ACE ID Genotype and the MuscleStrength and Size Response to UnilateralR esistance Training

LINDA S. PESCATELLO', MATTHEW A. KOSTEK', HEATHER GORDISH-DRESSMAN 2, PAUL D. THOMPSON 3,RICHARD L. SEIP 3, THOMAS B. PRICE 3'4, THEODORE J. ANGELOPOULOS 5, PRISCILLA M. CLARKSON 6,PAUL M. GORDON7. MALL M. MOYNA 8, PAUL S. VISICH 9, ROBERT F. ZOELLER' 0 , JOSEPH M. DEVANEY 2,and ERIC P. HOFFMAN

2

'School of Allied Health, University of Connecticut, Storrs, CT; 2Research Center for Genetic Medicine, Children's NationalMedical Center, Washington, DC; 3Division of Cardiology, Hartford Hospital, Hartford, CT; 4Department of DiagnosticRadiology, Yale University School of Medicine, New Haven, CT; -5Center for Lifestyle Medicine and Department of HealthProfessions, University of Central Florida, Orlando, FL; 6Department of Exercise Science, University of Massachusetts,Amherst, MA; 7Division of Exercise Physiology, West Virginia University. Morgantown, WV; 8Departnent of Sport Scienceand Health, Dublin City University, Dublin, IRELAND; Hunman PelforTnance Laboratory, Central Michigan University,Mount Pleasant, MI; and l°Department of Exercise Science and Health Promotion, Florida Atlantic University, Davie, FL

ABSTRACT

PESCATELLO, L. S., M. A. KOSTEK. H. GORDISH-DRESSMAN, P. D. THOMPSON, R. L. SEIP. T. B. PRICE. T. J.ANGELOPOULOS, P. M. CLARKSON, P. M. GORDON, N. M. MOYNA. P. S. VISICH. R. F. ZOELLER, J. M. DEVANEY, andE. P. HOFFMAN. ACE ID Genotype and the Muscle Strength and Size Response to Unilateral Resistance Training. Med. Sci. SportsExerc., Vol. 38, No. 6, pp. 1074-1081, 2006. Purpose: To examine associations among the angiotensin I-converting enzyme (ACE)insertion (I)/deletion (D) polymorphism and the response to a 12-wk (2 d-wk-1) unilateral, upper-arm resistance training (RT) program inthe trained (T, nondominant) and untrained (UT, dominant) arms. Methods: Subjects were 631 (mean ± SEM, 24.2 ± 0.2 yr) white (80%)men (42%) and women (58%). The ACE ID genotype was in Hardy-Weinberg equilibrium with frequencies of 23.1, 46.1, and 30.8% forACE H, ID, and DD, respectively (X2 = 1.688, P = 0.430). Maximum voluntary contraction (MVC) and one-repetition maximum (IRM)assessed peak elbow flexor muscle strength. Magnetic resonance imaging measured biceps muscle cross-sectional area (CSA). Multiplevariable and repeated-measures ANCOVA tested whether muscle strength and size differed at baseline and pre- to post-RT among T andUT and ACE ID genotype. Results: Baseline muscle strength and size were greater in UT than T (P < 0.001) and did not differ amongACE ID genotype in either arm (P > 0.05). In T, MtVC increases were greater for ACE 1/ID (22%k) than DD (17%) (P < 0.05), whereas1RM (51%) and CSA (19%) gains were not different among ACE ID genotype pre- to post-RT (P > 0.05). In UT, MVC increased amongACE 11/D (7%) (P < 0.001) but was similar among ACE DD (2%) pre- to post-RT (P 2! 0.05). In UT, IRRM (11%) and CSA (2%)increases were greater for ACE DD/ID than ACE II (IRM, 7%; CSA. -0.1%) (P < 0.05). ACE ID genotype explained approximately1% of the MVC response to RT in T and approximately 2% of MVC, 2% of IRM, and 4% of CSA response in UT (P < 0.05).Conclusion: ACE ID genotype is associated with the contralateral effects of unilateral RT, perhaps more so than with the muscle strengthand size adaptations that result from RT. Key Words: EXERCISE, GENETICS. STRENGTH TRAINING, QUANTITATIVE TRAITLOCI, RENIN-ANGIOTENSIN SYSTEM

he renin-angiotensin system (RAS) is a hormonalcascade that regulates cardiovascular function (2).The pathway begins with the production of renin that

acts on angiotensinogen to form angiotensin I. AngiotensinI-converting enzyme (ACE) transforms biologically inac-tive angiotensin I into angiotensin II, a potent vasopressor

Address for correspondence: Linda S. Pescatello, Ph.D., Center of HealthPromotion, University of Connecticut. School of Allied Health, 358Mansfield Road, U-2101 Storrs, CT 06269-2101; E-mail: Linda.Pescatello@uconn.edu.Submitted for publication November 2005.Accepted for publication January 2006.

0195-9131/06/3806-107410MEDICINE & SCIENCE IN SPORTS & EXERCISE%Copyright © 2006 by the American College of Sports Medicine

DOI: 10.1249/01.mss.0000222835.28273.80

whose actions include vasoconstriction, renal sodium reab-sorption, and aldosterone production. ACE also degradesbradykinin, a vasodilator that has favorable effects onendothelial function and substrate utilization. A functionalpolymorphism of the ACE gene is the insertion (I) anddeletion (D) polymorphism, depending on the presence orabsence of a 287 amino acid base pair Alu repeat sequencewithin intron 16 on chromosome 17. Hence, three ACE IDgenotypes exist: fl. ID, and DD, the distributions of whichwithin a white population are approximately 25, 50, and25%, respectively (1).

The D allele of the ACE ID polymorphism is associatedwith higher serum and tissue ACE activity, resulting ingreater production of angiotensin II and aldosterone, in-creased vascular smooth muscle growth, and a decreasedhalf-life of bradykinin compared with the ACE I allele(2,26.27). Although serum ACE levels are generally stablewithin an individual, there is considerable variability in

1074

serum ACE levels in the general population (11,17,23,26),largely attributed to the presence of the ACE I or D allele.The differential actions of the ACE I and D alleles on theRAS have been associated with the response of the car-diovascular and musculoskeletal systems to environmentalperturbations such as exercise (4,16).

The ACE I allele is more common in elite male enduranceathletes including distance runners (15,27), rowers (7),triathletes (4), and mountaineers (13,29) and is associatedwith an enhanced cardiovascular response to enduranceexercise training than the ACE D allele (8,12,13,27-30). Incontrast, the ACE D allele is reported to be more commonin muscle strength and power athletes (15,28) and to beassociated with a superior muscle size and strength responseto exercise training (6,12,13). However, only three investi-gative teams (6,21,26) have used a resistance training (RT)intervention to examine these associations, and they havearrived at different conclusions. Folland et al. (6) reportedgreater maximum voluntary contraction (MVC) and similarone-repetition maximum (IRM) gains after RT amongsubjects with the ACE D allele compared with those withthe ACE II genotype. Williams et al. (26) found noassociations among the ACE ID polymorphism and themuscle strength response to RT. Thomis et al. (21) reportedborderline significance for greater concentric flexion torquegains for ACE I allele carriers but found no associationsamong the ACE ID genotype and the muscle size responseto RT of the elbow flexors.

Because evidence is limited, we examined the influence ofthe ACE ID genotype on the muscle strength and sizeadaptations to a standardized 12-wk unilateral, upper-ann RTintervention in a large sample of apparently healthy youngadults. Consistent with the conclusions of previous reports(6,12,13,15,28), we hypothesized that the muscle strengthand size gains from RT would be greater among ACE DDhomozygotes compared to carriers of the ACE I allele.

METHODS

Study overview. This study was part of the FunctionalSingle Nucleotide Polymorphisms Associated with HumanMuscle Size and Strength (FAMuSS) multicenter trialconducted by the Exercise and Genetics CollaborativeResearch Group (22). FAMuSS was designed to identifynonsynonymous single nucleotide polymorphisms (SNP)that associate with various phenotypes of human musclesize and strength. The institutional review boards from the 10institutions involved with FAMuSS approved the study protocol.

The experimental design of FAMuSS has been described(3,9,22). Potential study volunteers were recruited from theeight RT sites via strategic flyer placement and inhouse,listserv, and radio announcements. The mean (± SEM)number of subjects trained at the eight sites was 75 ± 9,with a range of 49 to 114 individuals per site. After obtain-ing informed consent from all participants, isometric (MVC)and dynamic strength (IRM) and cross-sectional area (CSA)of the upper arms by magnetic resonance imaging (MRI)were measured before and after RT. The standardized, pro-

ACE ID GENOTYPE AND RESISTANCE TRAINING

gressive RT intervention consisted of 12 wk of elbow flexorand extensor training of the nondominant arm (i.e., the handwith which the subject did not write; trained, T) in 264 menand 367 women who had not performed RT in the previousyear. The dominant arm (untrained, UT) served as the non-exercise comparison in response to RT. Biannual investigatortraining was performed to ensure standardization of studyprotocols among sites.

Study population. Study volunteers who used medi-cations known to affect skeletal muscle function such ascorticosteroids, antihypertensive or hyperlipidemic medi-cations, anabolic steroids, diuretics, arthritis medications(Vioxx, Celebrex), Depo-Provera Contraceptive Injection,Clenbuterol, Rhinocort nasal inhaler, lithium, and chronicuse of nonsteroidal antiinflammatory drugs were excluded.In addition, those who had chronic medical conditions suchas diabetes; had metal implants in arms, eyes, head, brain,neck, or heart; had performed any resistance training and/orregular activity that required repetitive use of the armsbeyond normal daily activities within the prior year; con-sumed on average more than two alcoholic drinks daily; orused dietary supplements reported to build muscle size/strength or to cause weight gain such as protein supple-ments, creatine, or androgenic precursors were also excluded.Due to the potential confounding effects of weight fluctuationin the muscle strength and size response to RT, subjects thatreported trying to lose weight, beginning a special dietpurported to bring about a weight change, or having a weightchange of more than 5 lb within 3 months of studyparticipation were excluded. All subjects gave writteninformed consent prior to participation.

Anthropometric measurements. Pre- and post-RTassessments included body weight (in pounds using astandard balance beam scale) and height (in inches) thatwere used to calculate the body mass index (BMI)(kg.m- 2). Subjects were instructed to follow their usualdiet throughout the study. To ensure weight stabilitydefined as ± 5.0 lb of pre-RT weight, body weight wasalso measured every 3 wk during study participation.

Isometric strength testing. MVC of the elbowflexor muscles of the T and UT arms was assessed usinga custom-made preacher curl bench and strain gauge(model 32628CTL, Lafayette Instrument Company,Lafayette, IN). Baseline MVC was assessed on threeseparate days 24-48 h apart, and post-RT measurementswere assessed on two separate days 24-48 h apart andwithin 48 h of the final RT session. Baseline values wererecorded as the average of the second and third pre-RTtesting days, with the first day serving as a familiarizationsession. Each MVC attempt began with a verbal cue fromthe tester, with subjects gradually increasing to a maximaleffort that was sustained for 3 s with 1 ruin allowedbetween contractions. The same investigator measuredMVC for a subject pre- and post-RT after calibrating thestrain gauge and using a fixed seat height and a goniometerto maintain the ann angle at 90'. To minimize compensa-tory movement, the investigator ensured that the arm notbeing tested was relaxed and placed in neutral position

Medicine & Science in Sports & Exercise. 1075

with the hand pronated and arm extended on the lap. Thetesting session ended once three measurements were within5 feet per pound of each other or a maximum of sixattempts had been made. The closest three measurementswere averaged and recorded in kilograms. The intersitewithin-subject coefficient of variation based on baselinemeasurements made on days 2 and 3 was 7.4%, indicatingadequate reliability among sites.

1RM maximum strength testing. The dynamicstrength of the elbow flexor muscles of T and UT armswas assessed by IRM on a standard preacher curl bench(Yukon International Inc.. Cleveland, OH) holding aPowerblock (Powerblocks, Intellbell, Inc., Owatonna,MN) before and 48 h after the last RT session. Subjectswere familiarized with the 1RM procedures on anotheroccasion prior to testing. Powerblocks are handheldweights resembling dumbbells in increments of 2.50 and5.00 lb. If needed, additional weight could also be added in1.25-lb increments using Platemates@ (Benoit Built Inc.,Boothbay Harbor, ME). The same investigator measuredIRM for a subject and ensured that the arm not beingtested was relaxed and placed in neutral position. Eachsubject performed two warm-up sets with increasingweight. Study investigators then verbally instructedsubjects to perform one full range of motion repetition,extending the elbow to 1800 and curling the weight backup to the shoulder with the weight at 100% of estimatedmaximum. If the lift was unsuccessful, a 3-min rest wastaken and the weight decreased slightly. If the lift wassuccessful, a 3-min rest was taken and the weight in-creased. The procedure was repeated until subjects failed tocomplete a full range of motion lift. Weights were chosenso that the IRM could be determined in three to fiveattempts. Maximum weight lifted was recorded in kilogramsas the greatest amount of weight successfully lifted onetime. As with the MVC testing, the same study investigatormeasured 1RM and provided verbal encouragement duringeach IRM attempt for a given subject pre- and post-RT.

MRI. CSA of the T and UT biceps brachii was measuredusing MRI with 1.5-T systems. MRI were performed prior tothe first RT session and within 48-96 h after the final RTsession. Prior to entering the MR magnet. a radiographicbead (Beekley Spots, Beekley Corp., Bristol, CT) was placedat the maximum circumference or the point of measure(POM) of the upper arms of each subject. The POM wasdetermined with subject's arm abducted 900 at the shoulder,flexed 900 at the elbow, hand open and the biceps maximallycontracted. The same investigator visually located the POMon the T and UT arm for a subject pre- and post-RT.

The MRI consisted of 15 axial slices comprising 24 cmof the upper arm. Subjects laid supine on the scanning bedin an anatomical position, with the arm aligned to theisocenter of the magnet. The hand was supinated and tapedin place on the scanner bed, and the POM was centered tothe alignment light of the MRI. Coronal and sagittal scoutimages were produced to locate the long axis of thehumerus and to align the eighth to ninth axial slices withthe POM, respectively. Fifteen spoiled gradient images

1076 Official Journal of the American College of Sports Medicine

were generated (time to echo (TE) = 1.9 s, time to repeat(TR) = 200 ms, flow artifact suppression, 300 flip angle),with POM as the center point. Axial imaging began at thesuperior portion of the upper arm and proceeded distallytoward the elbow joint. Each individual image slice was16 mm thick with a 0-mm interslice gap, 256 x 192matrix resolution, 22 x 22-cm field of view, and numberof experiments (NEX) = 6.

Muscle CSA measurements. MR images from eachinvestigative site were saved via magnetic optical disk orCD-ROM in a DICOM format and sent to the centralimaging facility for analysis. The same investigatoranalyzed MR images using a custom-designed programcreated to function within Matlab (The Math Works, Inc.,Natick, MA). This software enables the user to assignregions of interest in an image set by tracing region borderswith a mouse. Because muscle is easily identifiable on MRimages, CSA could be measured using this computerizedplanimetry technique. Once the region of interest wasdefined, the program reported the number of pixelscontained in the selected region of interest. CSA was thendetermined by multiplying the number of pixels within the

2defined area by a preset CSA value of 0.01 cm ,determined from the NM matrix and field of view. MRIstandardization between sites was accomplished by com-paring the radiographic bead's measured CSA with theMRI determined CSA.

To assign the slice to be assessed, the analyst identifiedthe slice immediately following the axilla and then counteddown slice by slice to the slice showing the POM in arm. Inthe rare instance that the number of slices between theaxilla and POM differed pre- and post-RT POM, readilyapparent discernible irregularities in the contour of themuscle and shape of the arm pre-RT were compared withslices adjacent to the post-RT POM until an identicalanatomical match was found. The ninth axial slice wasmeasured for maximum biceps CSA for most subjects. Thepre-CSA was subtracted from the post-CSA, yielding theRT response for that arm. Interobserver reliability was ±3.5%, and the intraobserver reliability for the entire processof image acquisition and analysis was calculated to be acorrelation coefficient of 0.99. To further validate the CSAcalculation, a subset of data from 70 subjects was analyzedby volumetric analysis in the T and UT arms. The CSA(cmr) of 11 successive slices was determined over 17.6 cmof the scanned length of the upper arm. Each CSA wasmultiplied by the known slice thickness (1.6 cm) to yield aslice volume (cm 3). Slice volumes were then summed overthe length of the biceps. Comparison of the relativepercentage from baseline training-induced change in volumeversus CSA within the subgroup of 70 subjects revealed nosignificant differences between the two methods (P = 0.315).

RT program. A unilateral upper-arm RT program waschosen as the exercise intervention to minimize theconfounding influence of activities of daily living on themuscle strength and size response to RT (22). In addition,this study design allowed the UT arm to serve as anonexercise comparison. Subjects underwent 12 wk of

http://www.acsm-msse.org

gradually progressive, supervised RT of their nondominantarm, twice weekly, separated by a minimum of 48 h. Theexercises consisted of the biceps preacher curl, bicepsconcentration curl, standing biceps curl, overhead tricepsextension, and triceps kickback. The primary purpose wasto train the elbow flexors, but the elbow extensors werealso trained to balance muscle strength across the elbow.

Each RT session began with a warm-up consisting of twosets of 12 repetitions of the biceps preacher curl and the

overhead triceps extension. A 3-min rest followed eachwarm-up set. Following the warm-up series, subjectsperformed three sets of 12 repetitions at 65-75% of theirIRM for each of the five above-mentioned exercises. Thespeed of each repetition was 4 s: 2 s for the concentric and2 s for the eccentric phase. A 2-min rest followed each set.At week 5, the number of repetitions was decreased toeight and then to six at week 10. Thus, the exerciseintensity at weeks 5 and 10 increased to 75-82% 1RM and83-90% 1RM, respectively. All exercises were performedwith Powerblocks, and some exercises used the preachercurl bench. All training sessions were supervised and lastedapproximately 45-60 min.

Genotyping methods. Blood samples were obtainedfrom all subjects in vacutainer tubes containing eth-ylenediamine tetraacetic acid and sent to the coordinatingsite in Washington, DC, for DNA isolation using Puregenekits (Gentra Systems, Inc., Minneapolis, MN). For the ACEID genotype, we used a method (23) that has beenvalidated using three additional primers that produceunambiguous results for the ACE ID genotype. Theprimers (F: CTGGAGACCACTCCCAATCCTTTC andR: GATGTGGCCATCACATTCGTC) were used to am-plify the region of Alu insertion, with the Alu element's

presence or absence detected by running the product on anagarose gel. Polymerase chain reaction amplification wasperformed in a 10-/iL reaction containing 20 ng of DNA,0.10 mmol-L-L of each primer, 0.125 mmol-L-1 of eachdNTP, 2 mmol.L-1 MgCI2 , and 0.1 U of AmpliTaq GoldTm(Applied Biosystems). The cycling conditions were 95'Cfor 10 min, then 35 cycles of 94'C for 1 min, 58°C for 45 s,72°C for 1.5 min, and, finally, 72°C for 10 min. All gelswere called by two investigators, and if any disagreementin genotyping was found, the genotyping was repeated.

Data administration. Data from all investigative siteswere compiled in a master database maintained by a statis-tical consultant at the coordinating site in Washington, DC.Each investigative site was able to access the database andmanually enter data via a secure intranet using a confiden-tial username and password.

Quality control. To ensure standardization betweensites, the following procedures were followed: testertraining and protocol and methodology reviews were donebiannually; there were annual site visits to ensure protocoladherence; common standard operating procedure manualwas used at each site; and there was frequent contactamong the investigators through regular conference calls.Additionally, identical testing and workout equipment wereused at each site.

ACE ID GENOTYPE AND RESISTANCE TRAINING

Statistical analysis. The attrition rate from the RTprogram was 9% with no difference among the ACE IDgenotypes. Consequently, all analyses included onlysubjects who completed the study. Descriptive statisticsand frequencies were calculated for study variables. TheX test was used to determine whether the ACE IDgenotype was in Hardy-Weinberg equilibrium for whitepopulations. Dependent variables included baseline andchange in muscle strength (post-RT - pre-RT) for MVCand 1RM and muscle size (CSA) in the T and UT arms,which are presented in absolute (no correction; MVC,IRM, and CSA), relative percentage (post-RT - pre-RT/pre-RT x 100; MVC, IRM, and CSA), and allometric(strength (kg) x body weight (kg)- 0 67; MVC and IRM)terms (24).

Multiple-variable and repeated-measures ANCOVA,with age and BMI as covariates and ACE ID genotypeand gender as fixed factors, tested whether muscle strengthand size differed in the T and UT arms among the totalsample and ACE ID genotype at baseline and pre- to post-RT, respectively. Multiple variable regression testedwhether the relative percentage of change from baselinediffered from 0 in the T and UT arms pre- to post-RTamong the total sample and ACE genotype. The resulting Pvalues from these linear tests were adjusted for multiplecomparisons using the Sidak post hoc multiple comparisontest. No gender x ACE ID genotype interactions werefound for any of the muscle phenotypes examined. Thus,gender was found not to alter the influence of ACE IDgenotype on the muscle strength and size response to RT.In addition, the ACE genotype distribution was in Hardy-Weinberg equilibrium for both men and women. For thesereasons, and because our findings on the influence ofgender on the muscle strength and size response to RThave been published (9), results for this study are presentedfor the T and UT arms among the total sample and ACE IDgenotype only.

Because of the large sample size, the proportion of allvariance in the muscle strength and size response thatcould be attributable to ACE genotype was calculated forall study variables in the T and UT arms with thelikelihood test ratio. The likelihood test ratio comparesthe full statistical model containing ACE ID genotype,gender, age, and BMI to the constrained model withoutACE ID genotype. Statistical significance was set at P <0.05, with all data reported as mean ± SEM. Allcalculations were made using SPSS 13.0 for Windows.

RESULTS

Subjects. The study sample (N = 631) had a mean ageof 24.2 ± 0.2 yr (± SEM) and was composed of 367(58.2%) women and 264 (41.8%) men. The sample waspredominately white (79.5%), with 8.2% of the subjects

Asian, 4.6% Hispanic, 4.1% African American, and 3.3%other. The ACE ID genotype distribution of the studysample was in Hardy-Weinberg equilibrium for whitepopulations, with frequencies of 23.1, 46.1, and 30.8% for

Medicine & Science in Sports & Exercise® 1077

TABLE 1. Mean (i SEM) physical characteristics of the total sample and byACE ID genotype.

Genotype

Total Sample 11 ID DDVariable (N = 631) (N= 146) (N = 291) (N = 194)

Age (yr) 24.2 - 0.2 24.4 _ 0.5 24.2 ± 0.3 24.1 ± 0.4Weight (kg) 70.6 : 0.6 69.6 _i 1.2 71.6 ± 1.0 69.9 ± 1.1Height (cm) 170.0 :k 0.3 170.3 ± 0.7 169.8 . 0.5 169.9±: 0.6BMI (kg.m- 2) 24.5 * 0.2 24.1 ± 0.3 24.9 ± 0.3 24.5 ± 0.2

There were no significant differences in physical characteristics among the ACE IDgenotypes.ACE, angiotensin I-converting enzyme; I, insertion allele; D, deletion allele; BMI,body mass index.

the ACE 11, ID, and DD genotypes, respectively (x2 =

1.688; P = 0.430) and frequencies of the I and D alleles of46.2 and 53.8%, respectively. Descriptive characteristicsdid not differ by ACE genotype (Table 1) (P > 0.05).

Muscle strength and size by ACE genotype. Themuscle strength and size measures in the T and UT arms atbaseline and in response to RT are displayed in Table 2.Baseline muscle strength (MVC and IRM) and size (CSA)were greater in the UT (dominant) than T (nondominant)arm in the total sample and ACE ID genotype groups (P <0.001). However, baseline muscle strength and size did notdiffer among the ACE ID genotype groups in either the Tor UT arm (P > 0.05).

T arm. All muscle strength and size measures increased

in the T arm pre- to post-RT in the total sample and ACE IDgenotype groups (P < 0.001) (Table 2). MVC gains in the T

arm pre- to post-RT were greater for subjects with the ACEI allele (ACE fl/ID) than those with the ACE DD genotype

(Table 2), whether these gains were expressed in absoluteterms, adjusted for baseline values, or allometrically scaled

for body mass (P < 0.05). In contrast, unadjusted (absolute)and adjusted (relative percentage of baseline and allome-tric) IRM increases in the T arm pre- to post-RT were notdifferent among ACE ID genotype groups (P > 0.05)(Table 2). Absolute and relative percentage of muscle sizeincreases in the T arm also were not different among ACEID genotype groups (P _> 0.05) (Table 2).

UT arm. All muscle strength and size measuresincreased in the UT arm pre- to post-RT among the totalsample (P < 0.05): however, there were variable musclestrength and size responses to RT in the UT arm amongACE ID genotype groups (Table 2). MVC increased in theUT arm pre- to post-RT among those with the ACE I allele(ACE 11/ID) (P < 0.001), whereas MVC was not differentin the UT arm pre- to post-RT among those with the ACEDD genotype (P _> 0.05). whether the responses wereexpressed in absolute terms, adjusted for baseline values,or allometrically scaled for body mass (Table 2). Unad-justed (absolute) and adjusted (relative percentage ofbaseline and allometric) 1 RM increased in the UT armpre- to post-RT among ACE ID genotype groups (P <0.05), and these gains were greater for subjects with theACE D allele (ACE ID/DD) than those with the ACE 11genotype (P < 0.05) (Table 2). Unadjusted (absolute) andadjusted (relative percentage of baseline) CSA increased inthe UT arm pre- to post-RT among subjects with the ACED allele (ACE DDAID), whereas unadjusted (absolute) CSAdecreased (P = 0.049) and adjusted (relative percentage ofbaseline) CSA was similar (P 2! 0.05) pre- to post-RTamong those with the ACE 1H genotype (Table 2).

Proportion of variance attributable to ACEgenotype. Our sample was large, enabling us tocalculate the proportion of variance in the muscle

TABLE 2. Mean (i SEM) muscle strength and size measures in the trained and untrained arms at baseline and pre- to post-resistance training in the total sample and byACE ID genotype."b

GenotypeVariable Arm Total Sample (N= 631) 11 (N= 145) ID (N= 291) DD (N= 194)

Baseline MVC (kg) Trained 44.8 = 0.6 43.1 ± 1.2 46.0 ± 0.9 45.4 =1 1.1Untrained 46.9 - 0.7 45.6 :k 1.3 48.0 - 1.0 47.1 i 1.2

MVC absolute Trained 8.0 =' 0.3 8.7 ± 0.6 8.6 ± 0.5 6.8 :1 0,6tChange (kg) Untrained 1.8 :E 0.3 2.3 : 0.6 2.4 ± 0.4 0.6 -0.5^AA, fMVC relative Trained 20.5 .-_ 0.9 22.8 ± 1.7 22.0 + 1.3 16.8 - 1.6tChange (%) Untrained 5.2 - 0.8 6.6 ± 1.4 7.0 ± 1.0 2.0 ± 1.3"^^, t:MVC allometric Trained 0.45 A 0.43 0.50 ± 0.04 0.50 + 0.03 0.40 0.03tChange (kg-kg-0.67) Untrained 0.10 ± 0.02 0.14 ± 0.03 0.14 + 0.02 0.04 ± 0.03 AAA, $Baseline 1RM (kg) Trained 8.6 . 0.2 8.8 ± 0.2 9.2 - 0.1 9.2 ± 02

Untrained 9.8 ± 0.1 9.6- 0.2 9.9 ± 0.1 10.0 ± 021RM Absolute Trained 3.9 ± 0.1 3.8 ± 0.2 4.1 + 0.1 4.0 ± 0.1Change (kg) Untrained 0.8 ± 0.1 0.5 ± 0.1* 0.9 ± 0.1 1.0 ± 0.11RM relative Trained 52.8 ± 1.3 51.6 + 2.5 50.9 . 1.8 51.2 ± 2.3Change (%) Untrained 9.9 ± 0.8 7.1 ± 1.5* 10.7 ± 1.1 11.9 ± 1.31 RM allometric Trained 0.23 - 0.00 0.24 . 0.01 0.24 + 0.01 0.23 ± 0.01Change (kg.kg--67) Untrained 0.05 - 0.00 0.03 ± 0.00** 0.05 ± 0.00 0.06 _ 0.01Baseline CSA (cm2) Trained 17.0 ± 0.3 17.6 ± 0.4 18.0 ± 0.3 17.2 ± 0.4

Untrained 18.3 ± 0.2 18.5 ± 0.4 18.5 ± 0.3 17.9 ± 0.4CSA absolute Trained 3.2 - 0.1 3.1 ± 0.2 3.4 + 0.1 3.4 ± 0.2Change (cm2) Untrained 0.1 ± 0.5 -0.2 ± 0.1*S 0.3 ± 0.1 0.2 t 0.1CSA relative Trained 18.7 - 0.0 18.1 ± 0.9 19.1 + 0.6 19.9 ± 0.8Change (%) Untrained 0.8 + 0.3 -0.9 0 6.5--,A,*S 1.7 ± 0.4 1.5 ± 0.5a Covariates included age and body mass index with gender and ACE ID genotype as fixed factors.b All muscle and sizes changes pre- to post-RT were significant among the total sample and the ACE ID genotype groups (P< 0.001); except AAA P> 0.05.

t.P< 0.05, t P< 0.01, ACE DD vs ACE ID/ID.* P< 0.05, ** P< 0.01, $ P< 0.001, ACE 11 vs ACE IDIDD.ACE, angiotensin I-converting enzyme; I, Insertion allele; D, deletion allele; MVC, maximal voluntary contraction; 1RM, one-repetition maximum; CSA, cross-sectional area.

1078 Official Journal of the American College of Sports Medicine http'://www.acsm-msse.org

TABLE 3. Variability attributable to ACE genotype in muscle strength and size at baseline and pre- to post-resistance training in the trained and untrained arms.

I Likelihood ratio test comparing full model (with ACE genotype, gender, age, and body mass index) to constrained model (gender, age, and body mass index).ACE, angiotensin I-converting enzyme; MVC, maximal voluntary contraction; 1RM, one-repetition maximum; CSA, cross-sectional area.

strength and size response to RT attributable to ACE IDgenotype in the T and UT arms (Table 3).

T arm. As shown in Table 3, 0.9% of the variability inthe absolute MVC increase (P = 0.050), 1.5% of thevariability in the MVC increase adjusted for baselinevalues (P < 0.01), and 1.0% of the allometrically scaledMVC increase in the T arm were attributable to ACE IDgenotype. The likelihood ratio tests of all other musclestrength (lRM) and size (CSA) measures at baseline andpre- to post-RT in the T ann did not achieve statisticalsignificance (P >_ 0.05).

UT arm. ACE TD genotype accounted for a smallproportion of the variance in the muscle strength (WVC,1.0-1.5%; 1RM, 1-1.7%) and size (CSA, 3.4-3.6%)response to RT in the UT arm (P < 0.05), whereas thelikelihood ratio tests for contributions of ACE ID genotypeto baseline muscle strength and size did not achievestatistical significance (P > 0.05).

DISCUSSION

We tested whether the ACE DD genotype was associ-ated with superior muscle strength and size response to astandardized, unilateral RT intervention in a large populationof healthy young men and women who were mostly white.The 11 muscle strength and size measures examined in the Tand UT arm were baseline MVC and 1RM and muscle size,absolute change in MWC and 1RM and muscle size, relativepercentage of change in MVC and 1RM and muscle size, andallometric change in MVC and 1RM.

The major findings of this study were 1) subjects withthe ACE I allele (ACE Il/ID) had greater unadjusted(absolute) and adjusted (relative percentage of baseline andallometric) MVC gains compared with ACE DD homo-zygotes in the T and UT arms (Table 2); 2) the ACE IDgenotype was not associated with unadjusted and adjusted

ACE ID GENOTYPE AND RESISTANCE TRAINING

gains in IRM and muscle size in the T arm (Table 2); 3)subjects with the ACE D allele (ACE DD/ID) had greaterunadjusted and adjusted gains in IRM and muscle size thanACE II homozygotes in the UT arm (Table 2); and 4) ACEgenotype was not associated with baseline muscle strengthand size in either arm (Table 2). Thus, the ACE IDgenotype was associated with the contralateral musclestrength and size effects of unilateral RT, and theseassociations were no longer apparent after dynamic RTwhen the T arm was tested dynamically. These unexpectedresults are contrary to our hypothesis and to reports ofothers (6,15,28) that the ACE D allele is associated with asuperior muscle strength and size response to RT comparedwith the ACE I allele. Furthermore, they suggest the ACEID genotype appears to be associated with the cross-education effects of unilateral RT (5,14,18), more so thanwith the inherent muscle strength and size adaptations thatresult from RT.

The assertion that the ACE D allele is associated withenhanced muscle strength and power-oriented performanceis based primarily on observational evidence. An excess ofthe ACE D allele has been found among elite sprint runners(15) and swimmers (28). Folland et al. (6) is one of the fewinvestigators to use an RT intervention to examine theassociations of the ACE ID genotype and the musclestrength response to RT. In this study, 33 young menperformed 9 wk of quadriceps muscle RT in which one legwas trained isometrically and the other leg dynamically.Folland et al. (6) observed greater MVC and similar IRMstrength gains among subjects with the ACE D allele (ACEDD/ID) than the ACE II genotype. Thomis et al. (21) stu-died 57 young male twins who underwent 10 wk of intense,dynamic RT of the elbow flexors. They found no asso-ciations of the ACE ID genotype with 1RM gains andmuscle size assessed by computed tomography, but did findborderline significance for larger concentric flexion torque

Medicine & Science in Sports & Exercise® 1079

Variable

Baseline MVC (kg)

MVC absolute change (kg)

MVC relative change (%)

MVC allometric change (kg.kg-06 7 )

Baseline 1RM (kg)

1RM absolute change (kg)

IRM relative change (%)

1RM allometric change (kg-kge--7 )

Baseline CSA (cm2)

CSA absolute change (cm2)

CSA relative change (%)

Arm

TrainedUntrainedTrainedUntrainedTrainedUntrainedTrainedUntrainedTrainedUntrainedTrainedUntrainedTrainedUntrainedTrainedUntrainedTrainedUntrainedTrainedUntrainedTrainedUntrained

R2 Full Model

0.54710.55310.10420.02710.02530.02820.08230.02550.62430.64840.1 0090.04480.16350.07200.11980.04850.50650.53610.24390.03530.02820.0414

R2 Constrained Model

0.54520.55170.09480.01220.01070.01030.07240.01130.62220.64700.09820.02810.16330.06180.11760.03370.50420.53440.23930.00170.02340.0049

Variation due to Genotype (%)0.190.140.941.491.461.790.991,420.210.140.271.670.021.020.221.480.200.170.463.360.483.65

Likelihood Ratio2 P Value

0.2900.3910.0500.0140.0140.0060.0460.0170.1820.3020.3870.0050.9200.0340.4600.0080.3220.4170.231

< 0.0010.297

< 0.001

gains in ACE II homozygotes than those with the ACE Dallele. In contrast, Williams et al. (26) found no differencein the isokinetic muscle strength response to an 8-wk dy-namic RT program of the legs among 44 men 23 yr of age.

The reasons for the discrepancies between the findings ofFolland et al. (6), Thomis et al. (21), Williams et al. (26).and ours are not readily apparent. They could be related todifferences in the RT intervention and assessmentsemployed, that is, lower- versus upper-body and/or dynamic,isokinetic, or isometric training and/or testing. The largesample size of this study (N = 631) enabled us to statisticallyaccount for important confounding factors in the musclestrength and size response to RT (i.e., age, gender, and BMI)and provided us with sufficient statistical power to detectthe differences we found in the muscle strength and sizeresponse to RT according to ACE ID genotype.

We observed similar (MVC) and even stronger (IRMand CSA) associations among the ACE genotype and themuscle strength and size response to RT in the UTcompared with the T arm (Tables 2 and 3). These findingssuggest the ACE ID genotype is associated more with thecontralateral effects of unilateral RT than with the intrinsicmuscle strength and size adaptations that result from RT.The proposed mechanisms for the contralateral effects ofunilateral training, also termed cross-education, cross-training, and/or the cross-transfer effect, include improvedvoluntary activation via motor unit recruitment andincreased motor unit firing rate resulting from bilateralactivation of the central nervous system during a unilateraltask (5,14,18). The recommended modality for evaluatingcross-education effects when training the muscle dynami-cally is MVC in order to avoid learning effects (18,20). Itis interesting to note that Folland et al. (6), Thomis et al.(21), and we have found associations among the ACE IDgenotype and the muscle strength response to dynamic RTin the T limb when measured with isometric or isokinetictesting. Collectively, these findings support the notion thatthe ACE ID genotype associates with the cross-educationand learning effects of RT that are primarily neurologicallymediated and that these associations are no longer evidentwhen the limb is trained and tested dynamically.

Mechanisms to explain our findings that the IRM andmuscle size gains were greater in carriers of the ACE Dallele (ACE DD/ID) than those with the ACE II genotype inthe UT arm, while the MVC gains were greater in carriers ofthe ACE I allele (II/ID) than those with the ACE DDgenotype in the T and UT arms, are not readily apparent.However, these results suggest that the associations amongthe ACE genotype and the muscle strength and size responseto RT are mediated by neurological mechanisms due tocross-education and learning effects. Wali (25) and Jonssonet al. (10) have shown that angiotensin I1 facilitates neuro-muscular transmission, and that this response is exagger-ated in spontaneously hypertensive rats. The ACE D alleleis associated with higher ACE activity and angiotensin IIproduction than the ACE I allele (2,11,23), lending supportfor a neurological explanation for our findings. Alterna-tively, the ACE I allele is associated with enhanced

1080 Official Journal of the American College of Sports Medicine

contractile efficiency by the skeletal muscles comparedwith the D allele (27,30) and could account for the greaterMVC gains in carriers of the ACE I allele than subjectswith the ACE DD genotype. Bradykinin is involved in theexercise pressor reflex, being released by high-intensity,static muscle contractions in direct proportion to lactateproduction and inversely related to pH (19). It seemsplausible that the exercise-induced ACE signaling effectsare greater with the ACE I allele due to its associationswith increased bradykinin activity compared with the ACED allele (23), resulting in enhanced contractile efficiencyand a superior MVC response to RT.

Another explanation for our findings is that the ACE IDpolymorphism is one of many genetic variants contributingto the observed variance in the muscle strength and sizeresponse to RT (3,11,23). Epistatic interactions betweenthe ACE ID genotype and another gene variant in the kininP2 receptor associated with the regulation of skeletalmuscle exercise performance have recently been observed(27). We found that approximately 1% of the variability inMVC strength in the T arm and 2-4% of the variability inthe muscle strength and size response in the UT arm wasattributable to the ACE genotype (Table 3). Such smallcontributions that were detected in a large sample suggestthe ACE ID genotype may be a marker for some otherfunctional genetic variant or be in linkage disequilibriumwith another gene or genes more directly responsible forthe effects that we observed. Clearly, more work is neededto better clarify the pathways through which the ACE IDgenotype and other genetic variants may associate with themuscle strength and size response to RT.

In conclusion, we found the ACE ID genotype associ-ated with the contralateral muscle strength and size effectsof unilateral RT. and these associations remained afterdynamic RT only when the T arm was tested isometrically.Contrary to our hypothesis, subjects with the ACE I allele(ACE II/ID) had greater MVC strength gains comparedwith ACE DD homozygotes in the T and UT arms. Thus, itappears that the ACE ID genotype is primarily associatedwith the cross-education and learning effects rather thanthe inherent muscle strength and size adaptations that resultfrom RT. The variability of the muscle strength and sizegains as a result of RT attributable to ACE ID genotypewas approximately 1-4%. Such small contributions foundin a large study sample indicate that ACE ID polymor-phism may merely be a functional marker and/or is oneof many genes that contribute to the muscle strength andsize response to RT. The challenge remains to identifyother genetic variants and their interactions that explain alarger proportion of the muscle strength and size responseto RT.

We thank the students and technicians at the participatinginstitutions for their time and effort, the subjects for their participationand commitment to the project, and Monica Hubal, M.S., and StephenBilbie, M.S., R.D., for the expert input they gave to the manuscript.

Supported by a grant from the NIH (NINDS/NIA/NIAMSNS40606), and the Parsons Family Foundation.

http://www.acsm-msse.org

REFERENCES

1. BARLEY, J., A. BLACKWOOD, and N. CARTER. Angiotensin-convertingenzyme insertion/deletion polymorphism: association with ethnicorigin. J. Hypertens. 12:955-957, 1994.

2. BAuDiN, B. New aspects on angiotensin-converting enzyme: fromgene to disease. Clin. Chem. Lab. Med. 40:256-265, 2002.

3. CLARKSON, P. M., J. M. DFvANEY, and H. GoRDISH-DRBssMAN.ACTN3 genotype is associated with increases in muscle strengthand response to resistance training in women. J. Appl. Physiol.99:154-163, 2005.

4. COLLINS, M., S. L. XENoPHoNrTos, M. A. CARoLou, et al. The ACEgene and endurance performance during the South Africanironman triathlons. Med. Sci. Sports Exerc. 36:1314-1320, 2004.

5. FARTHING, J. P., P. D. CmLiBEcK, and G. BINSTED. Cross-educationof arm muscular strength is unidirectional in right-handedindividuals. Med. Sci. Sports Exerc. 37:1594-1600, 2005.

6. FOLLAND, J., B. LEACH, T. LrrTLE. et al. Angiotensin-convertingenzyme genotype affects the response of human skeletal muscleto functional overload. Exp. Physiol. 85:75-579, 2000.

7. GAYAGAY, G., B. Yu, B. HAmBLY, et al. Elite endurance athletesand the ACE I allele-the role of genes in athletic performance.Hum. Genet. 103:48-50, 1998.

8. HAGBERG, J. M., R. E. FERRELL, S. D. McCOLE, K. R. WmuND, andG. E. MooRE. VO2max is associated with ACE genotype inpostmenopausal women. J. Appl. Physiol. 85:1842-1846, 1998.

9. HuBAL, M. J., H. GORDISH-DREssmAN, and P. D. THOMPSON.Variability in muscle size and strength gain following unilateralresistance training. Med. Sci. Sports Exerc. 37:964-972, 2005.

10. JONSSON, J. R., S.D. SMID, D. B. FREwiN, and R. J. HEAD.Angiotensin 11-mediated facilitation of sympathetic neurotrans-mission in the spontaneously hypertensive rat is not associatedwith neuronal uptake of the peptide. J. Cardiovasc. Pharmacol.22:750-753, 1993.

11. McKENziE, C. A., C. JuLIER, and T. FORRESTER. Segregation andlinkage analysis of serum angiotensin I-converting enzymelevels: evidence for two quantitative-trait loci. Am. J. Hum.Genet. 57:1426-1435, 1995.

12. MONTGOMERY, H., P. CLARKSON, and M. BARNARD.. Angiotensin-converting-enzyme gene insertion/deletion polymorphism andresponse to physical training. Lancet 353:541-545, 1999.

13. MoNT'oMERY, H. E., R. MARSHALL, and H. HEMINGWAY. Humangene for physical performance. Nature 393:221-222, 1998.

14. MUNN, J., R. D. HERBERT, M. J. HANCOCK, and S. C. GANDEviA.Training with unilateral resistance exercise increases contralat-eral strength. J. Appl. Physiol. 99:1880-1884, 2005.

15. MYaRSON, S., H. HEMINGWAY, R. BUDGET, J. MARTIN, S.

HumpiiRms, and H. MoNrGOMERY. Human angiotensin I-convert-ing enzyme gene and endurance performance. J. Appl. Physiol. 87:1313-1316, 1999.

16. RANKINEN, T., L. PERUSsE, R. RAURAMAA, M. A. RIVERA,B. WoLFARTH, and C. BOUCHARD. The human gene map for

performance and health-related fitness phenotypes: the 2004update. Med. Sci. Sports Exerc. 37:881-903, 2005.

17. RiGAT, B., C. HUBERT, F. ALHENc-GELAs, F. CAMBIEN, P. CORVOL, andF. SouBmei. An insertion/deletion polymorphism in the angiotensinI-converting enzyme gene accounting for half the variance of serumenzyme levels. J. Clin. Invest. 86:1343-1346, 1990.

18. SHIMA, N., K. IsHmA, K. KATAYAMA, Y. MOROTOME, Y. SATO, andM. MiyAMuRA. Cross education of muscular strength duringunilateral resistance training and detraining. Eur. J. App?.Physiol. 86:287-294, 2002.

19. STEBBINS, C. L., 0. A. CARRETERO, T. MINDROIU, and J. C.LONGHuRsT. Bradykinin release from contracting skeletal muscleof the cat. J. Appl. Physiol. 69:1225-1230, 1990.

20. THoMIs, M. A. I., G. P. BEUNEN, and H. H. MAEs, et al. Strengthtraining: importance of genetic factors. Med. Sci. Sports Exerc.30:724-731, 1998.

21. THoMIs, M. A. I., W. HUYGENS, S. HEUNINCKX, et al. Exploration ofmyostatin polymorphisms and the angiotensin-converting en-zyme insertion/deletion genotype in responses of human muscleto strength training. Eur. J. Appl. Physiol. 92:267-274, 2004.

22. THOMPSON, P. D., N. MOYNA, and R. SEip. Functional poly-morphisms associated with human muscle size and strength. Med.Sci. Sports Exerc. 36:1132-1139, 2004.

23. TItrE, L., B. RIGAT, S. VisviKis, et al. Evidence, from combinedsegregation and linkage analysis: that a variant of the angiotensinI-converting enzyme (ACE) gene controls plasma ACE levels.Am. J. Hum. Genet. 51:197-205, 1992.

24. VANDERBURGH, P. M., M. T. MAHAR, and C. H. CHOU. Allometricscaling of grip strength by body mass in college-age men andwomen. Res. Q. Exerc. Sport 66:80-84, 1995.

25. WALl, F. A. Effect of angiotensin J1 on mechanical and electricalresponses of frog, chick and rate skeletal muscle. Arch. Int.Pharmacodyn. 282:314-317, 1986.

26. WILLIAMS, A. G., S. H. DAY, J. P. FOLLAND, P. GOHLKE,

S. DHANRAIT, and H. E. MONTGOMERY. Circulating angiotensinconverting enzyme activity is correlated with muscle strength.Med. Sci. Sports Exerc. 37:944-948, 2005.

27. WILLIAMS, A. G., S. S. DHAmRArr, and P. T. E. WOOTTON.Bradykinin receptor gene variant and human physical perfor-mance. J. Appl. Physiol. 96:938-942, 2004.

28. Wooos, D., M. HICKMAN, and Y. JAMsHI-L Elite swimmers and the Dallele of the ACE W/D polymorphism. Hum. Genet. 108:230-232,2001.

29. WOODS, D. R., A. J. POLLARD, and D. J. COLLIER. Insertion/deletion polymorphism of the angiotensin I-converting enzymegene and arterial oxygen saturation at high altitude. Am. J.Respir. Crit. Care Med. 166:362-366, 2002.

30. WOODS, D. R., M. WORLD, and M. P. RAYsON. Enduranceenhancement related to the human angiotensin I-converting enzymeI-D polymorphism is not due to differences in the cardiorespiratoryresponse to training. Eur. J. Appl. Physiol. 86:240-244, 2002.

ACE ID GENOTYPE AND RESISTANCE TRAINING Medicine & Science in Sports & Exercisee 1081

COPYRIGHT INFORMATION

TITLE: ACE ID Genotype and the Muscle Strength and SizeResponse to Unilateral

SOURCE: Medicine and Science in Sports and Exercise 38 no6 Je2006

PAGE(S): 1074-81WN: 0615201727009

The magazine publisher is the copyright holder of this article and itis reproduced with permission. Further reproduction of this article inviolation of the copyright is prohibited.

Copyright 1982-2006 The H.W. Wilson Company. All rights reserved.