Plant Physiology and Biochemistry 45 (2007) 673e690www.elsevier.com/locate/plaphy

Research article

Capturing candidate drought tolerance traits in two native Andean potatoclones by transcription profiling of field grown plants under water stress

Roland Schafleitner*, Raymundo Oscar Gutierrez Rosales, Amelie Gaudin, CarlosAlberto Alvarado Aliaga, Giannina Nomberto Martinez, Luz Rosalina Tincopa Marca,Luis Avila Bolivar, Felipe Mendiburu Delgado, Reinhard Simon, Merideth Bonierbale

Germplasm Enhancement and Crop Improvement Division, International Potato Center, Avenida La Molina 1895, Apartado 1558, La Molina, Lima 12, Peru

Received 27 September 2006; accepted 20 June 2007

Available online 28 June 2007

Abstract

Candidate traits for drought tolerance were targeted by analyzing water stress responses in two moderately drought-tolerant native Andeanpotato clones, SA2563 and Sullu (Solanum tuberosum L. subsp, andigena (Juz, Bukasov) Hawkes) under field conditions. SA2563 exhibitedincreased root growth under drought, while Sullu retained a higher relative leaf water content. Gene expression profiling using the TIGR 10K microarray revealed 1713 significantly differentially expressed genes, 186 of these genes were up-regulated in both clones. In addition to thesecommonly up-regulated genes, each clone induced a specific gene set in response to drought. Gene expression and metabolite analysispinpointed candidate traits for drought tolerance present either in one or both of the clones under investigation. These traits included osmoticadjustment, changes in carbohydrate metabolism, membrane modifications, strengthening of cuticle and cell rescue mechanisms, such as detox-ification of oxygen radicals and protein stabilization. Many of the up-regulated genes have been identified previously in laboratory studies onmodel plants using shock treatments, and the present study confirms the importance of these factors under field conditions.� 2007 Elsevier Masson SAS. All rights reserved.

Keywords: Potato; Drought; Drought tolerance traits; Microarray; Gene expression profiling

1. Introduction

Potato is often considered to be a drought sensitive crop.All developmental stages are susceptible to water stress,from emergence through tuber initiation, bulking, and tubergrowth. Exposure to even short drought periods results in yielddecline, as tuber development depends on carbohydrate supplyfrom the foliage which suffers under drought due to reduction

Abbreviations: ABA, abscisic acid; AD, after drought onset; BCAA,

branched-chain amino acid; fw, fresh weight; LEA, late embryogenesis abun-

dant; n.s, not significant; PP2C, protein phosphatase 2C; RWC, relative leaf

water content; StGI, Solanum tuberosum Gene Index; TC, tentative consensus

sequence.

* Corresponding author. Tel.: þ51 1 349 6017; fax: þ51 1 317 5326.

E-mail address: r.schafleitner@cgiar.org (R. Schafleitner).

0981-9428/$ - see front matter � 2007 Elsevier Masson SAS. All rights reserved

doi:10.1016/j.plaphy.2007.06.003

in photosynthetic rate [18]. In spite of its sensitivity, potatostill produces reasonable yields under conditions that cancause grain crops to fail, particularly if drought coincideswith flowering and seed set.

Agronomic and ecological definitions of drought tolerancediffer considerably. The ecological definition simply requiresthat a plant remains viable and produces at least some seedduring or following periods of water stress. The agronomicdefinition requires sufficient growth to produce an economi-cally significant yield. Traits conferring yield stability underdrought might include an array of morphological, physiologi-cal and biochemical adaptations involving hundreds of genes.Year to year variability of drought occurrence and severity im-poses an additional challenge for selecting drought-tolerantvarieties that maintain maximum productivity under optimalconditions.

.

674 R. Schafleitner et al. / Plant Physiology and Biochemistry 45 (2007) 673e690

Drought tolerance traits increase plant vigor and survivalrate under water-limiting conditions. Morphological charac-ters, such as root architecture or leaf form, biochemical re-sponses, including osmolyte accumulation, detoxification orsynthesis of protective compounds, and physiological adapta-tions leading to increased water use efficiency may all contrib-ute to drought tolerance of crops [22]. Drought adaptation canalso involve gene expression changes. In osmotic stress ex-posed Arabidopsis thaliana (L.) Heynh., a large number ofgenes are differentially expressed, encompassing approxi-mately 12% of the total transcriptome [21]. These differen-tially regulated genes are associated with virtually allcellular functions, reflecting the complexity of the droughtstress response and water stress adaptation. Drought respon-siveness of genes appears to be rather conserved over differentplant species, e.g. between A. thaliana and rice [35], particu-larly those genes associated with cell communication and sig-naling, osmotic adjustment and detoxification, functions thatapparently play key roles in drought adaptation.

In potato, maintenance of a high photosynthetic rate underdrought has been proposed as the most crucial drought toler-ance trait [44]. Drought tolerance has also been associatedwith rooting depth [24], control of growth and carbon transferunder water stress [47], enhanced water use efficiency [19]and osmotic adjustment [15], particularly with proline accu-mulation [29]. Microarray-based analysis of the potato stresstranscriptome using potted potato plants exposed to heat,cold, or salt stress revealed in total 3314 significantly up- ordown-regulated features of the TIGR 10 K potato cDNA mi-croarray in response to at least one stress condition [38].This work showed that transcription factors, signal transduc-tion components and heat shock proteins which have been as-sociated with abiotic stress tolerance in A. thaliana and rice,are also activated in potato. Gene expression changes in potatoupon drought were targeted in a recent greenhouse study ofthree different Solanum tuberosum subsp. andigena accessionsexhibiting adaptive, acclimatory or both phenotypes. Using thesame 10 K microarray as Rensink et al. [38], Watkinson et al.[53] identified 2000 features that showed drought-related var-iation of expression, with adapted accessions exhibitinggreater gene expression changes, and constitutively higherlevels of expression of stress-related genes, than the accli-mated ones. Genes involved in adaptive responses comprisedmetallothioneins, flavonoid-, terpenoid and other anti-oxidantbiosynthesis genes, cytochrome P450, and specific classes oftranscription factors.

The present study focused on gene expression changes inpotato during drought under field conditions. Emphasis wasgiven to drought responses of native Andean potato (S. tuber-osum subsp. andigena), because of the extraordinary biodiver-sity present in this potato species and because many of thesegenotypes are known to yield reliably under a range of stressconditions including repeated cycles of drought. Unlike wildrelatives that are often used as sources of resistance or toler-ance genes, native Andean potatoes are cultivated crops, andtherefore excellent sources of genes conferring adaptation to wa-ter limiting conditions. Through a combination of agronomical

and genomic analysis we targeted differences and similaritiesbetween the drought responses of two native Andean potatovarieties to identify candidate traits for drought tolerance ofpotato.

2. Materials and methods

2.1. Plant material, culture condition

Two field plots (5 � 25 m), located at the CIP field stationLa Victoria in Huancayo (Peru) at 3200 m above sea level,were prepared with humic soil (pH 4) and equipped withnets and roofs made of transparent plastic. Plastic foil barriersprevented uncontrolled water inflow from the sides as well asfrom below, resulting in a soil depth of 50 cm.

Soil water potentials between 0 and �0.2 MPa were deter-mined tensiometrically (Watermark). In parallel and belowthis soil water potential, soil water content was determinedgraviometrically in soil profiles down to 50 cm depth.

Sprouted seed potatoes of the clones Sullu and SA2563were sown on October 5, 2004 in blocks of five plants eachin a randomized complete block design with seven replica-tions. The blocks cultivated with SA2563 and Sullu were sep-arated by blocks planted with the potato varieties Cceccoraniand Puca Pishgush (Solanum stenotonum (Juz. and Bukasov)subsp. goniocalyx) and Perricholi (S. tuberosum L subsp.tuberosum � S. tuberosum subsp. andigena). Distances be-tween rows were 1 m and spaces in a row were 30 cm.

The plots were fertilized with 100e160e120 kg/ha nitro-gen-phosphate-potassium before planting and with 100 kg/hanitrogen 30 days after planting. Fungicide and insecticidesprays (Mancoceb, Propineb, Dimetofor, Cymoxanil, Permetrinand Cypermetrin) were applied in weeks 10, 12, 14, 15, 17 and18 after planting according to suppliers’ recommendations.

In the drought plot, irrigation was stopped during tuberiza-tion of the clones SA2563 and Sullu, on day 91 after planting(January 4, 2005) and plants were exposed to drought for42 days, until February 15, 2005. The control plot was irri-gated throughout the growing period and the soil water poten-tial was kept between 0 and �0.02 MPa.

2.2. Relative water content

Relative water content (RWC) was tested 24, 30 and42 days after drought onset (AD) according to [47] using the3rd and 5th leaf of three replicate plants of each block.

2.3. Yield analysis

Biomass distribution was determined on the three centralplants of three blocks of each clone 133 days after planting,on February 15, 2005. Fresh weight of the plant materialwas determined immediately after harvest and dry mass wasmeasured after oven drying at 60 �C for 3 days. Tuber yieldwas determined after the final harvest, 165 days after planting,on March 19, 2005.

675R. Schafleitner et al. / Plant Physiology and Biochemistry 45 (2007) 673e690

2.4. Sampling for gene expression and metaboliteanalysis

Two biological repeats of drought-exposed and controlplants of clone SA2563 and Sullu were sampled for molecularbiological analysis when plants showed the first symptoms ofwater stress, such as slight wilting of leaves during midday, onJanuary 27 (114 days after planting and 23 days after droughtonset) and 19 days later, on a time point, when plants showedheavy wilting at midday, on February 15, 2005 (day 133 afterplanting and 42 after drought onset). Each biological repeatconsisted of pools of leaves 3, 4, and 5, from the 3 centralplants of a block. The material was shock-frozen in liquid ni-trogen and stored at �80 �C until analysis. Sampling was donesimultaneously in the drought and control field, always at thesame time of day (10:00 h) to avoid circadian variation.Leaves were ground in liquid nitrogen and total RNA was pre-pared using Trizol (Invitrogen) according to the suppliers’ rec-ommendations. DNA was eliminated by DNase treatment(DNA free kit, Ambion). RNA was quantified by UV spectros-copy, precipitated, re-suspended in DEPC-treated water toa concentration of 2 mg/ml and stored at �80 �C.

2.5. Microarray hybridization and analysis

The 10 K potato cDNA microarray was produced and val-idated by The Institute for Genomics Research (TIGR) as de-scribed in [38]. The chip contained 15,264 cDNA clones,spotted twice each. The cDNAs were annotated using theTIGR Solanum tuberosum Gene Index (StGI). 120 mg DNA-free total RNA per sample was precipitated, lyophilized, sentto TIGR and submitted to Cy3 and Cy5 labeling and hybrid-ization essentially as outlined in http://www.tigr.org/tdb/potato/microarray_SOPs.html. Slides were scanned witha GenePix Array Scanner at 532 and 635 nm for the two fluorsand two separate 16-bit TIFF format gray scale image fileswere generated for each channel by TIGR. Composite overlaysof both channels were generated and analyzed with GenePixPro 5.1. The background-subtracted intensities of the validatedspots were normalized and the resultant spot intensities at635 nm (Cy5, control samples) and 532 nm (Cy3, droughtstressed samples) of two technical and two biological repeats

were submitted to two-class unpaired significance analysis ac-cording to [49] using the SAM software of the TIGR MultiEx-periment Viewer, comparing drought and control plants at 23and 43 days AD for each cultivar. The delta values were cho-sen in a way that the median false discovery rate was 0. Anarbitrary threshold of 2-fold induction or repression was setas minimum for assuming significant expression changes.Chip features with significantly different spot intensitieswere attributed to their corresponding TC, and TCs were asso-ciated, when possible, to genes using the TIGR StGI. In caseswhere more than one probe was present on the chip for oneTC, a mean of the ratios of each feature was calculated. Incases where the probes were complementary to several differ-ent TCs, all these TCs were listed in the results. No statisticaltest was used to compare expression profiles across dates orcultivars.

2.6. Real-time PCR

cDNA was synthesized from 3 mg total RNA with super-script III reverse transcriptase (Invotrogen) using 200 ng ran-dom hexamer primers and 50 min synthesis time at 50 �C.PCR primers were designed based on tentative consensus se-quences of TIGR StGI (Table 1) using the Vector NTI� soft-ware (Informax, Invitrogen). Real-time PCR was performedwith 50 ng cDNA using DyNAmo SYBR-Green qPCR Kit(Finnzymes) in 10 ml reaction volumes on a Chromo 4 Four-Color Real-Time System (MJ-research), with 0.25 mM primerend concentration and the following cycling steps: initial dena-turation for 2 min at 94 �C, followed by 40 cycles with 15 s at94 �C, 20 s at 55 �C and 20 s at 72 �C, and 10 min terminalelongation at 72 �C. Relative quantification of transcript abun-dance in treated and control plants was done according to [34]using the potato cytochrome b oxidase gene (TIGR SyGITC116542) as internal standard to correct for differentamounts of RNA input for cDNA synthesis [54]. At least threetechnical repeats per biological repeat were analyzed. Stan-dard curves for real-time PCR amplification for all primershave been established using 10-fold dilutions of purifiedPCR fragments in concentrations between 10 pg to 0.1 fg.The curves obtained allowed the determination of PCR effi-ciency according to [34].

Table 1

Primers for real-time PCR expression analysis

Gene name TIGR TC Primer forward Primer reverse Amplicon size (bp)

LEA5 112718 CATCACAAGGTGGTGTTTCT ATTGCTTCTAACAGCCCCA 43

AtHB-7 113966 TATGATCACTGGTGGGATTTCTGGTC AGTGAAAACAAAGGATGCCCAGC 150

Neutral invertase 124949 TTGGTCACTGATGGGTCCTG GAGTCGTTGATGGTGAGCAT 124

CAAT-Box binding factor 127517 TTCTGACTCAATGACACGCCAAAG GTAACACCTTGCTTGGCTTTGTAATC 109

PP2C 119843 GTCCCAATTCCTCTGTCCA TCACCGATTGCTCGAGACA 139

D1-pyrrolidine carboxylate

synthase

128842 CGATCCACAATCAGAGCTAATTC GCAGTCATACCACCTCTTTCCA 102

Proline dehydrogenase 127497 TTCGATAGGCAACTCATGAGGA TCGGTGATGTTTCCTCGTTTATTA 125

Cytochrome b oxidase 116542 CGTCGCATTCCAGATTATCCA CAACTACGGATATATAAGAGCCAAAACTG 79

The cytochrome b oxidase gene (TC 116542) was used for normalization according to Weller et al. [54].

676 R. Schafleitner et al. / Plant Physiology and Biochemistry 45 (2007) 673e690

2.7. Metabolite analysis

One hundred milligrams (fw) of frozen leaf tissue wasground in liquid nitrogen and mixed with 1 ml of 80% ethanolfor 30 min at 4 �C and centrifuged at 13,000 � g, at 4 �C for10 min. The supernatant was collected and the residues wereextracted again with 0.5 ml 80% ethanol. The pooled superna-tants were evaporated at reduced pressure and the dried extractwas re-suspended in 1 ml milli-Q water and filtered througha 0.45-mm polyvinylidenedifluoride filter prior to analysis us-ing high performance anion exchange chromatography cou-pled with pulsed amperometric detection according to [55].Quantification of proline in leaves was done according to [4]using frozen leaf material.

3. Results

3.1. Soil and leaf water content during drought treatment

Drought stress was applied by withholding water for42 days, beginning at 91 days after planting. Soil water poten-tial in the drought plot decreased to �0.2 MPa on day 10 AD,which corresponded to a soil water content of 31%. The soilwater content in the drought plot decreased further to 23%on day 23 AD and remained on average around 21% duringthe rest of the drought treatment. In the irrigated field, soilwater content was maintained at 45% (0 to �0.02 MPa soilwater potential) for the duration of the experiment. RWC inleaves decreased during the drought treatment in a clone spe-cific manner from 96% to 98% in well irrigated plants down to67% in SA2563 and 72% in Sullu on day 42 AD.

3.2. Yield and biomass production of native Andeanpotato under drought

SA2563 and Sullu had similar phenology and tuberizingtime points. Both clones revealed drought tolerance, whencompared with other native Andean potato landraces and cul-tivars. Under the drought conditions applied, the yield loss ofthe two tolerant clones ranged between 26.3% and 28.1% onfw basis, while the sensitive clones Puca Pishgush, Cceccoraniand Perricholi planted in the same field plots had a yield dropof 55.7% to 74.1%. Tuber yield differences between droughtand irrigated fields were significant for the clones Puca Pish-gush, Cceccorani and Perricholi ( p ¼ 0.05, 0.019, 0.016

respectively) and insignificant for Sullu and SA2563( p ¼ 0.51 and 0.53 respectively), underlining the drought tol-erance of these two clones (Table 2). Under drought stress,Sullu retained a high harvest index and allocated more re-sources to tubers, while SA2563 produced a high amount oftotal biomass (Table 2). Interestingly, root growth was stimu-lated in SA2563 under drought with a root biomass increasefrom a mean of 67.1 g (fw) under irrigated conditions to103.3 g (fw) under drought ( p ¼ 0.02).

3.3. Microarray gene expression analysis

Transcriptome changes upon drought were monitored bymicroarray hybridization in field grown potato plants of theclones SA2563 and Sullu. The reproducibility between thechip hybridizations was high: Pearson’s correlation coefficientR2 between dye swap hybridizations was 0.97, amounted to0.91 between normalized spot intensities of the two technicalreplicates of 8 hybridizations, and was from 0.71 to 0.95 be-tween the biological repetitions, with a mean of 0.8. Signifi-cance analysis of the log2 normalized data and introductionof a two-fold induction/repression cut-off rate resulted ina list of increased or decreased probes for each pair wisecomparison between drought-exposed and control plants.Each significantly expressed feature was attributed to the cor-responding tentative consensus sequence(s) (TC) of the TIGRStGI resulting in a list of differentially expressed TCs andgenes. Basing the analysis on TCs, and herewith on putativegenes, in contrast to probes, permitted us to estimate the num-ber of genes participating in the drought response and also en-abled us in specific cases to discriminate between differentmembers of the same gene family participating in water stressresponses.

To support our gene expression profiling data, real-timePCR was carried out on 7 selected transcripts. The transcriptswere chosen to cover the whole range of chip hybridizationsignal intensities from low (below 10,000), medium(10,000e30,000) and high (above 30,000), and representedexpression ratios between drought-exposed and control plantsfrom 1 (not induced) to 22.9-fold up-regulated. The expressionpatterns were found consistent between both methodologies.Genes appeared either induced or not induced, regardlesswhether expression analysis was done with real-time PCR ormicroarray (Table 3). However, quantitative differences be-tween microarray and real-time PCR data suggested that the

Table 2

Biomass distribution in g/ plant in SA2563, Sullu, Perricholi, Puca Pishgush and Cceccorani in drought-exposed (D) and control (C) plants

Leaves Shoots Roots Tubers Total biomass Harvest index Tuber yield loss

under drought (%)D C D C D C D C D C D C

SA-2563 556.5 662.8 1613.0 1643.7 103.3* 67.1* 765.5 1038.7 3038.3 3412.3 0.25 0.30 26.3

Sullu 207.8 433.0 928.1 1183.8 41.9 37.0 747.7 1039.4 1925.4 2693.1 0.39 0.39 28.1

Perricholi 295.8 953.7 1052.0 2436.2 81.6 87.3 1078.8* 2436.0* 2508.1* 5913.2* 0.43 0.41 55.7

Puca Pishgush 224.7 548.8 476.9 1048.0 108.9 111.2 370.8* 938.7* 1181.3 2646.8 0.31 0.35 60.5

Cceccorani 195.6 215.7 579.2 725.8 41.7 43.0 101.3* 391.8* 917.8 1376.3 0.11 0.28 74.1

*Significant ( p < 0.05) differences between water-stressed and control plants according to t-test.

677R. Schafleitner et al. / Plant Physiology and Biochemistry 45 (2007) 673e690

Table 3

Verification of microarray (MA) expression data by real-time PCR

StGI annotation SA2563 Sullu

day 23 day 42 day 23 day 42

MA PCR MA PCR MA PCR MA PCR

LEA5 TC112718 2.8 2.4 5.8 2.3 7.7 4.6 1 1

AtHB-7 TC113966 9.5 4.6 22.9 4.1 1 1 9.5 11.2

Neutral Invertase TC124949 5.5 4.7 5.8 12.2 1 1 2.9 3.3

CAAT-box binding factor TC27517 1 1 1 1 1 1 1 1

Protein phosphatase 2C TC119843 8 6.9 11.8 14.7 1 1 10.3 10.2

D1-pyrrolidine-5-carboxylate synthase TC128842 9.9 14.3 11.6 21.1 1 1 5.9 3.4

Proline dehydrogenase TC127497 2 5.4 1 1 5.5 4.5 1 1

The values given represent n-fold induction under drought compared to control plants. All tested genes showed the same expression trend with both methodologies,

however the measurements with both methods showed quantitative differences.

microarray expression ratios should not be interpreted as exactnumbers for fold-induction of a gene, but the microarray datawere shown to be sufficiently consistent to reveal generalchanges in gene expression patterns.

3.4. Drought transcriptome of native Andean potato

Comparison of expression patterns between drought-exposed and control plants revealed in total 1713 significantlydifferentially regulated genes in the two potato clones. 904 ofthese genes were elevated and 710 were down-regulated atleast at one time point (23 or 42 days AD) in at least one cloneunder drought. A further 99 genes were either down- or up-regulated, dependent on the harvest time point and clone underinvestigation. Comprehensive lists of all differentially regu-lated genes and their expression patterns are available athttp://research.cip.cgiar.org/confluence/display/FGenomics/Home. In SA2563 alone, 562 genes were up- and 656 genesdown-regulated. In Sullu, a similar number of induced geneswas found (594); however, down-regulation in this clonewas less frequent, since only 194 genes appeared repressedunder drought. Additionally, 44 genes were either up- ordown-regulated in Sullu, depending on the harvest timepoint. Only a subset comprising 186 drought response geneswere up-regulated in both clones under water stress and 77were commonly repressed, as illustrated in Fig. 1. This dem-onstrates that the drought response of these moderatelydrought-tolerant potato landraces consists of both, a shared

response to drought, and of a clone-dependent responsecomponent.

Common regulation in both clones concerned mainly tran-scription factors, but also genes involved in cell communica-tion and signaling, cell rescue, transport, carbohydrate,amino acid, and secondary metabolism. Approximately a thirdof the genes participating in the shared response were inducedor repressed at the same time points in both clones, whilea larger number of genes showed clone-specific timing ofup- or down-regulation. Interestingly, most of the genes thatwere induced in SA2563 at both time points, were up-regu-lated in Sullu either on day 23 or 42 AD only, while mostof the genes that were induced either early or late underdrought in SA2563 showed the same induction patterns inSullu. Shared repressed functions concerned the same cate-gories as the up-regulated genes; however, the number of thedown-regulated genes was much smaller for each functionalcategory.

In a similar manner as the up-regulated genes, joint down-regulated functions also showed differences in timing betweenthe clones, with a general trend of earlier and longer lastingreaction in SA2563 than in Sullu. Taking into account thatmost down-regulated genes participate in assimilation andgrowth-related functions, this expression pattern suggeststhat drought affects these functions in SA2563 more stronglythan in Sullu.

Clone-dependent drought responses included 358 genesthat were exclusively up-regulated in SA2563 and 360 genes

induced

Up- and down-regulated(clone-and time point dependent)

Induced inSA2563 only

Induced in SA2563and Sullu

Repressed in SA2563 only

Repressed in Sullu only

Repressed in SA2563 andSullu

Induced inSullu only

repressed

Fig. 1. Induced and repressed genes in SA2563 and Sullu. From a total of 1713 differentially regulated genes, 904 were induced, 710 were repressed and 99 were

either up- or down-regulated, dependent of the clone and of the sampling time point. Up- and down-regulated genes either contributed to the shared response (criss-

cross hatch area, 186 up-regulated and 77 down-regulated genes) or were regulated in a clone-dependent manner (vertical and horizontal hatched areas).

678 R. Schafleitner et al. / Plant Physiology and Biochemistry 45 (2007) 673e690

in Sullu covering all functional categories (Fig. 1 http://research.cip.cgiar.org/confluence/display/FGenomics/Home).SA2563 induced more genes involved in chromatin remodel-ing, transcription control, protein synthesis, cell communicationand signal transduction, protein destination and turn-over,amino acid metabolism and heat shock response than Sullu,while the latter clone up-regulated a greater number of genesinvolved with calcium binding, cell wall, cytoskeleton, phe-nylpropanoid and flavonoid metabolism, cell rescue, photosyn-thesis, as well as carbohydrate metabolism genes and genes ofunknown function.

Clone-dependent repression of gene expression underdrought was more widespread in SA2563 than in Sullu: 516 ad-ditional genes were repressed in SA2563 but only 117 in Sullu(http://research.cip.cgiar.org/confluence/display/FGenomics/Home). More genes involved with energy, cell elongation,photosynthesis, cell wall- and membrane modification, re-sponse to abiotic stress and metabolism were down-regulatedin SA2563 than in Sullu. Again, in Sullu, most of the down-regulated genes were either repressed transiently early underdrought or repressed at a later time point than in SA2563,while gene repression at both harvest time points was mostfrequently observed in SA2563.

Ninety-nine genes were either up- or down-regulated, de-pendent on the sampling time point, on day 23 or 42 AD, oron the clone under investigation (Supplemental Table 3 athttp://research.cip.cgiar.org/confluence/display/FGenomics/Home). Sixty-three of these genes comprising functionssuch as growth, lipid-, amino acid- and secondary metabo-lism, transcription, transport and protein destination andturn-over were down-regulated in SA2563 and up-regulatedin Sullu, which indicates another time that in SA2563 morefunctions were repressed under drought stress than in Sullu.

3.5. Functions of differentially regulated genes underdrought in native potato

Transcription control was strongly altered by drought.Chromatin remodeling genes were essentially down-regulatedin SA2563 but remained unchanged in Sullu. Nevertheless theup-regulation of a stress-inducible histone H1 in SA2563 andof a histone H2B2 in Sullu suggested that chromatin remodel-ing takes place in potato drought tolerance under the field con-ditions. A set of 26 transcription factors was up-regulated incommon in both clones upon drought, and a further 37 tran-scription factor genes were induced in a clone-dependentway. Different transcription factor gene family members ofNAC (NAM), HD-ZIP I, ERF/APS (DREB), MYB, WRKY,WIZZ and CCR4 were activated in SA2563 and Sullu. Addi-tionally, VAHOX or RAU gene family members were up-regulated either in SA2563 or Sullu. Differences in transcrip-tion factor expression between clones point to candidates forregulation of clonal differences of down stream gene expres-sion under drought.

Under drought, in both clones, protein synthesis-relatedgenes were repressed rather than induced; only a RNA heli-case, a translation initiation factor-like protein gene and

a gene similar to a 60S ribosomal protein L18 were commonlyinduced in both clones. In SA2563, a greater number of trans-lation-related genes were differentially regulated underdrought than in Sullu, along with various up-regulated RNAprocessing, ribosomal protein and translation initiation factorgenes. This suggests that changes in translation including ex-change or replacement of translation factors take place underdrought in this clone. Nevertheless, only a few genes of thiscategory were significantly induced, indicating that transcrip-tional changes of translation-related genes does not representa major component of the drought response in potato underfield conditions.

Expression of a large set of signaling and cell communica-tion-related genes, including Ca2þ-binding- and GTP-bindingfactors, kinases and protein phosphatases was altered underdrought. Common up-regulation in both clones was observedwith kinase genes, including osmotic stress responsive kinase(TC 121412) and protein phosphatase genes, such as ABI2(TC119910). Other kinase and phosphatase encoding tran-scripts were induced in a clone-dependent manner, witha higher number of induced genes in SA2563 than in Sullu,while more Ca2þ-binding factor genes increased in Sulluthan in SA2563.

Drought influenced ethylene and gibberellin metabolismgene expression in different ways in both clones. Ethylene bio-synthesis genes were more strongly up-regulated in SA2563with several induced isoforms of 1-aminopropane-1-carboxyl-ate synthase, in contrast to Sullu, where only one gene encod-ing this function was up-regulated. Gibberellin biosynthesisenzyme genes, such as two ent-kaurene oxidases, were in-duced in SA2563, while an ent-kaurenic acid oxidase wasrepressed, suggesting a change in gibberellin isoform compo-sition in this clone. In Sullu, a gibberellin 2-oxidase gene act-ing in gibberellin degradation was strongly induced on day 23AD, which might lead in a decrease of gibberellin content inthat clone.

Photosynthesis-related genes were predominantly down-regulated in SA2563. Repression concerned transcripts encod-ing chlorophyll binding proteins or photosystem components.In contrast, photorespiration-related genes, such as glutamate/malate translocator and alanine aminotransferase genes puta-tively facilitating ammonia re-assimilation generated by thephotorespiratory cycle were activated. In Sullu, most photo-synthesis and photorespiration related genes remained un-changed, while mitochondrial alternative oxidase pathwaygenes were activated stronger in Sullu than in SA2563.

Protein destination was a further function affected bydrought. Protein O-glycosylation genes and a nuclear localiza-tion signal binding protein were up-regulated under drought inboth clones. Furthermore, several protein degrading enzymegenes appeared induced upon drought. Their up-regulationwas mainly clone-dependent, with more induced proteinasegenes in SA2563 than in Sullu.

Metabolism-related genes strongly responded to droughtstress and their expression was highly clone dependent. In car-bohydrate metabolism, one aspect of gene expression changesunder drought concerned up-regulation of starch and sugar

679R. Schafleitner et al. / Plant Physiology and Biochemistry 45 (2007) 673e690

degradation enzyme genes, such as b-amylase and neutral in-vertase, with a stronger and earlier induction of these genes inSA2563 than in Sullu. In SA2563, a pullulanase gene involvedwith starch degradation was induced in coordination with twosucrose synthase genes. In Sullu, the simultaneous up-regula-tion of two starch synthase and two a-glucan phosphorylasegenes indicated increased starch turn over under drought.Citrate cycle, glycolysis and pentose phosphate cycle anda set of glycosyltransferase genes were down-regulated inSA2563 but remained unchanged in Sullu. Strong inductionof UDP-glucose-4-isomerase transcripts in both clones pin-pointed to an important role of these genes under drought.

Amino acid biosynthesis and turn-over gene expressionchanges were more distinct in SA2563 than in Sullu. Up-reg-ulation was particularly strong for genes involved with prolinemetabolism and branched chain amino acid catabolism. Gly-cine, serine and threonine, as well as aromatic amino acid bio-synthesis genes were repressed, mainly in SA2563. Changes inlipid metabolism transcript levels in potato under drought werehighly clone dependent, with more down-regulated genes inSA2563 than in Sullu. Commonly induced lipid metabolismgenes comprised a long chain fatty acid elongase and a waxsynthesis gene. Non-specific lipid-transfer protein transcriptsalso increased under drought in both clones, more in Sulluthan in SA2563. Patatin genes were induced in Sullu23 days AD, but appeared strongly repressed 42 days AD rel-ative to control plants. Sterol-metabolism genes were mainlydown-regulated in SA2563, but remained unchanged or wereslightly induced in Sullu.

Transcription of secondary metabolism genes was more re-pressed than induced by drought. Induction was observed withphenyl-propanoid metabolism genes fuelling flavanoid and an-thocyanine biosynthesis pathways in Sullu on day 23 AD, im-plicating coordinated up-regulation of phenylalanine lyase,chalcone synthase, flavanoid monooxygenase, flavone 3b-hydroxylase, two chalcone-flavone isomerases and dihydrofla-vonol 4-reductase. However, no up-regulation of these geneswas observed in SA2563. In contrast, chalcone synthase andflavanoid monooxygenase were repressed in this clone, butboth clones induced cinnamoyl-CoA reductase and N-hydrox-ycinnamoyl-CoA:tyramine N-hydroxycinnamoyl transferaseTHT7e8 that are involved with cell wall strengthening.

Transport proteins up-regulated under drought included ion,nitrate, protein, sugar and water transporters. Transcriptionalactivation of these genes was largely clone specific, withonly a few commonly induced genes. Pectin methyl esterasesand pectate lyases involved in remodeling cell walls duringcell elongation were strongly repressed in both clones. Cellu-lose synthase genes were repressed, and in SA2563 extensins,expansins and xyloglucan glucosylases and transferases weredown-regulated, pinpointing reduced cell elongation underdrought.

An array of genes involved with cell rescue, pathogen re-sponse, abiotic stress response and senescence were differen-tially expressed in drought-challenged potato, partly in bothclones, partly in a clone specific manner. Interestingly, thedrought-responsive enzyme set associated with active oxygen

radical detoxification differed largely between SA2563 andSullu. Early under drought stress, SA2563 induced glutathioneS-transferase, ascorbate peroxidase, ascorbate oxidase and fer-ritin genes, while in Sullu other active oxygen detoxificationgenes, such as phospholipid hydroperoxide glutathione perox-idase and superoxide dismutase transcripts were augmentedonly later under drought stress. Additionally, thioredoxingenes and a glutaredoxin family protein were up-regulatedin Sullu. This differential induction of key genes of oxidativestress response suggests significant variation in drought re-sponses present in the two clones. The only commonly in-duced gene involved with active oxygen detoxification wasan aldehyde dehydrogenase of the antiquitin ALDH7 genefamily. A set of differentially expressed transcripts corre-sponded to sequences previously identified as water-stress in-duced genes, such as LEA and dehydrin genes. Sullu induceda greater variety of LEA genes to a higher extent on day 23,but induction of this gene group lasted longer in SA2563.More different heat shock protein genes were expressed inSA2563 than in Sullu. The reverse was observed for metallo-thioneins with more induced isoforms in Sullu than inSA2563. Different DnaJ-like chaperones genes were up-regu-lated in both clones, with more induced isoforms in Sullu thanin SA2563. Additionally, several pathogen defense genes werefound differentially regulated under drought in potato, inSA2563 to a lesser extent than in Sullu, as well as the putativestress response genes Ci21A and Ci21B, which have been re-ported to be expressed under cold stress in potato tubers [41].

The drought response comprised a large number of geneswith unknown function. Sixty-four of the commonly inducedgenes belonged to this category, comprising 34% of the genesof the shared response. Two genes of this category, one similarto AT3g29575, and further a putative RING zinc finger likeprotein (TC122137 and TC128001), were induced in bothclones at all time points, pointing to their important functionin the drought response.

3.6. Changes in sugar, sugar alcohol and prolineconcentrations under drought

Expression changes of genes involved in carbohydrate andproline metabolism guided us to measure sugars and prolineconcentrations in leaf tissue of drought exposed and controlplants. For this analysis, we used the same batches of leaf tis-sues that were also submitted to molecular analysis. Controlplants of both clones contained similar sugar and proline con-centrations, except glucose, fructose, inositol and trehaloselevels were higher in SA2563 than in Sullu control plants.As shown in Table 4, drought had a stronger effect on sugarand sugar alcohol accumulation in leaves of Sullu than inSA2563. All sugars except sucrose, reached highest levels indrought stressed Sullu. In SA2563 drought only caused a sig-nificant increase in melibiose and pinitol concentrations; how-ever, all measured sugars, except sucrose, trehalose, mannitoland raffinose, were found to be augmented in Sullu, at leastunder extreme drought. In contrast, under severe drought,most sugar concentrations except fructose, melobiose and

680 R. Schafleitner et al. / Plant Physiology and Biochemistry 45 (2007) 673e690

Table 4

Sugar, sugar alcohol and proline concentrations in nM/g fw in leaves of drought exposed and control plants of SA2563 and Sullu

SA2563 Sullu

d 23 d 42 d 23 d 42

D SD (�) C SD (�) D SD (�) C SD (�) D SD (�) C SD (�) D SD (�) C SD (�)

Arabinose 28.1 0.04 48.7 22.15 36.5 3.6 54.3 36.2 37.5 2.6 55.8 6.0 134.3** 1.1 20.8 4.1

Galactose 254.0 203.8 481.6 6.68 505.3 76.2 399.7 206.7 185.8 3.4 318.7 3.9 2316.6* 615.4 153.0 24.3

Glucose 8023.3 7969.8 7987.7 3132.8 14853.9 2143.6 11606.0 91.8 6542.9 325.1 5164.8 669.0 14410.3* 1567.8 5882.7 1058.2Sucrose 12384.1 1283.6 13169.6 1341.6 11532.6 2405.4 15291.4 945.0 12740.3 127.1 11248.4 3659.3 11297.1 386.1 13999.6 2214.5

Xylose 39.1 12.8 66.5 31.26 128.4 28.6 68.4 47.2 17.9 0.6 123.9 81.9 143.4** 60.4 16.4 19.9

Fructose 11166.7 1389.0 8647.1 7807.6 15717.0 6703.8 14788.8 314.6 7018.9 682.7 4804.8 730.7 21017.5** 1316.8 4035.1 1144.3

Melibiose 92.4 57.5 29.7 29.39 104.1** 15.6 12.3 2.47 10.4 0.9 14.9 4.6 244.8* 74.7 34.5 3.3Raffinose 420.5 127.33 526.5 42.76 260.3 93.2 400.4 23.6 337.8 46.9 291.7 122.8 n.d. 224.3 185.5

Pinitol 47.1 9.3 95.8 46.1 604.6* 193.4 91.6 7.5 63.6 12.2 95.9 14.3 711.6* 250.4 105.9 21.5

Inositol 2503.6 250.0 2785.8 224.63 1723.8 789.6 4333.0 3134.9 2065.4 288.2 864.7 222.8 1478.6* 343.2 719.7 47.8Trehalose 114.2 23.6 106.5 17.62 84.9 27.2 80.8 4.5 66.8 10.9 53.7 41.5 58.3 10.9 68.0 13.1

Mannitol 19.2 4.2 25.1 11.4 16.4 2.5 27.1 0.2 14.6 2.2 13.3 3.0 12.9 3.2 12.6 0.9

Proline 531.8 31.8 892.3 53.1 804.7* 46.0 300.0 19.4 417.9 23.7 612.6 31.7 2083.5** 45.6 558.6 15.1

D, drought-exposed; C, control plants; SD, standard deviation between repeats.

Concentration difference between drought-exposed and control plants: *significant at the p < 0.05 level, **significant at p < 0.01 level according to t-test.

pinitol decreased in SA2563; however, all of these differenceswere insignificant.

In both clones, on day 23 AD, proline concentrations werehigher in controls than in drought-exposed plants. Only on day42 AD proline increased in water-stressed plants, stronger inSullu (3.4-fold compared to control plants) than in SA2563(2.7-fold, Table 4).

The metabolite data show clearly that solute accumulationtakes place at a greater extent in Sullu than in SA2563, but thelatter clone had higher constitutive sugar levels in its leaves.

4. Discussion

Two drought-tolerant native Andean potato clones, SA2563and Sullu, were exposed to water stress under field conditions.The recorded drought stress responses identified putative can-didate traits of drought tolerance present either in one or bothof the clones under investigation.

Water stress causes closure of stomata, which limits CO2

availability for the dark reaction of photosynthesis and conse-quently favors photorespiration. Decreased photosynthetic ac-tivity is accompanied by lower transcript abundance ofphotosynthesis-related genes [39]. The activation of photores-piration-associated genes, such as plastidic glutamate/malatetranslocator and alanine aminotransferase [37], as well as thegreater down-regulation of genes involved with photosynthe-sis, glycolysis and citrate cycle in SA2563 suggest a strongerimpact of drought on photosynthesis in this clone than inSullu.

4.1. Candidate traits for drought tolerance of SA2563and Sullu

4.1.1. Increased root growth under drought in SA2563Root mass increased in SA2563 under drought. Larger and

deeper roots provide better access to remaining soil water and

have been shown to contribute to drought tolerance in manycrops. In potato, tuber yield was significantly correlated withroot dry mass [24]. The current genomics investigation didnot target root gene expression, so no genes involved withinduced root growth were detected.

4.1.2. Reduced canopy size and higher maintenanceof RWC in leaves in Sullu

In Sullu, leaf mass per plant was reduced under drought andrelative leave water content was maintained at a higher levelthan in SA2563. Several genetic traits which might contributeto canopy reduction and lower decrease of RWC are discussedbelow.

4.1.3. Regulative networks involved with drought responsesin SA2563 and Sullu

Expression of candidate drought tolerance traits are basedon activation of regulatory networks, consisting of transcrip-tion factors and regulatory enzymes such as kinases and phos-phatases that orchestrate responses involving a multitude offunctions including metabolic changes and synthesis of cellprotective compounds (Table 5). Drought induced the expres-sion of a number of transcription factors in both clones. Manyof these genes previously have been identified as key regula-tors of drought responses in model plants. Our results confirmthat these genes also play a role in drought responses of An-dean potato under field conditions. Transcription factor genesthat function either in abscisic acid (ABA)-dependent path-ways, such as ATHB-7 and RD26 [13,46] as well as inABA-independent pathways, such as DREB family transcrip-tion factors [25] were up-regulated in Andean potato underdrought. Several of the drought-inducible transcription factorsof potato previously have been shown to respond to increasedH2O2 levels [51], suggesting a link between oxidative stressand drought-related gene expression changes [32]. Also, mem-bers of the WRKY transcription factor family, including

681R. Schafleitner et al. / Plant Physiology and Biochemistry 45 (2007) 673e690

Table 5

Genes of the regulative network induced by drought in SA2563 and Sullu

Probe Gene name StGI Function SA2563 Sullu

d 23 d 42 d 23 d 42

STMJL16 AG-motif binding protein-1 TC118192 Transcription factor n.s. n.s. 3.0 2.5

STMEU37 CaCBF1B (DREB-like) TC116037 7.6 n.s. 6.8 n.s.

STMHE73 DREB-like protein TC131101 n.s. n.s. 2.4 n.s.

STMDF42 Dehydration-responsive element binding protein 3 TC111818 2.3 n.s. n.s. n.s.

STMCY54 Dehydration-responsive element binding protein 4 TC111845 2.7 n.s. n.s. n.s.

STMCY81

STMIW74

STMDD59 CCR4-associated factor 1-like protein TC126255 n.s. n.s. 2.0 n.s.

STMIN13 CCR4-associated factor 1-like protein TC116734 n.s. n.s. 2.8 n.s.

STMCC74 Putative CCR4-associated factor TC119638 n.s. 2.4 n.s. n.s.

STMHR69 DNA-binding protein 1 TC131998 3.3 5.9 n.s. n.s.

STMDJ76 DNA-binding protein 3 TC120484 4.6 n.s. 4.4 n.s.

STMHA63 DNA-binding protein 4 TC112852 6.5 3.6 3.5 n.s.

STMEF49 TC112853

STMEG07

STMET20

STMIK39 Ethylene-responsive element binding factor TC112188 4.0 n.s. 2.8 �2.7

STMCF93 F7G19.16 protein TC119134 2.6 2.7 n.s. n.s.

TC119135

STMHQ55 G-box-binding protein TAF-3 TC114402 4.5 6.5 2.3 4.4

STMID35

STMIZ28 Homeobox-leucine zipper protein HAT22 TC127382 2.2 2.5 n.s. 3.0

STMCM32 Homeodomain leucine zipper protein HDZ2 TC121639 2.8 6.3 n.s. 4.0

TC129714

STMIK23 Homeodomain leucine zipper protein HDZ2 TC129714 2.6 5.3 n.s. 3.8

STMHT30 Homeotic protein Athb-7 TC113966 9.5 22.9 n.s. 9.5

STMEF08 Homeotic protein VAHOX1 TC119689 3.4 5.1 n.s. n.s.

STMEK10 TC119689

STMGG58 I-box binding factor TC115595 2.2 3.6 n.s. 3.6

STMIY82 Jasmonic acid 2 TC120089 3.5 7.0 3.5 3.4

TC120090

STMJM02 Myb DNA binding protein-like TC120036 3.4 2.8 n.s. n.s.

STMCZ79

STMGX63

STMHF70 Transcription factor Myb1 TC112028 n.s. 2.8 n.s. 2.9

TC112033

TC112033

STMGY33 MYC transcription factor TC126985 2.2 2.2 n.s. n.s.

STMGI14 TC126986

STMEB22 Nam-like protein 10 TC112538 2.4 2.8 n.s. n.s.

STMIO26 Nam-like protein 10 TC127522 n.s. n.s. 2.4 n.s.

STMJD19 RD 26, similar to NAM family protein TC128464 3.6 6.4 4.6 5.9

STMCC18 Similar to NAM-like protein TC120205 2.8 3.4 n.s. n.s.

STMIW03 WIZZ TC130471 6.7 n.s. 20.7 n.s.

STMEP07 WIZZ TC121628 n.s. 2.4 6.8 n.s.

STMHY53 WRKY3 TC113340 2.9 3.0 6.0 n.s.

STMCN42 WRKY transcription factor Nt-SubD48 TC116478 2.1 2.7 n.s. n.s.

STMIU36 WRKY1 TC128904 2.7 n.s. 2.6 n.s.

STMIZ09

STMJC11 WRKY-type transcription factor TC118798 4.0 n.s. 2.5 n.s.

STMHA17 WRKY12 TC122948 n.s. n.s. n.s. 5.4

STMJC75 Putative short-root protein, similar to scarecrow

transcription factor family protein

TC116954 n.s. n.s. 3.4 n.s.

TC123553

STMDT03 SCARECROW transcriptional regulator-like protein TC120067 4.0 2.5 8.9 n.s.

STMDH07 Putative CCAAT-binding transcription factor TC120344 3.1 3.7 n.s. 2.0

TC120345

TC128542

STMHU70 Putative CCAAT-binding transcription factor TC128542 7.1 n.s. n.s. 2.5

STMGW72 Probable CCCH-type zinc finger protein TC126625 n.s. 5.5 n.s. 2.9

STMCS81 Probable transcription regulator PA5438 TC129489 n.s. n.s. 6.2 n.s.

(continued on next page)

682 R. Schafleitner et al. / Plant Physiology and Biochemistry 45 (2007) 673e690

Table 5 (continued )

Probe Gene name StGI Function SA2563 Sullu

d 23 d 42 d 23 d 42

STMCL24 Putative transcription factor RAU1 TC120214 n.s. n.s. 2.4 n.s.

STMJG69 Nucleic acid binding protein-like TC128611 3.0 3.6 n.s. n.s.

TC128610

STMHX38 Similar to basic helix-loop-helix family protein TC115176 3.2 7.7 n.s. 3.8

STMHN79 Similar to TATA-binding protein-associated

factor TAFII55

TC125938 3.2 3.0 n.s. n.s.

TC125949

STMCN79 SPF1 protein TC126464 3.8 n.s. 5.5 n.s.

STMFB71

STMHE15 Transcription factordfava bean TC126883 2.5 2.5 n.s. 2.7

STMJB52 Transcription factor Pti4 TC120677 2.7 n.s. 5.6 n.s.

STMEV24 Tuber-specific and sucrose-responsive element

binding factor

TC112512 n.s. n.s. 2.5 n.s.

STMDH60 Tuber-specific and sucrose-responsive element

binding factor

TC119970 2.0 3.7 n.s. 3.2

STMHY91 Calcium-binding allergen Ole e 8 TC115046 Ca-binding n.s. n.s. 7.5 n.s.

STMGF23 Caleosin-related protein, ABA-inducible TC130973 n.s. n.s. 2.4 n.s.

STMES89 Calcium related protein TC130469 2.6 n.s. 6.4 n.s.

STMIN72 Calmodulin-like protein TC117168 2.5 3.1 4.6 n.s.

STMER65 Calmodulin-like protein TC128019 2.7 n.s. 2.2 n.s.

STMEG05 Putative calmodulin TC124123 n.s. n.s. 3.3 n.s.

TC123353

STMCB58 Calcium-binding protein TC114213 n.s. n.s. 2.6 n.s.

STMCK59 Calmodulin 7 TC112120 n.s. n.s. 2.5 n.s.

STMHL92 Similar to IQ domain-containing protein TC119109 Calmodulin-binding n.s. 8.5 n.s. 7.6

STMHU62 TC19110

STMHP72

STMFA45 Calmodulin-binding family protein TC125576 2.4 n.s. n.s. n.s.

STMEB64 Calmodulin-binding family protein TC126306 2.2 n.s. n.s. n.s.

TC126307

STMDT23 Calmodulin-binding family protein TC126772 n.s. 2.2 n.s. n.s.

STMHQ95 Calmodulin-binding family protein TC129329 n.s. n.s. n.s. 2.4

STMEF62 SCARECROW phytochrome A signal transduction TC128201 Phytochrome A signaling 2.6 2.0 5.2 n.s.

STMJL27

STMIL26 Probable serine/threonine-specific protein kinase TC127763 Kinase 3.6 2.9 n.s. 2.1

STMGX18 CBL interacting protein kinase 4 TC112635 2.6 3.2 n.s. 2.6

STMJC86 Protein kinase homolog TC115960 2.4 2.4 3.0 n.s.

STMCR96 Serine/threonine kinase SNFL1 TC117710 2.4 n.s. 2.4 n.s.

STMGQ87 MAPK 3 TC120898 2.1 n.s. 3.4 n.s.

TC120899

STMDC87 Osmotic stress-activated protein kinase TC121412 n.s. 3.2 n.s. 3.0

STMCY12 Similar to protein phosphatase 2C-related TC119910 Phosphatase 3.7 3.7 n.s. 2.8

STMHO79 Protein phosphatase 2C TC119843 8.0 11.8 n.s. 10.3

STMHS17

STMGP26 Avr9/Cf-9 rapidly elicited protein 284 TC131877 12.7 n.s. 7.9 n.s.

STMER41 Similar to protein phosphatase 2C TC127020 2.4 2.8 n.s. n.s.

TC127021

STMHU71 Protein tyrosine phosphatase TC126294 2.5 3.2 n.s. n.s.

STMIQ20 Similar to protein-tyrosine phosphatase 3 TC123816 2.1 n.s. 4.1 n.s.

STMGM24 Similar to protein phosphatase 2C family protein TC116723 4.4 n.s. 6.7 n.s.

TC131824

STMIC93 Putative phosphatase TC115793 n.s. n.s. 4.5 n.s.

STMGN10 Probable protein phosphatase 2C TC114133 5.1 5.6 n.s. 6.9

TC114134

Values represent n-fold induction in drought-exposed plants compared to control. ns: expression difference not significant between drought and control plants.

683R. Schafleitner et al. / Plant Physiology and Biochemistry 45 (2007) 673e690

WIZZ transcription factor were induced in potato leaves upondrought in our study, as well as in tobacco under elevatedH2O2 levels [51]. WRKY and WIZZ transcription factors aretypically and rapidly induced by wounding and pathogen in-fection; however, there is increasing evidence that WRKY pro-teins also regulate developmental and physiological processesof plants, including responses to salinity, drought, and coldstress [42]. Rizhsky et al. [39] demonstrated that WRKY andethylene response element binding factor transcripts accumu-late in tobacco under a combination of drought and heat stress.Further overlaps between water stress and H2O2 induced tran-script accumulation were found with specific transcription fac-tors and signaling genes of the SCARECROW, MYB, CCR-4,TAF-3 and NAM transcription factor families. The latter groupis also activated by ABA [57].

Several genes involved with signaling and cell communica-tion genes including calcium- and GTP binding proteins,kinases and protein phosphatases showed differential regula-tion under drought. The important role of calcium signalingin the transduction of drought stress into plant responses hasbeen reported [20]. This signaling might involve Hþ/Ca2þ-antiporters, Ca2þ-carriers such as calmodulin and calcium-de-pendent kinases. One of the up-regulated kinase genes, the os-motic stress responsive kinase (TC 121412) has high sequencesimilarity to SRK2c, a SNF1-related protein kinase 2, whichmediates drought tolerance by controlling stress-responsivegene expression in A. thaliana [50]. Several protein phospha-tases 2C (PP2C) genes were strongly activated under drought,including a transcript with high similarity to ABI2(TC119910). The A. thaliana ortholog of this gene is transcrip-tionally up-regulated by ABA and functions as negative regu-lator of ABA signaling [31]. NtPP2C1, a tobacco ortholog toanother drought-induced PP2C of potato (TC119843) hasbeen suggested to operate at the junction of drought, heatshock and oxidative stress in tobacco [52]. Strong up-regula-tion of PP2C genes stresses the importance of phosphatases

in the regulation of drought responses. A set of drought-induc-ible kinase- and phosphatase transcripts overlapped with H2O2

responsive genes of tobacco [51] and ABA-inducible genes inA. thaliana [57]. Patatin genes encoding phospholipase A wereinduced predominantly in Sullu. These genes might participatein stress signal transduction [16], but also have been associatedwith oxidative stress mitigation [26].

4.1.4. Plant hormone balance: induction of a gibberellindegradation gene in Sullu

Gibberellin biosynthesis and degradation pathway geneswere differentially expressed (Table 6). Gibberellins act asgrowth promoters. The gibberellin oxidase gene up-regulatedin Sullu is responsible for gibberellin degradation [28] andthus might be a candidate for regulating gibberellin-mediateddecreased shoot and leaf growth in this clone under drought.Changes of the gibberellin biosynthesis enzyme gene expres-sion such as ent-kaurene and ent-kaurenic acid oxidases inSA2563 might redirect synthesis to different forms ofgibberellins.

Increased ethylene biosynthesis gene expression, predomi-nantly in SA2563, might be associated with increased stressperception of this clone. An important component ofdrought-related signaling is based on ABA; however, no dif-ferentially regulated genes participating with ABA biosynthe-sis-related genes, such as 9-cis-epoxycarotenoid dioxygenase(TC122556) or ABA aldehyde oxidase (TC123094) weredetected.

4.1.5. Carbohydrate metabolism: higher starch turn-overand a-glucan phosphorylase induction in Sullu

Under drought, carbohydrate metabolism apparently wasredirected towards reserve mobilization, as illustrated by in-duction of starch degrading enzymes, invertase and sucrosesynthase (Table 7A). In A. thaliana, two sucrose synthasegenes, putative orthologs to the drought-responsive sucrose

Table 6

Genes involved with ethylene and gibberellin metabolism induced in SA2563 or Sullu

Probe Gene name StGI Function SA2563 Sullu

d 23 d 42 d 23 d 42

STMJH65 1-aminocyclopropane-1-

carboxylate synthase 1A

TC131957 Ethylene biosynthesis n.s. n.s. 2.3 n.s.

STMER30 1-aminocyclopropane-1-

carboxylate oxidase

TC113389 2.5 3.5 n.s. n.s.

STMHW60 1-aminocyclopropane-1-

carboxylate oxidase

TC124789 n.s. 7.7 n.s. n.s.

STMIK35 1-aminocyclopropane-1-

carboxylate oxidase

TC120650 3.4 6.7 n.s. n.s.

STMHU33 Probable epoxide hydrolase TC132634 2.5 3.5 n.s. n.s.

STMGR14 Ent-kaurene oxidase TC117264 Gibberellin biosynthesis 2.1 2.2 n.s. n.s.

TC131903

STMEC32 Ent-kaurene oxidase TC132506 2.1 3.0 n.s. n.s.

TC131903

STMCY85 Ent-kaurenoic acid oxidase TC126787 �2.4 �2.6 n.s. n.s.

STMGM89 Gibberellin 2-oxidase TC115530 Gibberellin degradation n.s. n.s. 6.4 n.s.

TC115531

684 R. Schafleitner et al. / Plant Physiology and Biochemistry 45 (2007) 673e690

Table 7

Genes putatively involved with metabolism-related drought tolerance traits

Probe Gene name StGI Function SA2563 Sullu

d 23 d 42 d 23 d 42

A

STMGB87 Similar to soluble starch

synthase

TC123342 Starch metabolism n.s. n.s. 3.1 n.s.

TC122716

STMJI82 Similar to starch synthase

isoform IV

TC122716 n.s. n.s. 2.0 n.s.

STMGU01 Similar to beta-amylase TC118938 2.4 2.6 n.s. 2.1

TC118938

TC118991

STMHA65 Beta-amylase TC126648 4.2 3.5 n.s. 2.7

STMGU66 Pullulanase-like protein TC120143 2.5 2.5 n.s. n.s.

TC121946

STMHP33 Probable alpha-glucan

phosphorylase, similar to

Wsv453

TC128790 n.s. n.s. 2.2 n.s.

STMHE50 Alpha-glucan phosphorylase

H isozyme

TC131096 n.s. n.s. 2.1 n.s.

STMEG79 Sucrose synthase TC119044 Sucrose metabolism 2.0 2.7 n.s. n.s.

TC122019

STMHE19 Sucrose synthase 2 TC112214 3.7 4.7 n.s. n.s.

TC113215

STMGD25 Neutral invertase TC118858 5.5 5.8 n.s. 2.9

TC124949

STMGN62 Neutral invertase TC118858 5.2 6.9 n.s. 2.7

B

STMHT08 3-methyl-2-oxobutanoate

dehydrogenase

TC115779 Branched-chain amino acid

metabolism

3.2 8.7 n.s. 2.8

TC124955

STMGW55 3-methyl-2-oxobutanoate

dehydrogenase

TC118134 n.s. n.s. n.s. 8.6

STMIR14 Branched-chain amino acid

aminotransferase

TC124992 2.5 2.3 n.s. n.s.

STMDD10 Aminotransferase class IV

protein

TC131127 n.s. 2.0 n.s. n.s.

STMGV36 Acetolactate synthase II TC119339 n.s. 2.4 n.s. n.s.

TC119340

STMIU02 Acetolactate synthase-like

protein

TC113574 n.s. n.s. n.s. 2.5

STMDO82 Ketol-acid reductoisomerase TC112090 n.s. n.s. �2.4 n.s.

C

STMHV15 Delta-1-pyrroline-5-

carboxylate dehydrogenase

TC126656 Proline metabolism 3.5 5.5 n.s. 3.1

STMGU82 Delta 1-pyrroline-5-

carboxylate synthetase

TC128842 9.9 11.6 n.s. 5.9

STMCP25 CIG1, proline oxidase TC127497 2.0 n.s. 5.5 n.s.

TC127497

D

STMGR44 Lipid transfer protein 1 TC126089 Lipid transfer 8.9 15.1 n.s. 4.6

STMGN69 Lipid transfer protein 1 TC126632 5.4 11.8 n.s. 8.2

STMGQ20 Lipid transfer protein 2 TC126090 7.2 10.9 n.s. 3.2

STMCS65 Lipid transfer protein 2 TC126088 n.s. 2.7 2.7 3.3

STMJJ13 Putative lipid transfer protein TC128202 n.s. 2.2 n.s. n.s.

STMIM60 Putative lipid transfer protein TC122025 n.s. n.s. n.s. 2.1

STMGZ28 Nonspecific lipid-transfer

protein

TC128015 2.1 n.s. n.s. n.s.

685R. Schafleitner et al. / Plant Physiology and Biochemistry 45 (2007) 673e690

Table 7 (continued )

Probe Gene name StGI Function SA2563 Sullu

d 23 d 42 d 23 d 42

E

STMIP10 Wax synthase isoform 3 TC114234 Long chain fatty acid

metabolism (cuticle

reinforcement)

n.s. n.s. n.s. �2.3

TC114236

STMDT79 Wax synthase isoform 3 TC114713 2.7 2.9 n.s. 2.4

STMCV45 Fatty acid elongase-like

protein (cer2-like)

TC114172 n.s. 2.8 n.s. 2.2

F

STMJE63 N-hydroxycinnamoyl-

CoA:tyramine N-

hydroxycinnamoyl

transferase THT7e8

TC112913 Lignin biosynthesis 2.1 n.s. 2.7 n.s.

TC112915

STMEZ84 N-hydroxycinnamoyl-

CoA:tyramine N-

hydroxycinnamoyl

transferase THT7e9

TC112914 2.3 n.s. 3.9 n.s.

STMHT83 Cinnamoyl-CoA reductase-

like protein

TC127955 4.7 6.9 4.3 n.s.

STMIX43

A, sucrose and starch metabolism; B, branched-chain amino acid metabolism; C, proline metabolism; D, non-specific lipid transfer proteins; E, long chain fatty

acid metabolism; F, secondary metabolism (lignification).

synthases of potato, were transcriptionally up-regulated underdrought or cold stress [5] and were shown also to respond toABA [57]. Two a-glucan phosphorylase genes involved withstarch degradation, were induced in Sullu only. These geneswere reported to enhance the capacity of the leaf lamina ofA. thaliana to endure a transient water deficit, possibly by pro-viding hexose phosphate substrates for the oxidative pentosephosphate pathway, contributing herewith to control reactiveoxygen intermediate levels [59]. These genes might contributeto the increased drought tolerance in Sullu. Interestingly, inaddition to starch and sugar degradation-associated genes,Sullu induced also starch biosynthesis genes, which points to-wards maintained capacity to generate carbohydrate reservesin leaves under drought. UDP-glucose isomerase was stronglyinduced in both clones. This gene is ABA-inducible in A. thali-ana [57] and has been associated with salt tolerance in rice[11], but its mode of action is unclear.

Even though carbohydrate metabolism transcript amountsoften do not correlate with the actual metabolic activity [14],repression of glycosyltransferases and activation of carbohy-drate degrading genes and in SA2563 might indicate higherdrought sensitivity of this clone compared with Sullu.

4.1.6. Branched-chain amino acid degradationpredominantly in SA2563

Branched chain amino acid (BCAA) degradation geneswere induced by drought, stronger in SA2563 than in Sullu(Table 7B). BCAA degradation could maintain the pool offree branched-chain amino acids at low and non toxic levels,under drought stress conditions [30]. BCAA degradationmight also be a response to C-N imbalance and could servefor C and N remobilization from leaves. In A. thaliana suspen-sion cells, BCAA degradation is increased under stresses such

as sugar starvation, suggesting that this activity partly replacessugars as energy sources [12].

4.1.7. Osmolyte accumulation predominantly in SulluAn increase of solute concentrations in plants lowers the

osmotic potential in the plant tissue, allows uptake of morewater from dryer soils, and might serve as protection formembranes, proteins and DNA during dehydration [43].Sugar and proline concentrations were increased, predomi-nantly in Sullu under drought (Table 4). Proline, hexosesand sugar alcohols, particularly methylated cyclitols suchas pinitol have been associated with drought tolerance inmany plant species [6], and also in potato [2]. High prolinecontents also were associated with increased stress recoverycapacity [1]. Proline is considered to function as an osmo-lyte, but recent findings also support its role as an antioxi-dant [9]. Proline biosynthesis genes were induced in bothclones (Table 7C), accordingly proline levels were elevated.Induction of D1-pyrroline 5 carboxylate synthase and D1-pyrroline 5 carboxylate dehydrogenase was stronger inSA2563 on day 42 AD than in Sullu. This would suggesthigher increases of proline levels in SA2563 than in Sullu;however, proline increases under drought were higher inSullu compared to SA2563 (3.7 versus 2.7 fold increase)and the absolute proline concentration was with 2083 nM/gfw more than 2 times higher in Sullu than in SA2563(804.7 nM/g fw). This result showed that proline concentra-tions in leaves were not proportional to the induction ofproline metabolism genes, indicating additional means ofproline regulation other than transcriptional changes of pro-line metabolism enzyme genes, such as degradation andtranslocation, might influence proline steady state levels inleaves [36].

686 R. Schafleitner et al. / Plant Physiology and Biochemistry 45 (2007) 673e690

Table 8

Cell rescue genes putatively contributing to drought tolerance traits

Probe Gene name StGI Function SA2563 Sullu

d 23 d 42 d 23 d 42

STMER81 Syringolide-induced protein

B13-1-1

TC114627 Oxygen radical detoxification n.s. n.s. 3.2 n.s.

STMEC68 Aldehyde dehydrogenase

family 7 member

TC119606 3.4 3.6 n.s. 2.3

STMHG87 Superoxide dismutase TC126481 �4.0 n.s. 2.4 n.s.

STMDC64

STMEQ90

Probable phospholipid

hydroperoxide glutathione

peroxidase

TC119213 n.s. n.s. 2.9 n.s.

STMHZ64 Glutathione S-transferase TC120455 2.2 n.s. n.s. n.s.

TC120456

STMIN28 Decarg1, putative glutathione

S-transferase T3

TC130900 n.s. n.s. 3.0 n.s.

STMIU75 Similar to glutaredoxin

family protein

TC132446 n.s. n.s. 3.7 n.s.

STMDS48 Ferritin 1 TC126123 n.s. 2.1 n.s. n.s.

STMIN58 Ferritin 2 TC126126 n.s. 2.9 n.s. n.s.

STMGY57 Ferritin 1 TC126819 2.7 6.8 n.s. n.s.

STMHU05 Cytosolic ascorbate

peroxidase

TC127391 n.s. 2.7 n.s. n.s.

STMIH39 Thioredoxin-like 3 TC114592 n.s. n.s. 2.0 n.s.

STMCV49 Thioredoxin F-type 2 TC115669 n.s. n.s. 2.0 n.s.

STMHP28 Chalcone synthase 2 TC117356 Flavanoid metabolism,

oxidative stress mitigation

n.s. �5.3 10.6 n.s.

TC120450

STMHG36 SRG1 protein, similar to

flavonol synthase

TC114845 n.s. 2.1 n.s. n.s.

STMHO88 Flavonoid 30-monooxygenase TC112643 n.s. �3.9 2.9 n.s.

TC115343

STMDB35 Flavanone 3b-hydroxylase TC113679 n.s. �2.6 4.4 n.s.

STMJF94 Chalconeeflavonone

isomerase B

TC127504 n.s. n.s. 3.8 n.s.

STMHQ57 Dihydroflavonol 4-reductase TC120173 n.s. n.s. 2.2 n.s.

STMIU56 Similar to contains similarity

to chalcone-flavonone

isomerase

TC129877 n.s. n.s. 4.7 n.s.

STMHT73 Flavonoid 30-monooxygenase TC112644 n.s. �5.0 3.3 n.s.

STMHX32 Metallothionein-like protein

type 2

TC125711 Response to stress n.s. n.s. 2.1 n.s.

STMEW16 Metallothionein-like protein

type 2 A

TC112461 n.s. n.s. 2.5 n.s.

STMIO10 Metallothionein-like protein

type 2 B

TC112052 n.s. n.s. n.s. 2.1

STMGS26

STMHU53 DnaJ protein, AN11 TC125946 Protein folding n.s. 2.2 n.s. n.s.

TC125955

TC130412

STMEQ11 DnaJ-like protein TC113625 n.s. n.s. n.s. 2.2

STMCM42 DnaJ-like protein TC118443 n.s. n.s. 2.5 6.1

STMGZ22 Similar to DnaJ protein TC128206 �2.4 �2.4 2.2 n.s.

STMIY26

STMCC17 Putative DnaJ protein, appr-

1-p processing enzyme

family protein

TC121102 2.3 2.6 n.s. n.s.

TC123560

STMGI18 Similar to DNAJ heat shock

N-terminal domain

TC117178 n.s. �2.8 n.s. n.s.

687R. Schafleitner et al. / Plant Physiology and Biochemistry 45 (2007) 673e690

Table 8 (continued )

Probe Gene name StGI Function SA2563 Sullu

d 23 d 42 d 23 d 42

STMHK25 Chloroplast small heat shock

protein class I

TC119396 Heat stress defense 2.5 3.7 n.s. n.s.

STMID83 TC119397

STMID86

STMGQ82 Chloroplast small heat shock

protein class I

TC113157 5.6 5.4 n.s. n.s.

STMHK44 Chloroplast small heat shock

protein class I

TC113156 4.7 5.3 2.5 n.s.

STMHK18 Chloroplast small heat shock

protein class I

TC113158 2.4 3.8 n.s. n.s.

STMEI68 Mitochondrial heat shock

protein MTSHP precursor

TC120233 3.0 3.0 n.s. n.s.

STMHR92 70kD heat shock protein TC125185 2.3 2.7 3.8 n.s.

STMHO80 Hsp20.0 protein TC112520 Heat stress defense 4.2 6.2 n.s. n.s.

STMHK68 70kD heat shock protein TC118721 2.6 n.s. n.s. n.s.

STMGB34 17.6 kDa class I small heat

shock protein

TC112521 5.3 5.5 n.s. n.s.

STMGD72 Class II small heat shock

protein Le-HSP17.6

TC119946 9.9 8.2 n.s. 2.6

TC119947

STMHQ27 Dehydrin TAS14 TC119280 LEA, dehydrin 5.7 6.5 n.s. 5.1

STMES67 Dehydrin-like protein TC112438 n.s. n.s. 2.1 n.s.

STMED14 Dehydration-induced protein

ERD15

TC112509 n.s. n.s. 2.1 n.s.

STMDB29 Dehydration-induced protein

ERD15

TC112511 n.s. n.s. 2.3 n.s.

STMER10

STMIJ62 Dehydration-induced protein

ERD15

TC112510 n.s. n.s. 2.7 n.s.

STMJG89 LEA5 TC112718 2.8 5.8 7.7 n.s.

STMIH22 LEA5 TC112721 2.5 4.3 8.6 n.s.

STMIW26

STMDW52 LEA5 TC112720 2.8 4.9 7.5 n.s.

STMIQ26 LEA like protein TC113209 n.s. n.s. 9.0 n.s.

STMJI56 LEA like protein TC132015 n.s. n.s. 8.5 n.s.

STMIM43 LEA homolog (tomato) TC112719 3.3 6.0 8.2 n.s.

STMJO88 LEA-18 TC117167 2.9 2.5 2.0 n.s.

STMGA34 LEA-like protein ER5 TC121446 3.1 4.3 14.6 5.0

STMGU74 Drought-responsive protein/

drought-induced protein

(Di21), LEA domain

TC122011 2.6 2.7 4.8 2.4

STMEW74 Ci21A protein TC125994 Response to cold stress 4.0 3.2 2.5 2.8

STMHZ25 Ci21B protein TC128226 3.0 2.7 n.s. 3.2

4.1.8. Membrane modification and stabilization in SA2563and Sullu

Membranes are the main targets of degenerating processescaused by drought, therefore adaptation of membrane lipids todrought conditions might be key for tolerance. Drought causeda significant up-regulation of non-specific lipid transfer proteingenes in both clones (Table 7D). Non-specific lipid transferproteins shuffle lipids between membranes and have been as-sociated with freezing tolerance [56] and water stress [10].

4.1.9. Strengthening of cuticle in SA2563 and SulluThe drought-induced long chain fatty acid and wax syn-

thase genes presumably produce fatty acids exported to the

cuticle to enhance its function as a transpiration shield (Table7E) [48].

4.1.10. Cell wall strengtheningBoth clones accumulated transcripts for cinnamoyl-CoA

reductase, which catalyses the first step of the phenylpropa-noid pathway specifically dedicated to the monolignolbiosynthetic branch [23], as well as for another enzymepivotal in cell wall strengthening, N-hydroxycinnamoyl-CoA:tyramine N-hydroxycinnamoyl transferase THT7e8(Table 7F), which might increase mechanical resistance ofdrought-exposed cells.

688 R. Schafleitner et al. / Plant Physiology and Biochemistry 45 (2007) 673e690

4.1.11. Cell rescueTranscriptional changes suggested that cell rescue associ-

ated traits are important components of putative drought toler-ance traits in potato (Table 8). Accumulation of reactiveoxygen species is part of many plant stress responses [32]and detoxification of these compounds is essential to mitigatecell damage, but also influences enzyme activation by regulat-ing the cellular redox state [58]. One of the oxidative stress re-lated genes induced by drought in both clones was an aldehydedehydrogenase of the antiquitin ALDH7 gene family. Thisgene was highly similar to the soybean antiquitin GMTP55,whose ectopic expression in A. thaliana, improved drought, sa-linity and oxidative stress tolerance [40]. Antioxidants, such asflavanoids and anthocyanins, also might be implicated in oxi-dative stress detoxification. Biosynthesis pathway genes forthese compounds were strongly induced in Sullu, includingphenylalanine lyase, chalcone synthase, flavanoid monooxyge-nase, flavone 3b-hydroxylase, two chalcone-flavone isomer-ases and dihydroflavonol 4-reductase.

Activation of mitochondrial alternative oxidase pathwaystakes place in both clones under drought. The mitochondrialalternative oxidase pathway acts as a sink for reducing power,preventing the accumulation of excess reducing equivalents inchloroplasts and thereby decreasing the probability of loss ofphotosynthetic function. In wheat, respiration rates increasedby more than 40% under water stress and the increase in res-piration was mostly due to an increase in the alternative oxi-dase pathway involving mitochondrial alternative oxidaseprotein [3]. The strong increase in alternative oxidase tran-scripts in drought-exposed potato points towards the impor-tance of this process in this crop.

Increased expression of DnaJ-like chaperons might contrib-ute to protein stabilization under drought stress conditions.Drought-induced expression of DnaJ like chaperones hasbeen observed in many plant species [33,42] and might con-tribute to plant performance under water stress. Increased tran-scripts of heat shock genes, particularly in SA2563, mightserve a similar function.

LEA proteins are known to be drought-inducible and wereproposed to be involved in desiccation tolerance. A variety ofmechanisms for achieving this end have been suggested, in-cluding protecting cellular structures from the effects of waterloss by retention of water, sequestration of ions, direct protec-tion of other proteins or membranes, or renaturation of un-folded proteins [7]. Dehydrin expression has been related toacquisition of drought tolerance [27]. We propose that in-creased expression of LEA and dehydrin genes analogouslyincrease water stress tolerance in potato.

Strong induction of Ci21A and Ci21B points towardsa function of these genes in drought defense in potato. Themaize ortholog to Ci21A, ASR1, functions in ABA-dependentdrought response and is associated with a QTL of senescence[17]. The molecular function of this gene is unknown; how-ever, it was associated with drought and cold tolerance [17].

In potato under drought, several pathogen related genes,such as nematode resistance protein, endochitinase, basicchitinase, b-1,3-glucanase, PR1, PR5 and thionin were

up-regulated. The same genes are induced in model plants bypathogen attack, water stress [8], and by active oxygen speciesthat accumulate during many biotic and abiotic stresses [45].

5. Conclusions

This study proved that variation of drought tolerance ispresent in native Andean potato germplasm and that differentcombinations of drought tolerance traits may lead to the sameeffect: tuber yield maintenance under drought. Future studieson populations established from clones exhibiting differentcombinations of the identified drought tolerance traits willgive a more detailed insight into the impact of different traitcombinations on yield maintenance under drought.

Acknowledgments

Special thanks to The Institute of Genomics Research, partic-ularly to Willem Rensink and his team, for providing the TIGRExpression Profiling Service funded by the NSF FunctionalGenomics Project. Further we would like to thank DanielleEvers, Christelle Andre and Mouhssin Oufir (CRP-GabrielLippmann, Luxembourg) for sugar and sugar alcohol measure-ments and Prof Ruth Grene (Virginia Tech, USA) for helpfuldiscussions and comments on the manuscript. We also wouldlike to acknowledge the Generation Challenge Program-fundedCIP High Performance Computing Facility, which allowed us toincrease the efficiency of the bioinformatics analysis of ourresults. This study was financially supported by the AustrianGovernment.

References

[1] J.L. Andrade, A. Larque-Saavedra, C.L. Trejo, Proline accumulation in

leaves of four cultivars of Phaseolus vulgaris L. with different drought

resistance, Phyton 57 (1995) 149e157.

[2] K.C. Bansal, S. Nagarajan, Leaf water content, stomatal conductance and

proline accumulation in leaves of Potato (Solanum tuberosum L) in re-

sponse to water stress, Indian J. Plant Physiol. 29 (1986) 397e404.

[3] C.G. Bartoli, F. Gomez, G. Gergoff, J.J. Guiame, S. Puntarulo, Up-regu-

lation of the mitochondrial alternative oxidase pathway enhances photo-

synthetic electron transport under drought conditions, J. Exp. Bot. 56

(2005) 1269e1276.

[4] L.S. Bates, R.P. Waldren, L.D. Teare, Rapid determination of free proline

for water stress studies, Plant Soil 39 (1973) 205e207.

[5] S. Baud, M.N. Vaultier, C. Rochat, Structure and expression profile of the

sucrose synthase multigene family in Arabidopsis, J. Exp. Bot. 55 (2004)

397e409.

[6] H.J. Bohnert, D.E. Nelson, R.G. Jensenay, Adaptations to environmental

stresses, Plant Cell 7 (1995) 1099e1111.

[7] E.A. Bray, J. Bailey-Serres, E. Weretilnyk, Responses to abiotic stress,

in: B.B. Buchanan, W. Gruissem, R.L. Jones (Eds.), Biochemistry and

Molecular Biology of Plants, American Society of Plant Physiologists,

New York, 2000, pp. 1158e1203.

[8] E.A. Bray, Genes commonly regulated by water-deficit stress in Arabi-dopsis thaliana, J. Exp. Bot. 55 (2004) 2331e2341.

[9] C. Chen, M.B. Dickman, Proline suppresses apoptosis in the fungal pathogen

Colletotrichum trifoii, Proc. Natl. Acad. Sci. USA 102 (2005) 3459e3464.

[10] J.M. Colmenero-Flores, F. Campos, A. Garciarrubio, A.A. Covarrubias,

Characterization of Phaseolus vulgaris cDNA clones responsive to water

689R. Schafleitner et al. / Plant Physiology and Biochemistry 45 (2007) 673e690

deficit: identification of a novel late embryogenesis abundant-like pro-

tein, Plant Mol. Biol. 35 (1997) 393e405.

[11] N. Endo, K. Yoshida, M. Akiyoshi, Y. Yoshida, N. Hayashi, Putative

UDP-galactose epimerase and metallothioneine of Paspalum vaginatum

enhanced the salt tolerance of rice, Oryza sativa L from transplanting

to harvest stages, Breeding Sci. 55 (2005) 163e175.

[12] Y. Fujiki, T. Sato, M. Ito, A. Watanabe, Leucine and its keto acid enhance

the coordinated expression of genes for branched-chain amino acid ca-

tabolism in Arabidopsis under sugar starvation, J. Biol. Chem. 275

(2000) 6007e6013.

[13] M. Fujita, Y. Fujita, K. Maruyama, M. Seki, K. Hiratsu, M. Ohme-

Takagi, L.S. Tran, K. Yamaguchi-Shinozaki, K. Shinozaki, A dehydra-

tion-induced NAC protein, RD26, is involved in a novel ABA-dependent

stress-signaling pathway, Plant J 39 (2004) 863e876.

[14] P. Geigenberger, M. Stitt, A.R. Fernie, Metabolic control analysis and

regulation of the conversion of sucrose to starch in growing potato tubers,

Plant Cell Environ. 27 (2004) 655e673.

[15] B. Heuer, A. Nadler, Physiological response of potato plants to soil salin-

ity and water deficit, Plant Sci. 137 (1998) 43e51.

[16] A. Holk, S. Rietz, M. Zahn, H. Quade, G.F. Scherer, Molecular identifi-

cation of cytosolic, patatin-related phospholipases A from Arabidopsis

with potential functions in plant signal transduction, Plant Physiol. 130

(2002) 90e101.

[17] M. Jeanneau, D. Gerentes, X. Foueillassar, M. Zivy, J. Vida, A. Toppan,

P. Perez, Improvement of drought tolerance in maize: towards the func-

tional validation of the Zm-Asr1 gene and increase of water use efficiency

by over-expressing C4-PEPC, Biochimie 8 (2002) 1127e1135.

[18] R.A. Jefferies, D.K.L. MacKerron, Radiation interception and growth of

irrigated and droughted potato (Solanum tuberosum), Field Crops Res. 22

(1989) 101e112.

[19] R.A. Jefferies, D.K.L. MacKerron, Genotypic differences in water use ef-

ficiency in potato, Asp. Appl. Biol. 38 (1994) 63e70.

[20] H. Knight, A.J. Trewavas, M.R. Knight, Calcium signaling in Arabidop-

sis thaliana responding to drought and salinity, Plant J. 12 (1997) 1067e1078.

[21] J.A. Kreps, Y. Wu, H.S. Chang, T. Zhu, X. Wang, J.F. Harper, Transcrip-

tome changes for Arabidopsis in response to salt, osmotic, and cold

stress, Plant Physiol. 130 (2002) 2129e2141.

[22] D. Kumar, Breeding for drought resistance, in: M. Ashraf, P.J.C. Harris

(Eds.), Abiotic Stresses, Harworth Press, New York, 2005, pp. 145e165.

[23] E. Lacombe, S. Hawkins, J.V. Doorsselaere, J. Piquemal, D. Goffner,

O. Poeydomenge, A.M. Boudet, J. Grima-Pettenati, Cinnamoyl CoA re-

ductase, the first committed enzyme of the lignin branch biosynthetic

pathway: cloning, expression and phylogenetic relationships, Plant J.

11 (1997) 429e441.

[24] O. Lahlou, J.F. Ledent, Root mass and depth, stolons and roots formed on

stolons in four cultivars of potato under water stress, Eur. J. Agron. 22

(2005) 159e173.

[25] Q. Liu, M. Kasuga, Y. Sakuma, H. Abe, S. Miura, K. Yamaguchi-Shino-

zaki, K. Shinozaki, Two transcription factors, DREB1 and DREB2, with

an EREBP/AP2 DNA-binding domain separate two cellular signal trans-

duction pathways in drought and low-temperature-responsive gene ex-

pression respectively in Arabidopsis, Plant Cell 10 (1998) 1391e1406.

[26] Y.W. Liu, C.H. Han, M.H. Lee, F.L. Hsu, W.C. Hou, Patatin, the tuber

storage protein of potato (Solanum tuberosum L), exhibits antioxidant ac-

tivity in vitro, J. Agric. Food Chem. 51 (2003) 4389e4393.

[27] C.G. Lopez, G.M. Banowetz, C.J. Peterson, W.E. Kronstad, Dehydrin ex-

pression and drought tolerance in seven wheat cultivars, Crop Sci. 43

(2003) 577e582.

[28] D.N. Martin, W.M. Proebsting, P. Hedden, The SLENDER gene of pea

encodes a gibberellin 2-oxidase, Plant Physiol. 121 (1999) 775e781.

[29] C.A. Martinez, U. Moreno, Expresiones fisiologicas de resistencia a la

sequia en dos variedades de papa sometidas a estres hıdrico en condi-

ciones de campo, R. Bras. Fisiol. Veg. 4 (1992) 33e38.

[30] M. Malatrasi, M. Corradi, J.T. Svensson, T.J. Close, M. Gulli,

N. Marmiroli, A branched-chain amino acid aminotransferase gene iso-

lated from Hordeum vulgare is differentially regulated by drought stress,

Theor. Appl. Genet. (2006). doi:10.1007/s00122-006-0339-6.

[31] S. Merlot, F. Gosti, D. le Guerrier, A. Vavasseur, J. Giraudat, The

ABI1 and ABI2 protein phosphatases 2C act in a negative feedback

regulatory loop of the abscisic acid signalling pathway, Plant J. 25

(2001) 295e303.

[32] R. Mittler, Oxidative stress, antioxidants and stress tolerance, Trends

Plant Sci. 7 (2002) 405e410.

[33] T.T. Nguyen, N. Klueva, V. Chamareck, A. Aarti, G. Magpantay,

A.C. Millena, M.S. Pathan, H.T. Nguyen, Saturation mapping of QTL re-

gions and identification of putative candidate genes for drought tolerance

in rice, Mol. Gen. Genomics 272 (2004) 35e46.

[34] M.W. Pfaffl, G.W. Horgan, L. Dempfle, Relative expression software tool

(REST�) for group-wise comparison and statistical analysis of relative

expression results in real time PCR, Nucleic Acids Res. 30 (2002) e36.

[35] M.A. Rabbani, K. Maruyama, H. Abe, M.A. Khan, K. Katsura, Y. Ito,

K. Yoshiwara, M. Seki, K. Shinozaki, K. Yamaguchi-Shinozaki, Monitor-

ing expression profiles of rice genes under cold, drought, and high-salin-

ity stresses and abscisic acid application using cDNA microarray and

RNA gel-blot analyses, Plant Physiol. 133 (2003) 1755e1767.

[36] M.J. Raymond, N. Smirnoff, Proline metabolism and transport in Maize

seedlings at low water potential, Ann. Bot. 89 (2002) 813e823.

[37] P. Renne, U. Dressen, U. Hebbeker, D. Hille, U.I. Flugge, P. Westhoff,

A.P.M. Weber, The Arabidopsis mutant dct is deficient in the plastidic

glutamate/malate translocator DiT2, Plant J. 35 (2003) 316e331.

[38] W.A. Rensink, S. Iobst, A. Hart, S. Stegalkina, J. Liu, R. Buell, Gene ex-

pression profiling of potato responses to cold, heat, and salt stress, Funct.

Integr. Genomics 5 (2005) 201e207.

[39] L. Rizhsky, H. Liang, R. Mittler, The combined effect of drought stress

and heat shock on gene expression in tobacco, Plant Physiol 130 (2002)

1143e1151.

[40] S.M. Rodrıguez, M.O. Andrade, A.P. Soares-Gomes, F.M. DaMatta,

M.C. Baracat-Pereira, E.P.B. Fontes, Arabidopsis and tobacco plants ec-

topically expressing the soybean antiquitin-like ALDH7 gene display en-

hanced tolerance to drought, salinity, and oxidative stress, J. Exp. Bot. 57

(2006) 1909e1918.

[41] A. Schneider, F. Salamin, C. Gebhardt, Expression Patterns and promoter

activity of the cold-regulated gene ci27a of potato, Plant Physiol. 113

(1997) 335e345.

[42] M. Seki, M. Narusaka, J. Ishida, T. Nanjo, M. Fujita, Y. Oono, A. Kamiya,

M. Nakajima, A. Enju, T. Sakurai, M. Satou, K. Akiyama, T. Taji,

K. Yamaguchi-Shinozaki, P. Carninci, J. Kawai, Y. Hayashizaki,

K. Shinozaki, Monitoring the expression profiles of 7000 Arabidopsis

genes under drought, cold and high-salinity stresses using a full-length

cDNA microarray, Plant J. 31 (2002) 279e292.

[43] D. Shakhdhar, S.C. Shakhdhar, R.C. Pant, Osmoprotectants, an overview,

Physiol Mol. Biol. Plants 10 (2004) 167e180.

[44] D. Shimshi, M. Susnoschi, Growth and yield studies of potato develop-

ment in a semi-arid region 3 Effect of water stress and amounts of nitro-

gen top dressing on physiological indices and on tuber yield and quality

of several cultivars, Potato Res. 28 (1985) 177e191.

[45] N. Smirnoff, Tansley Review No 52: The role of active oxygen in the re-

sponse of plants to water deficit and desiccation, New Phytol. 125 (1993)

27e58.

[46] E. Soderman, J. Mattsson, P. Engstrom, The Arabidopsis homeobox gene

ATHB-7 is induced by water deficit and by abscisic acid, Plant J. 10

(1996) 375e381.

[47] C. Tourneux, A. Devaux, M.R. Camacho, P. Mamani, J.F. Ledent, Effect of

water shortage on six potato genotypes in the highlands of Bolivia (II): wa-

ter relations, physiological parameters, Agronomie 23 (2003) 181e190.

[48] S. Trenkamp, W. Martin, K. Tietjen, Specific and differential inhibition

of very-long-chain fatty acid elongases from Arabidopsis thaliana by dif-

ferent herbicides, Proc. Natl. Acad. Sci. USA 101 (2004) 11903e11908.

[49] V.G. Tusher, R. Tibshirani, G. Chu, Significance analysis of microarrays

applied to the ionizing radiation response, Proc. Natl. Acad. Sci. USA 98

(2001) 5116e5121.

[50] T. Umezawa, R. Yoshida, K. Maruyama, K. Yamaguchi-Shinozaki,

K. Shinozaki, SRK2C, a SNF1-related protein kinase 2, improves drought

tolerance by controlling stress-responsive gene expression in Arabidopsis

thaliana, Proc. Natl. Acad. Sci. USA 101 (2004) 17306e17311.

690 R. Schafleitner et al. / Plant Physiology and Biochemistry 45 (2007) 673e690

[51] S. Vandenabeele, K. Van Der Kelen, J. Dat, I. Gadjev, T. Boonefaes,

S. Morsa, P. Rottiers, L. Slooten, M. Van Montagu, M. Zabeau,

D. Inze, F. Van Breusegem, A comprehensive analysis of hydrogen per-

oxide-induced gene expression in tobacco, Proc. Natl. Acad. Sci. USA

100 (2003) 16113e16118.

[52] E. Vranova, C. Langebartels, M. Van Montagu, D. Ines, W. Van Camp,

Oxidative stress, heat shock and drought differentially affect expression

of a tobacco protein phosphatase 2C, J. Exp. Bot. 51 (2000) 1763e1764.

[53] J.I. Watkinson, L. Hendricks, A.A. Sioson, C. Vasquez-Robinet,

V. Stromberg, L.S. Heath, M. Schuler, H.J. Bohnert, M. Bonierbale,

R. Grene, Accessions of Solanum tuberosumssp.igena show differences

in acclimation to drought stress as reflected in gene expression profiles,

Plant Sci. 171 (2006) 745e758.

[54] S.A. Weller, J.G. Elphinstone, N.C. Smith, N. Boonham, Stead, D.E., De-

tection of Ralstonia solanacearum Strains with a quantitative, multiplex,

real-time, Fluorogenic PCR (TaqMan) assay, Appl. Environ. Microbiol.

66 (2000) 2853e2858.

[55] L. Wilson, G. Amy, C. Gerba, H. Gordon, B. Johnson, J. Miller, Water

quality changes during soil aquifer treatment of tertiary effluent, Water

Environ. Res. 67 (2000) 371e376.

[56] G. Wu, A.J. Robertson, X. Liu, P. Zheng, R.W. Wilen, N.T. Nesbitt,

L.V. Gusta, A lipid transfer protein gene BG-14 is differentially regulated

by abiotic stress, ABA, anisomycin, and sphingosine in bromegrass (Bro-

mus inermis), J. Plant Physiol 161 (2004) 449e458.

[57] Z. Xin, Y. Zhao, Z.L. Zheng, Transcriptome analysis reveals specific

modulation of abscisic acid signaling by ROP10 small GTPase in Arabi-

dopsis, Plant Physiol. 139 (2005) 1350e1365.

[58] H. Yano, J.H. Wong, Y.M. Lee, M.J. Cho, B.B. Buchanan, A strategy for

the identification of proteins targeted by thioredoxin, Proc. Natl. Acad.

Sci. USA 98 (2001) 4794e4799.

[59] S.C. Zeeman, D. Thorneycroft, N. Schupp, A. Chapple, M. Weck,

H. Dunstan, P. Haldimann, N. Bechtold, A.M. Smith, S.M. Smith, Plas-

tidial a-glucan phosphorylase is not required for starch degradation in

Arabidopsis leaves but has a role in the tolerance of abiotic stress, Plant

Physiol. 135 (2004) 849e858.