Protein Expression and PuriWcation 53 (2007) 404–410

www.elsevier.com/locate/yprep

A novel peptide tag for detection and puriWcation of recombinant expressed proteins

William T. Jones a,¤, Dawn Harvey a, Christopher Kirk a, Jasna Rakonjac b, Xiaolin Sun a, Nicky Frearson a, Taha Al Samarrai a

a The Horticulture and Food Research Institute of New Zealand Ltd, Private Bag 11 030, Palmerston North, New Zealandb Institute of Molecular Biosciences, Massey University, Private Bag 11 222, Palmerston North, New Zealand

Received 14 December 2006, and in revised form 10 January 2007Available online 19 January 2007

Abstract

Peptide tags have proven useful for the detection and puriWcation of recombinant proteins. However cross reactions of antibodiesraised to the tag are frequently observed due to the presence of host proteins containing all or parts of the tag. In this report we have iden-tiWed a unique viral peptide sequence, R-tag, that by blast searches is absent from the commonly expression hosts Arabidopsis thaliana,Escherichia coli, Pichia pastoris and mouse myeloma cell NSO. We have prepared monoclonal antibodies to this peptide and conWrmedthe absence of this peptide sequence from the above genomes by Western blotting. We have also modiWed protein expression vectors toincorporate this sequence as a fusion tag in expressed proteins and shown its use to successfully purify recombinant proteins by immuno-aYnity procedures.© 2007 Elsevier Inc. All rights reserved.

Keywords: Peptide tag; R-tag; Expression vectors; ImmunoaYnity puriWcation; Monoclonal antibody; Single chain antibody fragment; RGL-2;Expression hosts

Expression of recombinant proteins in a variety ofexpression hosts has become an important approach tocharacterize gene products for post-genomic research.Alternative systems, such as bacteria, yeast, virus, plantand mammalian cells, for expression of proteins are nec-essary to obtain soluble, correctly folded and appropri-ately translational processed proteins similar to their“native” condition. Such recombinant proteins arerequired for production of antibody reagents, for func-tional assays, to characterize their native structure andfor the development of aYnity reagents to identify inter-acting proteins.

Generally these recombinant proteins require puriWca-tion from host cell proteins. To aid in the puriWcationsteps, several diVerent tags have been developed anddescribed [1]. These tags have been placed at either the N-

* Corresponding author. Fax: +64 6 3517031.E-mail address: wjones@hortresearch.co.nz (W.T. Jones).

1046-5928/$ - see front matter © 2007 Elsevier Inc. All rights reserved. doi:10.1016/j.pep.2007.01.006

or C-terminus of the recombinant proteins and have beenused to enhance the solubility of the protein i.e. maltosebinding protein [2] and glutathione-S-transferase [3] orfor puriWcation and detection i.e. small peptide tags suchas polyhistidine [4], FLAG [5] and the sequenceTKDPSRVG to which polyol-responsive MAbs havebeen prepared that allow antigens to be eluted from theaYnity matrix under mild non-denaturing conditions [6].Problems frequently arise due to the short peptide tagoccurring wholly or in part in proteins present in theexpression host organism and resulting in co-puriWcationor detection of cross-reacting proteins.

In this report we present results which use a novel pep-tide, R-tag, that is, by Western blotting, undetected in thecommonly used protein expression hosts Escherichia coli[7], Arabidopsis thaliana [8], Pichia pastoris [9] or mousemyeloma cell line NSO [10] using high aYnity monoclo-nal antibodies reactive to R-tag. We also report thepuriWcation, using immunoaYnity chromatography, of

W.T. Jones et al. / Protein Expression and PuriWcation 53 (2007) 404–410 405

R-tagged recombinant proteins A. thaliana DELLARGL-2 [11], [12] N-terminal domain and a single chainantibody fragment (scFv)1 expressed in E. coli.

Materials and methods

Bovine serum albumin (BSA), RPMI culture media,HAT selection additive, fetal calf serum (Hybrimax), L-glutamine, sodium pyruvate, 2, 4, 10, 14-tetramethyl-pen-tadecane (Pristane), Tween 20, peroxidase-labelled goatanti-mouse IgG (Fc speciWc, A9303), peroxidase-labelledgoat anti-rabbit IgG (A0545) and o-phenylene diamine(OPD) were obtained from Sigma Chemical Co., (St.Louis, MO, USA). Cell culture plasticware and microEL-ISA Xat bottom F16 modules (Maxisorb) were obtainedfrom Nunc (Roskilde, Denmark). Avidin (AV), biotin–PEO-N-hydroxy succinimidyl ester), maleimidyl benzoicacid succinimidyl ester (MBS) were from Pierce Chemi-cals (Global Science, Auckland, New Zealand). Maleim-idyl hexanoic acid succinimidyl ester (MHS) was from(Boehringer Mannheim, Germany). Mouse monoclonalantibody (MAb) isotyping kit was obtained from Bio-Rad Laboratories (Auckland, NZ). Hi-Trap NHS-acti-vated columns, PD10 desalting columns were from GEHealthcare (Auckland, NZ). Rabbit polyclonal antibod-ies (C18) to maltose binding protein (MBP) were fromSanta Cruz Biotechnology. Monoclonal antibody BB7raised against Arabidopsis RGL-2 was prepared in ourlaboratory (unpublished results). All other reagents andsolvents were of analytical grade or better.

Gel electrophoresis and Western blotting procedures

SDS–PAGE analysis [13] on 12% polyacrylamide gelsfollowed by staining with Coomassie brilliant blue R wasperformed to monitor progress during protein puriWca-tion procedures and for screening of tissue and cellextracts.

For Western blot analysis, proteins separated on 12%SDS–PAGE gels were transferred to PVDF membrane.The membrane was blocked with 0.5% I-block (Perkin-Elmer, Australia) in phosphate buVered saline (PBS) con-taining 0.1% v/v Tween 20 (PBST), incubated with pri-mary antibodies for 2 h at room temperature, washedwith 0.1% w/v I-Block in PBST (3 times for 10 min) andincubated with peroxidase-labelled secondary antibody(1/20,000 dilution in blocking medium; 1 h at room tem-perature). The immuno-reactive protein bands weredeveloped with chemiluminescence reagent (WesternLightning Plus, NEN Life Science Products) and imagedusing a LAS 3000 (Fuji).

1 Abbreviations used: scFv, single chain antibody fragment; BSA, bovineserum albumin; OPD, o-phenylene diamine; MBS, maleimidyl benzoicacid succinimidyl ester; PBS, phosphate buVered saline; KLH, keyholelimpet haemocyanin.

Synthesis and conjugation of R-peptide to BSA, KLH and AV

R-peptide, H2N-CGGGPDQYEYKYP-amide was syn-thesized and puriWed to greater than 95% purity (Mimo-topes, Melbourne, Australia) and coupled to carrierproteins, bovine serum albumin (BSA), keyhole limpethaemocyanin (KLH) and avidin (AV) using the heterobi-functional reagents maleimidyl benzoic acid succinimidylester (MBS) for BSA and AV conjugates, and maleimidylhexanoyl succinimidyl ester (MHS) for KLH conjugates.BrieXy 5 �l of 0.15 M MBS in DMF was added to BSA andAV (10 mg in 1 ml PBS) or 20 �l of 0.15 M MHS to KLH(20 mg in 1 ml of PBS) and incubated at 23 °C for 1 h.Excess reagent was removed from the activated protein bychromatography on PD10 columns equilibrated in 0.1 Mphosphate buVer pH 6.7. Peptide (2.4 mg in 1 ml of phos-phate buVer pH 6.7) was added to each of the proteins andincubated at room temperature for 2 h. Conjugates werepuriWed from unbound peptides by gel Wltration on PD10columns equilibrated in PBS and stored at ¡20 °C.

ELISA for screening of polyclonal and monoclonal antibodies

Flat-bottomed 96-well polystyrene multi-wells (Nuncmaxisorb) were incubated with R-peptide-BSA conjugate(200 ng BSA/ml PBS) for 3 h at 37 °C and any remainingprotein-binding sites were blocked by incubation with 2%BSA in PBS containing 0.02% sodium azide. Plates werestored at 4 °C. Between addition of diVerent reagents, wellswere washed six times with PBST. The presence of antibod-ies to R-peptide was determined by diluting sera or hybrid-oma culture media in 2% BSA/PBST and incubating thewells for 2 h at 37 °C. Peroxidase-labelled goat anti-mouse(IgG Fc speciWc diluted 1/2000 in BSA/PBST; 50�l/well)was added to wells and incubated for 1 h at 37 °C. Peroxi-dase substrate, (40 mg O-phenylene diamine, 40 �l hydrogenperoxide in 100 ml of citrate/phosphate buVer pH 5.0;200 �l/well) was added to wells for 30 min and the reactionstopped by addition of 4 M sulphuric acid (50 �l/well).Absorbance was measured at 492 nm on a Dynatec 5000absorbance microwell spectrophotometer.

Immunization of mice

Four female mice (Balb/c PN X DBA) six to eight weeksold were immunized at intraperitoneal and subcutaneoussites with 100 �g of KLH conjugates in Freund’s completeadjuvant. The mice received a further three immunizations,at 28 day intervals, of 50 �g of conjugate in incomplete Fre-und’s adjuvant. Blood was taken from each mouse, prior tothe Wrst immunization (pre-immune) and 10 days followingthe fourth immunization. Both pre-immune and immunesera were tested for the presence of antibodies against R-peptide-BSA conjugates using ELISA. The mice with thestrongest immunological reaction to R-peptide-BSA conju-gate were immunized intravenously with 200�g of the

406 W.T. Jones et al. / Protein Expression and PuriWcation 53 (2007) 404–410

peptide conjugate in PBS four days prior to the preparationof hybridoma.

Production of hybridomas

Hybridoma cells secreting MAbs to the R-peptide wereprepared using electroporation by fusion of azoguanineresistant murine myeloma P3-NS-1-Ag4-1cells (NS-1; FlowLaboratories, Scotland) with splenocytes prepared fromimmunized mice. BrieXy spleen cells (1£ 108) were preparedin DMEM basal media (Sigma chemicals) containing 50 �g/ml DNAse1 and suspended at 5£107 cells/ml of media.Avidin conjugated peptide (20�g) was added to the cellsand incubated for 2 h at 4 °C using gentle rotation. NS-1cells were washed three times in sterile PBS and suspendedat a cell density of 107 cells/ml (10 ml) of PBS. NS-1 cellswere tagged with biotin by addition of biotin-PEO -NHS(20�l; 20 mg/ml of DMF) for 30 min at room temperature.Both NS-1 and splenocytes were washed separately threetimes with DMEM/DNAse1 and suspended in 1 ml of thesame media. Both cell types were combined and centrifugedat 380g for 5 min. Cells were suspended and incubated in1 ml of DMEM for 30 min at room temperature, layered onto 10 ml of sterile isotonic sucrose (272 mM Sucrose, 2 mMphosphate pH 7.2, 1 mM MgCl2, 1 mM CaCl2) and centri-fuged at 380g for 10 min at 4 °C. The cell pellet was sus-pended in 1.6 ml of isotonic sucrose and fused, in 0.4 mlaliquots, in 0.4 mm gap electroporation cells using the GenePulser 2 electroporator (Bio-Rad Laboratories) with threepulses at 400 V at 1 �F capacitance. Cells were diluted into200 ml of culture media (RPMI media containing 10% fetalcalf serum and 2X HAT) and plated at 100 �l per well overtwenty 96-well tissue culture plates containing 100�l perwell of mouse thymocyte cells (4£ 106/ml of culture mediawithout HAT). Hybridoma colonies were counted sevendays post-fusion.

Cultures were screened by ELISA, for antibodies to pep-tide-BSA conjugate, on day 12 when most wells were 70%conXuent. Positive cultures were immediately cloned bylimiting dilution [14], propagated and frozen in culturemedia containing 10% DMSO by slow freezing in liquid N2vapor and stored in liquid N2.

Preparation of monoclonal antibodies

Frozen hybridoma cells were rapidly thawed andwashed in 10 ml of warm culture media. The cells werecollected by centrifugation and suspended at 5£ 104 cellsper ml culture media. Cells were propagated, collected bycentrifugation, washed and suspended at 2£ 106 cells/mlin sterile PBS. Cell suspension (0.5 ml) was injected intra-peritoneal into three month old Balb/c male mice. 10–14days after injection of cells, ascitic Xuid was collected, cen-trifuged to remove cellular material, and the supernatantXuid frozen at ¡20 °C. MAbs were puriWed using ammo-nium sulfate fractionation followed by aYnity chroma-tography on protein A Sepharose [15] as previously

described [16]. The concentration of antibody was deter-mined by absorbance at 280 nm using an extinction coeY-

cient of 14.49 for a 1% solution of mouse gamma globulin.Immunoglobulin subclass of MAbs was determined usingmicroELISA plates coated with R-peptide-BSA conju-gates in combination with the mouse hybridoma isotyping( Bio-Rad Laboratories).

ModiWcation of vectors for expression of R-peptide labelled proteins

The MBP-fusion bacterial expression vector pETM-41(EMBL vector data: http://www.emblhamburg.de/»geerlof/webPP/genetoprotein/clo_vector/our_Ec_vectors. html) wasmodiWed by annealing and ligation of synthetic oligos, 5�-CATGGGCGGCCGCCGCGGCGATATGGAATTCCTGCAGGGTACCGGATCCC-3� and 5�-TCGAGGGATCCGGTACCCTGCAGGAATTCCATATGGCCGCGGCGGCCGCC-3� to replace the MCS with a new MCS contain-ing restriction endonuclease sites Nco1, Not1, SW1, Sac11,Nde1, EcoR1, Pst1, Kpn1, Bam1 and Xho1. The GST-fusionbacterial expression vector pETM-30 was modiWed by incor-poration of the same new MCS causing the removal of theDCOH sequence. TrxA from pETM 20 was cut using restric-tion enzyme Spe1 and cloned using PCR to replace the GSTin this new vector backbone, using primers 5�-GGACTAGTATGAGCGATAAAATTATTCACCTG-3� and 5�-GGACTAGTGGCCAGGTTAGCGT CGAGGAAC-3� contain-ing the Spe1 site (underlined). Further modiWcations weremade using two rounds of PCR and cloning products Xba1/Nco1 into the vector backbone. This incorporated the R-tag5� of the diVerent N-terminal fusion partners, MBP, GST andTrxA, for any coding sequence cloned into the new MCS andresulted in three new expression vectors (Fig. 1). Secondround PCR (common) 5� primer 5�-CTAGTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCATGCCGGATCA GTATGAATACAAATATCCG-3�. First

Fig. 1. Vector map for expression of R-tagged fusion protein. pETM-41EMBL vector was modiWed to replace the existing MCS with a new MCScontaining diVerent endonuclease sites Nco1, Not1 , SW1, Nde1, EcoR1,Pst1, Kpm1, BamH1, Xho1. The N-terminal His tag was replaced with theR-tag so as to express the required protein as N-terminal R-Tag-Fusionprotein-r-TEV recombinant protein. Three vectors were developed inwhich the fusion protein was either MBP, or GST or TrxA.

W.T. Jones et al. / Protein Expression and PuriWcation 53 (2007) 404–410 407

round 5� primers; MBP primer 5�-CCGGATCAGTATGAATACAAATATCCGATGAAAATCGAAGAAGGTAAAC-3�, GST primer 5�-CCGGATCAGTATGAATACAAATATCCGATGTCCCCTATACTAGGTTATTGG-3�, TrxAprimer 5�-CCGGATCAGTATGAATACAAATATCCGATGAGCGATAAAATTATTCACTG-3�. The 3� primer usedwas the reverse MCS oligo above.

The single chain antibody bacterial vector pAK300 [17]was modiWed by replacing the C-terminal His tag with theR-tag using PCR. The product was cloned using an internalAcc1 site and primer derived Hind 3 site (underlined). 5�-GAGAAGCTTACTACGGATATTTGTATTCATACTGATCCGGGAATTCGGCCCCCGAGGCCGATGG-3�and 5�-GAGGGCAAATCATGAAATACC-3�

Expression of R-tagged proteins

Escherichia coli cells (tuner DE3, Novagen) were trans-formed with the vectors described above containingDELLA protein At RGL-2 and grown to an optical densityat 600 nm of 0.3–0.5. Expression was induced by addition ofIPTG at a concentration of 0.5 mM for 3 h at 30 °C. Cellswere collected by centrifugation and washed in extractionbuVer (25 mM Tris chloride pH 7.4 containing 50 mMNaCl, 1 mM EDTA, 1 mM PMSF, and 1 mM DTT) and thepellet frozen at ¡20 °C overnight. Cells were suspended inextraction buVer (1/30th of culture volume), broken by son-ication on ice and centrifuged at 38000g for 20 min toremove insoluble materials.

R-tagged single chain antibodies (scFv) were expressedas previously described [17].

PuriWcation of R-labelled proteins

Prior to aYnity puriWcation, crude soluble proteins weresubjected to ion exchange chromatography using a 5 ml Hi-Trap DEAE FF column (GE Healthcare). The sample wasapplied to the column and washed with extraction buVerfollowed by a steep salt gradient (total gradient volume60 ml; 0–50% BuVer B (extraction buVer +1 M NaCl). Thisserved to separate pigmented media components from theproteins. Fractions containing R-tagged proteins were con-centrated 10-fold using 10 kDa cut-oV centrifugal concen-trators (Vivaspin).

Monoclonal antibody D9 (10 or 50 mg) was coupled toeither 1 or 5 ml NHS activated Sepharose (GE Healthcare;Hi-Trap columns), respectively, as described by the manu-facturer. AYnity columns were equilibrated with extractionbuVer containing 100 mM NaCl.

The scFv protein was made up to the free volume ofthe aYnity column (1 or 5 ml) and applied to the columnat a Xow rate of 0.2 ml/min. The column was placed at4 °C for 1 h, washed with ten column volumes of equili-bration buVer and scFv eluted with 0.1 M glycine/HClbuVer pH 3.0. Fractions were immediately neutralized bycollecting fractions into 1 M Tris/Cl to adjust the pH to7.0–7.5.

For acid labile proteins, R-tagged proteins were boundto the aYnity column as described above. The column waswashed with three column volumes of 25 mM Tris chloridebuVer pH 8.0 containing 1 mM EDTA, 1 mM DTT and100 mM NaCl (protease buVer). His tagged r-TEV protease[18] (r-TEV: R-tagged protein 1:50 w/w) was dissolved inone column volume of protease buVer, applied to the aYn-ity column and incubated overnight at 4 °C. r-TEV proteasehas a very stringent sequence speciWcity for the sequenceENLYFQG/S, cleaves between the QG or QS and this pep-tide sequence is uncommon. Incubation of the anti-R-tagMAbs with rTEV protease followed by SDS–PAGE didnot result in any detectable degradation of the MAbs. Thecolumn was washed with protease buVer (Wve column vol-umes) and the eluate containing the scFv and r-TEV prote-ase was concentrated to less than 1 ml and applied to aDEAE column (GE Healthcare; 5 ml). r-TEV protease didnot bind to DEAE anion exchanger (r-TEV pID9.15) andwas eluted in the column washings. RGL-2 was eluted with150 mM sodium chloride. The proteins were then dialyzedagainst PBS containing 10 mM EDTA and 40% glyceroland stored at ¡20 °C. The aYnity column was regeneratedusing 0.1 M glycine/HCl pH 3.0 and immediately neutral-ized and stored in 20 mM Tris chloride pH 8.0 containing0.1 M NaCl and 0.1% sodium azide.

Results and discussion

Production of monoclonal antibodies recognizing R-tag

Peptide tags are now commonly used for the puriWcationof recombinant proteins. However problems associated withtags include the formation of insoluble incorrectly folded pro-teins [19], diYculties with protein crystallized [20], and in crossreactions that result in co-puriWcation with host cell proteins[21,22]. For these reasons we have searched for and identiWeda novel and unique peptide sequence, R-tag, that is absentfrom commonly used protein expression hosts.

Mice were immunized with R-peptide conjugated toKLH. The titers of mouse sera were determined by anELISA assay on peptide BSA conjugates as describedabove. Titers of sera ranged from 1/32,000–1/256,000 togive an optical density at 492 nm of approximately 1.5whilst for sera at 1/100 dilution the absorbance was lessthan 0.05 for BSA at the same plating concentration. Pre-immune sera, at 1/100 dilution, showed no reaction withpeptide-BSA conjugate.

The mouse with the highest immune response to R-BSAconjugate was selected as the spleen donor for the prepara-tion of hybridomas. At day 7 the number of colonies per wellwas determined by microscopy and on day 12 post fusion,1000 wells supported cell growth, 60 of which contained sin-gle colonies. When screened for MAbs, using the ELISAassay against peptide-BSA conjugate, approximately 400wells were positive including the 60 wells containing singlecolonies. Six of the wells containing single colonies recordedan absorbance at 492 nm of greater than 3.0. The method of

408 W.T. Jones et al. / Protein Expression and PuriWcation 53 (2007) 404–410

antigen-directed fusion and electroporation for producinghybridoma used in our laboratory results in a greater per-centage (30–70%) of desirable antibody secreting hybridomacompared to polyethylene glycol induced fusions [23] (0.1–10%) commonly used for production of hybridoma.

These six cultures were cloned until stable and the hybrid-oma cells were either frozen in liquid nitrogen or injected intoBalb/c PN mice for production of ascitic tumors.

Monoclonal antibodies were prepared from ascitictumors as previously described [16] and stored at ¡80 °C.Isotyping indicated that all MAbs were IgG1,k. AYnity con-stants (KD) for each of the monoclonal antibodies, deter-mined using the Biacore X, were, 1.3£ 10¡10 M,2.5£10¡8 M and 1.5£ 10¡7 M for MAbs D9, (D2, C8) and(F6, B2 and G5), respectively .

Non-speciWc binding to A. thaliana, P. pastoris, E. coli, Mammalian cell line NSO

Extracts were prepared from A. thaliana, E. coli, mousemyeloma NSO and P. pastoris. These extracts together withsamples spiked with 0.5 ng of puriWed E. coli expressed R-tagged maltose binding protein (MBP) were subjected todenaturing polyacryamide gel electrophoresis and trans-ferred to PVDF membrane. The blots were probed withMAb D9 (100 ng/ml) and peroxidase-labelled anti-mouseIgG and developed as described above and are shown inFig. 2A. No reaction was observed between MAb D9 andany expression host molecule (Fig. 2A, lanes 2, 4, 6 and 8).Spiking the host extracts with 0.5 ng of R-Tag MBPresulted in detection of a single protein of the approxi-mately 43 kDa (Fig. 2A, lanes 3, 5, 7 and 9). The blots werewashed in distilled water and the protein bands stainedwith coomassie blue R (Fig. 2B). Thus by Western blottingwe have shown that monoclonal antibody D9 reacts speciW-cally with the R-tag epitope and that R-tag epitope cannotbe identiWed in expression hosts E. coli, A. thaliana, P. pas-toris and mammalian mouse myeloma NSO cells.

PuriWcation and crystallization of R-tagged proteins

The R-tag modiWed scFv vector, pAK300 [17] contain-ing scFv 2E12 was expressed in E. coli and applied to theanti-R-tag aYnity matrix. scFv was eluted with 0.1 M gly-cine/HCl buVer pH 3.0 into 1 M Tris to immediately adjustthe pH to 7–7.5 and concentrated to 500 �l. Denaturingpolyacrylamide electrophoresis of the scFv-R-tag and sub-sequent staining with coomassie blue R dye showed thepresence of a single pure scFv protein C-Terminal R-tag ofapproximately 28 kDa (Fig. 3, lane 4).

When either the E-tag (GE Healthcare) or c-myc tag sys-tems [24] have been used for scFv puriWcation [17], signiW-

Fig. 3. PuriWcation of R-tagged scFv 2E12. scFv 2E12 from extracts ofE. coli transformed with pAK300 vector containing the R-tagged-scFv2E12 was puriWed by immunoaYnity chromatography on MAbD9 cou-pled matrix, separated by electrophoresis on 12% SDS–PAGE and stainedfor protein with coomassie blue R. Lane 1, molecular weight markers; lane2, E. coli extract load; lane 3, non-bound proteins; lane 4, scFv 2E12 puri-Wed by MAb D9 immunoaYnity chromatography.

Fig. 2. SpeciWcity of MAb D9 anti R-tag. Western blots were prepared as described in Methods. Lane 1: prestained molecular weight markers (Invitrogen);2 and 3: 10 �l of extract of Arabidopsis thaliana (1 g fresh weight leaf tissue extracted into 3 ml SDS buVer); 4 and 5: 10 �l of extract of E. coli (1011 cells /ml); 6 and 7: 10 �l of extract of NSO myeloma cells (109 cells/ml); 8 and 9: 10 �l of culture media from Pichia pastoris (optical density 600 nm D 25). Lanes3, 5, 7 and 9 were spiked with R-tagged MBP (0.5 ng/well). (A) Western blot developed with MAb D9 and peroxidase-labelled goat anti-mouse IgG as

described in Methods. B. Blot was washed in distilled water and stained with Coomassie blue R.

W.T. Jones et al. / Protein Expression and PuriWcation 53 (2007) 404–410 409

cant contamination with E. coli proteins was observed(results not shown) presumably due to cross reactionsbetween the anti-E-tag or anti-c-myc antibodies, used foraYnity puriWcation, and E. coli proteins.

Approximately 2 mg of R-tagged scFv2E12, 85% recov-ery, was obtained from the anti-R-tag aYnity puriWcationand was applied to a Superdex75 16/60 gel Wltration col-umn (GE Healthcare) equilibrated with 10 mM Tris/Cl, pH7.4, 10 mM NaCl to exchange buVer for crystallizationexperiments. The antibody was eluted as a single peak.PuriWed 2E12 was concentrated to 5 mg/ml in 10 mM Tris/Cl, pH 7.4, 10 mM NaCl.

Crystallization trials of scFv 2E12 were carried out,using the vapor diVusion hanging drop method [25] in com-bination with Crystal Screen I (Hampton Research),ammonium sulfate and mono-disperse polyethylene 3350.Small thin plate crystals appeared within one week in50 mM Tris/Cl, pH 8.3, 12% PEG 3350. Fine screens aroundthis condition resulted in single crystals being producedwith 50 mM Tris/Cl, pH 8.3, 0.1 M (NH4)2SO4, 15%PEG3350 and ratio of protein solution to well solution of2:1. The crystals are shown in Fig. 4.

Fig. 4. Crystals of scFv 2E11. The single crystals, average size 0.2 mm,were grown using the hanging drop method with well solution: 50 mMTris/Cl, pH 8.3, 0.1 M (NH4)2SO4, 15% PEG 3350.

We also puriWed an acid labile protein, A. thaliana RGL-2 DELLA protein [11] from fusion protein R-Tag-MBP-rTEV-RGL-2 using a modiWed procedure. The R-taggedprotein was captured on a MAb D9 aYnity column, andthe RGL-2 was released from the matrix by in situ proteol-ysis of r-TEVsite, The aYnity column was regenerated bywashing the column with acidic buVer to remove the R-tagfusion partner from the aYnity column. PuriWcation wasmonitored by Western blots, stained for protein (Fig. 5A)or probed with antibodies to MBP (Fig. 5B), MAb BB7 toRGL-2 (Fig. 5C), and MAb D9 to R-tag (Fig. 5D). N-Rtag-MBP-RGL-2 was bound to the MAb D9 aYnity matrixand impurities were separated by washing with Wve columnvolumes of buVer (Fig. 5 A, lane 3). After column in situ r-TEV proteolytic cleavage, RGL-2 protein, together with r-TEV protease was eluted from the matrix (Fig. 5A, lane 4,Fig. 5C, lane 4). R-tagged MBP was removed from theaYnity column by column regeneration with glycine/Cl(0.1 M, pH 3.0) as shown in Fig. 5A, B and D, lane 5. PureRGL-2 (Fig. 5A and C, lane 6) was obtained by removal oftrace impurities ( r-TEV and degraded fusion protein) byanion exchange chromatography. Similar results wereobtained for fusions to TrxA and GST (results not shown).Successful puriWcation for labile proteins relies on theabsence of r-TEV sites in the recombinant protein since themonoclonal antibody anti-R-tag does not contain thecleavage sequence. In cases where the rTEV cleavage site ispresent in the recombinant protein other systems such asthe use of polyol-responsive MAbs [6], [26] should be usedfor immunoaYnity puriWcation.

In conclusion, we have identiWed and raised high aYnitymonoclonal antibodies to a novel peptide, R-tag, andshown, by Western blotting, the absence of this peptidesequence in the commonly used expression hosts A. thali-ana, E. coli, P. pastoris and mouse myeloma cell NSO. Alsowe have modiWed protein expression E. coli vectors toincorporate the R-tag and used a monoclonal antibody,speciWc for the R-tag, to prepare an aYnity matrix for puri-Wcation of acid labile and acid stable recombinant proteins.

Fig. 5. PuriWcation of recombinant Arabidopsis thaliana RGL-2 DELLA protein. (At) RGL-2 was expressed as n-R-Tag MBP fusion protein and puriWedfrom extracts of E. coli by immunoaYnity chromatography on MAbD9 coupled matrix. Proteins were separated by electrophoresis on 12% SDS–PAGEand transferred to PVDF membrane by Western blotting. (A) Blot stained with coomassie blue R. (B) Probed with rabbit anti-MBP polyclonal antibodyand peroxidase-labelled anti-rabbit IgG. (C) Blot probed with MAb BB7 speciWc for RGL-2 and peroxidase-labelled anti-mouse IgG. (D) Blot stainedwith MAb D9 anti R-tag and peroxidase-labelled anti-mouse IgG. Proteins on blots B, C and D were detected by chemiluminescence and imaged on aLAS 3000 (Fuji). Lane 1, molecular weight markers; lane 2, sample from DEAE puriWcation containing R-tag fusion protein and applied to MAb-D9immunoaYnity matrix; lane 3, proteins non-bound to D9 aYnity matrix; lane 4, proteins released from immunoaYnity column after treatment with r-TEV protease; lane 5, protein eluted from aYnity matrix with 0.1 M glycine –HCl pH 3.0; lane 6, PuriWed RGL-2 DELLA protein (N-terminal domain).

410 W.T. Jones et al. / Protein Expression and PuriWcation 53 (2007) 404–410

Acknowledgements

We thank Dr. Gunter Stier and Dr. Arie Geerlof, ProteinExpression and PuriWcation Facility European MolecularBiology Laboratory (EMBL) Meyerhofstrasse 1, D-69117Heidelberg, Germany for supplying us with the rTEVexpression vector and pETM vectors. This work was sup-ported by a grant from the New Zealand Foundation forResearch, Science and Technology.

References

[1] K. Terpe, Overview of tag fusions: from molecular and biochemicalfundamentals to commercial systems, App. Microbiol. Biotechnol. 60(2003) 523–533.

[2] C. di Guan, P. Li, P.D. Riggs, H. Inouye, Vectors that facilitate theexpression and puriWcation of foreign peptides in Escherichia coli bymaltose-binding protein, Gene 67 (1988) 21–30.

[3] D.B. Smith, K.S. Johnson, Single-step puriWcation of polypeptidesexpressed in Escherichia coli as fusions with glutathione-S-transfer-ase, Gene 67 (1988) 32–40.

[4] E. Hochuli, H. Dobeli, A. Schacher, New metal chelate absorbentselective for proteins and peptides containing neighbouring histidineresidues, J. Chromatogr. 422 (1987) 177–184.

[5] B.L. Brizzard, R.G. Chubet, D.L. Vizard, ImmunoaYnity puriWcation ofFLAG epitope-tagged bacterial alkaline phosphatase using a novel mono-clonal antibody and peptide elution, Biotechniques 16 (1994) 730–735.

[6] S.J. Duellman, N.E. Thompson, R.R. Burgess, An epitope tag derivedfrom human transcription factor IIB that reacts with a polyol-respon-sive monoclonal antibody, Protein Expr. Purif. 35 (2004) 147–155.

[7] L.D. Cabrita, W. Dai, S.P. Bottomley, A family of E. coli expressionvectors for laboratory scale and high throughput soluble protein pro-duction, BMC Biotechnol. 6 (2006) 12–20.

[8] S.J. Clough, A.F. Bent, Floral dip: a simpliWed method for Agrobacte-rium mediated transformation of Arabidopsis thaliana, Plant J. 16(1998) 735–743.

[9] K. Nico-Farber, W. Harder, G. Ab, M. Veenhuis, Methylotrophicyeasts as factories for the production of foreign proteins, Yeast 11(1995) 1331–1344.

[10] C.R. Bebbington, G. Renner, S. Thomson, D. King, D. Abrams, G.T.Yarrington, High-level expression of a recombinant antibody frommyeloma cells using a glutamine synthetase gene as an ampliWableselectable marker, Biotechnology 10 (1992) 169–175.

[11] H. Cheng, L.J. Qin, S.C. Lee, X.D. Fu, D.E. Richards, D.N. Cao, D.Luo, N.P. Harberd, J.R. Peng, Gibberellin regulates Arabidopsis Xoraldevelopment via suppression of DELLA protein function, Develop-ment 131 (2004) 1055–1064.

[12] D. Cao, A. Hussain, J. Peng, Loss of function of four DELLA genesleads to light- and gibberellin-independent seed germination inAra-bidopsis, Planta 223 (2005) 105–113.

[13] U.K. Laemmli, Cleavage of structural proteins during the assembly ofbacteriophage T4, Nature 227 (1970) 660–661.

[14] J.W. Goding, Monoclonal Antibodies: Principles and Practice, Aca-demic Press, New York, 1983.

[15] P.L. Ey, S.J. Prowse, C.R. Jenkin, Isolation of pure IgG1, IgG2a andIgG2b immunoglobulins from mouse serum using protein ASepharose, Immunochemistry 15 (1978) 429–436.

[16] W.T. Jones, P.H.S. Reynolds, S.D. Jones, C.P. Liddane, K.A. Rodber,Production and characterization of monoclonal antibodies againstaspartate aminotransferase-P2 from lupin root nodules, Plant Physiol.94 (1990) 1358–1364.

[17] A. Krebber, S. Bornhauser, J. Burmester, A. Honegger, J. Willuda,H.R. Bosshard, A. Pluckthun, Reliable cloning of functional antibodyvariable domains from hybridomas and spleen cell repertoiresemploying a re-engineered phage display system, J. Immunol. Meth-ods 201 (1997) 35–55.

[18] T.D. Parks, K.K. Leuther, S.A. Johnston, W.G. Dougherty, Release ofproteins and peptides from fusion proteins using a recombinant plantvirus proteinase, Anal. Biochem. 216 (1994) 413–417.

[19] M.I. Donnelly, M. Zhou, C. Sanville-Milard, S. Clancy, L. Stols, W.H.Eschenfeldt, F.R. Collart, A. Joachimiak, An expression vector tai-lored for large scale, high throughput puriWcation of recombinantproteins, Protein Expr. Purif. 47 (2006) 446–454.

[20] M.H. Bucher, A.G. Evdokimov, D.S. Waugh, DiVerential eVects ofshort aYnity tags on the crystallization of Pyrococcus furiosus malto-dextrin-binding protein, Acta Crystallogr. D Biol. Crystallogr. 58(2002) 392–397.

[21] J.J. Lichty, J.L. Malecki, H.D. Agnew, D.J. Michelson-Horowitz, S.Tan, Comparison of aYnity tags for protein puriWcation, ProteinExpr. Purif. 41 (2005) 98–105.

[22] B.S. Wojczyk, M. Czerwinski, M.M. Stwora-Wojczyk, D.L. Seigel,W.A. Abrams, W.H. Wunner, S.L. Spitalnik, PuriWcation of a secretedform of recombinant Rabies virus glycoprotein: comparison of twoaYnity tags, Protein Expr. Purif. 7 (1996) 183–193.

[23] G. Galfre, C. Milstein, Preparation of monoclonal antibodies:strategies and procedures, in: J.J. Langone, H. Van Vunakis(Eds.), Methods in Enzymology, Academic Press, New York, 1981,pp. 3–46.

[24] M.C. Hillman, L.S. Yang, S. Sun, J.L. Duke, K.T. O’Neil, J.E. Kochie,A. Karjoo, P. Nath, L.A. Breth, K. Murphy, O.H. Ross, T.C. Burn,G.F. Hollis, R. Wynn, A Comprehensive system for protein puriWca-tion and biochemical analysis based on antibodies to c-myc peptide,Protein Expr. Purif. 23 (2001) 359–368.

[25] A. McPherson, Preparation and analysis of protein crystals, Wiley,New York, 1982.

[26] R.R. Burgess, N.E. Thompson, Advances in gentle immunoaYnitychromatography, Curr. Opin. Biotechnol. 13 (2002) 304–308.