Association of interleukin-18 gene polymorphism with susceptibility to visceral leishmaniasis in...

Research ArticleAssociation of Interleukin-18 Gene Polymorphismwith Susceptibility to Visceral Leishmaniasis in EndemicArea of Bihar an Indian Population

Dinesh Kumar Puja Tiwary Jaya Chakravarty and Shyam Sundar

Infectious Disease Research Laboratory Department of Medicine Institute of Medical Sciences Banaras Hindu UniversityVaranasi Uttar Pradesh 221 005 India

Correspondence should be addressed to Shyam Sundar drshyamsundarhotmailcom

Received 30 July 2014 Revised 24 September 2014 Accepted 25 September 2014 Published 22 October 2014

Academic Editor Hidenori Ohnishi

Copyright copy 2014 Dinesh Kumar et al This is an open access article distributed under the Creative Commons Attribution Licensewhich permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited

Interleukin-18 (IL-18) is a cytokine that mediates Th1 response by inducing interferon-gamma (IFN-120574) production in T cells andnatural killer cells Genetic polymorphisms in the IL-18 gene have been found to be associated with its expression in cancertuberculosis HBV infection and various other diseases Lower plasma level of IL-18 in visceral leishmaniasis (VL) patientsmight be associated with polymorphisms in the regulating or coding region of the gene Three single nucleotide polymorphisms(SNPs) rs1946519 (minus656GT) and rs187238 (minus137GC) in the promoter region and rs549908 (+105AC) in the codon region weregenotyped in 204 parasitological confirmed VL patients and 267 controls with no past history of VL For each locus polymerasechain reaction (PCR) followed by restriction digestion was performed IL-18 expression in peripheral blood mononuclear cells(PBMC) collected from VL patients and controls was measured by quantitative real-time RT-PCR Distribution of G allele atposition minus656 (119875 lt 00001) and double haplotypes GGCGGA (119875 = 005) were found to be significantly associated with controlswhile genotypes TT (119875 lt 00001) and single haplotypes TGA (119875 = 00002) with cases The inheritance of G allele at the positionminus656 might be considered as a protective allele for VL

1 Introduction

Visceral leishmaniasis (VL) is a potentially fatal infectiousdisease caused by the intracellular protozoan parasites Leish-mania donovani and Leishmania infantum (chagasi) VL isresponsible for significant morbidity and mortality in theIndian subcontinent and Brazil The secondary infectionsresponsible for many deaths may be due to the immunocom-promised status of VL patients The mechanisms preventingclearance of the infection and underlying the predispositionof VL patients to secondary infections are not well known

A key immunological feature of VL is the inability ofperipheral blood mononuclear cells (PBMCs) to proliferateor to produce interferon-120574 (IFN-120574) in response to leishmanialantigens [1 2] Interleukin-18 (IL-18) is a member of the IL-1cytokine family and plays an important role in both kinds ofimmunity innate and acquired Initially it was characterizedby its capacity to promote Th1 responses in synergy with IL-12 [3] Th1-type immunity triggers enhanced leishmanicidal

activity in infected macrophages thus playing a protectiverole IL-18 has been described for broader properties inthe acquired immune responses It was shown to induceproliferation of T-cell IL-12R120572 expression IFN-120574 TNF-120572and GM-CSF production byTh1 clones [4] However at earlystages of T cell differentiation IL-18 can promote either Th1or Th2 responses independently of IL-4 or IL-12 suggestingits broader role in functional T cell differentiation [5]

IL-18 also was shown to induce IFN-120574 production by NKcells suggesting its involvement in the innate responses [6]After exposure to IFN-120574 intracellular killing in macrophagesinvolves mono-xidative mechanisms through the generationof nitric oxide and itsmetabolites fromL-arginine in presenceof nitric oxide synthase [7] Previous studies demonstratedthat IL18 upregulates the expression of intracellular adhesionmolecule-1 (ICAM-1) and vascular cell adhesion molecule-1(VCAM-1) on the endothelial cells that play important role ininflammation process [8]

Hindawi Publishing Corporatione Scientific World JournalVolume 2014 Article ID 852104 6 pageshttpdxdoiorg1011552014852104

2 The Scientific World Journal

Table 1 Characteristics of the subjects

Characteristic Case (119899 = 204) Control (119899 = 267)Age (mean plusmn SD) (yr) 249 plusmn 121 352 plusmn 126

Sex (no malesnofemales) 94110 124143

Fever history (mean plusmnSD) (days) 455 plusmn 477

Spleen size (mean plusmnSD) (cm) 380 plusmn 192

HIV status Negative Negative

Several studies in other disease models have shown theassociation of differential plasma level of IL-18 with the singlenucleotide polymorphisms (SNPs) in its encoding region[9ndash11] Such studies clearly point towards possibility of thegene polymorphisms in affecting susceptibility or protectiontowards the same disease in different individuals [12ndash14]Recently Moravej et al has found the association of IL-18gene polymorphism with VL in Iranian population [15] Theimportance of IL-18 in the defence against VL and the effectof gene polymorphism on its production in other diseasesinspired us to investigate the probable association betweenIL-18 gene polymorphism and VL disease susceptibility inIndian population

2 Materials and Methods

21 Subjects A total of 471 subjects were enrolled for thestudy 204 parasitologically confirmed VL patients wereadmitted at Kala-Azar Medical Research Centre in Muzaf-farpur Bihar Characteristics of all the subjects are shown inTable 1 The inclusion criteria included subjects aged morethan two years with sign and symptoms of VL and confirmedby microscopic identification of parasite in their splenicbiopsies Healthy controls were the subjects living in theendemic area with no history of VL aged more than 18 yearsand also with negative serology

The study was approved by the Ethical Committee ofthe Institute of Medical Sciences Banaras Hindu UniversityVaranasi Written informed consents were obtained from allparticipating subjects

22 Sample Collection and Storage Peripheral blood wasdrawn from each subject and collected in citrate vacutainers(BD Biosciences) and stored at 4∘C until DNA isolation 5mLblood was drawn from 13 cases and 13 controls for isolationof PBMC and stored in RNAlater (Qiagen Hilden) at minus80∘Cuntil RNA extraction

23 DNA and RNA Extraction DNA was isolated from200120583L peripheral blood using QIAamp Blood DNAmini kit(Qiagen) while RNA was isolated from PBMC using RNeasymini kit (Qiagen Hilden) as per the manufacturerrsquos protocolAll the samples were quantified using NanoDrop 2000c andaliquoted in triplicate to avoid damage during repeated freezethawing and stored

24 IL-18 Expression Study 1 120583g RNA was isolated fromPBMC was reverse transcribed in a 20120583L reaction usingHigh Capacity cDNA Reverse Transcription Kit (InvitrogenUSA) andwas diluted 10 timeswith RNase freewater for finalconcentration of 5 ng120583L TaqMan gene expression assays(Applied Biosystems USA) for IL-18 (Hs01038788) were usedto perform expression studies with 18S rRNA (PN 4319413E)used as an endogenous control and run on 7500 Real-TimePCR System (Applied Biosystems USA) All samples wererun in duplicate along with no template master mix asnegative controls in each plate Results were analysed by 7500software v201 (Applied Biosystems) and Graph pad prism5 Unpaired two-tailed 119905-tests were used to compare IL-18expression level in cases and controls

25 Genotyping PCR-RFLP based method was used todetect polymorphism in IL-18 gene Three SNPs rs1946519(minus656 GT) and rs187238 (minus137 GC) of promoter regionand rs549908 (+105 AC) of codon region were selectedfor the study For each polymorphism a specific PCR-RFLP was done using method described previously [13]with few modifications (Table 2) PCR was performed in25 120583L reaction mixture using 100 ng genomic DNA with15 U Taq DNA polymerase (New England Bio labs UK)supplemented with 10X Taq DNA polymerase buffer 15mMMgCl

2 25 120583M dNTPs and 10 pM of forward and reverse

primers Each amplified product was digested by specificrestriction enzymes (Fermentas) and electrophoresed ona 3 (wv) ethidium bromide (Merck Mumbai) stainedagarose gel (Sigma-Aldrich St Louis USA) and visualised onUV transilluminator

26 Statistical Analysis Allele and genotype frequencies ofthree SNPs were estimated by observing the digested frag-ments All the data was entered into EPI info 2000 1205942 testodds ratio and 95 confidence interval were calculated byGraphPad prism 5 and SPSS software version 16 SNPStatssoftware was used to estimate the haplotypes frequenciesand Hardy-Weinberg equilibrium The 119875 values lt 00015were considered as statistically significant after Bonferronicorrection for multiple tests The linkage disequilibrium(LD) measurings 1198772 and 1198631015840 were estimated by LD2SNPingprogram V 20 (httpbiokuasedutwLD2SNPing)

3 Results and Discussion

Quantitative real-time RT-PCR was done to observe expres-sion level of IL-18 in PBMC collected from 13 patients and 13controls and it was found significantly upregulated in controls(119875 lt 00377) (Figure 1)

PCR-RFLP methods were used to analyse the IL-18 geneSNPs and the electrophoretic pattern was shown in Figure 2

The frequency of G allele at position minus656 was foundsignificantly higher in the control group as compared to cases(7060 versus 5686 119875 lt 00001 OR = 0549 95 CI =0419ndash0719 and study power 992) while frequency of Gallele at minus137 was found significantly higher in cases (7819versus 7191 119875 = 002 OR = 140 95 CI = 103ndash189 and

The Scientific World Journal 3

Table 2 Polymerase chain reaction (PCR) primers and condition for IL-18 gene amplification

SNPs PCR primersAnnealingtemperature

(∘C)

Restrictionenzymes

Fragment sizes(bp)

+105(AC)

F AGATTTAATGTTTATTGTAGAAAACCTGGGACTCR CAGTCATATCTTCAAATAGAGGCCG 55 Dde I A 109 + 32

C 141minus656(GT)

F AGGTCAGTCTTTGCTATCATTCCAGGR CTGCAACAGAAAGTAAGCTTGCGGAGAGG 60 Mwo I G 96 + 24

T 120minus137(GC)

F CACAGAGCCCCAACTTTTTACGGCAGAGAAR GACTGCTGTCGGCACTCCTTGG 60 Mbo II G 116 + 39

C 155

Case Control

16

18

20

22

24

P lt 00377

Figure 1 The expression level of IL-18 gene is determined by RT-PCR in cases of VL and healthy controls The solid line representscutoff value and dot represents individual subjects

study power 5942) At position +105 both A and C alleleswere equally distributed in cases and controls (7603 119875 =080 OR = 103 95 CI = 076ndash140 and study power 370)The distributions of genotypes were according to the Hardy-Weinberg equilibrium

At the position minus656 the TT genotype frequency wassignificantly higher in cases while at other positions minus137and +105 no significant difference was found between casesand controls The genotypes minus656 GG minus137 GG +105AA were frequently distributed in both cases and controls(Table 3) The distribution of haplotypes in IL-18 polymor-phism showed that the frequency of GGA at positions minus656minus137 and +105 was higher in control (3831 119875 = 023 OR =0792 95 CI = 054ndash1161 and study power 2212) GGAhaplotypes were the most frequently distributed in all thesubjects while haplotypes TGA were higher in cases (2833versus 1449 119875 = 00002 OR = 230 95 CI = 147ndash368and study power 9552)

32 double haplotypes were constructed in the presentstudy The frequencies of the commonly distributed hap-logenotypes were shown in Table 4 and those haplotypeshaving frequencies less than 5 were omitted from the tableThe distribution of TGAGGA haplogenotypes was foundto be higher in cases (1863 versus 1124 119875 = 002OR = 180 95 CI = 107ndash303 and study power 6158)but the 119875 value could not tolerate Bonferroni correctionThe haplogenotypes GGCGGA were found more frequently

distributed in controls (1116 versus 637 119875 = 005 OR =005 95 CI = 026ndash108 and study power 4903)

The strong LDs were detected between all SNPs in bothcontrols and cases (Figures 3 and 4)

IL-18 has been classified in the IL-1 family in virtueof structural similarity to IL-1120573 Its ability to induce IFN-120574 from Th1 and NK cell separates it from IL-1 Thus IL-18 was originally identified as an IFN-120574 inducing factorsSome studies revealed that IL-18 induces the production ofTh2 cytokines from T-cell NK cell basophiles and mastcells [16ndash20] Moreover IL-18 can directly enhance theproliferation and cytotoxicity of Tc cell and NK cell [21ndash24] Thus IL-18 is a pleotropic cytokine which regulates bothnatural and acquired immune response The major sourceis macrophages although many other are also capable ofproducing IL-18 [25 26]

Although the production of IL-18 is affected by manyfactors it could also be affected by genetic variants in its pro-moter region It is tempting to speculate that polymorphismsin the IL-18 promoter could affect its expression Changes inIL-18 expression levelsmight disturb the balance betweenTh1andTh2 cytokine responses

Considering the involvement of IL-18 in affecting thecourse of infection investigating the common genetic vari-ants in IL-18 gene could provide important genetic determi-nants of VL This can lead to new immune-based therapiesby targeting cytokine signalling pathways Taking the roleof IL-18 in VL pathogenesis and the effect of known poly-morphisms in the promoter region in affecting its expressionlevels we wanted to investigate the relationship betweenIL-18 gene variants and susceptibility andor protection toLeishmania infection in North Indian population

Previously studies revealed that the higher production ofIL-18 and IFN-120574 is associatedwith the presence of nucleotidesG and A at the positions minus137 and +105 respectively [9ndash11]So we assumed that these alleles must be more frequentin control group as compared to VL cases but we did notget any significant differences in the distribution of thesealleles between cases and controls Contrary to the twoaforementioned polymorphic sites the frequency of G alleleat the position minus656 was significantly higher in controls thanthe cases Thus G allele at minus656 could be considered as aprotective factor for the VL in our population

In addition to the genotypes and alleles inherited com-bination of SNPs and polymorphic haplotypes can influ-ence predisposition to different diseases The frequency of


200 bp

100 bp

CC GG GC

IL-18 (minus137) IL-18 (+105)

CC AA AC GG GT TT

IL-18 (minus656)

155bp

116 bp

141bp

109 bp

96bp120 bp

Figure 2 The agarose gel electrophoretic patterns of IL-18 gene polymorphism

Table 3 IL-18 genotype and alleles frequencies in VL cases and controls

Genotypes and alleles Patient 119899 () Control 119899 () 1205942

119875 value OR (95 CI) Study power+105Genotypes

AA 114 5588 145 5431 0116 07335 1066 (0739ndash1538) 482CC 5 245 6 225 0021 08846 1093 (0329ndash3633) 268AC 85 4167 116 4345 0149 06989 0930 (0643ndash1345) 542

AllelesA 313 7672 406 7603 0060 08062 1039 (0767ndash1407) 370C 95 2328 128 2397minus656Genotypes

GG 89 4363 133 4981 1776 01827 0780 (0541ndash1125) 2642TT 61 2990 23 861 3576 lt00001 4525 (2685ndash7628) 100GT 54 2647 111 4157 1159 lt00007 0506 (0341ndash0751) 9311

AllelesG 232 5686 377 7060 191 lt00001 0549 (0419ndash0719) 9920T 176 4314 157 2940minus137Genotypes

GG 128 6275 136 5094 6546 00105 1622 (1119ndash2353) 7277CC 13 637 19 712 0101 07507 0888 (0428ndash1844) 446GC 63 3088 112 4195 6064 00138 0618 (0421ndash0908) 6955

AllelesG 319 7819 384 7191 4812 00283 140 (1036ndash1893) 5942C 89 2181 150 2809

haplotypes GGA was higher in controls while frequency ofTGA was significantly higher in cases of VL The inheritanceof GGCGGA haplotypes was significantly distributed incontrol (119875 lt 0052) while TGAGGA was more frequentin cases (119875 lt 002) It can be supposed that the inheritanceof TGAGGA haplogenotypes might be major genetic riskfactor for the occurrence of VL

Previously other published reports revealed associationof IL-18 gene polymorphisms with susceptibility to VL inIranian population with different allele [15] Because ofpopulation specific differences in allele anddisease frequency

the genetic associations become more meaningful whenreplicated in varied ethnic populations Likewise severalstudies have reported the association of IL-18 gene variantsand susceptibility to infectious and noninfectious diseaseslike Brucella infection [27] HBV infection [28] type-1 dia-betes [29] periodontitis [13]

4 Conclusion

The frequency of G allele at position minus656 (rs1946519) wassignificantly associated with protection to VL in our north


Table 4 Frequently occurrence of IL-18 single and double haplotypes distributions in cases and controls

Haplotypes Cases Control 1205942

119875 value OR (95 CI) Study powerSingle haplotypes

GGA 67 (3297) 102 (3831) 1444 02296 0792 (054ndash1161) 2212TGA 58 (2833) 39 (1449) 1352 00002 2333 (1477ndash3684) 9552GCA 23 (1106) 36 (1367) 05148 04731 0785 (0449ndash1375) 1296GGC 19 (945) 40 (1494) 339 00656 0594 (0334ndash1058) 4271TCA 9 (435) 26 (956) 4769 0029 0430 (0196ndash0945) 5807TGC 15 (743) 11 (417) 2318 01279 1845 (0832ndash4089) 3377GCC 7 (338) 10 (368) 003276 08564 0916 (034ndash2467) 281TCC 6 (302) 3 (118) 2038 01534 2608 (0663ndash10263) 3053

Double haplotypesGGAGGA 22 (1078) 39 (1461) 149 022 070 (040ndash123) 2275TGAGGA 38 (1863) 30 (1124) 511 002 180 (107ndash303) 6158GCAGGA 15 (735) 28 (1049) 136 0242 067 (035ndash130) 2102GGCGGA 13 (637) 31 (1161) 374 0052 005 (026ndash108) 4903

0831 0946

0515 0221

0103 0608

minus137

minus137

minus656

minus656

353

353R2

D998400

Figure 3 Linkage disequilibrium (LD) plot of IL-18 polymorphismin 1198772 and D1015840 value in VL patients Dark color cells represent highLD values

0750 0845

0763 0514

0435 0562353

R2

D998400

353 minus656

minus656

minus137

minus137

Figure 4 Linkage disequilibrium (LD) plot of IL-18 polymorphismin 1198772 and D1015840 value in controls Dark color cells represent high LDvalues

eastern populationThus presence of G allele at positionminus656can be considered as a potential candidate as protective allelefor VL

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Authorsrsquo Contribution

DineshKumar Puja Tiwary and Jaya Chakravarty conceiveddesigned and performed the experiments Dinesh KumarPuja Tiwary and Jaya Chakravarty analyzed the data ShyamSundar contributed reagentsmaterialsanalysis tools andDinesh Kumar and Puja Tiwary wrote the paper All of theauthors read and approved the final paper

Acknowledgments

Theauthors would like to thank all the staff of Kala AzarMed-ical Research Centre (KAMRC) a unit of Sitaram MemorialTrust for their assistance in collection of samples used inthis study This work was supported by NIAID NIH Grantno 1P50AI074321 Dinesh Kumar and Puja Tiwary want tothank Council of Scientific and Industrial Research (CSIR)New Delhi India for providing fellowships

References

[1] D L Sacks S L Lal S N Shrivastava J Blackwell and F ANeva ldquoAn analysis of T cell responsiveness in Indian Kala-azarrdquoThe Journal of Immunology vol 138 no 3 pp 908ndash913 1987

[2] A C White Jr M Castes L Garcia D Trujillo and L Zam-brano ldquoLeishmania chagasi antigens recognized in cured vis-ceral leishmaniasis and asymptomatic infectionrdquo AmericanJournal of Tropical Medicine and Hygiene vol 46 no 2 pp 123ndash131 1992


[3] MMunder MMallo K Eichmann andMModolell ldquoMurinemacrophages secrete interferon 120574 upon combined stimulationwith interleukin (IL)-12 and IL-18 a novel pathway of autocrinemacrophage activationrdquo The Journal of Experimental Medicinevol 187 no 12 pp 2103ndash2108 1998

[4] H Okamura S-I Kashiwamura H Tsutsui T Yoshimoto andK Nakanishi ldquoRegulation of interferon-120574 production by IL-12and IL-18rdquo Current Opinion in Immunology vol 10 no 3 pp259ndash264 1998

[5] D Xu V Trajkovic D Hunter et al ldquoIL-18 induces the differen-tiation of Th1 orTh2 cells depending upon cytokine milieu andgenetic backgroundrdquo European Journal of Immunology vol 30no 11 pp 3147ndash3156 2000

[6] K Takeda H Tsutsui T Yoshimoto et al ldquoDefective NK cellactivity and Th1 response in IL-18-deficient micerdquo Immunityvol 8 no 3 pp 383ndash390 1998

[7] S J Green M S Meltzer J B Hibbs Jr and C A Nacy ldquoActi-vated macrophages destroy intracellular Leishmania majoramastigotes by an L-arginine-dependent killing mechanismrdquoJournal of Immunology vol 144 no 1 pp 278ndash283 1990

[8] J CMMorel C C Park J MWoods andA E Koch ldquoA novelrole for interleukin-18 in adhesion molecule induction throughNF 120581B and phosphatidylinositol (PI) 3-kinase-dependent signaltransduction pathwaysrdquo Journal of Biological Chemistry vol276 no 40 pp 37069ndash37075 2001

[9] X H LiangW Cheung C K Heng and D YWang ldquoReducedtranscriptional activity in individuals with IL-18 gene variantsdetected from functional but not association studyrdquoBiochemicaland Biophysical Research Communications vol 338 no 2 pp736ndash741 2005

[10] V Giedraitis B He W-X Huang and J Hillert ldquoCloning andmutation analysis of the human IL-18 promoter a possiblerole of polymorphisms in expression regulationrdquo Journal ofNeuroimmunology vol 112 no 1-2 pp 146ndash152 2001

[11] J Arimitsu T Hirano S Higa et al ldquoIL-18 gene polymorphismsaffect IL-18 production capability by monocytesrdquo Biochemicaland Biophysical Research Communications vol 342 no 4 pp1413ndash1416 2006

[12] M Kalani M Rasouli A Moravej S Kiany and H R RahimildquoAssociation of interleukin-15 single nucleotide polymorphismswith resistance to brucellosis among Iranian patientsrdquo TissueAntigens vol 78 no 5 pp 352ndash358 2011

[13] M Folwaczny J Glas H-P Torok et al ldquoPolymorphisms of theinterleukin-18 gene in periodontitis patientsrdquo Journal of ClinicalPeriodontology vol 32 no 5 pp 530ndash534 2005

[14] A Moravej M Rasouli M Kalani et al ldquoIL-1120573 (-511TC)gene polymorphismnot IL-1120573 (+3953TC) and LT-120572 (+252AG)gene variants confers susceptibility to visceral leishmaniasisrdquoMolecular Biology Reports vol 39 no 6 pp 6907ndash6914 2012

[15] A Moravej M Rasouli S Asaei M Kalani and Y MansoorildquoAssociation of interleukin-18 gene variants with susceptibilityto visceral leishmaniasis in Iranian populationrdquo MolecularBiology Reports vol 40 no 6 pp 4009ndash4014 2013

[16] T Yoshimoto H Tsutsui K Tominaga et al ldquoIL-18 althoughantiallergic when administered with IL-12 stimulates IL-4 andhistamine release by basophilsrdquo Proceedings of the NationalAcademy of Sciences of the United States of America vol 96 no24 pp 13962ndash13966 1999

[17] T Yoshimoto H Mizutani H Tsutsui et al ldquoIL-I 8 inductionof IgE dependence on CD4+ T cells IL-4 and STAT6rdquo NatureImmunology vol 1 no 2 pp 132ndash137 2000

[18] T Hoshino R H Wiltrout and H A Young ldquoIL-18 is a potentcoinducer of IL-13 in NK and T cells a new potential role

for IL-18 in modulating the immune responserdquo The Journal ofImmunology vol 162 no 9 pp 5070ndash5077 1999

[19] K Nakanishi T Yoshimoto H Tsutsui and H OkamuraldquoInterleukin-18 is a unique cytokine that stimulates both Th1and Th2 responses depending on its cytokine milieurdquo Cytokineand Growth Factor Reviews vol 12 no 1 pp 53ndash72 2001

[20] T Hoshino H Yagita J R Ortaldo R H Wiltrout and H AYoung ldquoIn vivo administration of IL-18 can induce IgE pro-duction through Th2 cytokine induction and up-regulation ofCD40 ligand (CD154) expression on CD4+ T cellsrdquo EuropeanJournal of Immunology vol 30 no 7 pp 1998ndash2006 2000

[21] M G Netea B J Kullberg I Verschueren and J W M van derMeer ldquoInterleukin-18 induces production of proinflammatorycytokines in mice no intermediate role for the cytokines of thetumor necrosis factor family and interleukin-1 betardquo EuropeanJournal of Immunology vol 30 no 10 pp 3057ndash3060 2000

[22] C A Dinarello and G Fantuzzi ldquoInterleukin-18 and hostdefense against infectionrdquo Journal of Infectious Diseases vol 187no 2 pp S370ndashS384 2003

[23] H Helmby and R K Grencis ldquoIL-18 regulates intestinal mas-tocytosis andTh2 cytokine production independently of IFN-120574duringTrichinella spiralis infectionrdquoTheJournal of Immunologyvol 169 no 5 pp 2553ndash2560 2002

[24] X-Q Wei B P Leung H M L Arthur I B McInnes and FY Liew ldquoReduced incidence and severity of collagen-inducedarthritis in mice lacking IL-18rdquoThe Journal of Immunology vol166 no 1 pp 517ndash521 2001

[25] K Akita T Ohtsuki Y Nukada et al ldquoInvolvement of caspase-1 and caspase-3 in the production and processing of maturehuman interleukin 18 in monocytic THP1 cellsrdquo Journal ofBiological Chemistry vol 272 no 42 pp 26595ndash26603 1997

[26] H Okamura H Tsutsui T Komatsu et al ldquoCloning of a newcytokine that induces IFN-120574 production by T cellsrdquoNature vol378 no 6552 pp 88ndash91 1995

[27] M RasouliM Kalani AMoravej and S Kiany ldquoInterleukin-18single nucleotide polymorphisms contribute to the susceptibil-ity to brucellosis in Iranian patientsrdquoCytokine vol 54 no 3 pp272ndash276 2011

[28] P-A Zhang J-MWu Y Li andX-S Yang ldquoAssociation of pol-ymorphisms of interleukin-18 gene promoter region withchronic hepatitis B in Chinese Han populationrdquoWorld Journalof Gastroenterology vol 11 no 11 pp 1594ndash1598 2005

[29] N A C TavaresMM S Santos RMoura et al ldquoInterleukin 18(IL18) gene promoter polymorphisms are associated with type 1diabetes mellitus in Brazilian patientsrdquo Cytokine vol 62 no 2pp 286ndash289 2013

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of


Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology


Molecular Biology International

GenomicsInternational Journal of


The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014


BioinformaticsAdvances in

Marine BiologyJournal of



Signal TransductionJournal of


BioMed Research International

Evolutionary BiologyInternational Journal of



Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014


Genetics Research International


Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational



Enzyme Research



Microbiology


Table 1 Characteristics of the subjects

Characteristic Case (119899 = 204) Control (119899 = 267)Age (mean plusmn SD) (yr) 249 plusmn 121 352 plusmn 126

Sex (no malesnofemales) 94110 124143

Fever history (mean plusmnSD) (days) 455 plusmn 477

Spleen size (mean plusmnSD) (cm) 380 plusmn 192

HIV status Negative Negative

Several studies in other disease models have shown theassociation of differential plasma level of IL-18 with the singlenucleotide polymorphisms (SNPs) in its encoding region[9ndash11] Such studies clearly point towards possibility of thegene polymorphisms in affecting susceptibility or protectiontowards the same disease in different individuals [12ndash14]Recently Moravej et al has found the association of IL-18gene polymorphism with VL in Iranian population [15] Theimportance of IL-18 in the defence against VL and the effectof gene polymorphism on its production in other diseasesinspired us to investigate the probable association betweenIL-18 gene polymorphism and VL disease susceptibility inIndian population

2 Materials and Methods

21 Subjects A total of 471 subjects were enrolled for thestudy 204 parasitologically confirmed VL patients wereadmitted at Kala-Azar Medical Research Centre in Muzaf-farpur Bihar Characteristics of all the subjects are shown inTable 1 The inclusion criteria included subjects aged morethan two years with sign and symptoms of VL and confirmedby microscopic identification of parasite in their splenicbiopsies Healthy controls were the subjects living in theendemic area with no history of VL aged more than 18 yearsand also with negative serology

The study was approved by the Ethical Committee ofthe Institute of Medical Sciences Banaras Hindu UniversityVaranasi Written informed consents were obtained from allparticipating subjects

22 Sample Collection and Storage Peripheral blood wasdrawn from each subject and collected in citrate vacutainers(BD Biosciences) and stored at 4∘C until DNA isolation 5mLblood was drawn from 13 cases and 13 controls for isolationof PBMC and stored in RNAlater (Qiagen Hilden) at minus80∘Cuntil RNA extraction

23 DNA and RNA Extraction DNA was isolated from200120583L peripheral blood using QIAamp Blood DNAmini kit(Qiagen) while RNA was isolated from PBMC using RNeasymini kit (Qiagen Hilden) as per the manufacturerrsquos protocolAll the samples were quantified using NanoDrop 2000c andaliquoted in triplicate to avoid damage during repeated freezethawing and stored

24 IL-18 Expression Study 1 120583g RNA was isolated fromPBMC was reverse transcribed in a 20120583L reaction usingHigh Capacity cDNA Reverse Transcription Kit (InvitrogenUSA) andwas diluted 10 timeswith RNase freewater for finalconcentration of 5 ng120583L TaqMan gene expression assays(Applied Biosystems USA) for IL-18 (Hs01038788) were usedto perform expression studies with 18S rRNA (PN 4319413E)used as an endogenous control and run on 7500 Real-TimePCR System (Applied Biosystems USA) All samples wererun in duplicate along with no template master mix asnegative controls in each plate Results were analysed by 7500software v201 (Applied Biosystems) and Graph pad prism5 Unpaired two-tailed 119905-tests were used to compare IL-18expression level in cases and controls

25 Genotyping PCR-RFLP based method was used todetect polymorphism in IL-18 gene Three SNPs rs1946519(minus656 GT) and rs187238 (minus137 GC) of promoter regionand rs549908 (+105 AC) of codon region were selectedfor the study For each polymorphism a specific PCR-RFLP was done using method described previously [13]with few modifications (Table 2) PCR was performed in25 120583L reaction mixture using 100 ng genomic DNA with15 U Taq DNA polymerase (New England Bio labs UK)supplemented with 10X Taq DNA polymerase buffer 15mMMgCl

2 25 120583M dNTPs and 10 pM of forward and reverse

primers Each amplified product was digested by specificrestriction enzymes (Fermentas) and electrophoresed ona 3 (wv) ethidium bromide (Merck Mumbai) stainedagarose gel (Sigma-Aldrich St Louis USA) and visualised onUV transilluminator

26 Statistical Analysis Allele and genotype frequencies ofthree SNPs were estimated by observing the digested frag-ments All the data was entered into EPI info 2000 1205942 testodds ratio and 95 confidence interval were calculated byGraphPad prism 5 and SPSS software version 16 SNPStatssoftware was used to estimate the haplotypes frequenciesand Hardy-Weinberg equilibrium The 119875 values lt 00015were considered as statistically significant after Bonferronicorrection for multiple tests The linkage disequilibrium(LD) measurings 1198772 and 1198631015840 were estimated by LD2SNPingprogram V 20 (httpbiokuasedutwLD2SNPing)

3 Results and Discussion

Quantitative real-time RT-PCR was done to observe expres-sion level of IL-18 in PBMC collected from 13 patients and 13controls and it was found significantly upregulated in controls(119875 lt 00377) (Figure 1)

PCR-RFLP methods were used to analyse the IL-18 geneSNPs and the electrophoretic pattern was shown in Figure 2

The frequency of G allele at position minus656 was foundsignificantly higher in the control group as compared to cases(7060 versus 5686 119875 lt 00001 OR = 0549 95 CI =0419ndash0719 and study power 992) while frequency of Gallele at minus137 was found significantly higher in cases (7819versus 7191 119875 = 002 OR = 140 95 CI = 103ndash189 and




(∘C)

Restrictionenzymes

Fragment sizes(bp)

+105(AC)


C 141minus656(GT)


T 120minus137(GC)


C 155

Case Control

16

18

20

22

24

P lt 00377













200 bp

100 bp

CC GG GC

IL-18 (minus137) IL-18 (+105)

CC AA AC GG GT TT

IL-18 (minus656)

155bp

116 bp

141bp

109 bp

96bp120 bp










AllelesG 319 7819 384 7191 4812 00283 140 (1036ndash1893) 5942C 89 2181 150 2809




4 Conclusion








0831 0946

0515 0221

0103 0608

minus137

minus137

minus656

minus656

353

353R2

D998400


0750 0845

0763 0514

0435 0562353

R2

D998400

353 minus656

minus656

minus137

minus137







Acknowledgments


References







































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology




(∘C)

Restrictionenzymes

Fragment sizes(bp)

+105(AC)


C 141minus656(GT)


T 120minus137(GC)


C 155

Case Control

16

18

20

22

24

P lt 00377













200 bp

100 bp

CC GG GC

IL-18 (minus137) IL-18 (+105)

CC AA AC GG GT TT

IL-18 (minus656)

155bp

116 bp

141bp

109 bp

96bp120 bp










AllelesG 319 7819 384 7191 4812 00283 140 (1036ndash1893) 5942C 89 2181 150 2809




4 Conclusion








0831 0946

0515 0221

0103 0608

minus137

minus137

minus656

minus656

353

353R2

D998400


0750 0845

0763 0514

0435 0562353

R2

D998400

353 minus656

minus656

minus137

minus137







Acknowledgments


References







































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology


200 bp

100 bp

CC GG GC

IL-18 (minus137) IL-18 (+105)

CC AA AC GG GT TT

IL-18 (minus656)

155bp

116 bp

141bp

109 bp

96bp120 bp










AllelesG 319 7819 384 7191 4812 00283 140 (1036ndash1893) 5942C 89 2181 150 2809




4 Conclusion








0831 0946

0515 0221

0103 0608

minus137

minus137

minus656

minus656

353

353R2

D998400


0750 0845

0763 0514

0435 0562353

R2

D998400

353 minus656

minus656

minus137

minus137







Acknowledgments


References







































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology







0831 0946

0515 0221

0103 0608

minus137

minus137

minus656

minus656

353

353R2

D998400


0750 0845

0763 0514

0435 0562353

R2

D998400

353 minus656

minus656

minus137

minus137







Acknowledgments


References







































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology





































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology

Association of interleukin-18 gene polymorphism with susceptibility to visceral leishmaniasis in...

Documents

Transcript of Association of interleukin-18 gene polymorphism with susceptibility to visceral leishmaniasis in...