Journal of Microbiological Methods 80 (2010) 251–256

Contents lists available at ScienceDirect

Journal of Microbiological Methods

j ourna l homepage: www.e lsev ie r.com/ locate / jmicmeth

Application of multiplex single nucleotide primer extension (mSNuPE) to theidentification of bacteria: The Burkholderia cepacia complex case

L. Ferri a, E. Perrin a, S. Campana c, S. Tabacchioni d, G. Taccetti c, P. Cocchi c, N. Ravenni c, C. Dalmastri d,L. Chiarini d, A. Bevivino d, G. Manno b, M. Mentasti e, R. Fani a,⁎a Department of Evolutionary Biology, University of Florence, Via Romana 17–19, I-50125 Florence, Italyb Department of Paediatrics— Infectious Diseases Research and Diagnosis Laboratory— Cystic Fibrosis Center, University of Genoa, G. Gaslini Children's Hospital, Largo G. Gaslini 5, 16147 Genoa, Italyc Department of Paediatrics, University of Florence, Division of Paediatrics, Infectious Diseases, Cystic Fibrosis, Anna Meyer Children's Hospital, Via Luca Giordano 13, I-50132 Florence, Italyd ENEA — CRE — CASACCIA Plant Genetic and Genomic Section, Via Anguillarese 301, S. Maria di Galeria, 00123 — Rome, Italye Central Analysis Laboratory, Department of Clinical Pathology, G. Gaslini Children's Hospital, Largo G. Gaslini 5, 16147 Genoa, Italy

⁎ Corresponding author. Tel.: +39 0552288244; fax:E-mail address: renato.fani@unifi.it (R. Fani).

0167-7012/$ – see front matter © 2010 Elsevier B.V. Aldoi:10.1016/j.mimet.2010.01.008

a b s t r a c t

a r t i c l e i n f o

Article history:Received 30 December 2009Accepted 6 January 2010Available online 14 January 2010

Keywords:Single nucleotide polymorphismsBurkholderia cepacia complexIdentification

Burkholderia cepacia complex (BCC) is characterized by a complex taxonomy constituted by seventeenclosely related species of both biotechnological and clinical importance. Several molecular methods havebeen developed to accurately identify BCC species but simpler and effective strategies for BCC classificationare still needed.A single nucleotide primer extension (SNuPE) assay using gyrB as a target gene was developed to identifybacteria belonging to the B. cepacia (BCC) complex. This technique allows the successful detection anddistinction of single nucleotide polymorphisms (SNPs) and is effectively applied in routine medical diagnosissince it permits to analyze routinely many samples in a few times.Seven SNuPE primers were designed analyzing the conserved regions of the BCC gyrB sequences currentlyavailable in databases. The specificity of the assay was evaluated using reference strains of some BCC species.Data obtained enabled to discriminate bacteria belonging to the species B. multivorans, B. cenocepacia(including bacteria belonging to recA lineages III-A, III-C, and III-D), B. vietnamiensis, B. dolosa, B. ambifaria,B. anthina and B. pyrrocinia. Conversely, identification failed for B. cepacia, B. cenocepacia III-B and B. stabilis.This study demonstrates the efficacy of SNuPE technique for the identification of bacteria characterized by acomplex taxonomical organization as BCC bacteria.

+39 0552288250.

l rights reserved.

© 2010 Elsevier B.V. All rights reserved.

1. Introduction

Bacterial identification and typing represent major challenges formicrobiologists. In the last decade several methods including biochem-ical and molecular-based techniques have been set up and successfullyused. Most molecular methods are based on PCR amplification of targetsequences and themost commonly usedofwhich is 16S rRNAgene. Thisgene is extensively used to study bacterial diversity and allowsidentification of prokaryotes as well as to predict their phylogeneticrelationships. However, the 16S rRNA sequence is not often sufficientlyvariable to distinguish among closely related bacterial species. For thisreason, in the last years, other molecular markers, such as recA, gyrB,rpoB and other genes have been used for species discrimination. Theanalysis of a molecular marker requires gene-specific PCR amplificationfrom a bacterial isolate, followed by the analysis of the resultingamplicon in different ways. To this purpose, several molecular tech-niques have been developed since the beginning of 1990 (for a review

see Kirk et al., 2004). More recently, a Multilocus Sequence Typing(MLST) scheme, based on the simultaneous analysis of severalindependent loci, has been developed for the identification and typingof different microbial species (Maiden et al., 1998; Baldwin et al., 2005;Ahmed et al., 2006; Tanabe et al., 2007). Nevertheless, eachmethod hasits limitations and a polyphasic approach is often required for correctidentification; therefore, the set up of new methodologies is desirable.Among them is the single nucleotide primer extension (SNuPE), whichallows the detection of the nucleotide located at a given site of a DNAsequence, tipically a polymorphic one (referred to as interrogation site)The method was firstly developed by Kuppuswamy et al. (1991) todetect Phe508 mutation in the CFTR human gene. Many applications ofthis technique are further described in different fields such as in routinemedical diagnosis of genetic disorders (Piggee et al., 1997; Syvänenet al., 1990) and forensic research (Vallone et al., 2004). This techniquehas recently been applied for the detection of populations of the genusDehalococcoides from evironmental samples, i.e. groundwater samplescontaminated with chlorinated hydrocarbons (Nikolausz et al., 2008).However, the use of a single primer cannot permit the discrimination ofbacteria belonging to different species (of the same or different genus/

Table 1Burkholderia cepacia complex strains and nucleotide accession number of the relativegyrB sequence.

Strain name gyrB GenBankaccession

Strain name gyrB GenBankaccession

B. cepacia FCF38 (III-D) AY996907LMG 1222Ta AY996867 FCF39 (III-D) AY996908LMG 2161a AY996868LMG 18821 EU240562 B. stabilisFCF1 AY996866 LMG 14294Ta DQ124428FCF2a AY996865 LMG 18870 EU240565FCF3 AY996864 LMG 18888 EU240566

FCF40 AY996911B. multivorans FCF41a AY996912

LMG 13010T DQ124426LMG 18822a AY996877 B. vietnamiensisLMG 17588 DQ124425 LMG 10929Ta AY996913FCF4 AY996869 LMG 18835 EU240563FCF5 AY996870 LMG 18836 EU240564FCF6a AY996871 MDIIIAzo30 AY996915FCF7 AY996872 FCF42a AY996914FCF8 AY996873FCF9 AY996874 B. dolosaFCF10 AY996875 LMG 18943T EU240567FCF11 AY996876 LMG 18941 AY987923

LMG 18942a AY987924B. cenocepacia

LMG 16656Ta (III-A) DQ124427 B. ambifariaLMG 18827 (III-A) EU240559 LMG 19182 T EU240568FCF12a (III-A) AY996881 LMG 19467a AY987926FCF13 (III-A) AY996882 MCI 7a AY987925FCF14 (III-A) AY996879FCF15 (III-A) AY996878 B. anthinaFCF16 (III-A) AY996880 LMG 20980T AY987928LMG 18830 (III-B) EU240560 LMG 16670a AY987927LMG 16654a (III-B) AY996884 LMG 20983 EU240570LMG 16659 (III-B) EU240561FCF18a (III-B) AY996887 B. pyrrociniaFCF19 (III-B) AY996897 LMG 14191Ta AY987933FCF20 (III-B) AY996889 LMG 21824 EU240569FCF21 (III-B) AY996898 FCF43 AY987930FCF22 (III-B) AY996899 FCF44a AY987929FCF23a (III-B) AY996900 FCF45 AY987931FCF24 (III-B) AY996888 FCF46 AY987932FCF26 (III-B) AY996890 MVPC1/26 AY987934FCF27 (III-B) AY996892FCF30 (III-B) AY996891 B. lataLMG 19230 (III-C) AY996901 LMG 6991 DQ288141LMG 19240 (III-C) AY996902FCF32a (III-D) AY996909 BCC5

MVPC1/73AY996886

FCF33 (III-D) AY996910FCF34 (III-D) AY996904 BCC6

MVPC1/16AY996885

FCF35a (III-D) AY996903FCF36 (III-D) AY996905FCF37 (III-D) AY996906

a Strains used in SNuPE reaction.

252 L. Ferri et al. / Journal of Microbiological Methods 80 (2010) 251–256

genera) since only four variants can be present at a single polymorphicsite. In spite of this it is possible to interrogate simultaneously severalpolymorphic sites in a given DNA segment by using primers of differentlength (see below), paving the way to the possibility of discriminatingseveral species of the same (or a different) genus. Even though there is alimitation on the number of primers (up to 10) used for reaction(Vallone et al., 2004), thismethodology can allow detection of SNP(s) inany target sequence and it might represent a valid alternative to othermolecular techniques, especially when working with bacterial generaexhibiting a complex taxonomy. Indeed, in those cases the analysis ofslow evolving markers, such as 16S rRNA genes, is not sufficient todiscriminate between (closely related) species.

Thus, the aim of this workwas to set up amultiplex SNuPE reactionby analyzing several polymorphic sites in a target sequence differentfrom 16S rRNA genes in order to check its discriminating power inbacteria identification. To this purpose, we have chosen as model/target microorganisms bacteria belonging to the Burkholderia cepaciacomplex (BCC) consisting of (at least) 17 different closely relatedspecies. The correct identification of BCC bacteria is particularlyimportant in clinical microbiology as these bacteria are importantopportunistic pathogens that can cause variable lung infections inimmunocompromised patients and in those affected by cystic fibrosis(Chiarini et al., 2006). BCC bacteria are usually identified by means ofrecA polymorphism-based methods which include species-specificPCR, RFLP and sequencing (Mahenthiralingam et al., 2000; Vermiset al., 2002). Although these methods are currently applied to identifyBCC isolates, some possibility of failure have been reported (Dalmastriet al., 2005; Vermis et al., 2002). Recently, a Multilocus SequenceTyping (MLST) scheme has been developed for the precise differen-tiation of the species and strains of the BCC (Baldwin et al., 2005).Unfortunately, DNA sequencing and comparison of seven gene targetsfor each BCC isolate are not within the capabilities of many clinicallaboratories, and therefore, simpler and effective strategies for BCCidentification are still needed. A single well-conserved gene locus thatwould provide a simple method for unambiguous species-specificidentification is highly desiderable for the identification of BCCbacteria. Hence, we investigated the possibility to apply multiplexSNuPE (mSNuPE) to bacteria belonging to BCC. To this purpose wefocused the attention on gyrB gene, which has been recently showedto be a potential marker to discriminate BCC members by DNAsequence (Tabacchioni et al., 2008).

2. Materials and methods

2.1. Bacterial strains and growth conditions

The experimental panel used in this work consisted of 76 BCCstrains of different origin (Table 1). Strains were grown aerobically for48 h at 37 °C in Luria Broth (LB, Sambrook et al., 1989) and 16 gl−1 ofagar was added for plates.

2.2. PCR amplification of gyrB gene from BCC strains

DNA of each BCC isolate was prepared by lysis of 2–3 colonies grownovernight on LB agar plates, according to the method described byVandammeetal. (2002). Lysateswerestoredat−20 °C. PCRamplificationof a gyrB gene fragment of 1033 bp was performed as previouslydescribed by Tabacchioni et al. (2008), using primers gyr1 and PC6r.PCR products were analyzed by agarose gel (0.8%) electrophoresis.

2.3. Single nucleotide primer extension and post-extension treatment

After amplification, gyrB amplicons were purified in a final volumeof 50 μl using the High Pure PCR Product Purification kit (Roche)according to the manufacturer's instructions. SNuPE reactions wereperformed using an ABI Prism SNaPshot Multiplex kit (Applied

Biosystems) as follows. Each reaction was prepared in a final volumeof 10 μl, composed by 5 μl of SNaPshot Multiplex Ready Reaction Mix,1 μl of primer (simplex) or 1 μl of primers mix (multiplex) and 0.1–0.4 pmol of purified gyrB amplicon (approximately 3 μl of a PCRproduct purified as described above). The seven primers used inSNuPE reactions are listed in Table 2. When needed, sterile distilledwater was added up to the final volume of 10 μl. The primerconcentration was 0.9 μM for LF1, 1.8 μM for primer LF2, 0.8 μM forprimer LF2(gvr6), 0.3 μM for primer LF3, 0.3 μM for primer LF4, 1.2 μMfor primer LF5, and 0.3 μM for primer LF6. Primer mix for multiplexreactions was obtained preparing a stock solution containing allprimers. Primer extension was achieved as follows: 25 cyclesconsistingof10 s at 96.0 °C, 5 s at 58.0 °Cand30 s at 60.0 °C.Amplificationproducts can be stored at 4.0 °C. A post-extension treatment to purifySNuPE products from non incorporated ddNTPs was then performed,possibly immediately after extension, adding 1.0 unit of SAP (ShrimpAlkaline Phosphatase; Roche) and incubating the reaction mixture at

Table 2SNP position and primers used in SNuPE reactions performed on a 1033 bp gyrB DNA fragment amplified from BCC strains.

Primer Nucleotide sequence (5′–3′) Size Annealing sitea SNP positiona

LF 1 TTGTCCTTSGTYTGCGAGCT 20 642–623 622LF 2 TTTTAYCGCGGCGTCGCGCAGGATCGCGTG 30 30–55 56LF2(gvr6) TTTTATCGCGGCGTCGCGCAGAATCGGATT 30 30–55 56LF 3 TTTTTTTTTTTACCTTCACGGASAGCACGCACGACA 36 606–582 581LF 4 TTTTTTCGACGATCTTCCCGCARATGATCTTCGCGTCG 38 756–724 723LF 5 TTTTTTTTTTTTCGTGCTGTGCTTCACGAACAACATTCCGCAGCG 45 419–453 454LF 6 TTTTTTTTTTTTTACAAGTACATCRCCGAYAACGAAATCGCGAAGAAGGC 50 507–543 544

Symbols: R: G or A; S: G or C; Y : T or C.a Relative to the gyrB sequence of the B. cepacia reference strain LMG1222 (AY996867).

253L. Ferri et al. / Journal of Microbiological Methods 80 (2010) 251–256

37 °C for 1 h. SAP inactivation was achieved by incubating the reactionmixtures at 75 °C for15 min. Purified reactionswere storedat 4 °C. Signalswere then detected by standard capillary electrophoresis with an ABIPrism 310 Genetic Analyzer (Applied Biosystems).

3. Results and discussion

3.1. Description of the method

The experimental strategy adopted in this work is based on thesteps listed below and schematically reported in Fig. 1:

1) The first step is the choice of the target sequence, which stronglydepends on the aim of thework. If the aim is to differentiate strainsbelonging to closely related species, target sequence(s) with highevolutionary rate should be selected.

Fig. 1. Flow chart of a SnuPE analysis.

2) The following step is the multialignment of the available sequencesof the target region fromdifferent strains belonging to the sameand/or to different species, which, in turn, allows the identification of theinterrogation (polymorphic) sites and of two highly conservedregions upstream of and downstream from them. The latter regionsrepresent the targets of two PCR primers, which allow the PCRamplification of the region embedding the polymorphic site(s). Theselection of the identified interrogation sites to be used in SNuPEanalysis is based on the presence of a highly conserved region of atleast 12–15 nucleotides adjacent to each polymorphic site. TheSNuPEprimer is targeted toward this regionand isdesigned in suchaway that its last nucleotide coincideswith the nucleotide adjacent tothat located at the interrogation site.

3) Once the target sequence is amplified via PCR, the ampliconobtainedis purified from agarose gel in order to avoid any interference infurther SNuPE reaction by the PCR primers used.

4) The SNuPE reaction is then performed on the purified amplicon usingamix of dideoxynucleotides, each ofwhich is labelledwith a differentfluorochrome. In a simplex SNuPE (sSNuPE) reaction, a single SNuPEprimer is employed and allows the identification of the nucleotideresiding in the interrogation site selected. Indeed, just one dideox-ynucleotide is added to the 3′ end of the SNuPE primer by Taqpolymerase.On theotherhand, amultiplexSNuPE(mSNuPE) reactionimplies the use of (at least) two primers scanning (at least) twodifferent interrogation sites. The SNuPE primers used, besides theirspecificity, must have different length (see below). Since the SNuPEprimershave todiffer of at least somenucleotides (inorder topermit agood discrimination at the successive steps) fromeach other, it is veryunlikely tofindvery long completely conserved sequences (20, 25, 30,35, and 40 nt) adjacent to each interrogation site. However, thisobstacle can be easily bypassed by adding a poly-T tail of differentlength at the 5′ end of each primer. In thisway a set of differently longSNuPE primers can be designed and used in a mSNuPE reaction.

5) After the extension, the reaction mix is treated with SAP (ShrimpAlkaline Phosphatase) in order to eliminate unincorporated ddNTPs.

6) Lastly, the nucleotide present at each polymorphic site is identifiedby standard capillary electrophoresis. In the case of a sSNuPEreaction, a single peak will be obtained, whose colour identifies thenucleotide incorporated and thus complementary to that located atthe interrogation site. In a mSNuPE reaction a series of peaks (eachcorresponding to a given primer) will be obtained giving rise to aSNuPE profile that, in turn, allows the identification of the nucleotidepresent at each interrogation site (Fig. 2). In the context of thepresent work, the SNuPE profile is decodified in a six-letter word,which allows the identification of the (unknown) BCC bacterium.

3.2. Design of a set of SNuPE primers

All the 76 BCC gyrB sequences currently available in database(Table 1) were aligned using the program ClustalW (Thompson et al.,1994). The resulting multialignment was analyzed for the presence ofSNPs to be used in SNuPE reactions. Several SNPswere identifiedwithinthe gyrB sequence; six of them(Table 2)were located downstream from

Fig. 2. Schematic representation of amultiplex SnuPEprofile obtainedusing threedifferentprimersof different lengths interrogating three differentpolymorphic sites. TheX-axis representsthe size of the extended products (nucleotides); the Y-axis represents fluorescence intensity (in relative fluorescence intensity). Vertical bars represent the length of the internal standard.

254 L. Ferri et al. / Journal of Microbiological Methods 80 (2010) 251–256

or upstream of a highly conserved nucleotide sequence comprised in a1033 bp amplicon obtained by PCR using the primer set gyr1-pC6r(spanning from position 360 to 1393 in relation to B. fungorum LB400gyrB sequence). In this way the information of the entire sequencewas minimized in a shorter one, consisting of only six informativenucleotides (Fig. 3). Then, a set of seven SNuPE primers, referred to asLF1, LF2, LF2(gvr6), LF3, LF4, LF5, and LF6 were designed on these sixconserved regions to “interrogate” the six polymorphic sites. The sevenprimers are different in sequence and/or size, since they have to be usedsimultaneously in multiplex reactions. As shown in Table 3, some ofthese primers are species-specific; primer LF2(gvr6) is specific forB. dolosa, primer LF4 is specific for B. vietnamiensis, primer LF5 forB. anthina, and primer LF6 for B. pyrrocinia. The expected SNuPE profilesconsist in the six-letter codes reported in Table 3 and most BCC speciesexhibited species-specific SNuPE profile. However, some B. cenocepaciaIII-B and B. stabilis strains share the same profile of some B. cepaciaisolates.

3.3. SNuPE simplex(sSNuPE) reactions

The SNuPE methodology was firstly set up on three BCC strainsbelonging to three different species: B. vietnamiensis LMG10929,B. cenocepacia LMG16654, and B. dolosa LMG18942 that exhibitdifferent in silico SNuPE profiles. The 1033 bp gyrB fragment contain-ing the six interrogation sites was PCR-amplified using the primer setgyr1-PC6r. Each amplicon obtained was purified and subjected to aSNuPE simplex reaction. In order to test the reproducibility of themethod, each reaction was performed in triplicate on three indepen-dent DNA samples. Data obtained (not shown) revealed the presenceof a single peak with the expected colour and position in all samplesanalyzed. These data revealed the specificity of each primer and the

reproducibility of the technique, suggesting the possibility to use theentire set of primers in multiplex SNuPE reactions.

3.4. Multiplex SNuPE (mSNuPE) reactions

Multiplex reactions were carried out as described in Materials andmethods, using the mixture of the seven primers listed in Table 2.Reactions were firstly carried out in triplicate on three independentsamples of gyrB amplicons obtained from the DNA of the three strainsmentioned above. Data obtained (not shown) revealed that the SNuPEprofile corresponded to the expected one. Then, the reliability of theentire primer setwas checked on the gyrB gene froma panel of 22 strainsrepresentative of nine BCC species and of the four B. cenocepacia lineages(Table 1). A gyrB amplicon of the expected size was obtained from eachstrain in a PCR amplification reaction using the primers gyr1-pC6r. Threereplicates of each SNuPE reaction were carried out for all the 22 strainstested and for each reaction three capillary electrophoresis runs wereperformed. Data obtained showed that a SNuPE profile consisting of sixpeaks of a given colour was obtained from each sample (not shown)revealing the reproducibility of the SNuPE multiplex reactions. Some ofthe SNuPE profiles obtained are shown in Fig. 4. The analysis of the 22profiles showed that each of themcorresponds to that predicted by the insilico analysis. Each profile was reproducible even though the relativeintensity of each peak may vary in different reactions. Hence, the wholebody of data obtained revealed that it is possible to distinguish the BCCspecies tested (including the different recA lineages within the species B.cenocepacia). It was not possible to distinguish B. stabilis strainLMG18888 and B. cenocepacia III-B strains (except for LMG18827 andLMG18830) that share the same SNuPE profile withB. cepacia, which hasa profile different from those of all the other BCC species.

Fig. 3. Multialignment of the gyrB gene consensus sequences of all the nine BCC species, comprising the four B. cenocepacia lineages, analyzed in this work. Arrows indicate theannealing sites of SNuPE primers and the SNPs interrogated by them are highlighted in grey. Symbols: B: G, T or C; K: G or T; R, G or A; S: G or C; Y: T or C.

Table 3Nucleotide profiles expected using the SNuPE primers designed in this work.

BCC species Primer

LF1 LF2 LF2(gvr6) LF3 LF4 LF5 LF6

B. cepacia G C – G A C G/AB. multivorans G A – G/A T C GB. cenocepacia III-A G A – G A C GB. cenocepacia III-B G A/C – G A C GB. cenocepacia III-C G T – G A C GB. cenocepacia III-D G A – A A C GB. stabilis G/A C – G A C GB. vietnamiensis G C – G G C GB. dolosa G – C A T C GB. ambifaria G C – A A C GB. anthina G/A C – G A T GB. pyrrocinia G A/C – G/A A C C

255L. Ferri et al. / Journal of Microbiological Methods 80 (2010) 251–256

4. Conclusions

In summary, we have demonstrated that the multiplex SNuPEtechnique scanning several (six) polymorphic sites in the gyrB DNAsequence can be successfully applied to the identification of bacterialspecies exhibiting a complex taxonomy. Moreover, in agreement withNikolausz et al. (2008), the methodology might be also used for thedetection of a given bacterial species/genus in environmental samples.We are completely aware that the methodology used in this work andbased on thegyrB sequence is not able to differentiate all theBCC species.However, thiswork is not focused on the set up of amethodology able todiscriminate all the extant seventeen identifiedBCC species, but rather toshow that the multiplex SNuPE methodology may represent a veryuseful and powerful tool inmicrobial diagnostics for the identification ofbacteria, and might be useful especially for those microorganismsexhibiting a complex taxonomy and forming a group of closely related

Fig. 4. SNuPE profiles obtained by a multiplex reaction using the primers LF1, LF2, LF2(gvr6), LF3, LF4, LF5, and LF6 on the 1033 bp gyrB amplicon from nine BCC strains. The X-axisrepresents the size of the extended products (nucleotides); the Y-axis represents fluorescence intensity (in relative fluorescence intensity).

256 L. Ferri et al. / Journal of Microbiological Methods 80 (2010) 251–256

species. The constantly increasing number of sequences available willalso permit to identify and (possibly) use new (rapidly evolving) DNAmarkers for the identification of BCC bacteria by multiplex SNuPE.

Acknowledgements

This work was supported by Italian Cystic Fibrosis ResearchFoundation (grants 9#2003 and 13#2006) with the contribution of“ForMe s.r.l.” and by Ente Cassa di Risparmio di Firenze. We are verygrateful to the Editor-in-Chief and two anonymous referees for theirhelpful suggestions in improving the manuscript.

References

Ahmed, N., Devi, S.M., ValverdeMde, L., Vijayachari, P., Machang'u, R.S., Ellis,W.A., Hartskeerl,R.A., 2006. Multilocus sequence typing method for identification and genotypicclassification of pathogenic Leptospira species. Ann. Clin.Microbiol. Antimicrob. 23, 5–28.

Baldwin, A., Mahenthiralingam, E., Thickett, K.M., Honeybourne, D., Maiden, M.C.,Govan, J.R., Speert, D.P., Lipuma, J.J., Vandamme, P., Dowson, C.G., 2005. Multilocussequence typing scheme that provides both species and strain differentiation forthe Burkholderia cepacia complex. J. Clin. Microbiol. 43, 4665–4673.

Chiarini, L., Bevivino, A., Dalmastri, C., Tabacchioni, S., Visca, P., 2006. Burkholderiacepacia complex species: health hazards and biotechonological potential. TrendsMicrobiol. 14, 277–286.

Dalmastri, C., Pirone, L., Tabacchioni, S., Bevivino, A., Chiarini, L., 2005. Efficacy ofspecies-specific recA PCR tests in the identification of Burkholderia cepacia complexenvironmental isolates. FEMS Microbiol. Lett. 246, 39–45.

Kirk, J.J., Beudette, L.A., Hart, M., Moutoglis, P., Kliromonos, J.N., Lee, H., Trevors, J.T.,2004. Methods of studying soil microbial diversity. J. Microbiol. Methods 58,169–188.

Kuppuswamy, M.N., Hoffmann, J.W., Kasper, C.K., Spitzer, S.G., Groce, S.L., Bajaj, S.P.,1991. Single nucleotide primer extension to detect genetic diseases: experimentalapplication to hemophilia B (factor IX) and cystic fibrosis genes. Proc. Natl. Acad.Sci. U. S. A. 88, 1143–1147.

Mahenthiralingam, E., Bischof, J., Byrne, S.K., Radomski, C., Davies, J.E., Av-Gay, Y., Vandamme,P., 2000. DNA-based diagnostic approaches for identification of Burkholderia cepacia

complex, Burkholderia vietnamiensis, Burkholderia multivorans, Burkholderia stabilis, andBurkholderia cepacia genomovars I and III. J. Clin. Microbiol. 38, 3165–3173.

Maiden, M.C., Bygraves, J.A., Feil, E., Morelli, G., Russell, J.E., Urwin, R., Zhang, Q., Zhou, J.,Zurth, K., Caugant, D.A., Feavers, I.M., Achtman, M., Spratt, B.G., 1998. Multilocussequence typing: a portable approach to the identification of cloneswithin populationsof pathogenic microorganisms. Proc. Natl. Acad. Sci. U. S. A. 95, 3140–3145.

Nikolausz, M., Chatzinotas, A., Palatinszky, M., Imfeld, G., Martinez, P., Kästner, M., 2008.Single-nucleotide primer extension assay for detection and sequence typing of“Dehalococcoides” spp. Appl. Environ. Microbiol. 74, 300–304.

Piggee, C.A., Muth, J., Carrilho, E., Karger, B.L., 1997. Capillary electrophoresis for thedetection of known point mutations by single-nucleotide primer extension andlaser-induced fluorescence detection. J. Chromatogr. A 781, 367–375.

Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning: A Laboratory Manual,2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.

Syvänen, A.C., Aalto-Setälä, K., Harju, L., Kontula, K., Söderlund, H., 1990. A primer-guidednucleotide incorporation assay in the genotyping of apolipoprotein E. Genomics 8,684–692.

Tabacchioni, S., Ferri, L., Manno, G., Mentasti, M., Cocchi, P., Campana, S., Ravenni, N.,Taccetti, G., Dalmastri, C., Chiarini, L., Bevivino, A., Fani, R., 2008. Use of the gyrBgene to discriminate among species of the Burkholderia cepacia complex. FEMSMicrobiol. Lett. 281, 175–182.

Tanabe, Y., Kasai, F., Watanabe, M.M., 2007. Multilocus sequence typing (MLST) revealshigh genetic diversity and clonal population structure of the toxic cyanobacteriumMicrocystis aeruginosa. Microbiology 153, 3695–3703.

Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivityof progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673–4680.

Vallone, P.M., Just, R.S., Coble, M.D., Butler, J.M., Parsons, T.J., 2004. A multiplex allele-specific primer extension assay for forensically informative SNPs distributedthroughout the mitochondrial genome. Int. J. Legal. Med. 118, 147–157.

Vandamme, P., Henry, D., Coenye, T., Nzula, S., Vancanneyt, M., LiPuma, J.J., Speert, D.P.,Govan, J.R., Mahenthiralingam, E., 2002. Burkholderia anthina sp. nov. and Bur-kholderia pyrrocinia: two additional Burkholderia cepacia complex bacteria, mayconfound results of new molecular diagnostic tools. FEMS Immunol. Med.Microbiol. 33, 143–149.

Vermis, K., Coenye, T., Mahenthiralingam, E., Nelis, H., Vandamme, P., 2002. Evaluationof species-specific recA-based PCR tests for genomovar level identification withinthe Burkholderia cepacia complex. J. Med. Microbiol. 51, 937–940.