Bioresource Technology 97 (2006) 414–419

Comparative study of four extraction methods forenterovirus recovery from wastewater and sewage sludge

Khaoula Belguith a, Abdennaceur Hassen b,*, Mahjoub Aouni a

a Laboratoire des Maladies Transmissibles et Substances Biologiquement Actives, Faculte de Pharmacie de Monastir,

5000 Rue Avicenne, Monastir, Tunisiab Institut National de Recherche Scientifique et Technique, Laboratoire Eau et Environnement, BP 24-1082 Cite Mahrajene, Tunis, Tunisia

Received 8 March 2004; received in revised form 20 December 2004; accepted 16 March 2005

Available online 23 May 2005

Abstract

This study investigated four methods for the recovery of enteroviruses from sterilized raw wastewater, activated sludge, thickened

sludge and treated wastewater, inoculated with Echovirus 11, Gregory prototype. The adsorption–elution method recommended by

the US Environmental Protection Agency (EPA) was better for Echovirus 11 recovery than a sonication method, a modified EPA

method and a membrane adsorption elution method since it resulted in the highest detection levels by cell culture and RT-PCR

(Friedman�s test, p < 0.00041 and p = 0.041, respectively).

� 2005 Elsevier Ltd. All rights reserved.

Keywords: Enteroviruses; Wastewater; Sludge; Extraction method; Cell culture; PCR

1. Introduction

Numerous studies have documented the presence of

enteroviruses in raw and treated wastewater (Payment

et al., 1986) and sludge (Craun, 1984). Enterovirusesin the environment pose a public health risk because

these viruses can be transmitted via the faecal–oral route

through contaminated water (Craun, 1984) and low

numbers are able to initiate infection in humans.

The group of enteroviruses consists of the polioviruses,

coxsackieviruses A and B, echoviruses and some �new�enteroviruses. The standard method for the detection of

enteroviruses in water samples relies on concentrationof the viruses from water followed by inoculation of spe-

cific cell cultures. Most enteroviruses are capable of mul-

tiplying in host cells and provoking characteristic lesions

called cytopathic effects (CPE�s), which can be observedunder the microscope. These procedures are very time

0960-8524/$ - see front matter � 2005 Elsevier Ltd. All rights reserved.

doi:10.1016/j.biortech.2005.03.022

* Corresponding author. Tel.: +216 71788436; fax: +216 71410740.

E-mail address: abdohassen@yahoo.fr (A. Hassen).

consuming and expensive (Sobsey, 1982). Furthermore,

many of these viral agents cannot be cultivated (Binn

et al., 1984). Therefore, a low cost and faster detection

method, the polymerase chain reaction, has come into

use (Rotbart, 1990; Abbaszadegan et al., 1999; Pillaiet al., 1991; Dubois et al., 1997). RT-PCR is a sensitive,

specific and rapid method for detection of RNA viruses;

however, it cannot distinguish between infectious and

non-infectious viral particles. Aswith the culturemethod,

certain contaminants in virus preparation can be inhibi-

tory (Ijzerman et al., 1997). These effects can be elimi-

nated by successive washings after binding of the RNA

on silica beads (Boom et al., 1990), filtration throughSephadex and Chelex resins (Abbaszadegan et al., 1993)

or precipitation with polyethylene glycol (Schwabb

et al., 1993). Additionally, proteins and carbohydrates

can bind to nucleotides and magnesium ions, making

them unavailable to the polymerase (Schwabb et al.,

1995).

Several methods have been described for viral or

RNA extraction from environmental samples (Borrego

K. Belguith et al. / Bioresource Technology 97 (2006) 414–419 415

et al., 1991; Monpoeho et al., 2001; Zanetti et al., 2003).

They involve negatively and positively charged filters

and adsorption–elution (Joret et al., 1986; Queiroz

et al., 2001; Katayama et al., 2002), organic precipita-

tion (Traore et al., 1998), two phase separation

(Mignotte et al., 1999), ultrafiltration (Divizia et al.,1989) and ultracentrifugation (Schwartzbrod, 1995).

The aim of this study was to compare extraction

methods enabling the detection of enteroviruses by cell

cultures or methods of molecular biology. The efficiency

of viral elution was evaluated by TCID (50% of tissue

culture infectious dose) and RT-PCR. Utilization of

samples contaminated with known amounts of virus

(TCID 108 for cell culture assays and TCID 102–106

for PCR assays) allowed direct comparison to estimate

the output of the extraction method used.

2. Methods

2.1. Sewage sample processing

Four types of samples were collected from a waste-

water treatment plant, including raw wastewater,

activated sludge, thickened sludge and secondary waste-

water. The samples were autoclaved at 120 �C for

30 min, and seeded with a known TCID of Echovirus

11 (Gregory prototype), namely TCID 108 for cell cul-

ture assays and TCID 102–106 for PCR assays. Sixteen

negative controls were prepared and each type of samplewas extracted using the four methods to test for viral

RNA that survived autoclaving.

2.2. Virus extraction, concentration and concentrate

decontamination

Viruses were extracted from samples using the four

methods. Each extraction experiment was done intriplicate.

The first method was that recommended by the US

Environmental Protection Agency (EPA, 1992). Sam-

ples were added to 1% (v/v) of 0.05 M aluminum chlo-

ride and adjusted to pH 3.5 using HCl. The mixture

was homogenized and centrifuged at 2500g using a Het-

tich centrifuge (model Rotina 35R, d-78532, rotor 1718,

Germany) for 15 min at 4 �C. The pellet was resus-pended in 100 ml of 10% beef extract (LP029; Oxoid

Ltd., Basingstoke, Hants., England) and pH was ad-

justed to 7. The mixture was again homogenized and

centrifuged at 10,000g for 30 min at 4 �C. The superna-tant was used for virus detection. The second method

was that described by Albert and Schwartzbrod

(1991). Samples were centrifuged at 1500g for 15 min,

and the pellet was resuspended in 100 ml borate buffer(0.1 M) containing 3% beef extract (pH 9). The mixture

was stirred prior to sonication (80 W) on ice for 1 min

(Vibra cell TM model 72434, France). After centrifuga-

tion at 10,000g for 45 min, the supernatant was adjusted

to pH 7.2 and collected. For the third method, recom-

mended by Soares et al. (1994), samples were treated

as prescribed by the EPA except that after centrifuga-

tion at 2500g, the pellet was resuspended in 500 ml buf-fer of pH 7 (3.15 g/l Na2HPO4 and 0.15 g/l citric acid)

containing 3% beef extract. The mixture was homo-

genized and centrifuged at 15,300g for 10 min at 4 �Cand the supernatant was collected. The fourth method

was an adsorption–elution method with electronega-

tive filters as recommended by Schwartzbrod (1995).

After adding 1% (v/v) of 0.05 M aluminum chloride

and adjusting to pH 3.5 with HCl, the samples werefiltered at a flow rate of 5 l/min through an inorganic

membrane (Whatman 6809-5022, France) that was

washed with 250 ml NaCl (0.14 M). Viruses adsorbed

to the filter were eluted with buffered 3% beef extract

at pH 9. The beef extract passed through the filter

with a low flow rate of 80 ml/min. The extract was ad-

justed to pH 7. This method could not be used in the

case of activated and thickened sludge because of filterclogging.

The extract, concentrated by precipitation with poly-

ethylene glycol 6000 (PEG) as described by Lewis and

Metcalf (1988), was added to 5% PEG (w/v). After an

overnight incubation at 4 �C, the extract was centrifugedat 10,000g for 45 min, and the pellet was resuspended in

10 ml phosphate buffer, pH 7.2 (0.1 M). This suspension

was filtered through a 0.22 lm pore size membrane (Mil-lex-GS, SLGS0250S, Molsheim, France) and collected

as virus concentrate.

2.3. Quantification of infectious enteroviruses

Infectious enteroviruses were quantified by inoculat-

ing the decontaminated concentrates into in vitro rhab-

domyosarcoma (RD) cell layers in 96-well microplateswith eight successive dilutions using 10 wells for each

dilution. Each well was filled with 50 ll of inoculumand 200 ll of nutritive medium (DMEM, Gibco BRL-

52100-033 with 1% fetal calf serum) containing

2 · 105 cells/ml. Microplates were incubated at 37 �C ina 5% CO2 atmosphere for 7 days. Viral density was

determined daily until a cytopathic effect was observed.

TCID50% is defined as that dilution of a virus sus-pension required to infect 50% of inoculated cell cultures

(Hierholzer and Killington, 1996). Cytopathic effect was

observed in infected cells, and TCID50% was calculated

as recommended by Reed and Muench (1938).

2.4. Detection of viral genomes

RNA extractions were carried out with a Tri-reagent kit (Sigma, T9424, Germany) as described

by Chomczynski and Sacchi (1987), using 100 ll of

416 K. Belguith et al. / Bioresource Technology 97 (2006) 414–419

decontaminated concentrate. After processing, the dried

pellet was dissolved in 30 ll RNAase-free sterile water.Primers used in this RT-PCR assay are described by

Zoll et al. (1992) from the 5 0 no-coding region reported

to be highly conserved in enteroviruses.

Primer Sequence Polarity Positiona

006 TCCTCCGGCCCCTGAATGCG Sense 425–445007 ATTGTCACCATAAGCAGCCA Antisens 578–599a Positions refer to the Coxsakievirus B1 sequence of Lizuka et al. (1987).

Reverse transcription was performed with 20 ll ofmixture containing 10 ll of the extracted nucleic acids,5· reaction buffer, 0.2 mM of each dNTP, 2.5 U of

MMLV (Gibco BRL) and 40 pmol of 007 antisense pri-

mer. The reaction mixture was incubated for 30 min at

42 �C.A volume of 2 ll of cDNA product was amplified in a

50 ll reaction mixture containing 1.25 U of Taq DNApolymerase (Gibco BRL, UK), 10· reaction buffers,

0.2 mM of each dNTP, 2 mM MgCl2 and 40 pmol each

of 006 sense and 007 antisense primer. Cycling condi-

tions consisted of an initial denaturation step of 94 �Cfor 5 min followed by 30 cycles of 94 �C for 30 s,

42 �C for 1 min and 72 �C for 2 min and a final exten-sion at 72 �C for 10 min. PCR products were analyzedby electrophoresis in a 2% agarose gel containing0.5 lg/ml of ethidium bromide in TBE buffer and visual-ized under ultraviolet light (TFP-20C, France).

2.5. Statistical analysis

Statistical analysis was performed using the statistical

package SPSS version 10.0.1 (1999, SPSS Inc.). Results

Table 1

Efficiency of extraction methods as evaluated by TCID50% for infectious en

Sample Assay Method 1

(EPA, 1992)

Method 2

(Albert and

Schwartzbr

Primary sewage sludge 1 3.2 · 106 3.2 · 106

2 3.2 · 105 3.2 · 104

3 3.1 · 107 1.2 · 104

Secondary waste water 1 1.0 · 107 5.6 · 105

2 3.1 · 107 1.8 · 104

3 3.1 · 107 1.0 · 105

Activated sludge 1 3.2 · 106 3.2 · 105

2 3.1 · 105 3.1 · 105

3 1.0 · 105 1.0 · 104

Thickened sludge 1 1.0 · 107 3.2 · 104

2 3.1 · 106 1.0 · 105

3 1.0 · 106 3.1 · 106

Ranka 3.88 1.94

–: Not tested because of filter clogging; TCID50% expressed as viral particlea Friedman�s statistical ranks were assigned by assigning the higher value

of infectious enterovirus quantification and RT-PCR

were analyzed by Friedman�s (1937) test for relativeefficiency. Ranks were assigned by assigning the higher

value to the better yield method (Friedman�s testp < 0.04).

3. Results and discussion

3.1. Cell culture assays

The results of four different viral extraction methods

tested for four types of sewage samples, artificially con-

taminated with Echovirus 11 at a TCID50% of 108, are

shown in Table 1.This study compared three adsorption–elution

methods and one sonication. The efficiencies of the dif-

ferent methods differed significantly (Friedman�s test,p < 0.00041). The most efficient method was method 1

(rank = 3.88) followed by method 3 (Table 1).

The adsorption–elution method with electronegative

filters (method 4) has the major disadvantage that sus-

pended solids clog the filter. In addition, it may resultin loss of virus infectivity (Sobsey, 1982).

Lowering the pH and increasing multivalent cations

ensures maximal enterovirus adsorption (Sobsey et al.,

1973; Wallis and Melnick, 1967). The use of beef extract

as an elution medium has found worldwide acceptance,

and its use is compatible with virus detection by cell cul-

ture (Payment and Trudel, 1985; Yanko et al., 1993;

teroviruses in sewage samples

od, 1991)

Method 3

(Soares et al., 1994)

Method 4

(Schwartzbrod, 1995)

3.2 · 105 1.0 · 105

3.2 · 105 1.2 · 104

1.2 · 105 3.1 · 104

3.1 · 105 1.8 · 104

3.2 · 104 3.2 · 104

3.1 · 105 1.0 · 105

3.1 · 104 –

3.1 · 104 –

1.0 · 105 –

3.1 · 106 –

1.0 · 105 –

3.2 · 104 –

2.61 1.55

s/ml.

to the better yield method (Friedman�s test, p < 0.00041).

K. Belguith et al. / Bioresource Technology 97 (2006) 414–419 417

Dahling and Wright, 1988; Hurst et al., 1984). The

hydrophobic interaction with organic substances in beef

extract played an important role in the elution of viruses

from various absorbents in many studies (Logan et al.,

1980; Stetler et al., 1992).

However, this result contrasts with that of Ahmedand Sorenson (1995) who recommended a method

requiring sonication. It is also at variance with the

data of Monpoeho et al. (2001) and Mignotte et al.

(1999) who demonstrated a high yield with the method

described by Ahmed and Sorenson compared with

seven extraction methods including methods 1, 2 and

3. All these previous studies used raw waste samples

to compare viral extraction methods. It is well knownthat urban waste sludge is highly heterogeneous and

variation of the virus content from one waste sample

to another makes comparison difficult, particularly

for activated and thickened sludge where the viral

particle number is generally lower than the detection

limit of the cell culture technique (Schwartzbrod,

1995). As a result, sample heterogeneity affected the

statistical ranking and the virus recovery of differentextraction methods.

3.2. PCR assays

For each sewage sample seeded with different

amounts of Echovirus 11 (TCID50 of 102, 104, and

106, respectively), the result of virus genome detection

is expressed for all four tested extraction methods asthe ratio of positive vs. analyzed samples (Table 2).

No enterovirus RNA was detected in negative controls,

and autoclaving resulted in inactivation of viral RNA.

All methods except method 4 were suitable for virus

detection. In the case of secondary wastewater, no statis-

tical differences were observed between the results of the

four extraction methods. Method 1 allowed quantitative

detection regardless of the virus load (TCID50).Statistical analysis showed significant differences be-

tween the four methods (p = 0.04). The most efficient

method was method 1, followed by methods 2 and 3

which were equivalent.

In cell culture assays, methods 2 and 3 ranked signif-

icantly differently (Table 1). The two methods therefore

Table 2

Efficiency of extraction methods as evaluated by RT-PCR in sewage

Sample Method 1 Meth

Primary sewage sludge 3/3a 2/3

Secondary waste water 3/3 3/3

Activated sludge 3/3 1/3

Thickened sludge 3/3 1/3

Rankb 3.63 2.38

–: Not tested.a Number of positive samples/number of sample analyzed.b Friedman�s statistical ranks were assigned by assigning the higher value

appeared to have the same potential for virus recovery,

but these viruses were not demonstrated to be all infec-

tious in RT-PCR.

On the other hand, RT-PCR was reported to be the

best option for developing sensitive, rapid and specific

tests for detection of enteroviruses in environmentalsamples (Schvoerer et al., 2000; Abbaszadegan et al.,

1999); however, interference by PCR inhibitors may

occur (Sieh et al., 1995; Ijzerman et al., 1997). The re-

sults are not consistent with those reported by Schwabb

et al. (1995), who suggested that beef extract elution had

an inhibitory effect on the subsequent viral genome

detection by RT-PCR after PEG 6000 precipitation.

Monpoeho et al. (2001) described extraction methodsbased on beef extract buffer and PEG 6000 precipitation

that yielded higher viral titers with both cell culture and

PCR. Wastewater may contain inhibitors of PCR that

could limit the virus genome detection. On the other

hand, activated and thickened sludge contains high lev-

els of suspended particles, making viruses inaccessible to

extraction.

The purpose of this study was to evaluate four extrac-tion methods for enterovirus detection in sewage samples

and to test the simultaneous use of cell culture and

genome amplification for the detection of human enteric

viruses in various environmental samples. Method 1,

recommended by the US Environmental Protection

Agency, allowed a higher viral recovery for cell cultures

and better detection by RT-PCR. Additional studies to

correlate the number of enteric virus genomes with infec-tious particles are necessary for evaluation of the treat-

ment efficiency in sewage treatment plants, and for

establishment of a threshold for viral risk in the

environment.

PCR results should be interpreted as an indication of

possible virus occurrence in wastewater and sewage

sludge and of a potential risk of disease, rather than as

a definitive public health problem. The PCR revealeda higher level of viral contamination than the cell culture

assay. This result could have been due to the great sen-

sitivity of the PCR method for the detection of viruses in

water samples. At the same time, there is a high possibil-

ity that the PCR detected non-infectious viral nucleic

acids (Abbaszadegan, 2001).

od 2 Method 3 Method 4

2/3 2/3

3/3 3/3

1/3 –

1/3 –

2.38 1.63

to the better yield method (Friedman�s test p < 0.04).

418 K. Belguith et al. / Bioresource Technology 97 (2006) 414–419

Acknowledgements

The authors thank the directors and sanitary techni-

cians of the ‘‘Office National de l�Assainissement’’ ofMonastir, Tunisia, for technical assistance and Profes-

sor Hans-W. Ackermann, Department of Microbiology,Faculty of Medicine, Laval University, Quebec, Can-

ada, for helpful discussion and critical review of the

manuscript.

References

Abbaszadegan, M., Huber, M.S., Gerba, C.P., Pepper, L.L., 1993.

Detection of enteroviruses in groundwater with the polymerase

chain reaction. Appl. Environ. Microbiol. 59, 1318–1324.

Abbaszadegan, M., Stewart, P., Le Chevalier, M., 1999. A strategy for

detection of viruses in groundwater by PCR. Appl. Environ.

Microbiol. 65, 444–449.

Abbaszadegan, M., 2001. Advanced detection of viruses and proto-

zoan parasites in water. Rev. Biol. Biotechnol. 1, 21–26.

Ahmed, A.U., Sorenson, D.L., 1995. Kinetics of pathogen destruction

during storage of dewatered biosolids. Water Environ. Res. 67,

143–150.

Albert, M., Schwartzbrod, L., 1991. Recovery of enterovirus from

primary sludge using three elution concentration procedures.

Water. Sci. Technol. 24, 225–228.

Binn, L.N., Lemon, S.M., Marchwicki, R.H., Redfield, R.R., Gates,

N.L., Bancroft, W.H., 1984. Primary isolation and serial passage of

hepatitis A strains in primate cell cultures. J. Clin. Microbiol. 20,

28–33.

Borrego, J.J., Cornax, R., Preston, D.R., Farrah, S.R., McElhaney, B.,

Bitton, G., 1991. Development and application of new positively

charged filters for recovery of bacteriophages from water. Appl.

Environ. Microbiol. 57, 1218–1222.

Boom, R., Sol, C., Salimans, M., Jansen, C., Wertheim-van Dillen, P.,

van der Noorda, J., 1990. Rapid and simple method for purifica-

tion of nucleic acids. J. Clin. Microbiol. 28, 465–503.

Chomczynski, P., Sacchi, N., 1987. Single-step method of RNA

isolation by acid guanidinium thiocyanate–phenol–chloroform

extraction. Anal. Biochem. 162, 156–159.

Craun, G.F., 1984. Health aspects of groundwater pollution. In:

Bitton, G., Gerba, C.P. (Eds.), Groundwater Pollution Microbiol-

ogy. John Wiley & Sons, Inc., New York, pp. 135–179.

Dahling, D.R., Wright, B.A., 1988. A comparison of recovery of virus

from wastewaters by beef extract-celite, ferric chloride, and filter

concentration procedures. J. Virol. Methods 22, 337–346.

Divizia, M., Santi, A.L., Pana, A., 1989. Ultrafiltration: An efficient

second step for hepatitis A virus and poliovirus concentration. J.

Virol. Methods 23, 55–62.

Dubois, E., Le Guyader, F., Haugarreau, L., Kopecka, M., Pomme-

puy, M., 1997. Molecular epidemiological survey of rotaviruses in

sewage by reverse transcriptase seminested PCR and restriction

fragment length polymorphism assay. Appl. Environ. Microbiol.

63, 1794–1800.

Environmental Protection Agency, 1992. Standards for the disposal of

sewage sludge, E.P.A., Washington, DC, Federal Register, part

503, pp. 9387–9404.

Friedman, M., 1937. The use of ranks to avoid the assumption of

normality implicit in the analysis of variance. J. Am. Stat. Assoc.

32, 675–701.

Hierholzer, J.C., Killington, R.A., 1996. Virus isolation and quanti-

fication. In: Mahy, B.W.J., Kangro, H.O. (Eds.), Virology Meth-

ods Manual. Academic Press Ltd., London (Chapter 2).

Hurst, C.J., Dahling, D.R., Safferman, R.S., Goyke, T., 1984.

Comparison of commercial beef extracts and similar materials for

recovering viruses from environmental samples. Can. J. Microbiol.

30, 1253–1263.

Ijzerman, M.M., Dahling, D.R., Fout, G.S., 1997. A method to

remove environmental inhibitors prior to the detection of water-

borne enteric viruses by reverse transcription-polymerase chain

reaction. J. Virol. Methods 63, 145–153.

Joret, J.C., Hassen, A., Bourbigot, M.M., Hartemann, P., Agbalika,

F., Foliguet, J.M., 1986. Virus inactivation during water treatment

by a progressive ozonation unit. Water Res. 20, 871–876.

Katayama, H., Shimasaki, A., Ohgaki, S., 2002. Development of a

virus concentration method and its application to detection of

Enterovirus and Norwalk virus from coastal seawater. Appl.

Environ. Microbiol. 68, 1033–1039.

Lewis, G.D., Metcalf, T.G., 1988. Polyethylene glycol precipitation for

recovery of pathogenic viruses including hepatitis A and human

rotavirus from oyster, water, and sediments. Appl. Environ.

Microbiol. 54, 1983–1988.

Lizuka, N., Kuge, S., Nomoto, A., 1987. Complete nucleotide

sequence of the genome of coxsakievirus B1. Virology 151, 64–73.

Logan, K.B., Rees, G.E., Seely, N.D., Primrose, S.B., 1980. Rapid

concentration of bacteriophages from large volumes of freshwater:

Evaluation of positively charged, microporous filters. J. Virol.

Methods 1, 87–97.

Mignotte, B., Maul, A., Schwartzbrod, L., 1999. Comparative study of

techniques used to recover viruses from residual urban sludge. J.

Virol. Methods 78, 71–80.

Monpoeho, S., Maul, A., Mignotte, B., Schwartzbrod, L., Billaudel,

S., Ferre, V., 2001. Best viral method available for quantification of

enteroviruses in sludge by both cell culture and reverse transcrip-

tion-PCR. Appl. Environ. Microbiol. 67, 2484–2488.

Payment, P., Trudel, M., 1985. Detection and health risk associated

with low virus concentration in drinking water. Water Sci. Technol.

17, 97–103.

Payment, P., Fortin, S., Trudel, M., 1986. Elimination of human

enteric viruses during conventional waste water treatment by

activated sludge. Can. J. Microbiol. 32, 922–925.

Pillai, S.D., Josephson, K.L., Baily, R.L., Gerba, C.P., Pepper, I.L.,

1991. Rapid method for processing soil samples for polymerase

chain reaction amplification of specific gene sequences. Appl.

Environ. Microbiol. 57, 2285–2286.

Queiroz, A.P.S., Santos, F.M., Sassaroli, A., Harsi, T.A., Monezi,

T.A., Mehnert, D.U., 2001. Electropositive filter membrane as an

alternative for the elimination of PCR inhibitors from sewage and

waters samples. Appl. Environ. Microbiol. 67, 4614–4618.

Reed, L.J., Muench, H., 1938. A simple method of estimating fifty

percent endpoints. Am. J. Hyg. 27, 493–497.

Rotbart, H.A., 1990. Diagnosis of enteroviral meningitis with the

polymerase chain reaction. J. Pediatr. 117, 85–89.

Schvoerer, E., Bonnet, F., Dubois, V., Cazaux, G., Serceau, R.,

Fleury, H.J.A., Lafon, M.E., 2000. PCR detection of human

enteric viruses in bathing areas, wastewater, and human stools in

southwestern France. Res. Microbiol. 151, 693–701.

Schwabb, K.J., De Leon, R., Sobsey, M.D., 1993. Development of

PCR methods for enteric virus detection. Water Sci. Technol. 27,

211–218.

Schwabb, K.J., De Leon, R., Sobsey, M.D., 1995. Concentration and

purification of beef extract mock eluates from water samples for the

detection of enteroviruses, hepatitis A and Norwalk virus by

reverse transcription PCR. Appl. Environ. Microbiol. 61, 531–

537.

Schwartzbrod, L., 1995. Virus humains et sante publique: Conse-

quence de l�utilisation des eaux usees et des boues en agriculture etconchyliculture. Organisation Mondiale de la Sante, Geneve, 175.

Sieh, Y.S.H., Wait, P., Tai, L., Sobsey, M.D., 1995. Methods to

remove inhibitors in sewage and others faecal wastes for Entero-

K. Belguith et al. / Bioresource Technology 97 (2006) 414–419 419

virus detection by the polymerase chain reaction. J. Virol. Methods

54, 51–66.

Soares, A.C., Straub, T.M., Pepper, l.L., Gerba, C.P., 1994. Effect of

anaerobic digestion on the occurrence of enteroviruses and Giardia

cysts in sewage sludge. J. Environ. Sci. Health. Part A: Environ.

Sci. Eng. 29, 1887–1897.

Sobsey, M.D., 1982. Quality of currently available methodology for

monitoring viruses in the environment. Environ. Int. 7, 39–51.

Sobsey, M.D., Wallis, C., Henderson, M., Melnick, J.L., 1973.

Concentration of enteroviruses from large volumes of water. Appl.

Environ. Microbiol. 26, 529–534.

Stetler, R.E., Waltrip, S.C., Hurst, C.J., 1992. Virus removal and

recovery in the drinking water treatment train. Water Res. 26, 727–

731.

Traore, O., Arnal, C., Mignotte, B., Maul, A., Laveran, H., Billaudel,

S., Schwartzbrod, L., 1998. Reverse transcriptase PCR detection of

astrovirus, hepatitis A virus, and poliovirus in experimentally

contaminated mussels: Comparison of several extraction and

concentration methods. Appl. Environ. Microbiol. 64, 3118–3122.

Wallis, C., Melnick, J.L., 1967. Concentration of enteroviruses on

membrane filters. J. Virol. 1, 472–477.

Yanko, K., Yoshida, Y., Shinkai, T., Kaneko, M., 1993. A practical

method for the concentration of viruses from water using fibriform

cellulose and organic coagulant. Water Sci. Technol. 27, 295–

298.

Zanetti, S., Deriu, A., Manzara, S., Cattani, P., Mura, A., Mollicoti,

P., Fadda, G., Sechi, L.A., 2003. A molecular method for the

recovery and identification of enteric virus in shellfish. New

Microbiol. 26, 157–162.

Zoll, G.J., Melchers, W.J., Kopecka, H., Jambroes, H., Jambroes, G.,

Van der Poel, H.J., Galama, J.M., 1992. General primer mediated

polymerase chain reaction for detection of enteroviruses: Applica-

tion for diagnostic routine and persistent infections. J. Clin.

Microbiol. 30, 160–165.