Bacteriophage infection is targeted to cellular poles

Bacteriophage infection is targeted to cellular poles

Rotem Edgar,1* Assaf Rokney,2 Morgan Feeney,3

Szabolcs Semsey,1,4 Martin Kessel,5

Marcia B. Goldberg,3 Sankar Adhya1 andAmos B. Oppenheim1,2†

1Laboratory of Molecular Biology, Center for CancerResearch, National Cancer Institute, National Institutesof Health, Bethesda, MD 20892, USA.2Department of Molecular Genetics and Biotechnology,Hebrew University-Hadassah Medical School,Jerusalem 91120, Israel.3Infectious Disease Division, Massachusetts GeneralHospital/Harvard Medical School, Boston, MA 02114,USA.4Department of Genetics, Eötvös Lóránd University,H-1117 Budapest, Hungary.5Laboratory of Cell Biology, Center for CancerResearch, National Cancer Institute, National Institutesof Health, Bethesda, MD 20892, USA.

Summary

The poles of bacteria exhibit several specialized func-tions related to the mobilization of DNA and certainproteins. To monitor the infection of Escherichia colicells by light microscopy, we developed proceduresfor the tagging of mature bacteriophages withquantum dots. Surprisingly, most of the infectingphages were found attached to the bacterial poles.This was true for a number of temperate and virulentphages of E. coli that use widely different receptorsand for phages infecting Yersinia pseudotuberculosisand Vibrio cholerae. The infecting phages colocalizedwith the polar protein marker IcsA–GFP. ManY, anE. coli protein that is required for phage l DNA injec-tion, was found to localize to the bacterial poles aswell. Furthermore, labelling of l DNA during infectionrevealed that it is injected and replicated at the polarregion of infection. The evolutionary benefits thatlead to this remarkable preference for polar infectionsmay be related to l’s developmental decision as wellas to the function of poles in the ability of bacterialcells to communicate with their environment and ingene regulation.

Introduction

Bacteriophages are among the smallest but most abun-dant organism on earth (~1031) (Suttle, 2005). For mostphages, the tail mediates the anchoring of the phage togenerally abundant bacterial outer membrane proteinsthat serve as specific receptors for their substrates. Forexample, the receptor for the temperate phage l is theEscherichia coli maltoporin receptor LamB, which func-tions in amylomaltose uptake (Ryter et al., 1975; Szmel-cman and Hofnung, 1975). The establishment of a stablephage–host interaction relays signals that allow injectionof DNA from the phage capsid through the tail and into thehost, leaving the empty capsid (head) attached to the cellsurface. Following phage l DNA injection, a decisionbetween the lytic or lysogenic pathways of bacteriophagel is made.

Our aim was to investigate the initial steps of binding(adsorption) and phage DNA injection. We designed aprotocol that allows us to follow infection visually in livingsamples. We labelled different phages with quantum dots(QDots) and followed adsorption using a fluorescencemicroscope. The surprising results showed that at lowmultiplicities of infection (moi), phages preferentiallyadsorb, inject and replicate their DNA at the bacterialpoles. This spatial preference was independent of hostproteins, ManY and Pel, required for phage l DNAinjection. The significance of the pole, the binding of thephage to the pole and its implications in lytic-lysogenicdecision are discussed.

Results and discussion

Labelling phage

Visualization of phages has been traditionally obtained byelectron microscopy of stained preparations, followinginfections at high moi (see Ptashne, 2004). To this day, thesmall nanometer size of phages presents an obstacle forthe direct observation of live infection. To visually monitorphage adsorption and follow the infection process, wedeveloped a technique for phage labelling as describedbelow. The method allows visualization of phage infectionby light microscopy in real time, without interfering with theinfection process. Phages are chemically decorated withbiotin using a cross-linker (EZ-Link Sulpho-NHS-Biotin,PIERCE) that forms a stable amide bond with primaryamines and has a long spacer arm to reduce steric

Accepted 4 March, 2008. *For correspondence. E-mail [email protected]; Tel. (+1) 301 451 8820; Fax: (+1) 301 496 2212. †Inmemory of the deceased.

Molecular Microbiology (2008) 68(5), 1107–1116 � doi:10.1111/j.1365-2958.2008.06205.xFirst published online 21 April 2008

Journal compilation © 2008 Blackwell Publishing LtdNo claim to original US government works

hindrance. The biotinylated phage is then conjugated tostreptavidin-coated QDots that are ~10–20 nm in size,smaller than tailed phage particles such as l. We firstconfirmed cross-linking and binding of QDots to the lphage using transmission electron microscopy (TEM)(Fig. 1A). QDots were detected on about 80% of thephages and the distribution of the QDots on the phagewas not random. About 50% of the QDots were bound tothe phage head, primarily on the half of the head that isclosest to the tail. Additional 50% of QDots were bound tothe tail.

Viability of labelled phage

We tested the ability of the labelled l phage to adsorb tocells by visualizing live samples under the fluorescencemicroscope. Biotinylated phages were incubated withbacterial cells for 5 min at room temperature. After anadditional short incubation with streptavidin-conjugatedQDots, samples were washed and observed under thefluorescence microscope. Phage adsorption to cells could

be readily visualized (Fig. 1B), and at moi of 1, forexample, about 25% of the cells had QDots foci. We nexttested viability of the QDot-conjugated l phages as deter-mined by their ability to form plaques. We optimized thecross-linking conditions to give maximum labelling (about80% of the phage particles, as mentioned above) withoutaffecting the number of plaque-forming units (PFUs) ascompared with the PFUs of unlabelled phages (data notshown). Finally, we infected a bacterial host carrying thereporter fusion pR’tR’–GFP with the QDot-conjugated lphage. Cells carrying the plasmid encoding GFP underthe l pR’tR’ promoter express GFP only in the presenceof the l phage late protein Q, an antiterminator that isproduced following injection of the phage DNA (Kobileret al., 2005). Incubation for 1 h following adsorption led toextensive activation of the reporter fusion as observed bythe accumulation of GFP in the infected cells (Fig. 1C,green). Infected cells were identified by the presence ofattached QDot-labelled phage (Fig. 1C, red). In agree-ment with the TEM estimation, 85% of the cells thatexpressed GFP had QDot-conjugated phage bound to

Fig. 1. Various phages labelled with QDotsbind to the polar regions of their host bacteria.A. Electron micrograph of QDots attached tophage that was chemically decorated withbiotin using the cross-linker EZ-LinkSulpho-NHS-Biotin. QDots are marked withasterisks.B. (i) l phage labelled with QDots as in(A), infecting E. coli. (ii) Percentage ofQDots-bound l phage at the indicated relativedistance on the bacteria cell, as observed inthe fluorescence microscope.C. Fluorescent micrographs of QDot-labelled(red) phages. The green colour shows GFPexpressed from the late gene reporter fusionpR’tR’–GFP as a response to effectiveinfection by QDot-labelled l phage.D. Electron micrographs of l phage infectingcells at high, ~100 (top) and low, ~5 (bottom)moi after 1 h incubation at 37°C. Arrows markphages at low moi.E. Infection of E. coli cells with different phagelabelled with QDots, as indicated.F. Infection of Y. pseudotuberculosis byQDot-labelled phage fA1122, and V. choleraeby QDot-labelled vibriophage KVP40.

1108 R. Edgar et al. �

Journal compilation © 2008 Blackwell Publishing Ltd, Molecular Microbiology, 68, 1107–1116No claim to original US government works

them. The remainder of cells that express GFP most likelyrepresent infection by unlabelled l phage as GFP expres-sion was observed only upon l phage addition; no fluo-rescence was detected in pR’tR’–GFP carrying cells whenl phage was omitted (QDot-conjugated or unconjugated,data not shown). These results indicate that QDot-conjugated l phages are both viable and able to carry outan effective infection.

During these tests we discovered that at lower moi (moiof 0.5–5.0), phage show a high preference for interactingwith the polar regions of bacterial host cells, hereafterreferred to as poles (Fig. 1B). About 70% of the QDot-labelled phages were found bound at the pole or at mid-cell, which represents a future pole of the cell (Fig. 1B;Table 1). The remainder of the QDot-labelled phages wasdistributed over the bacterial surface without apparentpreference for a particular location. When phage infectionwas omitted or upon infection of an E. coli lamB::Cmmutant, which is resistant to l infection because of theabsence of the l phage surface receptor LamB, no QDotswere detected bound to cells (results not shown), indicat-ing that the QDots observed on cells represent boundphage. Preferential binding of phage l to the cellular poleswas not due to the chemical modification of the phages orthe presence of QDots, as electron micrographs of fixedsamples showed phage l, not labelled with QDots, at anmoi of 5, also bound with high preference to the polarregions of the cells (Fig. 1D, bottom). The distribution ofuntreated phages was similar to that observed for QDot-conjugated phages at the same moi visualized by lightmicroscopy.

These findings were surprising as a recent analysis ofprotein distribution in E. coli (GenoBase) found that only16% of proteins demonstrate a specific localization withinthe E. coli cell, including polar and non-polar localization[given that GFP does not fold properly when exportedfrom the cytoplasm, the number might be an under-estimation (Feilmeier et al., 2000)]. These data are basedon visualization of GFP fusion proteins in E. coli K-12(W3110) using the fluorescence microscope (for construc-tion details and related information: http://ecoli.naist.jp/gb5/WGB/intro.html). In this analysis, the distributionpattern of GFP expressed from in-frame gfp fusions to

4706 distinct E. coli ORFs was determined and catego-rized as cellular component (64.2%), membrane compo-nent (8.3%), membranous and foci (2.2%), foci (14.1%),ring (0.2%), nucleoid (1.3%), nucleoid and foci (0.6%),undefined (0.3%) or no signal (8.9%).

We next investigated whether the observed preferenceof l phage for binding to the polar regions of E. coli is aunique behaviour of bacteriophage l and E. coli or a moregeneral behaviour of bacteriophage binding to Gram-negative bacteria.

Polar localization in other bacteria and phages

To test whether the preferential binding of l phage par-ticles to cellular poles is shared by other phages, wemonitored the behaviour of additional temperate coliph-ages: H-19B, a lambdoid phage that carries the stxIgenes, which encode the two toxin subunits of a Shiga-like toxin, f80, P1, and the virulent coliphages T4 and T7.Each phage binds to distinct cellular receptors: the recep-tor for phage f80 is the outer membrane iron transporterFhuA (Mangenot et al., 2005), the receptors for T4 phagesare the outer membrane proteins OmpF and OmpC(Hashemolhosseini et al., 1994) and the receptor forphage T7 is lipopolysaccharide (Steven et al., 1988).Phage P1 has a wide host range (Kaiser and Dworkin,1975). We used the same labelling method and confirmedviability for each of these phages by their infectivity. Ineach case, the bacterial poles were found to be the pre-ferred site of binding (Fig. 1E and Table 1). The prefer-ence of phages for binding to the polar regions of the cellwas also observed for bacteria other than E. coli K-12.QDot-conjugated phages were localized preferentially tothe cell poles upon infection of Yersinia pseudotuberculo-sis by the T7-like Yersinia phage fA1122 (Garcia et al.,2003) and upon infection of Vibrio cholerae by the T4-likevibriophage KVP40 (Miller et al., 2003) (Fig. 1F andTable 1). These data indicate that the preference of infect-ing phages for polar sites on the bacterial surface is ageneral characteristic of phage infection. These resultssuggest the possibility of evolutionary conservation ofcertain host proteins or structures to the polar regions ofGram-negative bacteria.

Table 1. Various phages labeled with QDots infecting their corresponding host were observed under the fluorescence microscope and scoredfor the localization on the cell surface.

Phage l T7 KVP40 fA1122 P1 T4 l lf80

Bacterial strain E. coli E. coli V. cholera Y. pseudotuberculosis E. coli E. coli E. coli pel E. coli% foci at the pole and mid-cell 69% 71% 73% 68% 78% 95% 71% 68%% foci in other locations 31% 29% 27% 32% 22% 5% 29% 32%

Percentage represents the number of cells with the indicated location, out of 100–500 cells with one foci, as observed in the fluorescencemicroscope.

Bacteriophage infection is targeted to cellular poles 1109


http://ecoli.naist.jp

Colocalization of QDot-conjugated l phages with thepolar protein IcsA

The process of cell division leads to the development ofnew cell poles that are derived from the septum at mid-cell. Several lines of evidence indicate that molecularmarkers of the future cell pole are present at mid-cellprior to septation. Indeed, certain polar proteins are ableto recognize mid-cell, as well as the sites of future cellpoles in filamentous cells. IcsA, a polar outer membraneprotein present in Shigella, is secreted at the bacterialpole after it is targeted to the pole in the bacterial cyto-plasm (Charles et al., 2001; Brandon et al., 2003). Local-ization of IcsA to the pole depends on two independentpeptides, residues 1–104 and residues 507–620; eachof these sequences is able to direct a GFP fusion to thepole in the cytoplasm of Shigella flexneri, E. coli andother enterobacteriaceae (Charles et al., 2001). In bac-teria in which cell division is blocked, a GFP fusion toIcsA residues 507–620 (IcsA507-620–GFP) localizes at ornear potential cell division sites, which correspond to thefuture poles of the cell (Janakiraman and Goldberg,2004). IcsA507-620–GFP can therefore be used as amarker for sites that correspond to poles and futurepoles of the cell. E. coli and Y. pseudotuberculosis cellsexpressing IcsA507-620–GFP were infected with QDot-labelled phage l and QDot-labelled Yersinia phagefA1122 respectively. The labelled phage colocalized withIcsA507-620–GFP (Fig. 2A and B), which was localized tothe polar regions of the cell and/or to mid-cell. Thisresult supports the results presented above and leadsto the conclusion that the sites to which the QDot-conjugated phages attach on the bacterial surfacecorrespond to present or future polar regions of thecell.

To test whether the observed preference of phage forbinding to the cellular poles is determined by the hemi-spherical configuration of the poles, we examined thedistribution of phage on cells that had been filamented. Asmentioned above, in filamented cells, potential cell divi-sion sites that correspond to future poles are marked byIcsA507-620–GFP (Janakiraman and Goldberg, 2004). Togenerate filamentous cells, cultures were treated with theantibiotic aztreonam, which inhibits the septum-specificenzyme PBP 3 (FtsI) (Adam et al., 1997). At low moi,QDot-conjugated phage l colocalized with at least one ofthe IcsA507-620–GFP foci, which were present at regularintervals along the lengths of filamented cells that hadbeen filamented (Fig. 2C), as previously described (Jana-kiraman and Goldberg, 2004), indicating that phage bindto sites corresponding to potential poles as well as tomature poles. Moreover, preferential binding to the polesdoes not depend on the hemispherical configuration of thebinding site.

Involvement of the host proteins LamB and ManY,which are required for l DNA injection

LamB, the bacterial receptor for phage l, is an abundantouter membrane protein, with approximately 30,000copies of LamB per cell (Boos and Shuman, 1998). Asexpected, we observed that binding of phage l was depen-

Fig. 2. Colocalization of IcsA507-620–GFP and adsorbed phage inlive bacteria.A and B. Shown from left to right, IcsA-labelled poles (green),QDot-labelled phages (red), and overlay of the two: (A) E. coli or(B) Y. pseudotuberculosis expressing IcsA–GFP and infected withQDot-labelled phage l or fA1122, respectively, at low moi.C. QDot-labelled phage l colocalized with IcsA507-620–GFP atintervals along the lengths of filamented cells.



dent on LamB, as no bacteria-bound QDots were detectedwhen an E. coli lamB mutant was infected with QDot-conjugated phage (data not shown). Using fluorescentlylabelled bacteriophage lambda tails, LamB has beenshown to be distributed in spirals that extend from pole topole along the length of the cell and to move laterally in theouter membrane along these spirals (Gibbs et al., 2004).LamB thereby provides many sites for phage adsorptionthat are distributed over the entire cell surface and wouldallow bound phage to move along the cell surface. Giventhe abundance of LamB, we tested whether the distributionof bound phage differs upon infection at high moi.At an moiof ~100, phage l was bound over the entire surface of thecell (Fig. 1D, top), as has been frequently seen in classicalelectron micrographs (Ryter et al., 1975). The polarbinding that was observed by TEM at low moi, but not athigh moi (Fig. 1D, bottom and top respectively), is consis-tent with a process in which phages bind LamB at manylocations on the cell surface. We postulate that whenphages are limiting, LamB-bound phages move laterallyalong the cell surface until they reach the pole, while at highmoi, phages move laterally reaching other locations inaddition to the one that reached the pole.

An extension of this model is that phage DNA injectionmight occur most efficiently after the phage reaches thecell pole. To identify the site of phage DNA injection, wefirst determined the location of ManY (PtsM), an innermembrane protein that is known to be required forphage l DNA injection (Scandella and Arber, 1974).ManY is the mannose-specific enzyme IICMan componentof the sugar phosphotransferase system (PTS); a poly-topic inner membrane component of the mannose-specific ABC transporter. It lies within the pel locus,which was shown in early work to be required for injec-tion of phage l DNA into E. coli (Williams et al., 1986). Ifphage injection occurred preferentially at the pole, onewould expect ManY to be preferentially at the pole aswell. To determine the localization of ManY, we gener-ated a GFP–ManY protein fusion, expressed under thecontrol of the arabinose promoter PBAD. Expression ofGFP–ManY rescued the ability of l to produce plaqueson a lawn of a manY mutant of E. coli (data not shown),indicating that the GFP–ManY fusion is functional for lDNA injection. GFP–ManY localized to the poles and/orto the cell division sites of manY E. coli cells in 87% ofcells (Fig. 3B, left), whereas the expression of GFPalone showed uniform diffused fluorescence (foci at thepole and/or mid-cell was observed in < 1% of the cellsexpressing GFP alone). These results and the observa-tion that Enzyme I, which carries the first enzymatic stepin the PTS pathway, is also localized to the cell poles(Patel et al., 2004) suggest that the observed polarlocalization of GFP–ManY is specific and functional.As expected from our model, localization of QDot-

conjugated phage to the cell poles was unperturbed incells carrying a deletion in manY or pel (Fig. 3A), asManY/Pel is not required for phage adsorption, but for alater step of phage DNA injection.

Localization of injected phage l DNA

To test whether DNA injection takes place at the poles,we constructed a l phage carrying an array of 64 lacoperators (Lau et al., 2003; Fekete and Chattoraj, 2005).The expression of LacI–GFP was induced for 1 h prior tophage infection. Following infection, phage genomes car-rying the cluster of LacO appeared near the pole andremained there during replication, as indicated byincreasing fluorescence in time-lapse images (Fig. 4).This result suggests that, as for phage particles adsorp-tion, DNA injection occurs preferentially at the poles. Incontrast, we found that cells with stable lysogens, inwhich the phage genome is integrated at the attl of thebacterial genome, contained two LacI–EYFP foci thatappear, as expected, in the nucleoid region (data notshown). Unlike the cellular replication machinery, whichhas been suggested to localize to mid-cell (Li et al.,

Fig. 3. Localization of QDot-labelled l phage and GFP–ManY in amanY strain.A. Infection of E. coli manY mutant cells with QDot-labelled phagel.B. Distribution of GFP signal from E. coli BW25113 DmanY::Kanexpressing GFP–ManY (left) or GFP alone (right). Directfluorescence microscopy of GFP signal. Images are representativeof those obtained in three experiments. Arrows, foci at the bacterialpole; arrowheads, foci at mid-cell.



2002), phage DNA-associated replisomes appear to bereplicated at the subcellular position of the injected DNA,at the pole, as has also been shown for the replisomesassociated with a multicopy plasmid in Bacillus subtilis(Wang et al. 2004).

FtsH, a protein involved in l phage lysis-lysogenydetermination, is localized to the pole

The protease FtsH (HflB) degrades phage l CII and CIIIIproteins and thereby affects whether infecting l phage willfollow the lytic or the lysogenic pathway. ftsH mutationsstabilize the CII and CIII proteins, resulting in higher levelsof the CI repressor synthesis and thus shifting the lytic-lysogenic decision in favour of lysogeny (Herman et al.,1997). In B. subtilis, during vegetative growth, FtsH accu-mulates in the mid-cell septum, whereas at the onset ofsporulation, at positions near the cell poles that appearsto coincide with future division sites (Wehrl et al., 2000).To determine the localization of FtsH in E. coli, we con-structed a protein fusion of GFP to FtsH. The C-terminusof FtsH undergoes proteolytic cleavage, a self-catalysedreaction that requires ATP hydrolysis (Akiyama, 1999).While complementation experiments with genetically con-structed variants suggested that both the processed and

the unprocessed forms of FtsH are functional (Akiyama,1999), for the localization studies we fused GFP to theuncleaved N-terminus of FtsH. The fusion protein wasfunctional, as determined by its ability to complement llytic growth on an ftsH-deleted strain, which dose notsupport the lytic cycle. The efficiency of plating (PFU)increased by 103 on the ftsH-deleted host (data notshown). Fluorescence microscopy showed that the GFP–FtsH fusion forms foci that are predominantly polar in thecell (Fig. 5), consistent with FtsH being localized mainly tothe bacterial pole. The concentration of FtsH at the polesuggests that CII expressed from l phage that infects atthe pole may be more susceptible to degradation by FtsHthan CII expressed from l phage that infects at othersites.

Model for l infection and the lytic-lysogenic decision

The results presented above lead us to propose a workingmodel for phage infection that is illustrated in Fig. 6. Aninfecting phage l first encounters one of the many LamBreceptors on the cell surface and then the LamB bound lphage migrates along the cell surface. At the poles, itencounters a ‘slot’ or interacts with additional proteins,which stops its movement. The DNA is injected at thepoles, with the help of ManY, where phage replicationoccurs. As FtsH localizes preferentially to the cell pole, theCII protein, the major player in the lytic-lysogenic cycledecision, is subject to degradation. Consequently, thephage that infects at the pole (at low moi) is more likely toend up in the lytic cycle. At high moi, where it has beenshown that lysogenization is preferable (Kourilsky, 1973),phages stop their movement at sites other than the pole.DNAinjection at these sites might be less efficient as ManYlocalization is preferentially to the pole and mid-cell.Because FtsH is preferentially localized to the pole, CIIexpressed by phage that inject DNA at these other sitesmay be less apt to be degraded, favouring lysogenization.In addition, CII and CIII expressed by phage that infects at

Fig. 4. Monitoring the localization of phage DNA in lytic cycle.Cells carrying a plasmid expressing LacI–GFP were infected byphage l that contain an array of lac operators in its genome.A. Snapshot gallery.B. Time-laps picture taken at 5, 10, 15, 27 and 57 min afterincubation at 37°C following infection at room temperature. Cellsafter l phage DNA injection at the pole (left) or mid-cell (right).

Fig. 5. FtsH, a protein involved in l phage lysis-lysogenydetermination, is localized to the pole. Localization of theGFP–FtsH fusion protein expressed in an ftsH strain.



the pole may titrate the FtsH locally, thereby leading toaccumulation of CII expressed by phages that infect atnon-polar sites. CII protein, made at latter sites, can thendiffuse through the cell to its other targets, as supported bya diffuse fluorescent signal from the functional CII–GFPfusion protein expressed from a plasmid (data not shown).

Why then do phages (l, T4, T7, P1 Yersinia phagefA1122 and vibriophage KVP40 tested in the presentstudy) attach to the polar regions of the cell? It is possiblethat the polar region is the preferred place for DNA injec-tion to take place, as uptake of DNA by naturally compe-tent bacteria also occurs at the pole (Chen et al., 2005).The polar localization of ManY and FtsH supports thisnotion, as does the reported polar localization of FhuD(see http://ecoli.naist.jp). The identification of host compo-nents essential for DNA injection of other phages and thelocalization of these host components remains to beinvestigated. The nucleoid-free cytoplasm at the cell polescould also provide a space for rapid phage DNA replica-tion following infection. Regardless of the evolutionaryforces, the data presented here indicate that phages haveevolved mechanisms to utilize the asymmetry that ispresent in Gram-negative bacteria.

Experimental procedures

Bacteria strains plasmid and phage

Standard microbiological techniques were used for growthand manipulation of bacteria and phage (Miller, 1972; Mania-tis et al., 1982; Sambrook et al., 1989). The phages l cI857S7,f80, H-19B, P1vir, T4, T7 and Yersinia phage fA1122 arefrom our collection. Phage KVP40 was kindly supplied by theD. Hinton laboratory. Bacterial strains E. coli K-12 C600 andW3110, Y. pseudotuberculosis, are from our collection.V. cholera was kindly provided by the D. Chattoraj laboratory.Other strains include the ftsH deletion strain, which is W3110sfhC ZAD220::Tn10 ftsH3::Kan (Ogura et al., 1999). To gen-erate a lysate of l I29 CIts 64 lacO Kan, an overnight cultureof the lysogen MG1655 gal::64 l cIO cm, attB::l I29 CIts 64lacO Kan was grown at 30°C in LB medium supplementedwith the appropriate antibiotics. It was then back-diluted1:100 into the same medium, grown for 4 h at 32°C, and thenshifted to 42°C until lysis was visible.

For the localization of l phage DNA, we used E. coli strainBW27750, which allows uniform expression of genes underthe control of the arabinose promoter (PBAD) among cells inthe population (Khlebnikov et al., 2001). As a source of LacI–EYFP (an enhanced yellow-green variant of the AequoreaVictoria GFP) we have used the low-copy-number plasmids

Fig. 6. A schematic model for phageinfection (not to scale). An infecting phagel first encounters one of the many LamBreceptors on the cell surface. It moves whilebound to LamB and migrates along the cell tothe poles where interaction with additionalhost proteins takes place. The DNA is injectedat the poles, a process that depends on thepolar protein ManY. Following DNA injection,phage replication occurs at the pole; hostand phage proteins required for phagedevelopment are colocalized at the poles. Theprotease FtsH, which is localized at the pole,degrades CII, leading to the lytic cycle. Ifmore then one phage binds a cell (right), CIIfrom the phage infecting in a location otherthan the pole is not degraded. Due to theeffect of CII, which diffuses throughout thecytoplasm, including to phage DNA thatwas injected at the pole, lysogenization isestablished. IM, inner membrane; OM, outermembrane.



http://ecoli.naist.jp

pRFY001 in which the fusion protein is cloned under thecontrol of the arabinose promoter (Lau et al., 2003; Feketeand Chattoraj, 2005).

The pR’tR’–GFP expression plasmid used for viability testsof the labelled l phage carries GFP under the control of thel promoter-terminator (l coordinates 5′-44300 and 44831-3′)(Marr et al., 2001).

pBAD24–gfp::manY and pBAD24–gfp::ftsH were obtainedby cloning the coding sequences of manY or ftsH under thecontrol of the arabinose promoter, downstream of gfp inpBAD–gfp (Nilsen et al., 2004) as a translational fusion.

For localization of GFP–ManY, strain BW25113 DmanY::Kan and its isogenic strain BW25113 (Baba et al., 2006) weretransformed with plasmids pBAD24–gfp or pBAD24–gfp::manY.

Construction of (lacO64) phage

The l (lacO64) phage was constructed by in vivo recom-bineering (Thomason et al., 2005). First, the R6Kg/zeoplasmid was constructed by ligating the 814 bp XmnI–EcoRIfragment of pGEM-4Z (Promega) with the 324 bp HindIII–PvuII fragment of plasmid pMOD™-3<R6Kgori/MCS>(Epicentre) zeocin resistance cassette of pEM7/zeo (Invitro-gen), which was amplified by PCR using primers containingEcoRI and HindIII restriction sites, and digested with thecognate enzymes. The R6Kg/zeo plasmid was maintained inE. coli EC100 pir+ host expressing the P protein required forreplication of plasmids containing the R6Kg origin ofreplication. The regions of 46368–46465 and 47981–48387of bacteriophage l (GenBank Accession No. J02459) wereamplified by PCR using the primer pairs of l64upNdeI(GAAAACATATGATATCACTATGCAAAAACAACTGGAAGGAAC) and l64upPvuII (AAAAGGATCCAGCTGCTCGGTTTTATTACTTTAGGC), or l64downRI (AAAAGAATTCGATATCGTATTAATTGATCTGCATCAACTTAAC) and l64downPvuII(AAAAGGATCCTTACTGCAATGCCCTCGTAATTAAGT) res-pectively. The PCR product of the 46368–46465 region wasdigested with NdeI and BamHI, and the PCR product of47981–48387 region was digested with EcoRI and BamHI.The fragments were inserted between the EcoRI and NdeIends of plasmid R6Kg/zeo in a three-piece ligation reaction,resulting in R6Kg/l. The ends of the 4070 bp NdeI fragmentof plasmid pRFB110 (Fekete and Chattoraj, 2005), containingan array of 64 lac operator sites and a kanamycin resistancecassette, were filled in using the Klenow fragment of DNApolymerase. The fragment was then inserted at the PvuII sitelocated between the two l phage-derived sequences ofR6Kg/l. Finally, the resulting plasmid was digested withEcoRV, and the linear fragment containing the array of 64 lacoperator sites and the kanamycin resistance cassette flan-ked by the l phage-derived sequences was recombinedonto a lI21CIts prophage by recombineering, and reco-mbinant phages were isolated as kanamycin-resistantcolonies.

Chemical modification of bacteriophages

CsCl-purified or crude bacteriophage lysates were incub-ated with 4 mM EZ-LinkTM Sulpho-NHS-LC-LC-Biotin

[sulphosuccinimidyl-6-(biotinamido)-6-hexanamido hex-anoate] (PIERCE). A 10 mM solution was made in 1¥ PBS towhich 10 mM MgSO4 was added and the solution was diluted10- or 100-fold. After 30 min at room temperature the reactionwas stopped by the addition of glycine to a final concentrationof 0.025%. Conditions were optimized to have minimal effecton phage viability as tested by direct plaque assay.

Preparation of samples for fluorescence and TEM

For phage binding localization, cells were grown to exponen-tial phase (with 0.2% maltose for l phage, with 2 mg ml-1

aztreonam for experiments in filamented cells) in LB mediumand mixed with appropriate chemically modified bacterioph-age. After incubation at room temperature, samples werecentrifuged for 5 min at 2300 g and re-suspended in PBSbuffer. Alternatively, infected cells were incubated at 37°C foradditional 5 min to induce bacteriophage DNA injection. Forfluorescence microscopy, Qdot® 655 streptavidin conjugates(Invitrogen) were added in excess, followed by a 5 min incu-bation at room temperature and spin as before.

For l phage DNA localization, an overnight culture ofBW27750 strain carrying pRFY001 was diluted 1:100 inminimal medium + maltose and grown to OD600 0.2. Arabinoseat a concentration of 0.00002% was added to induce theexpression of LacI–EYFP for 1 h. Cells were concentrated toOD600 10 and phage l was added followed by incubation for20 min on ice and additional 5 min at 37°C. About 3 ml of cellswere then placed on a slide and overlaid with a coversliptreated with poly-L-lysine (Sigma Diagnostics).

For time-lapse microscopy, slides with 1.5% agarose(Seakem GTG Agarose, Cambrex Bio Science Rockland) inminimal medium were prepared. About 3 ml of cells were thenplaced on a slide and overlaid with a coverslip. The micro-scope stage was maintained at 37°C.

The expression of GFP–ManY or GFP–FtsH was inducedby adding arabinose to exponential-phase cells to a concen-tration of 0.2% for 30–60 min at 37°C. Cells were thenharvested, washed and observed using a fluorescentmicroscope.

Fluorescence microscopy

Most microscopy was performed on an Eclipse E1000microscope (Nikon), using a Sensicam QE CCD camera(Cooke Corporation) controlled by IP Laboratories software(Scanalytics). Approximately 2 ml of samples were placed ona slide and overlaid with a coverslip or coverslip treated withpoly-L-lysine (Sigma Diagnostics).

GFP–ManY fluorescence microscopy was performed usinga 100¥ oil immersion objective on a TE300 microscope(Nikon) with Chroma Technology filters. Images were cap-tured using a Photometrics CoolSnap HQ charge-coupleddevice camera and IP Laboratory software (Scanalytics).

Transmission electron microscopy

QDots-conjugated CsCl-purified lcI857susS7 or CsCl-purified lcI857susS7 phage that had been incubated withlate exponential-phase W3110 cells grown in LB with 0.25%



maltose at the indicated moi was used as samples. Fourmicrolitres of the sample to be examined was applied as adrop to a carbon-coated, glow-discharged specimen grid.After 30 s the excess liquid was wicked away by filter paperand the grid was negatively stained by allowing several dropsof 1% aqueous uranyl acetate to flow over the grid. Speci-mens were examined in a FEI Tecnai12 operating at 120 kVand images were recorded on a Gatan CCD Camera.

Acknowledgements

We thank Debbie Hinton for the vibriophage KVP40, and IlanRosenshine for fruitful discussions. This research was sup-ported in part by The Israel Science Foundation (Grant No.489/01-1 and 340/04), by the Intramural Research Programof the National Institutes of Health, National Cancer Institute,Center for Cancer Research, and by NIH Grants AI35817 andAI071240 (to M.B.G.).

References

Adam, M., Fraipont, C., Rhazi, N., Nguyen-Distèche, M.,Lakaye, B., Frère, J.-M., et al. (1997) The bimodular G57–V577 polypeptide chain of the class B penicillin-bindingprotein 3 of Escherichia coli catalyzes peptide bond forma-tion from thiolesters and does not catalyze glycan chainpolymerization from the lipid II intermediate. J Bacteriol179: 6005–6009.

Akiyama, Y. (1999) Self-processing of FtsH and its implica-tion for the cleavage specificity of this protease. Biochem-istry 38: 11693–11699.

Baba, T., Ara, T., Hasegawa, M., Takai, Y., Okumura, Y.,Baba, M., et al. (2006) Construction of Escherichia coliK-12 in-frame, single-gene knockout mutants: the Keiocollection. Mol Syst Biol 2: 1–11.

Boos, W., and Shuman, H. (1998) Maltose/maltodextrinsystem of Escherichia coli: transport, metabolism, andregulation [Review]. Microbiol Mol Biol Rev 62: 204–229.

Brandon, L.D., Goehring, N., Janakiraman, A., Yan, A.W.,Wu, T., Beckwith, J., and Goldberg, M.B. (2003) IcsA, apolarly-localized autotransporter with an atypical signalpeptide, uses the Sec apparatus for secretion, although theSec apparatus is circumferentially distributed. Mol Micro-biol 50: 45–60.

Charles, M., Pérez, M., Kobil, J.H., and Goldberg, M.B.(2001) Polar targeting of Shigella virulence factor IcsA inEnterobacteriacae and Vibrio. Proc Natl Acad Sci USA 98:9871–9876.

Chen, I., Christie, P.J., and Dubnau, D. (2005) The ins andouts of DNA transfer in bacteria [Review]. Science 310:1456–1460.

Feilmeier, B.J., Iseminger, G., Schroeder, D., Webber, H.,and Phillips, G.J. (2000) Green fluorescent protein func-tions as a reporter for protein localization in Escherichiacoli. J Bacteriol 182: 4068–4076.

Fekete, R.A., and Chattoraj, D.K. (2005) A cis-actingsequence involved in chromosome segregation in Escheri-chia coli. Mol Microbiol 55: 175–183.

Garcia, E., Elliott, J.M., Ramanculov, E., Chain, P.S., Chu,M.C., and Molineux, I.J. (2003) The genome sequence of

Yersinia pestis bacteriophage phiA1122 reveals an intimatehistory with the coliphage T3 and T7 genomes. J Bacteriol185: 5248–5262.

Gibbs, K.A., Isaac, D.D., Xu, J., Hendrix, R.W., Silhavy, T.J.,and Theriot, J.A. (2004) Complex spatial distribution anddynamics of an abundant Escherichia coli outer membraneprotein, LamB. Mol Microbiol 53: 1771–1783.

Hashemolhosseini, S., Holmes, Z., Mutschler, B., andHenning, U. (1994) Alterations of receptor specificities ofcoliphages of the T2 family. J Mol Biol 240: 105–110.

Herman, C., Thevenet, D., D’Ari, R., and Bouloc, P. (1997)The HflB protease of Escherichia coli degrades its inhibitorl cIII. J Bacteriol 179: 358–363.

Janakiraman, A., and Goldberg, M.B. (2004) Evidence forpolar positional information independent of cell division andnucleoid occlusion. Proc Natl Acad Sci USA 101: 835–840.

Kaiser, D., and Dworkin, M. (1975) Gene transfer to myxo-bacterium by Escherichia coli phage P1. Science 187:653–654.

Khlebnikov, A., Datsenko, K.A., Skaug, T., Wanner, B.L., andKeasling, J.D. (2001) Homogeneous expression of the P(BAD) promoter in Escherichia coli by constitutive expres-sion of the low-affinity high-capacity AraE transporter.Microbiology 147: 3241–3247.

Kobiler, O., Rokney, A., Friedman, N., Court, D.L., Stavans,J., and Oppenheim, A.B. (2005) Quantitative kinetic analy-sis of the bacteriophage lambda genetic network. Proc NatlAcad Sci USA 102: 4470–4475.

Kourilsky, P. (1973) Lysogenization by bacteriophagelambda. I. Multiple infection and the lysogenic response.Mol Gen Genet 122: 183–195.

Lau, I.F., Filipe, S.R., Soballe, B., Okstad, O.A., Barre, F.X.,and Sherratt, D.J. (2003) Spatial and temporal organizationof replicating Escherichia coli chromosomes. Mol Microbiol49: 731–743.

Li, Y., Sergueev, K., and Austin, S. (2002) The segregation ofthe Escherichia coli origin and terminus of replication. MolMicrobiol 46: 985–996.

Mangenot, S., Hochrein, M., Radler, J., and Letellier, L.(2005) Real-time imaging of DNA ejection from singlephage particles. Curr Biol 15: 430–435.

Maniatis, T., Fritsch, E.F., and Sambrook, J.F. (1982) Molecu-lar Cloning: A Laboratory Manual. Cold Spring Harbor Labo-ratory, NY: Cold Spring Harbor Laboratory Press.

Marr, M.T., Datwyler, S.A., Meares, C.F., and Roberts, J.W.(2001) Restructuring of an RNA polymerase holoenzymeelongation complex by lambdoid phage Q proteins. ProcNatl Acad Sci USA 98: 8972–8978.

Miller, J.H. (1972) Experiments in Molecular Genetics. ColdSpring Harbor, NY: Cold Spring Harbor Laboratory Press.

Miller, E.S., Heidelberg, J.F., Eisen, J.A., Nelson, W.C.,Durkin, A.S., Ciecko, A., et al. (2003) Complete genomesequence of the broad-host-range vibriophage KVP40:comparative genomics of a T4-related bacteriophage.J Bacteriol 185: 5220–5233.

Nilsen, T., Ghosh, A.S., Goldberg, M.B., and Young, K.D.(2004) Branching sites and morphological abnormalitiesbehave as ectopic poles in shape-defective Escherichiacoli. Mol Microbiol 52: 1045–1054.

Ogura, T., Inoue, K., Tatsuta, T., Suzaki, T., Karata, K.,Young, K., et al. (1999) Balanced biosynthesis of major



membrane components through regulated degradation ofthe committed enzyme of lipid A biosynthesis by the AAAprotease FtsH (HflB) in Escherichia coli. Mol Microbiol 31:833–844.

Patel, H.V., Vyas, K.A., Li, X., Savtchenko, R., and Roseman,S. (2004) Subcellular distribution of enzyme I of theEscherichia coli phosphoenolpyruvate: glycose phospho-transferase system depends on growth conditions. ProcNatl Acad Sci USA 101: 17486–17491.

Ptashne, M. (2004) A Genetic Switch: Phage Lambda Revis-ited, 3rd edn. Cold Spring Harbor, NY: Cold Spring HarborLaboratory Press.

Ryter, A., Shuman, H., and Schwartz, M. (1975) Intergrationof the receptor for bacteriophage lambda in the outermembrane of Escherichia coli: coupling with cell division.J Bacteriol 122: 295–301.

Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989) Molecu-lar Cloning: A Laboratory Manual, 2nd edn. Cold SpringHarbor, NY: Cold Spring Harbor Laboratory Press.

Scandella, D., and Arber, W. (1974) An Escherichia colimutant which inhibits the injection of phage lambda DNA.Virology 58: 504–513.

Steven, A.C., Trus, B.L., Maizel, J.V., Unser, M., Parry, D.A.,Wall, J.S., et al. (1988) Molecular substructure of a viralreceptor-recognition protein. The gp17 tail-fiber of bacte-riophage T7. J Mol Biol 200: 351–365.

Suttle, C.A. (2005) Viruses in the sea [Review]. Nature 437:356–361.

Szmelcman, S., and Hofnung, M. (1975) Maltose transport inEscherichia coli K-12: involvement of the bacteriophagelambda receptor. J Bacteriol 124: 112–118.

Thomason, L.C., Bubunenko, M., Costantino, N., Wilson,H.R., Oppenheim, A., Datta, S., and Court, D.L. (2005)Recombineering: genetic engineering in bacteria usinghomologous recombination. In Current Protocols inMolecular Biology. Ausubel, F.M., Brent, R., Kingston,R.E., Moore, D.D., Seidman, J.G., Smith, J.A., andStruhl, K. (eds). New York, N.Y.: Wiley, pp. 1.16.11–1.16.21.

Wang, J.D., Rokop, M.E., Barker, M.M., Hanson, N.R., andGrossman, A.D. (2004) Multicopy plasmids affect repli-some positioning in Bacillus subtilis. J Bacteriol 186: 7084–7090.

Wehrl, W., Niederweis, M., and Schumann, W. (2000) TheFtsH protein accumulates at the septum of Bacillus subtilisduring cell division and sporulation. J Bacteriol 182: 3870–3873.

Williams, N., Fox, D.K., Shea, C., and Roseman, S. (1986)Pel, the protein that permits lambda DNA penetration ofEscherichia coli, is encoded by a gene in ptsM and isrequired for mannose utilization by the phosphotransferasesystem. Proc Natl Acad Sci USA 83: 8934–8938.



Bacteriophage infection is targeted to cellular poles

Documents

Transcript of Bacteriophage infection is targeted to cellular poles