1 23

Molecular Biology ReportsAn International Journal on Molecularand Cellular Biology ISSN 0301-4851 Mol Biol RepDOI 10.1007/s11033-014-3117-6

Association of CYP1A1 and CYP2D6 genepolymorphisms with head and neck cancerin Tunisian patients

Rim Khlifi, Amine Chakroun, AmelHamza-Chaffai & Ahmed Rebai

1 23

Your article is protected by copyright and all

rights are held exclusively by Springer Science

+Business Media Dordrecht. This e-offprint

is for personal use only and shall not be self-

archived in electronic repositories. If you wish

to self-archive your article, please use the

accepted manuscript version for posting on

your own website. You may further deposit

the accepted manuscript version in any

repository, provided it is only made publicly

available 12 months after official publication

or later and provided acknowledgement is

given to the original source of publication

and a link is inserted to the published article

on Springer's website. The link must be

accompanied by the following text: "The final

publication is available at link.springer.com”.

Association of CYP1A1 and CYP2D6 gene polymorphismswith head and neck cancer in Tunisian patients

Rim Khlifi • Amine Chakroun • Amel Hamza-Chaffai •

Ahmed Rebai

Received: 8 March 2013 / Accepted: 10 January 2014

� Springer Science+Business Media Dordrecht 2014

Abstract The purpose of this study was to investigate the

relationship between head and neck cancer (HNC) and

environmental agents and polymorphisms in CYP1A1,

CYP2D6, NAT1 and NAT2 metabolic enzymes genes. To

the best of our knowledge, this is the first report on poly-

morphisms in CYP1A1 6310C[T, CYP2D6 Arg365His,

NAT1 52936A[T and NAT2 Arg268Lys (NAT2*12A)

genes and susceptibility to HNC in Tunisian population.

We study the prevalence of these polymorphisms in 169

patients with HNC and 261 control subjects using poly-

merase chain reaction based methods in a Tunisian popu-

lation. We detected an association between HNC and

CYP1A1 6310C[T (TT) and CYP2D6 Arg365His (His/His)

variant carriers (OR 1.75, P = 0.008 and OR 1.66,

P = 0.016, respectively). No association was found

between the polymorphisms genotypes of NAT1

52936T[A and NAT2 Arg268Lys and risk of HNC. An

association between HNC and CYP1A1 (TT) genotype was

found among patients with smoking (P = 0.011) and

drinking habit (P = 0.009). The combinations of NAT1

(AT or AA) and NAT2 (AA) at-risk genotypes increased

HNC risk (OR 4.23, P = 0.005 and OR 3.60, P = 0.048,

respectively). However, the combinations of CYP1A1 (AA)

and CYP2D6 (CC) genotypes decreased risk of HNC (OR

0.20; P = 0.006). Genetic polymorphisms in CYP1A1 and

CYP2D6 may significantly associate with HNC in the

Tunisian population. The results of this study suggest a

possible gene–environment interaction for certain carcin-

ogen metabolizing enzymes, but larger studies that fully

evaluate the interaction are needed.

Keywords Head and neck cancer � CYP1A1 � CYP2D6 �NAT1 � NAT2 � Genetic polymorphism � Risk factors

Abbreviations

CYP450 Cytochrome P450

CI Confidence interval

CY Consumption-year

HNC Head and neck cancer

LC Laryngeal cancer

NPC Nasopharyngeal

cancer

NAT N-Acetyl-transferase

OR Odds ratio

PY Pack-years

PCR Polymerase chain

reaction

RFLP Restriction fragment

length polymorphism

Introduction

Head and neck cancer (HNC) is a complex disease resulting

from both gene–gene and gene–environment interactions

[1]. Increasing epidemiological studies indicate that these

cancers are strongly linked to environmental factors such as

chemical carcinogens present in tobacco and alcohol [2, 3].

R. Khlifi (&) � A. Hamza-Chaffai

Unit of Marine and Environmental Toxicology, UR 09-03,

IPEIS, Sfax University, BP 1172, 3018 Sfax, Tunisia

e-mail: rimkhlifi@yahoo.fr

R. Khlifi � A. Rebai

Bioinformatics and Signalling Group, Centre de Biotechnologie

de Sfax, PO Box 1177, 3018 Sfax, Tunisia

A. Chakroun

Department of Otorhinolaryngology, Habib BOURGUIBA

Hospital, Sfax, Tunisia

123

Mol Biol Rep

DOI 10.1007/s11033-014-3117-6

Author's personal copy

Metabolic enzymes that are potentially involved in either the

activation or detoxication of chemical carcinogens have

received a great deal of attention recently as possible genetic

susceptibility factors for a variety of cancers [4–7].

Cytochrome P450s (CYP450) enzymes play a key role in

the metabolism of drugs and environmental chemicals [8–

11]. Among these cytochrome P450s, two important bio-

transformation enzymes, cytochrome P450 1A1 (CYP1A1)

and cytochrome P450 2D6 (CYP2D6), involved in the

metabolism of carcinogens. The CYP2D6 and CYP1A1

genes are localized on chromosome 22q13.1 and 15q22-24,

respectively. A large numbers of epidemiological studies

have since been performed examining the potential associ-

ation between HNC and the genetic variants of CYP1A1 [12–

18] and CYP2D6 [19–21]. However, no data were available

in the literature regarding the association between CYP2D6

Arg365His (rs1058172) variant and cancer risk. In the case

of CYP1A1 6310C[T (rs4646421) variant, there are a very

limited number of studies available in the literature, which

have investigated the role of CYP1A1 6310C[T polymor-

phism in the gene–environment interaction and the risk of

cancer development [11, 22].

The NAT genes are located on chromosome 8p21.3-23.1

and express two highly polymorphic isoenzymes, NAT1

and NAT2 with distinct functional roles. Thirty-six NAT2

genetic variants have been identified in human, of which

NAT2*12A is classified as rapid allele [23]. Four relatively

common polymorphic alleles exist for NAT1 with NAT1*4

being the most common allele [23]. Genetic variants of

both genes have been associated with increased risk of

cancer by either reduced capacity to detoxify aromatic

amine carcinogens or by increased capacity to produce

higher levels of reactive metabolites [24–29]. To date there

has been limited investigation of the role of the NAT gene

variants and conflicting data address their association with

HNC [20, 30–35].

In this case–control study, we examined the associa-

tion of CYP1A1 6310C[T, CYP2D6 Arg365His, NAT1

A52936T and NAT2 Arg268Lys (NAT2*12A) polymor-

phisms with risk of HNC in Tunisian population. Potential

gene–environment interactions were analyzed between

these polymorphisms and the risk factors in the etiology of

HNC. We also studied the effects of gene–gene interactions

of the carcinogen metabolizing-related genes in association

with HNC risk.

Materials and methods

Study subjects

Patients with pathologically proven HNC selected (n = 169)

were recruited from the department of Otorhinolaryngology

of the Sfax, University Hospital Habib Bourguiba between

January 2007 and December 2010. All cases were newly

diagnosed and previously untreated. Clinical characteristics

including basic medical data were obtained from medical

records. The control group consisted of 261 subjects. The

controls were recruited simultaneously from residents living

in the similar geographic area (South Tunisia) and matched

with patients for age and social conditions.

All individuals voluntarily participated in the study and

gave their written informed consent. Cases and controls

subjects were interviewed using a standard questionnaire

including demographic characteristics (e.g. age and sex),

history of smoking, chewing and drinking. Lifetime con-

sumption of tobacco smoking and chewing and alcohol

drinking were also collected. Tobacco smoking dose was

estimated as ‘pack-years’ (CY = number of packs of 20

cigarettes per days for 1 year). Likewise, tobacco chewing

dose was estimated as ‘consumption-year’ (CY = fre-

quency of tobacco chewing 9 kept/day 9 duration of

year). Similarly, subjects who had drunk alcoholic bever-

ages at least once a week for more than 1 year previously

were defined as drinkers, and non-drinkers were those who

had never drunk alcohol.

DNA extraction and SNPs genotyping

DNA was extracted from peripheral blood samples of

patients and controls using the conventional phenol/chlo-

roform extraction method. Four SNP CYP1A1 6310C[T,

CYP2D6 8356G[A, NAT1 52936T[A, NAT2 803A[G

were analyzed in this study (Table 1). All these polymor-

phisms were analyzed by polymerase chain reaction (PCR)

combined with restriction fragment length polymorphism

(RFLP). The PCR fragment of the four investigated poly-

morphisms’ was subsequently digested with their specific

restriction enzyme. Digestion products were separated by

electrophoresis on ethidium bromide stained agarose gel

and visualized under UV light. All primers and PCR con-

ditions used are described in Table 1.

Statistical methods

Hardy–Weinberg equilibrium was examined using a Chi

square test with one degree of freedom. The other statis-

tical analyses were done using the SPSS statistical package

software, version 13.0. Means of quantitative variables

were compared between groups using Student t test and

distributions of categorical variables were compared by

Pearson Chi square test. In case of inequality of variances,

Welch test was then used. Multiple logistic regression was

conducted to estimate the relative risk of each SNP

adjusted for age, gender, smoking, chewing as well as

alcohol drinking. Odds ratios (ORs) and their 95 %

Mol Biol Rep

123

Author's personal copy

confidence intervals (CIs) were calculated. All tests were

two-sided with a significant level of P value \0.05.

Results

Population characteristics

Table 2 provides demographic data and distribution of risk

factors for both cases and controls. The analyses included

169 patients. This sample consisted in 82.8 % male and

17.2 % female. The mean age in years was 58 ± 15.4

(median 60, range 13–90 years). The control group (261

individuals with no personal or familial history of cancer)

has an average age of 47.6 ± 14.2 (median 47, range

17–88) years. The controls were slightly younger than

cases and had a higher proportion of females (35.2 %). As

expected, there were more smokers among cases than

controls (71.0 vs. 25.7 %), this difference was statistically

significant (P \ 0.001). The difference in drinking status

was also observed between cases and controls (P \ 0.001).

Relationship between smoking, drinking and tobacco

chewing and the risk for HNC

To corroborate the strong effect of smoking and alcohol

drinking in the development of HNC in several studies,

cases and controls were compared with respect to their

smoking frequency and drinking habit (Table 2). Most

patients smoked more than 40 PY (37.3 %) when only

29.0 % had never smoked. The cases had higher values for

PY smoked than controls (P \ 0.001). For individuals who

smoked less than 40 PY, a 6.3-fold increased risk for the

development of HNC, this risk increased up to 24.3 for

individuals smoking more than 40 PY. Similarly, drinkers

were over represented among patients, compared with

controls subjects (39.0 vs. 6.5 %; P \ 0.001). The risk for

HNC was also significantly higher for individuals con-

suming tobacco chewing substance, especially those who

use it for more than 5 years (OR 5.60; P \ 0.001).

In order to understand these associations, we evaluated

risk of the smoking, chewing and drinking with tumor

location in the head and neck region. A clear difference in

cancer susceptibility was seen between laryngeal cancer

(LC) and nasopharyngeal cancer (NPC) (Table 3). In fact,

smoking habit (\30 PY) increases the risk of NPC with a

factor of 2.7 compared to subjects who never smoked

(P = 0.004), while this risk is about 7 in case of patients

with LC (P \ 0.001). The difference of sensibility of these

two anatomic regions, to carcinogenic substances of

tobacco smoke was more distinguished in the case of

patients who have smoked more than 30 PY, and specially

for LC patients (OR 52.67; P \ 0.001). However, the

significant association of tobacco chewing, during 5 years

or greater than, was more marked in patients suffering from

NPC (OR 7.17, P \ 0.001) than LC (OR 5.7, P \ 0.001).

Table 1 Methodology for PCR–RFLP analysis

Gene SNP dbSNP ID PCR Restriction digestion

Primer: Forward (50-30)Reverse (50-30)

Annealing

temperature

Product

(bp)

RE Genotype Fragment

sizes (bp)

CYP1A1 6310C[T rs4646421 GGGATTGAGCAGCAGAGAAC 59 �C, 35

cycles

191 NspI TT 191

TTAACATTTGGGGGAAGCAG CT 191, 113 and

78

CC 113 and 78

CYP2D6 Arg365His rs1058172 GTCCGTGTCCAACAGGAGAT 57 �C, 35

cycles

163 HaeII AA 163

CGATGTCACGGGATGTCATA AG 163, 111 and

52

GG 111 and 52

NAT1 52936T[A rs4921880 GGGCATTATGGATGTTGAGG 58 �C, 35

cycles

230 NspI TT 230

AGAAAGCCCATTCCTCAGAGT AT 230, 141 and

89

AA 141 and 89

NAT2 Arg268Lys rs1208 GAGGAAGAGGTTGAAGAAGTGCT 58 �C, 35

cycles

244 DdeI AA 244

AAATGCTGACATTTTTATGGATGA AG 244, 222 and

22

GG 222 and 22

SNP single nucleotide polymorphism, dbSNP ID database single-nucleotide polymorphisms identifier, PCR polymerase chain reaction, RFLP

restriction fragment length polymorphism, RE restriction enzyme

Mol Biol Rep

123

Author's personal copy

Association of polymorphisms with cancer risk

A significant departure from Hardy–Weinberg equilibrium

(Chi square test) in the control sample was found only for

CYP2D6 and NAT2. To determine interaction of metabolic

enzymes genes polymorphism and the risk of developing

HNC, genotype and ORs results are given in Table 4.

Allele frequencies were compared between cases and

Table 2 Distribution comparison and odds ratios for selected characteristics of HNC cases and controls

Characteristics Controls (%)

n = 261

Cases (%)

n = 169

Pa Logistic regression

OR (95 % CI)

P

Gender 0.010

Male 169 (64.8) 140 (82.8) – –

Female 92 (35.2) 29 (17.2)

Age (year) 0.003

Mean ± SD 47.62 ± 14.17 58.0 ± 15.4 – –

Min 17 13

Max 88 90

Smoking (PY)b \0.001

0 194 (74.4) 49 (29.0) 1.00 (Reference)

1–40 57 (21.8) 57 (33.7) 6.30 (2.49–13.49) \0.001

[40 10 (3.8) 63 (37.3) 24.30 (11.93–13.49) \0.001

Alcohol drinking \0.001

No 244 (93.5) 103 (61.0) 1.00 (Reference)

Yes 17 (6.5) 66 (39.0) 8.65 (4.89–15.25) \0.001

Tobacco chewing (CY)c \0.001

0 244 (93.5) 127 (75.2) 1.00 (Reference)

1–5 5 (1.9) 7 (4.1) 2.96 (0.83–8.64) 0.097

[5 12 (4.6) 35 (20.7) 5.60 (2.81–11.17) \0.001

OR odds ratio, adjusted for age and gender; CI confidence intervala Pearson’s Chi square test for gender, smoking, alcohol drinking and tobacco chewing. Welch’s test for ageb PY (pack-year): smoking index expressed as the number of packs of 20 tobacco cigarettes per days for 1 yearc CY (consumption year): frequency of tobacco chewing 9 kept/day 9 duration of year

Table 3 Cancer risk for the different anatomical regions according to smoking, tobacco chewing and drinking factors

Characteristics LC NPC

Control (%)

(n = 261)

Case (%)

(n = 97)

OR

(%95 CI)

Case (%)

(n = 48)

OR

(%95 CI)

P

Smoking (PY)a

0 194 13 Ref Ref 194 24 Ref Ref

1–30 50 24 7.35 (3.55–15.19) \0.001 50 17 2.74 (1.37–5.50) 0.004

[30 17 60 52.67 (24.19–114.66) \0.001 17 7 3.32 (1.25–8.84) 0.016

Tobacco chewing (CY)b

0 244 74 Ref Ref 244 34 Ref Ref

1–5 5 2 1.31 (0.25–6.93) 0.744 5 5 5.38 (2.11–13.72) 0.003

[5 12 21 5.77 (2.71–12.28) \0.001 12 9 7.17 (1.95–26.08) \0.001

Alcohol drinking

No 244 48 Ref Ref 244 38 Ref Ref

Yes 17 49 13.78 (7.39–25.68) \0.001 17 10 3.55 (1.52–8.27) 0.003

LC laryngeal cancer, NPC nasopharyngeal cancer, OR odds ratio, CI confidence intervala PY (pack-year): smoking index expressed as the number of packs of 20 tobacco cigarettes per days for 1 yearb CY (consumption year): frequency of tobacco chewing 9 kept/day 9 duration of year

Mol Biol Rep

123

Author's personal copy

controls for the CYP1A1 6310T, CYP2D6 365Arg, NAT1

52936T and NAT2 268Arg and were 61.7, 83.7, 30.6 and

42.3 %, respectively in controls and 73.2, 77.5, 25.7, and

44.1. %, respectively in cases (data not shown). Frequencies

of the CYP1A1 6310CC, CT and TT in cases were signifi-

cantly different from controls (v2 = 16.53, P = 0.005,

df = 2). Similarly, the CYP2D6 365Arg/Arg, Arg/His, His/

His in cases little differed significantly from those in controls

(v2 = 6.05, P = 0.023, df = 2). However, the distributions

of genotypes did not significantly differ between cases and

controls for polymorphisms at positions 52936T[A in NAT1

and the Arg268Lys in NAT2 gene.

The ORs and 95 % CI associated with CYP1A1,

CYP2D6, NAT1 or NAT2 polymorphism genotypes are

given in Table 4. The NAT1 (AT), NAT2 (Arg/Lys)

and NAT2 (Lys/Lys) genotypes increased the risk of HNC

marginally (crude ORs = 1.51, 1.15 and 1.17, respec-

tively), these were not statistically significant (P [ 0.05).

However, a significant association was found between the

risk of HNC and polymorphisms in CYP1A1 (CT and TT)

(adjusted OR 3.24, P = 0.043 and OR 2.06, P = 0.008,

respectively) and in CYP2D6 (His/His) (crude OR 1.66,

P = 0.016; adjusted OR 2.08, P = 0.047). Furthermore,

Arg/His?His (CYP2D6) combined genotype was signifi-

cantly associated with HNC risk (crude OR 1.35,

P = 0.014; adjusted OR 1.29, P = 0.032).

Gene–environment interactions and association

with HNC risk

In order to investigate the potential gene–environment

interactions, analyses were carried out stratifying by

smoking, tobacco chewing and alcohol drinking status

(Table 5). We found that CYP1A1 (CT) (crude OR 4.35,

P = 0.010; adjusted OR 5.54, P = 0.018) and (TT) (crude

OR 1.96, P = 0.050; adjusted OR 3.09, P = 0.011)

genotypes appeared to be associated with risk of HNC in

smokers. We further observed that CYP1A1 (TT) genotype

was significantly associated with HNC risk in drinkers

(crude OR 18.20, P = 0.006; adjusted OR 37.54,

P = 0.009). No significant associations were detected on

CYP2D6 Arg365His polymorphism among smokers and

drinkers. Moreover, we found that CYP1A1 (TT) and

CYP2D6 His/His (AA) genotype appeared to be associated

with risk of HNC in non chewers (crude OR 1.60, crude

OR 1.81, respectively, P \ 0.05). NAT1 and NAT2 poly-

morphisms displayed no statistical significance with these

risk factors of HNC (data not shown).

Gene–gene interactions and association with HNC risk

The combined genetic effects of SNPs may additively or

synergistically contribute to the increased cancer risk. Data

Table 4 Genotype frequencies of CYP1A1, CYP2D6, NAT1 and NAT2 among cases and controls, and their association with risk of HNC

SNP/gene Genotype Controls

n = 261 (%)

All cases

n = 169 (%)

Pa Logistic regression P

Crude OR

(95 % CI)

P Adjusted ORb

(95 % CI)

rs4646421/CYP1A1 CC 21 (8.1) 9 (5.3) 0.005 1.00 (Reference) 1.00 (Reference)

CT 169 (64.7) 92 (54.5) 2.23 (0.95–5.22) 0.063 3.24 (1.03–10.19) 0.043

TT 71 (27.2) 68 (40.2) 1.75 (1.15–2.67) 0.008 2.06 (1.21–3.52) 0.008

CT?TT 240 (91.5) 160 (94.7) 1.55 (0.69–3.48) 0.283 2.01 (0.68–5.95) 0.207

rs1058172/CYP2D6 GG (Arg) 183 (70.1) 99 (58.6) 0.023 1.00 (Reference) 1.00 (Reference)

AG (Arg/His) 71 (27.2) 64 (37.9) 1.58 (0.51–4.94) 0.421 2.77 (0.75–11.11) 0.124

AA (His) 7 (2.7) 6 (3.5) 1.66 (0.30–2.97) 0.016 2.08 (1.11–4.00) 0.047

AG?AA 141 (54.0) 124 (73.4) 1.35 (0.44–4.16) 0.014 1.29 (0.40–1.96) 0.032

rs4921880/NAT1 TT 5 (1.9) 4 (2.4) 0.065 1.00 (Reference) 1.00 (Reference)

AT 150 (57.5) 79 (46.7) 0.98 (0.26–3.78) 0.981 0.32 (0.05–1.90) 0.214

AA 106 (40.6) 86 (50.9) 1.51 (0.39–5.82) 0.542 0.55 (0.09–3.16) 0.503

AT?AA 256 (98.1) 165 (96.6) 0.81 (0.21–3.04) 0.749 0.34 (0.12–1.34) 0.334

rs1208/NAT2 GG (Arg) 45 (17.2) 33 (19.5) 0.623 1.00 (Reference) 1.00 (Reference)

AG (Arg/Lys) 131 (50.2) 83 (49.1) 1.15 (0.68–1.96) 0.586 0.73 (0.34–1.57) 0.433

AA (Lys) 85 (32.6) 53 (31.4) 1.17 (0.66–2.07) 0.574 0.75 (0.37–1.51) 0.435

AG?AA 216 (82.7) 136 (80.4) 0.86 (0.52–1.41) 0.548 0.54 (0.24–1.20) 0.135

CI confidence intervala Two-sided Chi square test (exact test correcting)b Odds ratio adjusted for age, gender, pack-years of smoking, tobacco chewing, and alcohol drinking by multiple logistic regression (Student’s

t test for equal variances)

Mol Biol Rep

123

Author's personal copy

analysis of the gene–gene interaction was shown in

Table 6. The combinations of NAT1 (AT or AA) and NAT2

(AA) at-risk genotypes showed a 4-fold increased risk (OR

4.23 and 3.60, respectively, P \ 0.05) when compared to

individuals with other genotypes. However, the combina-

tions of CYP1A1 (AA) and CYP2D6 (CC) genotypes

decreased risk of HNC (OR 0.20; P = 0.006). No statis-

tically significant interactions were observed between

CYP1A1-NAT1, CYP1A1-NAT2, CYP2D6-NAT2 and

CYP2D6-NAT1 genotype combinations (data not shown).

Discussion

In the present study we investigated the role of polymor-

phisms in metabolic enzymes genes as risk factors for

Tunisian patients with HNC. To the best of our knowledge,

this is the first report on the impact of combined effects of

CYP1A1 (6310C[T), CYP2D6 (Arg365His), NAT1

(52936T[A) and NAT2 (Arg268Lys) genes among the

habitual tobacco smokers and chewers and alcohol drink-

ing in the susceptibility to HNC in the Tunisian population.

Table 5 Association between CYP1A1 and CYP2D6 genotypes and HNC according to smoking, drinking, and chewing status

Genotype Logistic regression

Case/

Ctrl, n

Crude OR

(95 % CI)

P Adjusted ORa

(95 % CI)

P Case/

Ctrl, n

Crude OR

(95 % CI)

P Adjusted ORa

(95 % CI)

P

Non smoker Smoker

CYP1A1

CC 2/11 1.00 (Reference) 1.00 (Reference) 7/10 1.00 (Reference) 1.00 (Reference)

CT 28/128 1.90 (0.38–9.35) 0.430 1.18 (0.21–16.15) 0.565 64/41 4.35 (1.42–13.39) 0.010 5.54 (1.33–23.04) 0.018

TT 19/55 1.57 (0.81–3.06) 0.176 1.15 (0.48–2.75) 0.742 49/16 1.96 (0.98–3.90) 0.0.50 3.09 (1.29–7.37) 0.011

CT?TT 47/183 1.41 (0.30–6.59) 0.660 1.70 (0.21–13.60) 0.614 113/57 2.83 (1.02–7.83) 0.045 2.56 (0.72–9.05) 0.144

CYP2D6

GG 30/136 1.00 (Reference) 1.00 (Reference) 69/47 1.00 (Reference) 1.00 (Reference)

AG 17/52 1.51 (0.29–8.33) 0.624 1.31 (0.22–12.50) 0.814 47/19 2.77 (0.29–2.27) 0.377 4.76 (0.41–100.00) 0.210

AA 2/6 1.49 (0.75–2.94) 0.254 1.36 (0.58–3.22) 0.477 4/1 1.69 (0.88–3.22) 0.115 1.78 (0.74–3.84) 0.212

AG?AA 19/58 1.33 (0.26–7.14) 0.750 1.19 (0.21–11.11) 0.884 51/20 2.32 (0.24–5.00) 0.466 4.16 (0.35–50.00) 0.262

Non drinker Drinker

CYP1A1

CC 5/20 1.00 (Reference) 1.00 (Reference) 4/1 1.00 (Reference) 1.00 (Reference)

CT 63/153 2.00 (0.69–5.77) 0.200 2.24 (0.57–10.21) 0.230 29/16 8.25 (0.42–59.15) 0.162 11.20 (1.15–68.12) 0.042

TT 35/70 1.21 (0.73–2.00) 0.449 1.00 (0.50–2.01) 0.980 33/1 18.20 (2.22–45.87) 0.006 37.54 (2.45–75.23) 0.009

CT?TT 98/223 1.75 (0.64–4.81) 0.273 2.41 (0.62–9.37) 0.204 62/17 2.91 (0.10–8.70) 0.932 3.45 (0.23–49.89) 0.363

CYP2D6

GG 62/170 1.00 (Reference) 1.00 (Reference) 37/13 1.00 (Reference) 1.00 (Reference)

AG 36/67 2.32 (0.69–8.33) 0.185 2.63 (0.44–16.66) 0.290 28/4 8.33 (0.42–10.00) 0.162 0.90 (0.28–20.00) 0.946

AA 5/6 1.49 (0.90–7.14) 0.128 1.20 (0.60–2.38) 0.597 1/1 0.45 (0.22–4.45) 0.495 1.78 (0.39–8.33) 0.374

AG?AA 41/73 2.40 (0.60–7.41) 0.256 2.43 (0.35–14.28) 0.321 29/5 0.26 (0.15–4.45) 0.352 0.71 (0.16–14.28) 0.820

Non chewer Chewer

CYP1A1

CC 7/20 1.00 (Reference) 1.00 (Reference) 2/1 1.00 (Reference) 1.00 (Reference)

CT 71/153 2.13 (0.83–5.43) 0.113 2.20 (0.74–6.50) 0.154 21/16 2.25 (0.16–31.32) 0.546 0.83 (0.06–19.97) 0.942

TT 50/67 1.60 (1.01–2.55) 0.044 1.81 (1.05–3.11) 0.030 18/4 3.42 (0.96–12.13) 0.056 0.66 (0.11–3.72) 0.693

CT?TT 121/220 1.57 (0.64–3.82) 0.319 1.48 (0.53–4.14) 0.446 39/20 0.97 (0.08–11.41) 0.987 1.10 (0.01–10.83) 0.967

CYP2D6

GG 70/167 1.00 (Reference) 1.00 (Reference) 29/16 1.00 (Reference) 1.00 (Reference)

AG 53/66 1.72 (0.52–5.55) 0.376 2.94 (0.76–11.11) 0.118 11/5 99.9 (1.11–111.1) 0.989 99.8 (10.0–111.1) 0.897

AA 5/7 1.81 (1.21–3.03) 0.005 2.00 (1.12–3.57) 0.020 1/0 1.21 (0.67–4.16) 0.756 0.82 (0.33–1.69) 0.112

AG?AA 58/73 1.36 (0.42–2.38) 0.612 2.25 (0.61–8.33) 0.223 12/5 2.94 (0.87–50.00) 0.879 3.44 (0.69–33.33) 0.789

CI confidence intervala Odds ratio adjusted for age, gender, pack-years of smoking, chewing, and alcohol drinking by multiple logistic

Mol Biol Rep

123

Author's personal copy

Environmental factors and HNC

Tobacco smoking is the strongest risk factor for HNC

besides lung cancer. Similarly; alcohol consumption is also

linked to an increase in HNC [36]. Our data show a sig-

nificant relation between tobacco smoking and the risk of

HNC. These results are compatible with previous epide-

miological data that show a strong correlation between oral

squamous cell carcinoma and smoking [37–40]. Moreover,

it was seen that tobacco chewing habits were not a negli-

gible risk factor, although by far not as important as

smoking. The use of tobacco chewing is considered as an

old-fashioned practice and the number of tobacco chewers

is diminishing gradually as younger generations of Tuni-

sians no longer take on this habit [41]. Many epidemio-

logical studies have shown a risk link between smokeless

tobacco (chewing) use and HNC [12, 21, 41–44].

Polymorphisms and HNC

Several studies that have been conducted in various ethnic

populations to examine the impact of putatively functional

polymorphisms in CYP1A1 and CYP2D6 in risk of HNC [12,

16, 19, 21, 36, 45] have yielded conflicting results. However, in

this case–control study in Tunisian population, we found a

significant association between CYP1A1 6310C[T and the

CYP2D6 Arg365His polymorphisms and risk of developing

HNC (Table 4). There were no previous report on association

of CYP2D6 Arg365His and CYP1A1 6310C[T SNPs with risk

of HNC. On the other hand, Li et al. [22] analyzed the geno-

types of CYP1A1 6310C[T polymorphism in Chinese patients

with hepato-cellular carcinoma and reported a significantly

higher risk for subjects with the CT or TT genotype. They

suggested that rs4646421 variant cause impaired inhibition of

the enzyme by altering the sequence specificity adequate for

the upstream stimulatory factor recognition, which may

repress CYP1A1 transcription, resulting in high inducibility of

CYP1A1 and carcinogenesis. In our study, we can support this

hypothesis in the case of HNC especially that the higher risk

appears to be dependent to allelic dose. In fact, Sakata et al.

[46] reported that CYP1A1 enzyme has a low level of tran-

scription in normal conditions, without induction elements as

carcinogen substances. Then, the presence of negative regu-

lator elements has been suggested.

The present finding suggests that no association was

found between the polymorphism genotypes of NAT1

52936T[A (rs4921880) and NAT2 Arg268Lys (rs1208)

and risk of HNC in our population. To our knowledge,

there have been only three studies examining NATs poly-

morphisms (rs4921880 and rs1208) and cancer [47–49]. In

fact, Majumder et al. [48] found that NAT2 Arg268Lys

genetic variant could not modulate the risk of oral cancer in

Indian population. Furthermore, Hou et al. [47] reported

that no association was observed between NAT2 Arg268-

Lys and oral and pharyngeal squamous cell carcinoma in

Taiwan population. Moreover, Heck et al. [49] concluded

that no clear associations were observed between renal

cancer and these two NATs polymorphisms in Countries of

Central and Eastern Europe.

Gene–environment interactions and association with HNC

risk

In the present study, the confounding effect of tobacco

smoking on the HNC association with CYP1A1 C6310T

and CYP2D6 Arg365His polymorphisms shows that only

CYP1A1 (CT) and (TT) genotypes appeared to be associ-

ated with risk of HNC in smokers (Table 5). Similar results

were observed in studies of other cancers in which the risk

of smokers was modulated by CYP1A1 (rs4646421) genetic

variations [22, 50–52]. CYP1A1 is expressed in many

epithelial tissues especially in buccal mucosa, suggesting

the in situ activation of tobacco carcinogens [53]. Cigarette

smoke has been shown to up regulate CYP1A1 under

in vitro conditions as well as in smokers [54–56]. A sig-

nificant association between the genetic variability affect-

ing detoxification of carcinogens derived from tobacco

smoke and the risk of HNC has been reported previously

[18, 36, 41, 57–60]. However, few studies [61–63] did not

find a relationship between smoking and risk of HNC

among cases with the CYP1A1 polymorphisms.

Table 6 HNC risk associated with genotypic combinations of

CYP1A1–CYP2D6 and NAT1–NAT2 polymorphisms in cases and

controls

Gene–gene Control, n Case, n Crude OR (95 % CI) P

CYP2D6–CYP1A1

AA–TT 1 3 Reference

AA–CT 22 30 0.093 (0.01–1.09) 0.050

AA–CC 48 35 0.20 (0.06–0.63) 0.006

AG–TT 6 3 0.38 (0.12–1.12) 0.061

AG–CT 46 30 0.55 (0.10–3.05) 0.499

AG/GG–CC 117 59 0.42 (0.14–1.27) 0.126

GG–TT 3 4 0.55 (0.19–1.55) 0.261

GG–CT 18 5 0.20 (0.03–1.25) 0.049

NAT1–NAT2

TT–GG 31 23 Reference

TT–AG 57 45 2.69 (0.45–16.00) 0.275

TT–AA 18 18 2.53 (0.44–14.45) 0.296

AT–GG 51 30 2.00 (0.32–12.33) 0.445

AT–AG 72 34 3.40 (0.58–14.68) 0.172

AT/AA–AA 27 15 4.23 (0.73–15.26) 0.005

AA–GG 3 0 3.60 (0.58–12.01) 0.048

AA–AG 2 4 0.00 (0.00–0.00) 0.999

OR odds ratio, CI confidence interval

Mol Biol Rep

123

Author's personal copy

In addition, CYP1A1 (TT) and CYP2D6 His/His (AA)

genotypes appeared to be associated with risk of HNC in

non-chewers (P \ 0.05) (Table 5). However, no interac-

tion was observed between these two polymorphisms and

risk of HNC among chewers. In contrast, recent case–

control studies found a significant association between

CYP1A1 and CYP2D6 polymorphism and head and neck

and oral cancer among chewers [12, 19, 64, 65].

No interaction between the NATs polymorphisms and

risk of HNC was observed in our population (among

smokers, chewers and drinkers) (data not shown). HNC is

strongly associated with smoking, and a few studies have

explored the role of NAT1 polymorphisms in the risk of

developing HNC in smokers. However, overall findings are

inconsistent and associations if present are weak, and

indicate either a decreased risk in carriers of NAT1 poly-

morphism [35], an increased risk [59] or a lack of associ-

ation [10, 31, 44, 66].

Gene–gene interactions and association with HNC risk

The combined genetic effects of single nucleotide poly-

morphisms may additively or synergistically contribute to

the increased cancer risk. To date, no studies have examined

the risk conferred by the combination of CYP1A1

(6310C[T), CYP2D6 (Arg365His), NAT1 (52936T[A) and

NAT2 (Arg268Ly) polymorphisms. Gene–gene interactions

in the present study reflected a pattern of susceptibility

similar to independent gene effects. We observed that the

presence of a variant either at NAT1 (AT or AA) or NAT2

(AA) locus increased HNC risk by 4-fold (P = 0.005)

(Table 6). However, single gene suggested no significant

association between the polymorphisms of these two genes

(NAT1 and NAT2) and risk of HNC. The combinations of

NAT1 (AT or AA) is linked to NAT2 (AA), so the influence of

NAT1 on susceptibility can be partially determined by

interactions with NAT2 and vice versa. However, functional

interactions are still obscure, and other combinations of

particular genetic variants of NAT enzymes may affect

cancer risk. This finding supports the hypothesis that com-

bined gene variants can lead to increased HNC risk by acting

synergistically. It is becoming clearly evident that single

gene cannot explain susceptibility to diseases with complex

etiology such as HNC. The lack of other gene–gene inter-

actions could be due to low statistical power because of the

small number of individuals in some genotypic classes.

Conclusion

In the present study, increased risk of HNC was been

observed with CYP1A1 6310C[T (TT) and CYP2D6

Arg365His (His/His) variant carriers. No association was

found between the polymorphisms genotypes of NAT1

52936T[A and NAT2 Arg268Lys and risk of HNC.

However, an increased risk of HNC was been observed

with the combination of both the NAT1 (AT or AA) or

NAT2 (AA) genotypes. The combinations of CYP1A1

(AA) and CYP2D6 (CC) genotypes decreased risk of HNC.

An association between HNC and CYP1A1 (TT) genotype

was found among patients with drinking habit and smok-

ing. This study is first such in the Tunisian population and

provides a baseline for further studies on metabolic genes

(CYP1A1 6310C[T, CYP2D6 Arg365His, NAT1

52936A[T and NAT2 Arg268Lys) polymorphisms and risk

of HNC in the Tunisian population.

Acknowledgments This work was supported by the Ministry of

Higher Education and Scientific Research, Tunisia. We thank the

Department of Otorhinolaryngology, Habib Borguiba Hospital, Sfax,

Tunisia for the recruitment of patients. We thank all members of this

Department of and specially Dr Adel Chakroun and Dr Bouthaina

Hammami for their efforts and assistance in recruiting patients.

Conflict of interest The authors declare that they have no conflict

of interest.

References

1. Koifman S, Koifman RJ (2003) Environment and cancer in

Brazil: an overview from a public health perspective. Mutat Res

544(2–3):305–311

2. Cloos J, Spitz MR, Schaniz SP et al (1996) Genetic susceptibility

to head and neck squamous cell carcinoma. J Natl Cancer Inst

88:530–535

3. Risch A, Ramroth H, Raedts V et al (2003) Laryngeal cancer risk

in Caucasians is associated with alcohol and tobacco consump-

tion but not modified by genetic polymorphisms in class I alcohol

dehydrogenases ADIIIB and ADIIIC, and glutathione S-trans-

ferases GSTM1 and GSTT1. Pharmacogenetics 13:225–230

4. Smith G, Stanley LA, Sim E et al (1995) Metabolic polymor-

phisms and cancer susceptibility. Cancer Surv 25:27–65

5. Rebbeck TR (1997) Molecular epidemiology of the human glu-

tathione S-transferase genotypes GSTM1 and GSTT1 in cancer

susceptibility. Cancer Epidemiol Biomark Prev 6:733–743

6. Boffetta P (2010) Biomarkers in cancer epidemiology: an inte-

grative approach. Carcinogenesis 31:121–126

7. Klaunig JE, Kamendulis LM, Hocevar BA (2010) Oxidative

stress and oxidative damage in carcinogenesis. Toxicol Pathol

38:96–109

8. Kawajiri K, Nakachi K, Imai K, Hayashi S, Watanabe J (1990)

Individual differences in lung cancer susceptibility in relation to

polymorphisms of P-450IA1 gene and cigarette dose. Princess

Takamatsu Symp 21:55–61

9. Bennett WP, Alavanja MCR, Blomeke B et al (1999) Envi-

ronmental tobacco smoke, genetic susceptibility, and risk of

lung cancer in never-smoking women. J Natl Cancer Inst

91:2009–2014

10. Agundez JAG (2008) Polymorphisms of human N-acetyltrans-

ferases and cancer risk. Curr Drug Metab 9:520–531

11. Wang S, Chanock S, Tang D, Li Z, Jedrychowski W, Perera FP

(2008) Assessment of interactions between PAH exposure and

genetic polymorphisms on PAH–DNA adducts in African-

Mol Biol Rep

123

Author's personal copy

American, Dominican, and Caucasian mothers and newborns.

Cancer Epidemiol Biomarkers Prev 17(2):405–413

12. Chaudhuri SR, Mukherjee S, Paul RR, Haldar A, Chaudhuri K

(2013) CYP1AI and CYP2E1 gene polymorphisms may increase

susceptibility to oral submucous fibrosis among betel quid

chewers of Eastern India. Gene 513:268–271

13. Tanimoto K, Hayashi S, Yoshiga K, Ichikawa T (1999) Poly-

morphisms of CYP1A1 and GSTM1 gene involved in oral

squamous cell carcinoma in association with a cigarette dose.

Oral Oncol 35:191–196

14. Gajecka M, Rydzanicz M, Jaskula-Sztul R et al (2005) CYP1A1,

CYP2D6, CYP2E1, NAT2, GSTM1 and GSTT1 polymorphisms

or their combinations are associated with the increased risk of the

laryngeal squamous cell carcinoma. Mutat Res 574:112–113

15. Singh AP, Shah PP, Ruwali M, Mathur N, Pant MC, Parmar D

(2009) Polymorphism in cytochrome P4501A1 is significantly

associated with head and neck cancer risk. Cancer Invest 27:

869–876

16. Olivieri HER, Silva SD, Mendonca FF et al (2009) CYP1A2*1C,

CYP2E1*5B and GSTM1 polymorphisms are predictors of risk

and poor outcome in head and neck squamous cell carcinoma

patients. Oral Oncol 45:e73–e79

17. Gattas GJ, de Carvalh MB, Siraque MS et al (2006) Genetic

polymorphisms of CYP1A1, CYP2E1, GSTM1 and GSTT1

associated with head and neck cancer. Head Neck 28:819–826

18. Tai J, Yang M, Ni X, Yu D et al (2010) Genetic polymorphisms

in cytochrome P450 genes are associated with an increased risk

of squamous cell carcinoma of the larynx and hypopharynx in a

Chinese population. Cancer Genet Cytogenet 196:76–82

19. Shukla P, Gupta D, Pant MC, Parmar D (2012) CYP 2D6 poly-

morphism: a predictor of susceptibility and response to chemo-

radiotherapy in head and neck cancer. J Cancer Res Ther 8(1):

40–45

20. Gonzalez MV, Alvarez V, Pello MF, Meneandez MJ, Suaarez C,

Coto E (1998) Genetic polymorphism of N-acetyltransferase-2

glutathione S-transferase-M1 and cytochromes P450IIE1 and

P450IID6 in the susceptibility to head and neck cancer. Clin

Pathol 51:294–298

21. Matthias C, Jahnke V, Jones PW, Hoban PR, Alldersea JE,

Worrall SF, Fryer AA, Strange RC (1999) Cyclin D1 glutathione

S-transferase and cytochrome P450 genotypes and outcome in

patients with upper aerodigestive tract cancers: assessment of the

importance of individual genes using multivariate analysis.

Cancer Epidemiol Biomarkers Prev 8:815–823

22. Li R, Shugart YY, Zhou W et al (2009) Common genetic vari-

ation of the cytochrome P450 1A1 gene and risk of hepatocellular

carcinoma in a chinese population. Eur J Cancer 45:1239–1247

23. Hirvonen A (1999) Polymorphic NATs and cancer predisposi-

tion. IARC Sci Publ 148:251–270

24. Suzuki H, Morris JS, Li Y et al (2008) Interaction of the cyto-

chrome P4501A2, SULT1A1 and NAT gene polymorphisms with

smoking and dietary mutagen intake in modification of the risk of

pancreatic cancer. Carcinogenesis 29(6):1184–1191

25. Ambrosone CB, Kropp S, Yang J, Yao S, Shields PG, Chang-

Claude J (2008) Cigarette smoking, N-acetyltransferase 2 geno-

types, and breast cancer risk: pooled analysis and meta-analysis.

Cancer Epidemiol Biomarkers Prev 17:15–26

26. Rouissi K, Ouerhani S, Marrakchi R et al (2009) Combined effect of

smoking and inherited polymorphisms in arylamine N-acetyltrans-

ferase 2, glutathione S-transferases M1 and T1 on bladder cancer in a

Tunisian population. Cancer Genet Cytogenet 190(2):101–107

27. Cui X, Lu X, Hiura M, Omori H, Miyazaki W, Katoh T (2012)

Association of genotypes of carcinogen-metabolizing enzymes

and smoking status with bladder cancer in a Japanese population.

Environ Health Prev Med [Epub ahead of print]

28. de Lima Junior MM, Reis LO, Guilhen AC, Granja F et al (2012)

N-Acetyltransferase-2 gene polymorphisms and prostate cancer

susceptibility in Latin American patients. Med Oncol 29(4):

2889–2894

29. Zabost A, Roszkowska-Sli _z B, Wiatr E et al (2012) Polymor-

phism in the N-acetyltransferase 2 gene in patients with lung

cancer. Short communication. Pneumonol Alergol Pol 80(4):

323–328

30. Katoh T, Kaneko S, Boissy R, Watson M, Ikemura K, Bell AD

(1998) A pilot study testing the association between N-acetyl-

transferases 1 and 2 and risk of oral squamous cell carcinoma in

Japanese people. Carcinogenesis 19:1803–1807

31. Henning S, Cascorbi I, Munchow B, Kahnke V, Roots I (1999)

Association of arylamine N-acetyltransferases NAT1 and NAT2

genotypes to laryngeal cancer risk. Pharmacogenetics 9:103–111

32. Garte S, Gaspari L, Alexandrie AK, Ambrosone C, Autrup H,

Autrup JL et al (2001) Metabolic gene polymorphism frequencies

in control populations. Cancer Epidemiol Biomarkers Prev 10:

1239–1248

33. Marques CFS, Koifman S, Koifman RJ, Boffetta P, Brennan P,

Hatagima A (2006) Influence of CYP1A1, CYP2E1, GSTM3 and

NAT2 genetic polymorphisms in oral cancer susceptibility:

results from a case-control study in Rio de Janeiro. Oral Oncol

42:632–637

34. Gara S, Abdennebli M, Chatti S, Touati S, Ladgham A, Guemira

F (2007) Association of NAT2 gene substitution mutation T341C

with increased risk for head and neck cancer in Tunisia. Acta

Oncol 46:834–837

35. McKay JD, Hashibe M, Hung RJ, Wakefield J et al (2008)

Sequence variants of NAT1 and NAT2 and other xenometabolic

genes and risk of lung and aerodigestive tract cancers in Central

Europe. Cancer Epidemiol Biomarkers Prev 17:141–147

36. Sabitha K, Vishnuvardhan Reddy M, Jamil K (2010) Smoking

related risk involved in individuals carrying genetic variants of

CYP1A1 gene in head and neck cancer. Cancer Epidemiol 34:

587–592

37. Wynder EL, Stellman SD (1977) Comparative epidemiology of

tobacco-related cancers. Cancer Res 37:4608–4622

38. Blot WJ, McLaughlin JK, Winn DM (1988) Smoking and

drinking in relation to oral and pharyngeal cancer. Cancer Res

48:3282–3287

39. Reibel J (2003) Tobacco and oral diseases. Update on the evi-

dence, with recommendations. Med Princ Pract 12(1):22–32

40. Werbrouck J, De Ruyck K, Duprez F et al (2008) Single-nucle-

otide polymorphisms in DNA double strand break repair genes:

association with head and neck cancer and interaction with

tobacco use and alcohol consumption. Mutat Res 656:74–81

41. Sam SS, Thomas V, Reddy KS, Surianarayanan G, Chandr-

asekaran A (2010) Gene–environment interactions associated

with CYP1A1 MspI and GST polymorphisms and the risk of

upper aerodigestive tract cancers in an Indian population. J Can-

cer Res Clin Oncol 136:945–951

42. Muscat JE, Richie JP Jr, Thompson S, Wynder EL (1996) Gender

differences in smoking and risk for oral cancer. Cancer Res

56(22):5192–5197

43. Schildt EB, Eriksson M, Hardell L, Magnuson A (1998) Oral

snuff, smoking habits and alcohol consumption in relation to oral

cancer in a Swedish case–control study. Int J Cancer 77(3):

341–346

44. Fronhoees S, Bruning T, Ortiz-Pallado E, Brode P et al (2001)

Real-time PCR analysis of N-acetyltransferase NAT1 allele *3,

*4, *10, *11, *14 and *17 polymorphism in squamous cell cancer

of head and neck. Carcinogenesis 22:1405–1412

45. Bartsch H, Nair U, Risch A, Rojas M, Wikman H, Alexandrov K

(2000) Genetic polymorphism of CYP genes alone or in

Mol Biol Rep

123

Author's personal copy

combination as a risk modifier of tobacco-related cancers. Cancer

Epidemiol Biomarkers Prev 9:3–28

46. Sakata Y, Yoshioka W, Tohyama C et al (2007) Internal genomic

sequence of human CYP1A1 gene is involved in superinduction

of dioxin-induced CYP1A1 transcription by cycloheximide.

Biochem Biophys Res Commun 355:687–692

47. Hou YY, Ou HL, Chu ST et al (2011) NAT2 slow acetylation

haplotypes are associated with the increased risk of betel quid-

related oral and pharyngeal squamous cell carcinoma. Oral Surg

Oral Med Oral Pathol Oral Radiol Endod 112(4):484–492

48. Majumder M, Ghosh S, Roy B (2012) Association between

polymorphisms at N-acetyltransferase 1 (NAT1) and risk of oral

leukoplakia and cancer. Indian J Med Res 136(4):605–613

49. Heck JE, Moore LE, Lee Y-CA, McKay JD et al (2012) Xeno-

biotic metabolizing gene variants and renal cell cancer: a multi-

center study. Cancer Epidemiol Prev 2:16

50. Taioli E, Ford J, Trachman J, Li Y, Demopoulos R, Garte S

(1998) Lung cancer risk and CYP1A1 genotype in African

Americans. Carcinogenesis 19(5):813–817

51. Ishibe N, Wiencke JK, Zuo ZF, McMillan A, Spitz M, Kelsey KT

(1997) Susceptibility to lung cancer in light smokers associated

with CYP1A1 polymorphisms in Mexican- and African-Ameri-

cans. Cancer Epidemiol Biomarkers Prev 6(12):1075–1080

52. Vineis P, Kogevinas M, Simonato L et al (2000) Levelling-off of

the risk of lung and bladder cancer in heavy smokers: an analysis

based on multicentric case–control studies and a metabolic

interpretation. Mutat Res 463(1):103–110

53. Vondracek M, Xi Z, Larsson P et al (2001) Cytochrome P450

expression and related metabolism in human buccal mucosa.

Carcinogenesis 22:481–488

54. Nagaraj NS, Beckers S, Mensah JK, Waigel S, Vigneswaran N,

Zacharias W (2006) Cigarette smoke condensate induces cyto-

chromes P450 and aldo–keto reductases in oral cancer cells.

Toxicol Lett 165:182–194

55. Chi AC, Appleton K, Henriod JB, Krayer JW et al (2009) Dif-

ferential induction of CYP1A1 and CYP1B1 by benzoapyrene in

oral squamous cell carcinoma cell lines and by tobacco smoking

in oral mucosa. Oral Oncol 45:980–985

56. Spivack SD, Hurteau GJ, Jain R, Kumar SV, Aldous KM, Gierthy

JF et al (2004) Gene–environment interaction signatures by

quantitative mRNA profiling in exfoliated buccal mucosal cells.

Cancer Res 64:6805–6813

57. Cha IH, Park JY, Chung WY, Choi MA, Kim HJ, Park KK (2007)

Polymorphisms of CYP1A1 and GSTM1 gene and susceptibility

to oral cancer. Yonsei Med J 48:233–239

58. Szyfter K, Szmeja Z, Szyfter W et al (1999) Molecular and

cellular alterations in tobacco smoke-associated larynx cancer.

Mutat Res 445:259–274

59. Olshan AF, Weissler M, Watson MA, Bell D (2000) GSTM1,

GSTT1, GSTP1, CYP1A1, and NAT1 polymorphisms tobacco

use and risk of head and neck cancers. Cancer Epidemiol Bio-

markers Prev 9:185–191

60. Basham VM, Pharoah PD, Healey CS et al (2001) Polymor-

phisms in CYP1A1 and smoking: no association with breast

cancer risk. Carcinogenesis 22:1797–1800

61. Matthias C, Bockmuehl U, Jahnke V et al (1998) Polymorphism

in cytochrome P450 CYP2D6, CYP1A1, CYP2E1 and glutathi-

one S-transferase, GSTM1, GSTM3, GSTT1 and susceptibility to

tobacco-related cancers: studies in upper aerodigestive tract

cancers. Pharmacogenetics 8:91–100

62. Oude Ophuis MB, Van Lieshout EM, Roelofs HM, Peters WH,

Manni JJ (1998) Glutathione S-transferase M1 and T1 and

cytochrome P4501A1 polymorphism in relation to the risk for

benign and malignant head and neck lesions. Cancer 82:936–943

63. Varel a-Lema L, Taioli E, Ruano-Ravina A, Barros-Dios JM,

Anantharaman D, Benhamou S et al (2008) Meta-analysis and

pooled analysis of GSTM1 and CYP1A1 polymorphisms and oral

and pharyngeal cancers: a HuGE-GSEC review. Genet Med

10:369–384

64. Anantharaman D, Chaubal PM, Kannan S, Bhisey RA, Mahimkar

MB (2007) Susceptibility to oral cancer by genetic polymor-

phisms at CYP1A1, GSTM1 and GSTT1 loci among Indians:

tobacco exposure as a risk modulator. Carcinogenesis

28:1455–1462

65. Hernando-Rodriguez M, Rey-Barja N, Marichalar-Mendia X et al

(2012) Role of cytochrome P-450 genetic polymorphisms in oral

carcinogenesis. J Oral Pathol Med 41:1–8

66. Demokan S, Suoglu Y, Gozeler M, Demir D, Dalay N (2010) N-

Acetyltransferase 1 and 2 gene sequence variants and risk of head

and neck cancer. Mol Biol Rep 37:3217–3226

Mol Biol Rep

123

Author's personal copy