north and east Africa,

Middle East, South America and China, visceral

leishmaniasis is a zoonotic disease caused by Leish-

mania infantum. Dogs are the principal reservoir of

these parasites and play a central role in the transmis-

sion cycle to humans by phlebotomine sand flies.

Veterinary Immunology and Immunopathology 88 (2002) 21–30

* Corresponding author. Tel.: þ351-21-3652600;

fax: þ351-21-3622458/351-21-3632105.

E-mail address: santosgomes@ihmt.unl.pt (G.M. Santos-Gomes).

Abbreviations: Bp, base pairs; RT-PCR, reverse transcriptase

PCR; IFI, indirect fluorescence immunoassay; SI, stimulation index

0165-2427/02/$ – see front matter # 2002 Elsevier Science B.V. All rights reserved.

PII: S 0 1 6 5 - 2 4 2 7 ( 0 2 ) 0 0 1 3 4 - 4

Several epidemic studies have indicated that about

half of the dogs with antileishmanial antibodies have

no clinical signs of disease (Abranches et al., 1991b,

Campino et al., 1995, Acedo-Sanchez et al., 1998, Fisa

et al., 1999) although, animals with subclinical infec-

tions are potentially infectious to sand flies (Molina

et al., 1994). Several clinical signs are presented by

dogs with disease such as: fever, adenopathy, emacia-

tion, skin lesions and ulcers, alopecia, onychogrypho-

sis, hepatosplenomegaly, hypergammaglobulinemia,

and anaemia usually followed by death.

There are clinical and experimental evidences that

indicate that the resolution of leishmanial infections is

T cell-dependent and mediated by macrophages acti-

vated by T cell-derived cytokines (Liew et al., 1982,

Castes et al., 1983, Murray, 1988). Cumulative studies

in patients infected with Leishmania indicate that

individuals which were able to control their infection

exhibit a specific Th1 response with production of

IFN-g (Carvalho and Badaro, 1985, Sacks et al.,

1987). On the other hand, patients with visceral leish-

maniasis developed an impaired Th1 response and

increased production of IL-10 (Ghalib et al., 1993).

Asymptomatic infected dogs have been associated

with specific proliferative responses, production of

IL-2, TNF and IFN-g (Cabral et al., 1992, Pinelli

et al., 1994, 1995), and low anti-leishmanial antibodies

titres. In contrast, sick animals presented depressed

T cell-mediated functions and high levels of specific

antibodies. Although, there are abundant immunolo-

gical information obtained from murine models of

leishmaniasis, limited information is available on the

immune response of dogs to Leishmania. In this study,

RT-PCR was used to analyse the mRNA expression of

IFN-g, IL-2, IL-12 p40, IL-6 and IL-10 in PBMC of

beagle dogs experimentally infected with L. infantum,

during the course of infection. In previous studies, it

was verified that inocula of cultured promastigotes

developed dog’s asymptomatic infections while amas-

tigotes developed symptomatic ones (Abranches et al.,

1991a, Campino et al., 2000, Santos-Gomes et al.,

2000). In this work amastigotes were used in order

to obtain symptomatic infections. However, inocula

did not contain sandfly saliva, which seems to con-

tribute to the success of the infection (Titus and

Ribeiro, 1990, Morris et al., 2001). Furthermore, the

number of amastigotes is probably much higher than

thenumberofparasitesdepositedduringthesandflybite.

As all lab animal models, the canine model is just an

approximation to natural infection, although, dogs

experimentally infected with L. infantum amastigotes

exhibited many of the symptoms observed in natural

chronic canine leishmaniasis.

2. Materials and methods

2.1. Animals

A total of 15 beagle dogs were used. The animals

were accommodated at the IHMT kennel and main-

tained according to the International Guiding Princi-

ples for Biomedical Research Involving Animals. All

animals were previously dewormed and vaccinated

against distemper, parvovirosis, infectious hepatitis,

leptospirosis and parainfluenza. Absence of specific

antibody anti-leishmania was confirmed by indirect

fluorescence immunoassay (IFI). Lymphocyte prolif-

eration to crude L. infantum antigen was evaluated.

RT-PCR for canine cytokines (IFN-g, IL-2, IL-10,

IL-12 p40 and IL-6) was carried out. Haematological

parameters were also analysed.

2.2. Parasites

Amastigotes of L. infantum (MHOM/PT/93/

IMT184) were isolated from spleen of infected ham-

sters. The isolation was carried out according to Chang

(1980) and Leandro et al. (2001), and the number of

parasites was determined as described by Stauber et al.

(1958). Briefly, the removed spleen was homogenised

in RPMI 1640 medium (GibcoBRL, Paisley, Scotland)

and centrifuged 5 min, 800 g at 4 8C. The supernatant

was treated with saponin (Sigma, St. Louis, USA), and

centrifuged 10 min, 1000 g at 4 8C. After two washes

with RPMI 1640 medium, the pellet was resuspended

with a 45% Percoll solution (Sigma, St. Louis, USA),

to which was carefully added a 90% Percoll solution

and centrifuged for 30 min, 3000 g at 15 8C. The

collected amastigotes were washed three times with

RPMI 1640 medium and inoculated in dogs.

2.3. Experimental infection

Thirteen dogs were intravenously inoculated with

106 amastigotes of L. infantum/kg of body weight and

22 G.M. Santos-Gomes et al. / Veterinary Immunology and Immunopathology 88 (2002) 21–30

two healthy animals were used as control group. At the

moment of inoculation the animals weighed 9–12 kg.

Following inoculation, all dogs were periodically

observed for clinical signs of the disease, parasitolo-

gical examination, haematological parameters and,

serum antibody levels. Antigen specific lymphocyte

proliferation was determined and RT-PCR for canine

cytokines was performed.

2.4. Haematological parameters

Total erythrocytes, leukocytes, platelets and hae-

moglobin were determined by an automated blood

cells counter (Sysmex K-1000).

2.5. Parasitological studies

Cultural examinations were carried out by popliteal

lymph node, bone marrow and skin biopsies. The

material was cultured for parasites in NNN (Novy–

McNeal–Nicolle) medium and incubated at 24 8C,

passaged and examined weekly over a 5-week period.

Parasite DNA was detected by PCR according to

Campino et al. (2000), from popliteal lymph node,

bone marrow and skin tissue.

2.6. Serological tests

IFI was performed as described by Abranches

(1984) and the antigen was prepared from a strain

of L. infantum zymodeme MON-1. The dilution of

1:128 was considered the limiting titre.

2.7. Lymphocyte proliferation assays

Lymphoproliferative assays were carried out

according to Abranches et al. (1991a). Briefly, PBMC

were isolated from heparinized blood by Ficoll density

sedimentation, washed and cultured in U-bottom 96-

well microtiter plates (Nunc, Naperville, USA) at a

concentration of 3 � 105 cells per well. Isolated

PBMC were incubated for 3 days in the presence of

5 mg/ml of ConA (Sigma, St. Louis, USA), 10 mg/ml

of crude Leishmania antigen or in the absence of

exogenous stimuli, in a humidified atmosphere at

37 8C and 5% CO2. Cells were pulsed during 14–

16 h with 1.6 mCi of [3H] thymidine (Amersham Life

Science, Aylesbury, UK) and harvested onto glass

fibre filters. [3H] thymidine incorporation was deter-

mined by liquid scintillation counting on a b-counter

(Beckman Ls 6500). Proliferation responses were

expressed as SI. SI � 3 was considered indicative

of a positive cellular response.

2.8. RNA isolation and RT-PCR for canine cytokine

IFN-g, IL-2, IL-6, IL-10 and IL-12 p40 expression

were analysed from lymphocytes cultured, as

described earlier, by RT-PCR. Total RNA was

extracted according to the manufacturer’s recommen-

dations using TRIzol (GibcoBRL). For the synthesis

of cDNA, 1 mg of RNA was reverse transcribed with

oligo-dT primers and MMLV-RT (GibcoBRL)

enzyme according to the manufacturer’s instructions

(GibcoBRL). PCR was conducted in a 20 ml final

reaction mixture containing 1.5 mM 10� Taq buffer,

0.250 mM dNTP, 0.4 mM of specific primers, 2 ml of

canine cDNA and 1 U/ml of Taq polymerase (Fer-

mentas, Hanover, USA). The mixture was amplified

with a thermal cycling profile of 95 8C (5 min), 40

cycles for 30 s at 95 8C, optimal annealing tempera-

ture for each cytokine (55 8C, IL-2 and IL-6; 60 8C,

INF-g and IL-10; 65 8C b-actin and IL-12 p40) for

30 s, 72 8C extension for 30 s, and a final extension at

72 8C (5 min). In the case of IL-6, the mixture was

amplified with this thermal cycling profile, but for 38

cycles. Amplified fragments were analysed by electro-

phoresis on a 1.5% agarose gel containing ethidium

bromide (0.5 mg/ml). A set of primers for constitutively

canine b-actin gene was used to adjust the efficiency of

cDNA synthesis and the amount of cDNA added in the

RT-PCR reactions. The sequences of the specific pri-

mers used are listed in Table 1. Specific primers were

designed based on published nucleic acid sequences

for dogs, or in the case of IL-2, on homology between

sequences of other animal species.

3. Results

Evolution of experimentally infected dogs was

followed up to 9 months (four dogs), 22 months

(one dog) and 23 months (eight dogs).

Parasites were isolated from lymph node or bone

marrow biopsies of 11 dogs within 2–5 months after

inoculation, and detected in skin of nine dogs after

G.M. Santos-Gomes et al. / Veterinary Immunology and Immunopathology 88 (2002) 21–30 23

5 months of observation. Six parasitized animals

presented significant titres of antileishmanial antibo-

dies detected by IFI, that appeared on the third month

of observation and that were consistently detected

throughout the infection. In four animals, with positive

parasitological examinations, positive antibodies titres

were occasionally observed. One dog never presented

clinical signs of disease or antileishmanial antibodies

and the parasite was not detected. Two parasitized

dogs, did not present significant titres of antibodies.

Until 11 months of observation, popliteal adeno-

megaly was the only clinical sign observed. Eight dogs

began to develop external clinical signs of disease

(cutaneous desquamation, lesions, alopecia, onicogry-

phosis, emaciation) 12 months after L. infantum infec-

tion. Thrombocytopenia (nine animals; platelets 6:3�104 to 17:3 � 104 mm�3) and anaemia (seven animals;

erythrocytes 3:83 � 106 to 4:7 � 106 mm�3; haemo-

globin 8.5–10.6 g/dl; haematrocrit 25.2–31.2%)

were the haematological alterations more frequently

observed. Leucopenia (leukocytes 2:2 � 103 to 5:4�103 mm�3) was also detected in five animals. Pancy-

topenia was only observed in three animals (Table 2).

The clinical status of the animals became more severe

with the course of infection and after 22 months of

observation one of the dogs became very sick and had

to be sacrificed.

No clinical, haematological (erythrocytes 6:13�106 to 7:63 � 106 mm�3; leukocytes 10:2 � 103 to

16:6 � 103 mm�3; haemoglobin 14.6–16.9 g/dl; pla-

telets 25:4 � 104 to 37:1 � 104 mm�3; haematrocrit

40.1–51.2%) or serological alterations were observed

in non-infected animals. The parasite or its DNA were

also not detected in these animals.

Non-infected animals presented strong PBMC

responses to ConA (SI average: 44) and no response

to Leishmania antigen. PBMC from inoculated dogs

developed weak (SI ranging 3.4–4.5) or no responses

to leishmanial antigen. High proliferative responses to

the L. infantum antigen was sporadically observed in

only two dogs (maximum SI: 13.7). Positive lympho-

cyte proliferation to ConA was observed in the inocu-

lated dogs (SI ranging 3.0–90.8).

IFN-g, IL-2 and IL-10 expression of dog’s PBMC

stimulated with parasite antigen or ConA, and unsti-

mulated are shown in Figs. 1 and 2. IFN-g was the only

detected cytokine in non-infected animals (month 0)

after PBMC stimulation with ConA. During the first

Table 1

Primer sequences and final product size of b-actin, IFN-g, IL-2, IL-6, IL-12 p40 and IL-10

Target Product size (bp) Forward primer Reverse primer

b-Actin 381 50 GCGATGAGGCCCAGAGCAAGAG 30 50 CAGCCAGGTCCAGACGCAAGAT 30

IFN-g 328 50 CGGTGGGTCTCTTTTCGTAG 30 50 CTGACTCCTTTTCCGCTTCCTTAG 30

IL-2 435 50 CATCGCACTGACGCTTGTA 30 50 ATTGTTGAGTAGATGCTTTGAC 30

IL-6 522 50 CATGCACTGACGCTTGTA 30 50 GAGGTGAATTGTTGTGTGCTTC 30

IL-12 p40 598 50 CCCCCGGAGAAATGGTGGTC 30 50 GTGGGTGGGTCTGGTTTGATGATG 30

IL-10 408 50 GACACCAGAGCACCCTACTTG 30 50 AAGATGTCTTTCTCACTCATGGC 30

Table 2

Number of L. infantum-infected dogs with particular haematological alterations ordered according to their antleishmanial antibodies titres

Haematological alterations Antileishmanial antibodies titres

<1:128 1:128–1:512 1:128–1:4096

Anaemia 1 2 0

Thrombocytopenia 1 3 0

Anaemia, thrombocytopenia and leucopenia 0 0 2

Thrombocytopenia, leucopenia and pancytopenia 0 0 1

Anaemia, thrombocytopenia, leucopenia and pancytopenia 0 0 2

Note: all 12 animals were parasitised; one additional dog did not present humoral immune response, positive parasitological observations nor

clinical signs.

24 G.M. Santos-Gomes et al. / Veterinary Immunology and Immunopathology 88 (2002) 21–30

5 months, the proportion of L. infantum inoculated

dogs expressing IFN-g mRNA was reduced. This

cytokine expression was restored afterwards in variable

proportions. IL-2 and IL-10 mRNA transcripts were

detected throughout the observation period in variable

proportions (IL-2: 0.08–0.75; IL-10: 0.08–0.33;

Fig. 1a). IL-6 and IL-12 p40 expression was observed

in few dogs (IL-12 p40: 0.08–0.22, IL-6: 0.22) between

the 12 and 20th month of infection (Fig. 3).

IFN-g, IL-2, IL-12 p40, IL-6 and IL-10 transcripts

were not detected before infection, either in cells

stimulated with L. infantum Ag or without exogenous

stimulation. During the observation period, IFN-g was

detected in specifically stimulated cells of only a few

animals (proportions <0.15) while IL-2 was rarely

detected, except on months 8, 9, 10 and 11 of observa-

tion where the proportion of dogs expressing IFN-gand IL-2 showed a considerable increase (IFN-g:

Fig. 1. Dog proportion expressing IFN-g, IL-2 and IL-10 mRNA in PBMC stimulated with ConA (a), parasite antigen (b), or without

exogenous stimulation (c), from L. infantum inoculated dogs during 23 months. Time point zero indicates cytokine proportion of non-infected

animals.

G.M. Santos-Gomes et al. / Veterinary Immunology and Immunopathology 88 (2002) 21–30 25

proportions ranging between 0.67 and 1; IL-2: propor-

tions of 0.33 and 0.67; Fig. 1b). During the same

period, an increase of the dog proportion expressing

IFN-g and IL-2 was also observed in non-stimulated

cells, which could have been activated by the parasite

prior to culture (Fig. 1c). The expression of IL-12 p40,

was rarely detected during the entire observation

period, although, the dog proportion expressing IL-

12 p40 suffered a slight increase during months 10–12

post-infection, which was more evident in non-stimu-

lated cells (maximum proportion: 0.50 of animals).

IL-10 transcripts were mainly observed during the

months 9–11 post-infection, but only in a small pro-

portion of the animals (proportions <0.40), both in

Fig. 2. PCR amplification products for IFN-g, IL-2, and IL-10 on month 11 in PBMC stimulated with ConA, parasite antigen (Ag) or without

exogenous stimulation (W/St), from nine L. infantum inoculated dogs (bp: base pair).

26 G.M. Santos-Gomes et al. / Veterinary Immunology and Immunopathology 88 (2002) 21–30

specifically stimulated and non-stimulated cells. IL-6

mRNA transcripts were rarely detected in specifically

stimulated cells and not observed in non-stimulated

nor conA induced cells, during the 23 months of

observation. b-Actin mRNA transcripts were detected

in all the analysed samples.

4. Discussion

The clinical presentation and evolution of leishma-

niasis is a consequence of complex interactions

between parasite and host immune response. The

outcome of infection depends on the ability of host

macrophage to effectively destroy the parasite. This

activity is determined by the balance between an

heterogeneous set of cytokines. In this work, the

cytokines expressed by peripheral blood mononuclear

cells of experimentally infected dogs were charac-

terised in a longitudinal study where the association

between the cytokine expression and clinical mani-

festations of canine leishmaniasis was examined.

Canine leishmaniasis is characterised by a pro-

longed asymptomatic period and an accentuated

humoral immune response (Abranches et al.,

1991a). Previous studies showed that dogs experimen-

tally infected with L. infantum amastigotes developed

a clinical symptomatic infection with high levels of

antileishmanial antibodies and a reduced in vitro

cellular immune response to the specific antigen

(Abranches et al., 1991b, Campino et al., 2000). In

this work, the majority of the animals developed the

same pattern with haematological alterations. The

sporadic high proliferative responses to the leishma-

nial antigen observed in some animals were already

reported in dogs natural and experimentally infected

by Leandro et al. (2001).

Parasite presence in dog skin indicates the possibi-

lity of parasite transmission few months after L.

infantum inoculation and during the prepatent and

patent phase of infection.

The cytokines, IFN-g and IL-2, activate human and

rodent macrophages to destroy the parasite (Liew and

O’Donnell, 1993). The decrease of the dog proportion

expressing IFN-g by ConA induced PBMC occurs

very early after infection, indicating that at this stage

the parasite interferes with the ability of lymphocytes

to express this cytokine. During the prepatent and

patent period of infection, animals partially restored

the ability to express IFN-g in non-specifically stimu-

lated cells. This observation is consistent with pre-

vious reports which refer that lymphocytes from

visceral leishmaniasis patients produced IFN-g when

they are non-specifically stimulated. However, when

lymphocytes were stimulated with Leishmania anti-

gen IFN-g production was absent (Carvalho and

Badaro, 1985).

IL-12 has been associated with the mediation of

Th1 cell development and the enhancement of IFN-gproduction. However, in this study, the proportion of

infected animals, that show non-stimulated or speci-

fically stimulated PBMC expression of IL-12 p40,

IFN-g or IL-2 mRNA, is generally very low during

an extensive period of time post-infection (8 months).

These results, associated with an overall low detection

of IL-10 transcripts, suggests the occurrence of a

Fig. 3. Some examples of PCR amplification products for IL-12 p40 and IL-6 in PBMC from L. infantum inoculated dogs.

G.M. Santos-Gomes et al. / Veterinary Immunology and Immunopathology 88 (2002) 21–30 27

relatively ‘‘silent establishment’’ of the parasite.

Indeed, the existence of a relatively long ‘‘silent’’

period without induction of the host-cell-mediated

immunity nor associated pathology during which

there was parasite multiplication, was also observed

in mice infected with L. major by Belkaid et al. (2000).

In the majority of these dogs, evidence of parasite

expansion and relatively fast dispersion in the popli-

teal lymph node, bone marrow and skin were also

detected within 2–5 months after amastigotes inocu-

lation. In addition, animals did not present disease

associated pathology during this period. This ‘‘silent’’

initial period, where adverse immunological reactions

of the host against the parasite were possibly avoided,

seems to promote parasite dissemination in the host

and its transmission. This fact should be confirmed

by feeding sand flies. Thus, the dog constitutes an

efficient reservoir for L. infantum maintaining a rela-

tively long time equilibrium which permits both the

survival of the host and the maintenance of the parasite

life cycle.

IL-10 has been linked to the suppression of cytokine

production by Th1 cells, to the development of a Th2

immune response (Mosmann and Moore, 1991) and to

the down-regulation of leishmanicidal macrophage

activation (Bogdan et al., 1991). In this study, the

low proportion of animals which express IL-10 and

IL-6 mRNA suggests that these cytokines may not

have a direct inhibitory effect on IFN-g or IL-2

expression. This observation could not be related

with the general immunosuppression observed in

these animals nor with disease severity. Moreover,

in human cutaneous and visceral leishmaniasis, the

co-existence of IFN-g and IL-10 both at protein and

mRNA level was detected. So, IL-10 does not seem to

have an immunoregulatory role in preventing the

expression of IFN-g (Sundar et al., 1997, Kenney

et al., 1998, Louzir et al., 1998). IL-6 has been

implicated in B-cell stimulation. However, in the

present study the rarely detectable expression of IL-

6 can not be correlated with the antileishmania anti-

body levels displayed in the majority of L. infantum

inoculated animals. In addition, Pinelli et al. (1994)

did not find any differences between uninfected and

infected dogs in relation to the specific PBMC pro-

duction of IL-6.

The late predominance of a Th1 type response (with

simultaneous expression of IFN-g, IL-2 and IL-12 p40

mRNA) for a relatively short period of time

(3 months), which occurred at the end of the prepatent

period of infection and before the definitive establish-

ment of external clinical signs, suggests that these

cytokines are required to delay the onset of disease,

thus, maximising host control of the parasite. In

addition, it was previously demonstrated that IFN-g,

IL-2 and TNF-a induced the activation of canine

macrophages with high production of nitric oxide

(Pinelli et al., 2000). However, the dogs were unable

to control the infection, leading to progressive disease,

despite the short existence of a larger proportion of dogs

expressing Th1 type cytokines and a smaller proportion

of animals with detectable IL-10 mRNA.

In this work, the reduction of the proportion of

animals expressing IFN-g and IL-2 observed during

the symptomatic period is similar to what was pre-

viously described in other studies with experimental

and naturally infected dogs (Pinelli et al., 1994) and in

active visceral leishmaniasis patients (Carvalho and

Badaro, 1985). Furthermore, the reduced detection

of IL-10 transcripts observed in these animals is

a distinct feature from human infections caused

by the agent of antroponotic visceral leishmaniasis,

L. donovani (Ghalib et al., 1993).

According to the results obtained in this study,

experimentally infected animals presented three dis-

tinct patterns during the evolution of L. infantum

infection: (1) prepatent long phase—dogs were

asymptomatic, with low expression of cytokines by

non-stimulated and stimulated cells; (2) prepatent

short phase—animals remained asymptomatic and

presented increased expression of IFN-g and IL-2

either when cells were specifically stimulated or

non-stimulated and; (3) patent phase—dogs presented

clinical signs and reduced expression of cytokines.

During these three phases, animals maintained speci-

fic humoral immune responses, general abrogation of

specific lymphocyte proliferation to parasite antigen

and the capacity to transmit the parasite, since its

presence can be detected in the skin.

Acknowledgements

This work was supported by JNICT through project

PBICT/BIA/2054/95 and by SINDEPEDIP, Programa

Projectos Mobilizadores para o Desenvolvimento

28 G.M. Santos-Gomes et al. / Veterinary Immunology and Immunopathology 88 (2002) 21–30

Tecnologico na area da Saude through project

IMUNOPOR. We are thankful to J.M. Cristovao

and J. Ramada for their technical assistance.

References

Abranches, P., 1984. O Kala-azar da Area Metropolitana de Lisboa

e da Regiao de Alcacer do Sal. Estudo dos reservatorios

domestico e silvatico e sobre a populacao humana em risco de

infeccao, Ph.D. Thesis, Faculdade de Ciencias Medicas da

Universidade Nova de Lisboa, 226 pp.

Abranches, P., Santos-Gomes, G., Rachamim, N., Campino, L.,

Schnur, L., Jaffe, C., 1991a. An experimental model for canine

visceral leishmaniasis. Parasite Immunol. 13, 537–550.

Abranches, P., Silva Pereira, M.C.D., Conceicao-Silva, F.M.,

Santos-Gomes, G.M., Janz, J.G., 1991b. Canine leishmaniasis:

pathological and ecological factors influencing transmission of

infection. J. Parasitol. 77, 557–561.

Acedo-Sanchez, C., Morillas-Marquez, F., Sanchız-Marın, M.C.,

Martin-Sanchez, J., 1998. Changes in antibody titres against

Leishmania infantum in naturally infected dogs in southern

Spain. Vet. Parasitol. 75, 1–8.

Belkaid, Y., Mendez, S., Lira, R., Kadambi, N., Milon, G., Sacks,

D., 2000. A natural model of Leishmania major infection

reveals a prolonged ‘‘silent’’ phase of parasite amplification in

the skin before the onset of lesion formation and immunity. J.

Immunol. 165, 969–977.

Bogdan, C., Vodovotz, Y., Nathan, C., 1991. Macrophage

deactivation by interleukin-10. J. Exp. Med. 174, 1549–1555.

Cabral, M., O’Grady, J., Alexander, J., 1992. Demonstration of

Leishmania specific cell-mediated and humoral immunity in

asymptomatic dogs. Parasite Immunol. 14, 531–539.

Campino, L., Rica Capela, M., Maurıcio, I., Ozensoy, S.,

Abranches, P., 1995. O Kala-Azar em Portugal. IX. A regiao

do Algarve: Inquerito epidemiologico sobre o reservatorio

canino no concelho de Loule. Rev. Port. Doen. Infect. 3/4,

189–194.

Campino, L., Santos-Gomes, G., Rica-Capela, M.J., Cortes, S.,

Abranches, P., 2000. Infectivity of promastigotes and amasti-

gotes of Leishmania infantum in a canine model for

leishmaniosis. Vet. Parasitol. 92, 269–275.

Carvalho, E.M., Badaro, R., 1985. Absence of gamma interferon

and interleukin-2 production during active visceral leishma-

niasis. J. Clin. Invest. 76, 2066–2069.

Castes, M., Agnelli, A., Verde, O., Rondon, A.J., 1983.

Characterization of the cellular immune response in american

cutaneous leishmaniasis. Clin. Immunol. Immunopathol. 27,

176–186.

Chang, K., 1980. Human cutaneous Leishmania in mouse

macrophage line: propagation and isolation of intracellular

parasites. Science 209, 1240–1242.

Fisa, R., Gallego, M., Castillejo, S., Aisa, M.J., Serra, T., Riera, C.,

Carrio, J., Gallego, J., Portus, M., 1999. Epidemiology of

canine leishmaniosis in Catalonia (Spain). The example of a

Priorat focus. Vet. Parasitol. 83, 87–97.

Ghalib, H.W., Piuvezam, M.R., Skeiky, Y.A.W., Siddig, M.,

Hashim, F., El-Hassan, A.M., Russo, D.M., Reed, S.G., 1993.

Interleukin 10 production correlates with pathology in human

Leishmania donovani infections. J. Clin. Invest. 92, 324–329.

Leandro, C., Santos-Gomes, G.M., Campino, L., Romao, P., Cortes,

S., Rolao, N., Gomes-Pereira, S., Rica Capela, M.J., Abranches,

P., 2001. Cell-mediated immunity and specific IgG1 and IgG2

antibody response in natural and experimental canine leishma-

niosis. Vet. Immunol. Immunopathol. 79, 273–284.

Kenney, R.T., Sacks, D.L., Gam, A.A., Murray, H.W., Sundar, S.,

1998. Splenic cytokine responses in Indian kala-azar before and

after treatment. J. Infect. Dis. 177, 815–818.

Liew, F.Y., Hale, C., Howard, J.G., 1982. Immunologic regulation

of experimental cutaneous leishmaniasis. V. Characterisation of

effector and specific suppressor T cells. J. Immunol. 128, 1917–

1922.

Liew, F., O’Donnell, C., 1993. Immunology of leishmaniasis. Adv.

Parasitol. 32, 161–259.

Louzir, H., Melby, P.C., Salah, A.B., Marrakchi, H., Aoun, K.,

Ismail, R.B., Dellagi, K., 1998. Immunologic determinants of

disease evolution in localized cutaneous leishmaniasis due to

Leishmania major. J. Infect. Dis. 177, 1687–1695.

Molina, R., Amela, C., Wieto, J., San-Andres, M., Gonzalez, F.,

Castillo, J., Lucientes, J., Alvar, J., 1994. Infectivity of dogs

naturally infected with Leishmania infantum to colonized

Phlebotomus perniciosus. Trans. R. Soc. Trop. Med. Hygiene

88, 491–493.

Morris, R.V., Shoemaker, C.B., David, J.R., Lanzaro, G.C., Titus,

R.G., 2001. Sandfly maxadilan exacerbates infection with

Leishmania major and vaccinating against it protects against L.

major infection. J. Immunol. 167, 5526–5530.

Mosmann, T.R., Moore, K.W., 1991. The role of IL-10 in

crossregulation of TH1 and TH2 responses. Immunol. Today

12, 49–53.

Murray, H.W., 1988. Interferon-gamma, the activated macrophage

and host defense against microbial challenge. Ann. Intern. Med.

108, 595–608.

Pinelli, E., Gebhard, D., Mommaas, A.M., van Hoeij, M.,

Langermans, J.A.M., Ruitenberg, E.J., Rutten, V.P.M.G.,

2000. Infection of a canine macrophage cell line with

Leishmania infantum: determination of nitric oxide production

and anti-leishmanial activity. Vet. Parasitol. 92, 181–189.

Pinelli, E., Gonzalo, R.M., Boog, C.J., Rutten, V.P., Gebhard, D.,

Del Real, G., Ruitenberg, E.J., 1995. Leishmania infantum-

specific T Cell lines derived from asymptomatic dogs that lyse

infected macrophages in a major histocompatibility complex-

restricted manner. Eur. J. Immunol. 25, 1594–1600.

Pinelli, E., Killick-Kendrick, R., Wagenaar, J., Bernadina, W., Real,

G., Ruitenberg, J., 1994. Cellular and humoral immune

responses in dogs experimentally and naturally infected with

Leishmania infantum. Infect. Immun. 62, 229–235.

Sacks, D.L., Lal, S.L., Shrivastava, S.N., Blackwell, J., Neva, F.A.,

1987. An analysis of T cell responsiveness in Indian kala-azar.

J. Immunol. 138, 908–913.

Stauber, L., Franchino, E., Grun, J., 1958. An 8-day method for

screening compounds against Leishmania donovani in golden

hamster. J. Protozool. 5, 269–273.

G.M. Santos-Gomes et al. / Veterinary Immunology and Immunopathology 88 (2002) 21–30 29

Santos-Gomes, G.M., Campino, L., Abranches, P., 2000. Canine

experimental infection: intradermal inoculation of Leishmania

infantum promastigotes. Mem. Inst. Oswaldo Cruz 95, 193–198.

Sundar, S., Reed, S.G., Sharma, S., Mehrotra, A., Murray, H.W.,

1997. Circulating T helper 1 (TH1) cell- and TH2 cell-

associated cytokines in indian patients with visceral leishma-

niasis. Am. J. Trop. Med. Hygiene 56, 522–525.

Titus, R.G., Ribeiro, J.M.C., 1990. The role of vector saliva in

transmission of arthropod-borne disease. Parasitol. Today 6,

157–160.

30 G.M. Santos-Gomes et al. / Veterinary Immunology and Immunopathology 88 (2002) 21–30