Download - The HVE/CAND1 gene is required for the early patterning of leaf venation in Arabidopsis

DEVELO

PMENT

3755RESEARCH ARTICLE

INTRODUCTIONThe venation patterns of plant leaves provide two-dimensionalmodels for dissecting the generative mechanisms of branchedstructures. Although detailed descriptions and consistent theoreticalmodels account for venation pattern formation (Meinhardt,1976; Meinhardt, 1984; Mitchison, 1980; Mitchison, 1981), themechanism by which such structures are built is still not fullyunderstood at the genetic level. Considerable experimental evidencesuggests that indole acetic acid (IAA, the main auxin) transport isinvolved in the patterning of plant vasculature. The spatialdistribution of IAA correlates well with the sites of vasculardifferentiation in shoot apices and young leaf primordia (Avsian-Kretchmer et al., 2002), and the inhibition of auxin polar transportcauses a variety of developmental defects in leaves, including anabnormal vascular network (Mattsson et al., 1999; Sieburth, 1999).These observations support the so-called ‘canalization hypothesis’,which states that the patterning of plant vascular systems dependson a positive feedback loop acting on the transport of auxin (Sachs,1991a; Sachs, 1991b).

Mutants with aberrant venation patterns in leaves or cotyledonshave been isolated using Arabidopsis thaliana as a model (Carlandand McHale, 1996; Carland et al., 1999; Deyholos et al., 2000;Koizumi et al., 2000; Steynen and Schultz, 2003). Some of thecorresponding genes have already been cloned, including

COTYLEDON VASCULAR PATTERN1 (CVP1), which encodes asterol methyltransferase involved in the biosynthesis of sterol andbrassinosteroid compounds (Carland et al., 2002), and CVP2, whichencodes an inositol polyphosphate 5� phosphatase and confirmsa role for inositol 1,4,5-trisphosphate (IP3)-mediated signaltransduction in vein ontogeny (Carland and Nelson, 2004).

In a search for naturally occurring variations of the leaf venationpattern in Arabidopsis, we found that the spontaneous hemivenata-1 (hve-1) allele reduces venation complexity in leaves andcotyledons (Candela et al., 1999). Here, we analyze thedevelopmental effects of hve-1 and two other recessive alleles ofHVE, which we positionally cloned and found to encode a CAND1protein. Our results demonstrate a role for ubiquitin-mediated auxinsignaling in Arabidopsis vein patterning.

MATERIALS AND METHODSPlant material and growth conditionsSeeds of most Arabidopsis thaliana (L.) Heynh. lines were supplied by theNottingham Arabidopsis Stock Centre (NASC) and the ArabidopsisBiological Resource Center (ABRC). These included the Wassilewskija-2(Ws-2; NASC Accession Number N1601), Col-0 (N1092) and Eifel-5 (Ei-5; N1128) wild-type accessions, the N599479 and N610969 T-DNAinsertion lines from the Salk Institute Genome Analysis Laboratory (Alonsoet al., 2003), and the pin1cay (N324) and axr1-12 (Leyser et al., 1993)mutants. The pin1cay mutant was isolated by G. Röbbelen and later namedcay by Serrano-Cartagena et al. (Serrano-Cartagena et al., 1999). Allelismof cay and pin1-1 was suggested by their similar phenotypes and confirmedin complementation crosses. We found that pin1cay is a null allele carrying aG-to-A substitution that produces a truncated protein lacking 489 aminoacids. lop1-65 and cvp2-1 (Carland and McHale, 1996; Carland et al., 1999)were kindly provided by Francine Carland; mpT370 (Przemeck et al., 1996)by Thomas Berleth; and the ATHB-8-GUS (Baima et al., 1995), CAND1-GUS (Chuang et al., 2004) and DR5-GUS (Ulmasov et al., 1997) transgeniclines by Simona Baima, William Gray and Thomas Guilfoyle, respectively.We obtained mpT370/mpT370;hve-3/hve-3 and mpT370/mpT370;HVE/-seedlings, all of which were lethal and failed to develop roots and produceleaves. In our hands, the induction of adventitious roots by hypocotyl basal

The HVE/CAND1 gene is required for the early patterning ofleaf venation in ArabidopsisMaría Magdalena Alonso-Peral1,*, Héctor Candela1,*,†, Juan Carlos del Pozo2, Antonio Martínez-Laborda3,María Rosa Ponce1 and José Luis Micol1,‡

The hemivenata-1 (hve-1) recessive allele was isolated in a search for natural variations in the leaf venation pattern of Arabidopsisthaliana, where it was seen to cause extremely simple venation in vegetative leaves and cotyledons, increased shoot branching, andreduced root waving and fertility, traits that are reminiscent of some mutants deficient in auxin signaling. Reduced sensitivity toexogenous auxin was found in the hve-1 mutant, which otherwise displayed a wild-type response to auxin transport inhibitors. TheHVE gene was positionally cloned and found to encode a CAND1 protein. The hve-1 mutation caused mis-splicing of the transcriptsof the HVE/CAND1 gene and a vein phenotype indistinguishable from that of hve-2 and hve-3, two putatively null T-DNA alleles.Inflorescence size and fertility were more affected by hve-2 and hve-3, suggesting that hve-1 is hypomorphic. The simple venationpattern of hve plants seems to arise from an early patterning defect. We found that HVE/CAND1 binds to CULLIN1, and that thevenation patterns of axr1 and hve mutants are similar, which suggest that ubiquitin-mediated auxin signaling is required forvenation patterning in laminar organs, the only exception being cauline leaves. Our analyses of double mutant and transgenicplants indicated that auxin transport and perception act independently to pattern leaf veins, and that the HVE/CAND1 gene actsupstream of ATHB-8 at least in higher order veins, in a pathway that involves AXR1, but not LOP1, PIN1, CVP1 or CVP2.

KEY WORDS: Arabidopsis, TIP120, CAND1, Venation pattern formation, Natural variation

Development 133, 3755-3766 (2006) doi:10.1242/dev.02554

1División de Genética and Instituto de Bioingeniería, Universidad Miguel Hernández,Campus de Elche, 03202 Elche, Alicante, Spain. 2Instituto Nacional de Investigacióny Tecnología Agraria y Alimentaria, Departamento de Biotecnología, Carretera de laCoruña Km. 7, 28040 Madrid, Spain. 3División de Genética, Universidad MiguelHernández, Campus de San Juan, 03550 Alicante, Spain.

*These authors contributed equally to this work†Present address: Plant Gene Expression Center, University of California, Berkeley,Albany, CA 94710, USA‡Author for correspondence (e-mail: [email protected])

Accepted 24 July 2006

DEVELO

PMENT

3756

bisection (Przemeck et al., 1996) led to an extremely low survival rate, whichmade not possible the isolation of a significant number of mpT370/mpT370

rosettes for morphometry of leaf vascular patterns.Plants were grown on agar medium, at 20±1°C and 60-70% relative

humidity and with 7000 lux of continuous fluorescent light (Ponce et al.,1998). Crosses and allelism tests were performed as described previously(Berná et al., 1999). ATHB-8-GUS and CAND1-GUS transgenic seeds weresterilized and kept in water at 4°C in the dark for 4 days to ensuresynchronized germination.

Physiological assaysTo study the effects of the synthetic auxin 2,4-dichlorophenoxyacetic acid(2,4-D), seeds were sown on non-supplemented agar medium and theseedlings were transferred to supplemented media 4 days later. Root lengthswere measured 4 days after the transfer (Lincoln et al., 1990). Thegravitropic response of roots was studied on Petri dishes containing 1.5%agar medium, which were kept vertically in a Conviron TC30 growthchamber for 8 days before being rotated 135° and observed 4 days later.

Characterization of vascular patternsHistological sections were obtained as described previously (Serrano-Cartagena et al., 2000). For venation pattern visualization and micrography,lateral organs were cleared as described previously (Candela et al., 1999).Histochemical visualization of �-glucuronidase (GUS) activity wasperformed as described previously (Donnelly et al., 1999). We combined thenull hve-3 allele with null alleles of other genes, in most cases in the samegenetic background (Col-0), to obtain double mutants, the venation of whichwas compared with those of their siblings. Data corresponding to leaf laminaarea, venation density and number of branching points/mm2 were collectedas described previously (Candela et al., 1999) and analyzed using theSPSS for Windows version 10.0.6 statistical software package (SPSS).Kolmogorov-Smirnov tests with Lilliefors correction were applied to assessthe normality of our data. When the data fitted a normal distribution, t testswere used to compare mean values. When normality was not accepted, thenon-parametric Mann-Whitney U test was used instead.

Molecular characterization of the HVE geneLinkage analysis (Ponce et al., 1999) was used for the positional cloning ofHVE. We have developed several novel molecular markers that are used forhigh-resolution mapping of the HVE gene (Table 1). Two RFLP markers thatflank nga1145 (Lister and Dean, 1993) were converted to PCR-based CAPSmarkers (Konieczny and Ausubel, 1993): MnlI restriction of the ve012 PCRproduct rendered a single band in Ei-5 (339 bp) and two in Ws-2 (300 and

39 bp), whereas EcoRI restriction of the m246 PCR product rendered a 1.6kb band in Ws-2 and two 0.8 kb bands in Ei-5. In addition, we found apolymorphic (AT)n microsatellite, which we named T17M13b, based on theavailable sequence of the T17M13 BAC clone. Sequencing the candidateregion allowed us to identify five novel single nucleotide polymorphisms(SNP), named T8K22-4, P450, T8K22-7, T8K22-1 and E2, which were usedfor mapping the HVE gene. The synthetic oligonucleotides were purchasedfrom Sigma-Genosys (UK). Genomic DNA was extracted, PCR-amplifiedand sequenced as described previously (Pérez-Pérez et al., 2004).

For gene expression and splicing analyses, RNA was extracted using theRNeasy Plant Mini Kit (Qiagen). RNA samples (2.5-5.0 �g) were reversetranscribed using random hexanucleotide primers and SuperScript II (Gibco-BRL, Cleveland). The resulting cDNA was used as a template inamplification reactions of the HVE gene with primers from Table 1, and incontrol amplification reactions of the housekeeping OTC gene (Quesada etal., 1999).

RESULTSPositional cloning of the HVE gene and molecularcharacterization of hve allelesWe have previously identified the hemivenata-1 (hve-1) allele of theHVE gene as being responsible for a monogenic, recessive traitdisplayed by the Eifel-5 (Ei-5) wild-type accession (Candela et al.,1999). This spontaneous allele strongly reduced venation patterncomplexity in vegetative leaves and cotyledons.

We positionally cloned HVE (Fig. 1A) using an F2 mappingpopulation derived from a Ws-2 � hve-1/hve-1 (in an Ei-5background) cross. After finding linkage between hve-1 and thenga1145 marker, near the upper telomere of chromosome 2, wedeveloped eight molecular markers (Fig. 1A) that were usedto screen for recombinants in 1545 F2 plants. Informativerecombinants narrowed down the candidate interval to a 61 kbgenomic region including 14 annotated genes (Fig. 1A).

To identify HVE among the candidate genes, we studied publiclyavailable T-DNA and transposon alleles. Forty-nine lines carryinginsertions within or close to 11 candidate genes (At2g02550-At2g02590, At2g02610-At2g02640, At2g02660 and At2g02670)were searched for phenotypic traits reminiscent of those of hve-1/hve-1 plants. Two of them, N599479 and N610969, carried T-

RESEARCH ARTICLE Development 133 (19)

Table 1. Novel primer sets used in this workOligonucleotide sequences (5´r3´)

Purpose Marker/gene BAC Position in BAC Forward primer (label, if any) Reverse primer

Linkage analysis ve012 T8K22 60,467 CGATGGGTTCCATCGAAGAA CAGCATACAATTTCACTTCCnga1145 T8K22 69,343 CCTTCACATCCAAAACCCAC (HEX) GCACATACCCACAACCAGAAT8K22-4 T8K22 60,526 TCTTCCTCCATATTGTCCGT CCGAGACTTGAGTGGTAGCT

P450 T8K22 49,031 GCTCTATCCAGATGTACTAC AGCCATCTTAATGGTTAGTAT8K22-7 T8K22 46,066 GCATTAGTGTAAAAGCCCATTAC TGTCCCGTTACTCAGTAGAAAGT8K22-1 T8K22 7511 CAGATACAGCTATGTACGGT GTTGAACTCCTCCGTTGAGAE2-SNP T20F6 29,254 CTACGATGATTCGTTGCTAG ACGAGATTCGAGACTCGGTA

T17M13b T17M13 67,337 GCTATTGATTCCATGATCCCTA GTCGGTGGATGAGCACAAGATAm246 F19B11 52,017 TGAAGAGCTATCCGAGATGG GCTTGAACTCCTCCTCCTTC

Genomic DNA HVE T8K22 61,139 TGAGATCCTTGTTTGATTGCAG AAGAAGGAAGATAGGAAGTACC*amplification and HVE T8K22 60,077 GTCAGCTTCTCTTGCTTCCAG CCTCCCTTTCCTTAAATCTATCcycle sequencing HVE T8K22 59,131 CATGACGGGAGTATACAAGATT CGTACTACTCTGACAAGTTCC†

HVE T8K22 57,981 TCCCTACACTTCAAAACCCAG GAAAAAACACAGACGAAGTCATCHVE T8K22 56,848 TCTTGTGGAGCTTTCATCTCTG TCTACCTGAAGTGCTGGAACAAHVE T8K22 55,505 ACCACTGTGAAAGCGAGGAAG* ATTCTTCTTCGCCGATTGAGAAA*HVE T8K22 60,279 TGCTCACTAAAGTATATCAAGAG†

HVE T8K22 62,123 CAGCATCGTGATACCGCAAG*

*Oligonucleotides used together with LBb1 and LBa1 (http://signal.salk.edu) for ascertaining the presence and position of T-DNA insertions in the N599479 and N610969lines.†Oligonucleotides used in amplifications of HVE cDNA.

DEVELO

PMENT

DNA insertions in the At2g02560 gene and displayed a simple leafvasculature and a bushy inflorescence. Complementation testsconfirmed that both lines carried alleles of hve-1. The presence andposition of their T-DNA insertions was confirmed by PCR and bysequencing (Table 1). These insertions lie at nucleotides 1195(N599479) and 5764 (N610969) of the At2g02560 transcriptionunit (numbering from the ATG; Fig. 1B), as described athttp://signal.salk.edu. We named the alleles carried by N599479 andN610969 as hve-2 and hve-3, respectively.

To determine the molecular lesion of the hve-1 allele, wesequenced the gene in several wild-type accessions, including Ei-5,Col-0 and Ws-2. To distinguish silent polymorphisms from themutation causing the phenotype, we only considered the differencesbetween Ei-5 (hve-1) and Col-0 or Ws-2 that did not correspond todifferences between Col-0 and Ws-2. Four single nucleotide changesin the hve-1 allele met this condition, affecting the 5th, 20th and 24thintrons, and the 16th exon (which substitutes a methionine for anisoleucine). We also found a 24-nucleotide deletion in the 16thintron and a 16-nucleotide deletion spanning the 3� end of the 14thexon and the 5� end of the 14th intron (Fig. 1B). The latter deletionremoves a splicing donor site and causes mis-splicing, as shown byPCR amplification of Col-0, Ws-2 and Ei-5 cDNAs using primersflanking the deletion (Fig. 1C). Three splice forms were detected inEi-5, but only one in Col-0 and Ws-2. Two of the threecorresponding gel bands (numbered as 1 and 3 in Fig. 1C) weresequenced and confirmed to originate from mis-spliced HVEtranscripts (Fig. 1C,D). The corresponding cDNAs were out offrame and were predicted to encode truncated proteins. We were notable to isolate molecules from the third band obtained from hve-1cDNA (band number 2 in Fig. 1C), which had a molecular weightgreater than that of the single band found in the wild type.

The HVE gene encodes a CAND1 (TIP120) proteinHVE encodes a predicted protein of 1217 amino acids (see Fig. S1in the supplementary material) and a molecular weight of134.6 kDa (http://mips.gsf.de/cgi-bin/proj/thal/search_gene?code=At2g02560), closely related to the mammalian TATA-binding protein-interacting protein 120 (TIP120A) (Yogosawa et al., 1996). TIP120,also known as CAND1 (Cullin-Associated and Neddylation-Dissociated) (Liu et al., 2002; Zheng et al., 2002), regulates theformation of the SCF complexes of ubiquitin E3 ligases. Although twoparalogs have been described in the rat and human genomes (Aoki etal., 1999), HVE/CAND1 is a single-copy gene in Arabidopsis.

Since mammalian CUL1 is known to interact with CAND1 (Liuet al., 2002; Zheng et al., 2002; Hwang et al., 2003; Oshikawa et al.,2003), we generated a recombinant Glutathione-S-transferase-HVE(GST-HVE) protein that was used in pull-down experiments. CUL1was translated in vitro in rabbit reticulocyte lysate in the presence of35S-Met and then incubated with GST or GST-HVE. As shown bySDS-PAGE gel autoradiography (see Fig. S2A in the supplementarymaterial), GST-HVE, but not GST, was able to interact with CUL1,suggesting that, as their mammalian counterparts, the HVE/CAND1protein of Arabidopsis regulates the activity of the SCF complexesby binding CUL1. While this work was being carried out, othergroups demonstrated that CAND1 and CUL1 physically interact(Chuang et al., 2004; Feng et al., 2004).

The morphological phenotype of hve mutantsThe hve mutants displayed vegetative leaves of slightly reduced size(Fig. 2A-D), and a bushy, extremely branched inflorescence (Fig.2E-G). Fertility was reduced in hve-1/hve-1 plants and was very lowin hve-2/hve-2 and hve-3/hve-3, which produced less than 10 seeds

3757RESEARCH ARTICLEA role for HVE in venation pattern formation

Fig. 1. Map-based cloning and characterization of hve mutations.(A) Strategy followed to identify the HVE gene. After analyzing 3090chromosomes, 41 recombinants (shown in parentheses) placed the HVEgene in the interval flanked by the nga1145 and T17M13B markers.Sequencing of segments of the candidate region in the informativerecombinants rendered five novel SNPs, which allowed us to map theHVE gene within a 61 kb interval encompassed by the T8K22 BAC.(B-D) Structure of the HVE gene of Arabidopsis with the position andnature of hve mutations indicated. (B) Schematic representation of theHVE gene. Exons and introns are depicted as black boxes and lines,respectively. The predicted translation start (ATG) and stop (TAA)codons are indicated. The region harboring the 16 nt deletion found inthe hve-1 allele is aligned with those of the wild-type HVE alleles ofCol-0 and Ws-2, the splicing donor signals of which are boxed. (C) PCRamplification products encompassing the 14th exon and 14th intron ofHVE, using as templates genomic DNA (gDNA) and cDNA from Col-0,Ws-2 and hve-1/hve-1 plants. The three different splicing productsidentified in hve-1 cDNA are numbered. M, molecular weight marker;NC, negative control. (D) Partial alignment of the predicted HVEproteins from Col-0 and two of the splicing products of hve-1.Numbers correspond to amino acid positions. Asterisks representpremature stop codons.

DEVELO

PMENT

3758

per plant. The inflorescence of the hve-1 mutant was of normal size,whereas those of hve-2 and hve-3 were dwarf (Fig. 2F,G). Floweringtime and senescence were delayed in all hve mutants. Together withthe molecular characterization of the alleles, these results suggestthat hve-1 is a hypomorphic allele, whereas hve-2 and hve-3 are null.

We also found that hve mutations determine an abnormal patternof root growth, as shown in hve-3 homozygotes and in 19 F3 familiesderived from hve-1/hve-1 individuals of the F2 of a Ws-2 � Ei-5cross. The ‘wavy’ pattern of growth characteristic of Col-0 and Ws-2 wild-type roots was absent from the mutant plants (Fig. 2H-J).

To determine the extent to which HVE is required for thedevelopment of the vascular pattern, we cleared cotyledons,vegetative and cauline leaves, sepals and petals of the hve mutantsand the Col-0 wild-type accession, which is the genetic backgroundof hve-2 and hve-3 (Fig. 3). The venation patterns of the three hvemutants were similar to one another and clearly distinct from that ofCol-0. The cotyledons contained three or four areoles (regions of thelamina completely bordered by veins) in the wild type (Fig. 3A), butonly two in the hve mutants, often incompletely closed (Fig.3H,O,V). The reduction in vein numbers was also apparent in thefirst two rosette leaves, which had fewer secondary veins than thewild type. No quaternary veins and only a few tertiary veins, whichended blindly within the areoles, were present in mutant leaves, theintramarginal vein of which was occasionally interrupted (Fig.3B,I,P,W). Similar observations were made in vegetative leaves ofthe third (Fig. 3C,J,Q,X) and seventh (Fig. 3D,K,R,Y) nodes. Thelower structural complexity of the mutant venation patterns was inall cases a consequence of a reduced number of secondary andtertiary veins and the absence or shortening of higher-order veins(quaternary and higher). Cauline leaves, by contrast, were smallerin the hve-2 and hve-3 mutants than in Col-0, but did not show anobvious reduction in vascular density (Fig. 3E,L,S,Z). In wild-typesepals, two secondary veins diverged from the apical end of the

primary vein to form two arches (Fig. 3F), whereas a single primaryvein and two incomplete secondary veins were observed in themutants (Fig. 3M,T,AA). Wild-type petals also showed a moreelaborate venation pattern than the corresponding organs of the hvemutants (Fig. 3G,N,U,AB).

As seen in paradermal and transverse sections (see Fig. S3 in thesupplementary material), the primary vein was thinner in hve-3/hve-3 leaves than in the wild type, but the secondary veins lookednormal. The structure of bundle sheath cells, sieve tubes andtracheary elements was also normal in the mutant. No differenceswith the wild type were found in the cell shape and size of the mutantepidermis, palisade mesophyll and spongy mesophyll. However, thespongy mesophyll had larger air spaces and the palisade mesophyllwas partially disorganized in the mutant. A midrib was clearlydistinguishable abaxial to the midvein in the wild type, but seemedto be absent in hve-3.

The HVE promoter drives GUS expression in leafveinsThe various organs affected in hve mutants suggested that theHVE/CAND1 gene is required throughout the life cycle, fromembryogenesis to floral development. To verify this, Col-0 RNA wasextracted from assorted organs and RT-PCR amplified, and HVE wasfound to be expressed in every organ studied (see Fig. S2B in thesupplementary material). To further define the postembryonic spatialexpression pattern of HVE/CAND1, we characterized the wild-typeexpression pattern (Fig. 4) of a CAND1 promoter-GUS fusion(PETA2-GUS) that includes 2.7 kb of upstream sequence (Chuang etal., 2004). Consistent with the pleiotropic phenotype of loss-of-function hve mutants and with our semi-quantitative RT-PCR results,the gene was found almost ubiquitously expressed in aerial andunderground organs of 10-day-old plants (Fig. 4A,B). At this stage,the gene was widely expressed in rosette leaves, at the highest level


Fig. 2. Some phenotypic traits of hvemutants. (A-D) Rosettes of (A) Col-0, (B) hve-1/hve-1, (C) hve-2/hve-2 and (D) hve-3/hve-3plants. (E-G) Bushy inflorescences of (E) hve-1/hve-1, (F) hve-2/hve-2 and (G) hve-3/hve-3plants. (H-J) Effects of hve alleles on root waving.(H) Ws-2, (I) hve-1/hve-1 and (J) hve-3/hve-3seedlings grown on vertically oriented 1.5% agarPetri dishes. Pictures were taken 8 (H-J), 21 (A-D)and 55 (E-G) days after sowing. Scale bars: 1 cm(A-D,H-J) and 2 cm (E-G).

DEVELO

PMENT

in the vasculature (Fig. 4A). By contrast, GUS staining was mostlyconfined to the leaf vasculature in 21-day-old plants, indicating thatHVE expression changes dynamically throughout leaf development(Fig. 4C). For cotyledons and vegetative leaves, the expression inmesophyll cells was apparently more intense at the beginning of leafexpansion, disappearing progressively as the leaves grew (Fig. 4D,E-H,P). Closer inspection revealed that the gene was expressed beforexylem differentiation in developing veins at the basal activelydividing region of rosette leaves (Fig. 4R) and, after thedifferentiation of tracheary elements, in the living cells of thevascular bundles (Fig. 4Q). The strong association of HVEexpression and the vascular tissues is consistent with its role invascular development (Fig. 4E-K,O-P) and with the defectivevenation of hve mutants. By contrast, the reporter was expressedthroughout young cauline leaves before being relegated to theirmargins, at which time no expression could be detected in the veins(Fig. 4I). This observation correlates with the absence of vascularmutant phenotype in the cauline leaves of hve mutants. Similarly, theexpression of the gene changed dynamically in developing flowers,being general in immature flowers (Fig. 4M) and restricted to thedistal tip of sepals, the veins of petals, and the vasculature, filamentand anthers of stamens in mature flowers (Fig. 4J,K). Expressionwas also detected in other organs, including siliques (Fig. 4L,N),stems (Fig. 4L), the root meristem and vascular cylinder (Fig. 4B).

The hve mutations perturb the spatial pattern ofexpression of ATHB-8 and DR5ATHB-8 encodes a class III homeodomain/leucine zipper (HD-ZipIII) transcription factor specifically expressed in procambial cells(Baima et al., 1995). Consistent with a positive role in vascular

differentiation, it is induced during revascularization of injuredstems and after the exogenous application of auxin (Baima et al.,1995), and its overexpression causes the premature differentiationof procambial cells into primary xylem (Baima et al., 2001). Wehave used an ATHB-8-GUS reporter (Baima et al., 1995) to traceback the perturbations caused by hve mutations in venation patternformation. The expression of ATHB-8-GUS is restricted to the veinsof wild-type Ws-2 (Baima et al., 1995) and Col-0 leaves (Fig. 5I-P).Previous results indicated that, at the stage shown in Fig. 5 (21 daysafter sowing), the first leaf is almost fully expanded, whereas thetenth leaf is just beginning to expand (Candela et al., 1999; Pérez-Pérez et al., 2002). In all these wild-type leaves, the expression ofthe reporter uncovered a complex, reticulate pattern consisting ofmature and differentiating vascular strands. By contrast, theexpression of the reporter revealed a much simpler GUS pattern inhve-3/hve-3 leaves than in wild-type leaves of the same age(compare Fig. 5A with 5I, 5B with 5J, 5C with 5K, and 5D with 5L).The GUS pattern was restricted to the fully differentiated venationpattern of the mutant, which lacked most tertiary and higher orderveins. The absence of GUS staining at the sites where the veinsnormally differentiate indicates that ATHB-8-GUS expression isdependent on the earlier acquisition of vascular fate at specificlocations within the leaf. Identical results were obtained incomparisons of Ws-2 with hve-1/hve-1 (see Fig. S4 in thesupplementary material).

The reduction of ATHB-8-GUS expression due to loss ofHVE/CAND1 function suggested that HVE/CAND1 is requiredearlier to determine the sites of ATHB-8 expression, and promptedus to compare the timing of CAND1-GUS (PETA2-GUS) and ATHB-8-GUS expression throughout the development of wild-type first leaf


Fig. 3. Venation pattern of assortedlateral organs in hve mutants.Cleared cotyledons, rosette leaves,cauline leaves, sepals and petals areshown from (A-G) Col-0, (H-N) hve-1/hve-1, (O-U) hve-2/hve-2 and (V-AB)hve-3/hve-3 plants. Plant material wascollected 15 (cotyledons), 21 (rosetteleaves), 28 (remaining lateral organs ofCol-0 plants), 37 (remaining lateralorgans of hve-2 and hve-3homozygotes) and 64 (remaininglateral organs of hve-1 homozygotes)days after sowing. Scale bars: 1 mm(cotyledons and leaves); 0.5 mm (sepalsand petals).

DEVELO

PMENT

3760

primordia. Their expression was not detected in leaf primordia 2.5-3.0 days after germination (DAG; Fig. 6A,L). The onset of CAND1-GUS was observed in 3.5-DAG primordia (Fig. 6B), when their tipsand presumptive midvein regions showed a mild GUS staining, andbecame stronger 4 or 4.5 DAG in the cells that will differentiate asthe midvein (Fig. 6C,D). Later on (5 DAG), when the characteristiccell wall thickenings were apparent in the tracheids of thedeveloping midvein, the promoter turned on in the secondary veins,which were arranged in the form of two loops (Fig. 6E). The veinsin these loops displayed differentiated tracheary elements at 5.5DAG, when two additional loops of secondary veins weredeveloping in the basal region of the lamina. Expression of thetransgene at this stage also revealed tertiary veins differentiatingwithin the first two loops (Fig. 6F). GUS staining persisted in matureveins, beyond the procambial stage (Fig. 6F-K), and in youngtrichomes, and was diffuse in the leaf lamina. The veins of the firstleaves of CAND1-GUS plants remained GUS-positive during thestudied period, between 3.5 and 21 DAG.

GUS staining was stronger and less diffuse in ATHB-8-GUS thanin CAND1-GUS plants. ATHB-8-GUS was strongly expressed inprocambial strands and veins with differentiating tracheary elementsin 3.5- to 7.5-DAG primordia (Fig. 6M-U). The region of thedeveloping midvein appeared stained in 3.5- and 4-DAG primordia(Fig. 6M,N). The expression was then detected in the secondaryveins of the most distal loops 4.5 DAG (Fig. 6O), and subsequently(5 DAG) in the basal loops (Fig. 6P). Only later (5.5 DAG), did theATHB-8-GUS transgene reveal the differentiation of tertiary veins(Fig. 6Q).

To ascertain whether the reduced vein number of the hve mutantsresults from reduced responsiveness to auxin, we studied theexpression of the DR5-GUS construct (Ulmasov et al., 1997), which

drives GUS expression under the control of auxin response elementsof the synthetic DR5 promoter. Previous studies have shown thatDR5-GUS expression precedes and coincides with the appearanceof procambial strands, and then disappears as the veins mature(Mattsson et al., 2003). The DR5-GUS reporter was not expressedin the veins of 21-day-old Col-0 and hve-3/hve-3 leaves from thefirst, third and seventh nodes (see Fig. S5 in the supplementarymaterial), although it was in the leaf margin, the hydathodes andsome mesophyll regions. For actively developing leaves of the 9thand upper nodes, by contrast, the DR5-GUS reporter was expressedat the tip, hydathodes, and tertiary and higher order veins of theproximal regions of the lamina in the wild type, but only at the tip inhve-3/hve-3 leaves.

Physiological assaysWe found no differences between the hve mutants and their wildtypes with regard to the root gravitropic response andskotomorphogenesis. Moderate 2,4-D resistance was displayed bythese mutants (see Fig. S6 in the supplementary material), providingfurther evidence for the involvement of HVE in auxinresponsiveness.

Genetic interactionsA number of genes required for vascular development and auxintransport and perception have been identified, including the above-mentioned CVP1 and CVP2; the recently cloned LOPPED1 (LOP1;also known as TORNADO1), which encodes a putative leucine-richrepeat protein of unknown function (Carland and McHale, 1996;Cnops et al., 2006); AUXIN RESISTANT1 (AXR1), which encodes asubunit of the RUB1-activating enzyme that promotes themodification of CUL1 with RUB1 (Lincoln et al., 1990; Leyser et


Fig. 4. Expression pattern of the HVEgene as uncovered by the PETA2-GUStransgene. (A) GUS staining of Col-0seedlings carrying (right) or not (left) thePETA2-GUS transgene. All the remainingpictures (B-R) correspond to transgenicplants. (B) Roots; (C) a rosette, magnified inD; (E) cotyledon; (F) first, (G) third and (H)seventh vegetative leaves; (I) cauline leaf; (J)sepal; (K) petal and stamen; (L)inflorescence; (M) several immature flowers;and (N) a single mature flower.(O-Q) Details of the venation of a first leafat several magnification levels; (R) a veinbefore xylem differentiation (red arrow) in aseventh leaf. Plant material was collected10 (A,B), 21 (C-H,O-R) and 35 (I-N) daysafter sowing. Scale bars: 1 mm in A-I,N; 2mm in L; 500 �m in J,K,O; 250 �m in M; 5�m in P; 2.5 �m in R; 1.25 �m in Q.

DEVELO

PMENT

al., 1993; del Pozo and Estelle, 1999; del Pozo et al., 2002); and PIN-FORMED1 (PIN1), which encodes an auxin efflux carrier thatcontributes to the basipetal transport of auxin (Goto et al., 1987;Goto et al., 1991; Gälweiler et al., 1998). To investigate thefunctional relationships between HVE and these genes, we obtaineddouble mutants and quantitatively analyzed their venation patterns.Leaf area, venation length and number of branching points in thevascular network were measured and used to calculate vasculardensity and number of branching points per surface unit (Table 2),as described previously (Candela et al., 1999).

We performed an HVE/hve-3 � PIN1/pin1cay cross, andidentified hve-3/hve-3;pin1cay/pin1cay double mutants with anadditive phenotype (Fig. 7, Table 2), suggesting that the minimalvenation pattern conditioned by the null hve-3 allele is stilldependent on auxin, as it is disrupted by the defective polartransport of this hormone. Phenotypic additivity suggests thatauxin perception and transport operate independently butcoordinately to pattern leaf veins. Identical conclusions weredrawn from the study of hve-1/hve-1;pin1-1/pin1-1 double mutants(data not shown).

Loss of AXR1 function causes auxin insensitivity and a bushyinflorescence, the latter due to a decrease in the inhibition of apicaldominance mediated by auxin (Estelle and Somerville, 1987;Lincoln et al., 1990; Stirnberg et al., 1999). The phenotypicsimilarities between hve/hve and axr1-12/axr1-12 plants, includingtheir bushy inflorescence and low fertility, point to a functional

relationship between HVE and AXR1. We did not find significantdifferences in vascular density and number of branching points persurface unit between axr1-12/axr1-12 and hve-3/hve-3 first leaves[Table 2; this aspect of the axr1 phenotype has been reported byDeyholos et al. (Deyholos et al., 2003)]. However, the leaf epinastyof axr1-12 mutants (see Fig. S7 in the supplementary material) is notshared by hve mutants. We identified hve-3/hve-3;axr1-12/axr1-12double mutants among the F2 progeny of an HVE/hve-3 � axr1-12/axr1-12 cross (Fig. 7, see Fig. S7 in the supplementary material).The hve-3/hve-3;axr1-12/axr1-12 leaves were epinastic, like thoseof HVE/-;axr1-12/axr1-12 plants (Fig. S7), and significantly smallerthan those of hve-3/hve-3;AXR1/- individuals (Table 2). The vascularlength and the number of branching points were similar in hve-3/hve-3;axr1-12/axr1-12 and hve-3/hve-3;AXR1/- plants, indicatingsimilar levels of vascular development and the functionalrelationship of HVE and AXR1. However, the vascular density andnumber of branching points per surface unit were higher in thedouble mutant, the leaves of which were smaller than those of theparentals.

We identified hve-3/hve-3;lop1-65/lop1-65 double mutants in F2families from an HVE/hve-3 � LOP1/lop1-65 cross in a 9:3:3:1segregation (�2=0.995; P=0.802; the presence of hve-3 was tested inphenotypically Lop1 and Hve Lop1 plants). The double mutantsshowed significantly smaller leaves (see Fig. S7 in thesupplementary material, Table 2), with fewer branching points,fewer branching points per surface unit, and a shorter vascular


Fig. 5. Expression of ATHB-8-GUS. hve-3/hve-3 (A-H) andCol-0 (I-P) transgenic leaves. Pictures of vegetative leavesfrom the first (A,I), third (B,J), seventh (C,K) and tenth (D,L)nodes were taken 21 days after sowing. Diagrams of hve-3/hve-3 (E-H) and Col-0 (M-P) obtained from the pictures arealso shown. Red lines are used to indicate poorly stained veinsegments. Leaves in I and J had to be incised to allowflattening. Scale bars: 1 mm.

DEVELO

PMENT

3762

network than those of their hve-3/hve-3;LOP1/- and HVE/-;lop1-65/lop1-65 siblings (Figs 7, S7 and Table 2). Their vasculardensities, however, were found to be similar to those of hve-3/hve-3;LOP1/- plants. Vascular islands were also observed in somedouble mutant individuals (Fig. 7).

An additive phenotype was found in the hve-3/hve-3;cvp2-1/cvp2-1 double mutants, which were identified in F2 families as plants witha simple venation pattern and disconnected secondary veins (Fig. 7,see Fig. S7 in the supplementary material). These disconnectionsoccurred more frequently in the double mutants than in HVE/-;cvp2-1/cvp2-1 single mutants, an observation that suggests that HVEcontributes to normal vascular connectivity, possibly by ensuring acertain level of vein thickness. Phenotypic characterization ofHVE/-;cvp2-1/cvp2-1 plants and their hve-3/hve-3;cvp2-1/cvp2-1 F2siblings demonstrated that leaf size, vascular network length and thenumber of branching points per surface unit were reduced in thedouble mutants and very similar to those of hve-3/hve-3;CVP2/-plants.

We identified hve-3/hve-3;cvp1-3/cvp1-3 double mutants in theF2 of an hve-3/hve-3 � cvp1-3/cvp1-3 cross. The cotyledons ofthese double mutants displayed an additive phenotype consisting

of the simple vascular pattern characteristic of hve-3, combinedwith the vein disconnections characteristic of cvp1-3. Wesequenced CVP1 in these plants to confirm that they were hve-3/hve-3;cvp1-3/cvp1-3. The venation patterns of hve-3/hve-3;cvp1-3/cvp1-3 and hve-3/hve-3;CVP1/- first rosette leaves werenot significantly different (Table 2, Fig. 7). By contrast, thevenation length, vascular density, number of branching points andthe number of branching points per surface area were significantlysmaller for HVE/-;cvp1-3/cvp1-3 plants than for theirHVE/-;CVP1/- wild-type siblings (Table 2, Fig. 7). This role ofCVP1 in the venation patterning of vegetative leaves had remainedunnoticed before.


Fig. 6. Expression of the HVE and ATHB-8 genes during first leafexpansion. Plants carrying the (A-K) PETA2-GUS and (L-U) ATHB-8-GUStransgenes. Numbers indicate days after germination. Pictures weretaken with differential interference contrast microscopy. Scale bars: 5�m in A,L,G; 1.25 �m in H; 50 �m in B-E,M-Q; 100 �m in F,I,R-T; 250�m in J,K,U.

Fig. 7. Venation pattern of single and double mutants withaltered vascular development. First leaf venation pattern diagramsare shown for the phenotypically wild-type (wt; left column), and single(second and third columns) and double (right column) mutant siblingsof several F2 populations. Diagrams were obtained from leavescollected 21 days after sowing. Scale bars: 1 mm.

DEVELO

PMENT

DISCUSSIONMutations in the HVE gene cause an auxin-relatedpleiotropic phenotypeThe pleiotropic phenotype of hve mutants includes a simple vascularpattern, an extremely branched inflorescence, altered root wavingand reduced fertility. Impaired auxin homeostasis may well explainthese phenotypic traits, which are reminiscent of mutants deficientin auxin perception or biosynthesis (Lincoln et al., 1990; Mullen etal., 1998; Rutherford et al., 1998). According to the canalizationhypothesis (Sachs, 1991b), the spacing of veins is the outcome of amechanism that requires that auxin exerts a positive feedback on itsown transport. Cells that transport the hormone more efficientlybecome prospective vascular bundles after reaching a threshold ofauxin concentration, while the resulting depletion of auxin inneighboring cells has the same effect as a lateral inhibitionmechanism. This model predicts that decreased auxin sensitivityshould result in a sparse vascular network, such as the one weobserved in hve leaves.

Like axr1 mutants, although to a lesser extent, the hve mutants areinsensitive to the synthetic auxin 2,4-D, in agreement with previousobservations (Cheng et al., 2004; Chuang et al., 2004; Feng et al.,2004). By contrast, root gravitropism, skotomorphogenesis andsensitivity to the auxin transport inhibitor TIBA were normal inhve/hve plants. Unlike some agravitropic mutants that are insensitiveto exogenous auxin, such as auxin resistant4 (axr4) (Hobbie andEstelle, 1995) and auxin-herbicide resistant1 (aux1) (Yamamotoand Yamamoto, 1998), hve/hve roots did not display alteredgravitropism.

A role for auxin and ubiquitination in venationpattern formationFollowing a map-based approach, we cloned HVE and found it toencode the Arabidopsis ortholog of mammalian CAND1. Theimportant role of the HVE/CAND1 gene in vascular developmenthas remained unnoticed so far, even though its cloning and thecharacterization of several mutant alleles have been reported bythree research groups (Cheng et al., 2004; Chuang et al., 2004; Feng

et al., 2004). Human CAND1 regulates the ubiquitination of targetproteins by binding to unneddylated CULLIN1 (CUL1). CUL1,SKP1 and F-box proteins form SCF complexes that ligate ubiquitinmoieties to proteins that will be degraded by the 26S proteasome. Ithas been proposed that the binding of CAND1 to unneddylatedCUL1 hinders the interaction of SKP1 with CUL1 preventing theassembly of the SCF complex. After neddylation of CUL1, CAND1is released and the SFC complex is assembled (Liu et al., 2002;Zheng et al., 2002; Hwang et al., 2003; Oshikawa et al., 2003).

Ubiquitin-mediated protein degradation is essential for auxinsignaling (Dharmasiri and Estelle, 2004). Auxin triggers the rapiddegradation of AUX/IAA transcriptional repressors through theaction of the SCFTIR1 complex (Gray et al., 2001). AUX/IAAproteins act by sequestering members of the ARF family oftranscription factors (Ulmasov et al., 1997; Guilfoyle et al., 1998)that bind auxin response elements (AREs), a conserved sequencemotif found in the promoters of auxin primary responsive genes(Guilfoyle et al., 1998). The identification of the F-box protein TIR1as the auxin receptor thus provides a simple explanation for the rapidresponses to auxin (Dharmasiri et al., 2005; Kepinski and Leyser,2005). In Arabidopsis, CAND1 binds to unneddylated CUL1, asdemonstrated in vivo (Feng et al., 2004) and in vitro (Chuang et al.,2004) (this work), and hence regulates the formation of SCFcomplexes involving the F-box proteins UFO, TIR1, COI1 andSLY1.

The fact that not only hve but also axr1 mutants have impairedleaf venation confirms the role of the ubiquitin pathway in thepatterning of plant vascular tissues. AXR1 encodes a protein similarto the E1 ubiquitin-activating enzymes and is required for theconjugation of RUB1 to CUL1 (Leyser et al., 1993; del Pozo andEstelle, 1999; del Pozo et al., 2002). As inferred from their similarnumber of branching points, the leaves of the hve and axr1 singlemutants and hve axr1 double mutants show similar structuralcomplexity, suggesting that both genes act in the samedevelopmental pathway. As noticed previously (Cheng et al., 2004)for other phenotypic traits, the similar venation defects of axr1 andhve loss-of-function mutants are paradoxical, as one would expect


Table 2. Morphometric analysis of the venation pattern of first leaves in F2 plantsLeaf area Venation Vascular density Branching

Genotype (mm2) length (mm) (mm/mm2) Branching points points/mm2 n

HVE/-;AXR1/- 17.87±4.42 62.73±12.73 3.55±0.37 87.57±19.02 5.02±1.05 7HVE/-;axr1-12/axr1-12 9.81±4.34 23.60±8.93 2.50±0.48 19.57±9.29 2.17±1.05 7hve-3/hve-3;AXR1/- 5.82±1.58 14.75±3.40 2.57±0.30 11.30±4.24 1.99±0.69 10hve-3/hve-3;axr1-12/axr1-12 4.35±1.16 13.37±2.39 3.20±0.84 13.33±3.98 3.09±0.69 6

HVE/-;LOP1/- 18.55±4.75 67.22±12.70 3.73±0.69 100.9±25.64 5.78±2.15 10HVE/-;lop1-65/lop1-65 8.22±1.48 27.36±4.58 3.35±0.41 21.40±4.83 2.63±0.55 10hve-3/hve-3;LOP1/- 4.59±1.35 13.37±3.03 2.97±0.35 11.40±4.27 2.52±0.86 10hve-3/hve-3;lop1-65/lop1-65 3.37±1.08 9.21±2.52 2.78±0.34 3.50±1.27 1.13±0.48 10

HVE/-;PIN1/- 28.30±4.91 101.80±14.40 3.63±0.28 154.9±18.81 5.58±0.92 10HVE/-;pin1cay/pin1cay 23.04±14.66 102.60±45.10 5.59±2.36 165.1±48.81 10.41±6.81 10hve-3/hve-3;PIN1/- 6.69±1.68 17.93±3.05 2.75±0.36 16.70±4.06 2.62±0.79 10hve-3/hve-3;pin1cay/pin1cay 5.53±2.77 24.64±8.91 4.98±1.83 37.30±16.76 7.78±4.16 10

HVE/-;CVP2/- 26.78±4.40 80.51±13.20 3.01±0.11 91.50±15.31 3.42±0.25 10HVE/-;cvp2-1/cvp2-1 25.82±5.04 70.66±12.5 2.75±0.21 79.33±16.23 3.12±0.71 9hve-3/hve-3;CVP2/- 6.25±1.31 15.73±2.39 2.55±0.19 11.10±1.85 1.82±0.35 10hve-3/hve-3;cvp2-1/cvp2-1 5.21±2.02 13.14±3.97 2.58±0.24 10.70±3.02 2.16±0.51 10

HVE/-;CVP1/- 18.04±4.66 67.91±12.70 3.86±0.48 97.00±12.99 5.65±1.37 10HVE/-;cvp1-3/cvp1-3 18.15±3.58 56.66±9.91 3.15±0.35 68.70±14.72 3.87±0.85 10hve-3/hve-3;CVP1/- 5.47±2.26 14.92±4.86 2.89±0.51 11.62±3.74 2.38±0.86 8hve-3/hve-3;cvp1-3/cvp1-3 5.52±1.38 14.43±2.12 2.69±0.38 8.60±2.32 1.67±0.70 10

DEVELO

PMENT

3764

them to have opposite phenotypes if the only role of CAND1 is tonegatively regulate the assembly of SCF complexes. The recentfinding that the deneddylation of CUL1 by the COP9 signalosomeis enhanced by CAND1 (Min et al., 2005) is equally paradoxical, asextra neddylation of CUL1 in loss-of-function hve mutants shouldalso lead to a phenotype opposite to that of axr1 mutants.Alternatively, by sequestering unneddylated CUL1, HVE/CAND1may cause that only neddylated CUL1 is incorporated intofunctional SCF complexes. The incorporation of unneddylatedCUL1 into the SCF complexes may impair their functionalitythrough a dominant-negative effect, explaining the similarphenotypes of axr1 and hve mutants, the compromised functionalityof the SCF complexes in cand1-1 mutants (Feng et al., 2004), andwhy, unlike null CUL1 alleles (Shen et al., 2002), null hve alleles arenot lethal.

It has been proposed that the concentration of auxin that leads tothe patterning of the primary and secondary veins is higher than theconcentration required for other veins (Aloni et al., 2003). If acertain threshold of an auxin signal must be surpassed for the groundcells to adopt vascular fates, the co-occurrence of decreased auxinsensitivity and the lower auxin concentration required for thepatterning of higher-order veins may explain why higher-order veinsare more severely affected in hve mutants. We found no expressionof the DR5-GUS reporter in hve-3/hve-3 leaves at the sites wherehigher-order veins are normally differentiating in the wild type. Thissuggests that loss of HVE function leads to a reduction in GUSexpression driven by the auxin response elements of the syntheticDR5 promoter, and further supports a correlation between animpaired auxin perception and the failure to form tertiary and higher-order veins.

HVE is required in a general, very early venationpatterning mechanismBased on the correlation between venation density and venationbranching found for different rosette leaves, we previously proposedthat a common patterning mechanism operates in all of them(Candela et al., 1999). This hypothesis is reinforced by the simplevascular network of all the rosette leaves and laminar floral organsof hve mutants. The extent of the venation abnormalities caused byhve alleles indicates that HVE is a component of such a commonmechanism. Nevertheless, the apparently normal venation pattern ofhve cauline leaves also indicates the existence of organ-specificelements. The expression of CAND1-GUS in the hydathodes andmargins of fully expanded cauline leaves suggests additional rolesfor HVE.

The dwarfism and extremely low fertility caused by hve-2 andhve-3 suggest that they are null alleles, as also proposed by Feng etal. (Feng et al., 2004). By contrast, hve-1 is probably hypomorphic,as its effects on fertility and overall plant and inflorescence size arenot so severe. Mis-splicing of hve-1 transcripts generates at least twotruncated predicted proteins that may keep some remnant function.Similarly, the phenotype caused by mis-splicing of another allele,Atcand1-1, is weaker than that of null alleles (Cheng et al., 2004).The similar vein pattern phenotypes conferred by hypomorphic andnull alleles of HVE suggest that venation patterning is more sensitiveto HVE loss of function than are plant size and fertility.

We studied the expression of ATHB-8-GUS, an early marker ofvascular cell identity (Baima et al., 1995), in hve-1/hve-1 and hve-3/hve-3 plants. The reporter highlighted a simple vascular patternwith reduced vascular density and lacking higher order veins.Consistent with their early role, the expression of both HVE andATHB-8 was detected before xylem differentiation in the midvein

of the first leaves, and they evolved in a very similar way. Ourresults suggest that, at least in higher order veins, HVE acts todetermine the location of new strands. Lack of HVE expression,however, does not preclude the formation of the primary vein, andonly partially inhibits the formation of the secondary and tertiaryveins. ATHB-8 expression seems to be required for vein-specificevents after vein initiation sites are established, and depends onprior HVE activity in higher order veins, only partially so in the caseof secondary and tertiary veins, and not at all in the primary vein.As this conclusion is solely based on the behavior of an ATHB-8-GUS transgene, further research will be required to shed light onthe order of action of HVE and ATHB-8. Cleared leaves andparadermal and transverse leaf sections showed no traces of abortedor incompletely developed vascular strands at the sites wherehigher-order veins are lacking in the hve mutants, an observationindicating a perturbation of vascular initiation rather than finaldifferentiation. The thin primary vein of the hve-3 mutant is a likelyconsequence of impaired auxin perception on the recruitment ofprovascular cells.

Double mutant analysis suggests that auxintransport and perception act independently topattern leaf veinsWe investigated the functional relationship of HVE with severalgenes involved in venation pattern formation or auxin perception ortransport, such as CVP1, CVP2, LOP1 and PIN1. The hve-3 pin1cay

double mutant was particularly informative, given that the simplevascular pattern of hve-3 was affected by the null pin1cay allele. AsPIN1 is an auxin transporter, this result shows that the minimalvascular pattern of hve leaves still depends on auxin for itsdevelopment and that alternative mechanisms of auxin perceptionare at work in the mutant. The additive hve-3 pin1cay phenotype wasas to be expected if auxin perception and transport operateindependently to pattern the vascular network. As the architectureof the venation pattern seems to be very sensitive to alterations ineither of these two factors, it follows that they must act coordinately.Further support for these conclusions came from the application ofthe auxin transport inhibitor TIBA to the hve-1 mutant, which causedthe same range of abnormalities as in the wild type.

The phenotypes of hve-3 lop1-65, hve-3 cvp1-3 and hve-3 cvp2-1 double mutants were also considered to be additive, suggestingthat additional independent processes are required for veindevelopment. The free-ending higher-order veins of cvp2-1 singlemutants indicate a role for CVP2 in the connectivity of vascularstrands. The secondary veins of hve-3 cvp2-1 double mutants wereoften disconnected, suggesting that the secondary veins of hve-3 areequivalent to the higher-order veins of the wild type, as inferred fromtheir similar sensitivity to the loss of CVP2 function. Thisequivalence suggests a gradual establishment of the venation patternand may be explained by an impaired auxin sensitivity leading to apremature arrest of the patterning process in the mutant, which isconsistent with the mechanism proposed by the canalizationhypothesis.

We thank F. Carland, S. Baima, W. Gray, T. Guilfoyle, T. Berleth, the NASC andthe ABRC for providing seeds; P. Robles and V. Quesada for comments on themanuscript; and J. M. Serrano and V. García-Sempere for technical assistance.This work was supported by grants BMC2002-02840 and BFU2005-01031 toJ.L.M., and by a fellowship to M.M.A.-P. from the Ministerio de Educación yCiencia of Spain.

Supplementary materialSupplementary material for this article is available athttp://dev.biologists.org/cgi/content/full/133/19/3755/DC1


DEVELO

PMENT

ReferencesAloni, R., Schwalm, K., Langhans, M. and Ullrich, C. I. (2003). Gradual shifts in

sites of free-auxin production during leaf-primordium development and theirrole in vascular differentiation and leaf morphogenesis in Arabidopsis. Planta216, 841-853.

Alonso, J. M., Stepanova, A. N., Leisse, T. J., Kim, C. J., Chen, H., Shinn, P.,Stevenson, D. K., Zimmerman, J., Barajas, P. and Cheuk, R. et al. (2003).Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science 301,653-657.

Aoki, T., Okada, N., Ishida, M., Yogosawa, S., Makino, Y. and Tamura, T. A.(1999). TIP120B: a novel TIP120-family protein that is expressed specifically inmuscle tissues. Biochem. Biophys. Res. Commun. 261, 911-916.

Avsian-Kretchmer, O., Cheng, J. C., Chen, L., Moctezuma, E. and Sung, Z. R.(2002). Indole acetic acid distribution coincides with vascular differentiationpattern during Arabidopsis leaf ontogeny. Plant Physiol. 130, 199-209.

Baima, S., Nobili, F., Sessa, G., Lucchetti, S., Ruberti, I. and Morelli, G. (1995).The expression of the Athb-8 homeobox gene is restricted to provascular cells inArabidopsis thaliana. Development 121, 4171-4182.

Baima, S., Possenti, M., Matteucci, A., Wisman, E., Altamura, M. M.,Ruberti, I. and Morelli, G. (2001). The Arabidopsis ATHB-8 HD-Zip protein actsas a differentiation-promoting transcription factor of the vascular meristems.Plant Physiol. 126, 643-655.

Berná, G., Robles, P. and Micol, J. L. (1999). A mutational analysis of leafmorphogenesis in Arabidopsis thaliana. Genetics 152, 729-742.

Candela, H., Martínez-Laborda, A. and Micol, J. L. (1999). Venation patternformation in Arabidopsis thaliana vegetative leaves. Dev. Biol. 205, 205-216.

Carland, F. M. and McHale, N. A. (1996). LOP1: a gene involved in auxintransport and vascular patterning in Arabidopsis. Development 122, 1811-1819.

Carland, F. M. and Nelson, T. (2004). Cotyledon vascular pattern2-mediatedinositol (1,4,5) triphosphate signal transduction is essential for closed venationpatterns of Arabidopsis foliar organs. Plant Cell 16, 1263-1275.

Carland, F. M., Berg, B. L., FitzGerald, J. N., Jinamornphongs, S., Nelson, T.and Keith, B. (1999). Genetic regulation of vascular tissue patterning inArabidopsis. Plant Cell 11, 2123-2137.

Carland, F. M., Fujioka, S., Takatsuto, S., Yoshida, S. and Nelson, T. (2002).The identification of CVP1 reveals a role for sterols in vascular patterning. PlantCell 14, 2045-2058.

Cheng, Y., Dai, X. and Zhao, Y. (2004). AtCAND1, a heat-repeat protein thatparticipates in auxin signaling in Arabidopsis. Plant Physiol. 135, 1020-1026.

Chuang, H., Zhang, W. and Gray, W. M. (2004). Arabidopsis ETA2, anapparent ortholog of the human cullin-interacting protein CAND1, is requiredfor auxin responses mediated by the SCFTIR1 ubiquitin ligase. Plant Cell 16,1883-1897.

Cnops, G., Neyt, P., Raes, J., Petrarulo, M., Nelissen, H., Malenica, N.,Luschnig, C., Tietz, O., Ditengou, F., Palme, K. et al. (2006). The TORNADO1and TORNADO2 genes function in several patterning processes during early leafdevelopment in Arabidopsis thaliana. Plant Cell 18, 852-866.

del Pozo, J. C. and Estelle, M. (1999). The Arabidopsis cullin AtCUL1 is modifiedby the ubiquitin-related protein RUB1. Proc. Natl. Acad. Sci. USA 96, 15342-15347.

del Pozo, J. C., Dharmasiri, S., Hellmann, H., Walker, L., Gray, W. M. andEstelle, M. (2002). AXR1-ECR1-dependent conjugation of RUB1 to theArabidopsis Cullin AtCUL1 is required for auxin response. Plant Cell 14, 421-433.

Deyholos, M. K., Cordner, G., Beebe, D. and Sieburth, L. E. (2000). TheSCARFACE gene is required for cotyledon and leaf vein patterning. Development127, 3205-3213.

Deyholos, M. K., Cavaness, G. F., Hall, B., King, E., Punwani, J., Van Norman,J. and Sieburth, L. E. (2003). VARICOSE, a WD-domain protein, is required forleaf blade development. Development 130, 6577-6588.

Dharmasiri, N. and Estelle, M. (2004). Auxin signaling and regulated proteindegradation. Trends Plant Sci. 9, 302-308.

Dharmasiri, N., Dharmasiri, S. and Estelle, M. (2005). The F-box protein TIR1 isan auxin receptor. Nature 435, 441-445.

Donnelly, P. M., Bonetta, D., Tsukaya, H., Dengler, R. E. and Dengler, N. G.(1999). Cell cycling and cell enlargement in developing leaves of Arabidopsis.Dev. Biol. 215, 407-419.

Estelle, M. A. and Somerville, C. (1987). Auxin-resistant mutants ofArabidopsis thaliana with an altered morphology. Mol. Gen. Genet. 206, 200-206.

Feng, S., Shen, Y., Sullivan, J. A., Rubio, V., Xiong, Y., Sun, T. and Deng, X.W. (2004). Arabidopsis CAND1, an unmodified CUL1-Interacting protein, isinvolved in multiple developmental pathways controlled by ubiquitin/proteasome-mediated protein degradation. Plant Cell 16, 1870-1882.

Gälweiler, L., Guan, C., Muller, A., Wisman, E., Mendgen, K., Yephremov, A.and Palme, K. (1998). Regulation of polar auxin transport by AtPIN1 inArabidopsis vascular tissue. Science 282, 2226-2230.

Goto, N., Starke, M. and Kranz, A. R. (1987). Effect of gibberellins on flowerdevelopment of the pin-formed mutant of Arabidopsis thaliana. Arabidopsis Inf.Serv. 23, 66-71.

Goto, N., Katoh, N. and Kranz, A. R. (1991). Morphogenesis of floral organs inArabidopsis: predominant carpel formation of the pin-formed mutant. Jpn. J.Genet. 66, 551-567.

Gray, W. M., Kepinski, S., Rouse, D., Leyser, O. and Estelle, M. (2001). Auxinregulates SCF(TIR1)-dependent degradation of AUX/IAA proteins. Nature 414,271-276.

Guilfoyle, T., Hagen, G., Ulmasov, T. and Murfett, J. (1998). How does auxinturn on genes? Plant Physiol. 118, 341-347.

Hobbie, L. and Estelle, M. (1995). The axr4 auxin-resistant mutants ofArabidopsis thaliana define a gene important for root gravitropism and lateralroot initiation. Plant J. 7, 211-220.

Hwang, J., Min, K., Tamura, T. and Yoon, J. (2003). TIP120A associates withunneddylated cullin 1 and regulates its neddylation. FEBS Lett. 541, 102-108.

Kepinski, S. and Leyser, O. (2005). The Arabidopsis F-box protein TIR1 is an auxinreceptor. Nature 435, 446-451.

Konieczny, A. and Ausubel, F. M. (1993). A procedure for mapping Arabidopsismutations using co-dominant ecotype specific PCR-based markers. Plant J. 4,403-410.

Koizumi, K., Sugiyama, M. and Fukuda, H. (2000). A series of novel mutants ofArabidopsis thaliana that are defective in the formation of continuous vascularnetwork: calling the auxin signal flow canalization hypothesis into question.Development 127, 3197-3204.

Leyser, H. M. O., Lincoln, C. A., Timpte, C., Lammer, D., Turner, J. and Estelle,M. (1993). Arabidopsis auxin-resistance gene AXR1 encodes a protein related toubiquitin-activating enzyme E1. Nature 364, 161-164.

Lincoln, C., Britton, J. H. and Estelle, M. (1990). Growth and development ofthe axr1 mutants of Arabidopsis. Plant Cell 2, 1071-1080.

Lister, C. and Dean, C. (1993). Recombinant Inbred Lines for mapping RFLP andphenotypic markers in Arabidopsis thaliana. Plant J. 4, 745-750.

Liu, J., Furukawa, M., Matsumoto, T. and Xiong, Y. (2002). Nedd8modification of CUL1 dissociates p120CAND1, an inhibitor of CUL1-SKP1 bindingand SCF ligases. Mol. Cell 10, 1511-1518.

Mattsson, J., Sung, R. and Berleth, T. (1999). Responses of plant vascularsystems to auxin transport inhibition. Development 126, 2979-2991.

Mattsson, J., Ckurshumova, W. and Berleth, T. (2003). Auxin signaling inArabidopsis leaf vascular development. Plant Physiol. 131, 1327-1339.

Meinhardt, H. (1976). Morphogenesis of lines and nets. Differentiation 6, 117-123.

Meinhardt, H. (1984). Models for positional signalling, the threefold subdivisionof segments and the pigmentation pattern of molluscs. J. Embryol. Exp.Morphol. 83, 289-311.

Min, K. W., Kwon, M. J., Park, H. S., Park, Y., Yoon, S. K. and Yoon, J. B.(2005). CAND1 enhances deneddylation of CUL1 by COP9 signalosome.Biochem. Biophys. Res. Commun. 334, 867-874.

Mitchison, G. J. (1980). The dynamics of auxin transport. Proc. R. Soc. Lond. BBiol. Sci. 209, 489-511.

Mitchison, G. J. (1981). The effect of intracellular geometry on auxin transport.Proc. R. Soc. Lond. B Biol. Sci. 214, 53-67.

Mullen, J. L., Turk, E., Johnson, K., Wolverton, C., Ishikawa, H., Simmons, C.,Soll, D. and Evans, M. L. (1998). Root-growth behavior of the Arabidopsismutant rgr1. Roles of gravitropism and circumnutation in the waving/coilingphenomenon. Plant Physiol. 118, 1139-1145.

Oshikawa, K., Matsumoto, M., Yada, M., Kamura, T., Hatakeyama, S. andNakayama, K. I. (2003). Preferential interaction of TIP120A with Cul1 that isnot modified by NEED8 and not associated with Skp1. Biochem. Biophys. Res.Commun. 303, 1209-1216.

Pérez-Pérez, J. M., Serrano-Cartagena, J. and Micol, J. L. (2002). Geneticanalysis of natural variations in the architecture of vegetative leaves inArabidopsis thaliana. Genetics 162, 893-915.

Pérez-Pérez, J. M., Ponce, M. R. and Micol, J. L. (2004). The ULTRACURVATA2gene of Arabidopsis encodes an FK506-binding protein involved in auxin andbrassinosteroid signaling. Plant Physiol. 134, 101-117.

Ponce, M. R., Quesada, V. and Micol, J. L. (1998). Rapid discrimination ofsequences flanking and within T-DNA insertions in the Arabidopsis genome.Plant J. 14, 497-501.

Ponce, M. R., Robles, P. and Micol, J. L. (1999). High-throughput geneticmapping in Arabidopsis thaliana. Mol. Gen. Genet. 261, 408-415.

Przemeck, G. K. H., Mattsson, J., Hardtke, C. S., Sung, Z. R. and Berleth, T.(1996). Studies on the role of the Arabidopsis gene MONOPTEROS in vasculardevelopment and plant cell axialization. Planta 200, 229-237.

Quesada, V., Ponce, M. R. and Micol, J. L. (1999). OTC and AUL1, twoconvergent and overlapping genes in the nuclear genome of Arabidopsisthaliana. FEBS Lett. 461, 101-106.

Rutherford, R., Gallois, P. and Masson, P. H. (1998). Mutations in Arabidopsisthaliana genes involved in the tryptophan biosynthesis pathway affect rootwaving on tilted agar surfaces. Plant J. 16, 145-154.

Sachs, T. (1991a). Cell polarity and tissue patterning in plants. Dev. Suppl. 1, 83-93.

Sachs, T. (1991b). Pattern Formation in Plant Tissues. Cambridge: CambridgeUniversity Press.


DEVELO

PMENT

3766

Serrano-Cartagena, J., Robles, P., Ponce, M. R. and Micol, J. L. (1999). Geneticanalysis of leaf form mutants from the Arabidopsis Information Servicecollection. Mol. Gen. Genet. 261, 725-739.

Serrano-Cartagena, J., Candela, H., Robles, P., Ponce, M. R., Pérez-Pérez, J.M., Piqueras, P. and Micol, J. L. (2000). Genetic analysis of incurvata mutantsreveals three independent genetic operations at work in Arabidopsis leafmorphogenesis. Genetics 156, 1363-1377.

Shen, W. H., Parmentier, Y., Hellmann, H., Lechner, E., Dong, A., Masson, J.,Granier, F., Lepiniec, L., Estelle, M. and Genschik, P. (2002). Null mutation ofAtCUL1 causes arrest in early embryogenesis in Arabidopsis. Mol. Biol. Cell 13,1916-1928.

Sieburth, L. E. (1999). Auxin is required for leaf vein pattern in Arabidopsis. PlantPhysiol. 121, 1179-1190.

Steynen, Q. J. and Schultz, E. A. (2003). The FORKED genes are essential fordistal vein meeting in Arabidopsis. Development 130, 4695-4708.

Stirnberg, P., Chatfield, S. P. and Leyser, H. M. O. (1999). AXR1 acts after

lateral bud formation to inhibit lateral bud growth in Arabidopsis. Plant Physiol.121, 839-847.

Ulmasov, T., Murfett, J., Hagen, G. and Guilfoyle, T. J. (1997). Aux/IAAproteins repress expression of reporter genes containing natural and highlyactive synthetic auxin response elements. Plant Cell 9, 1963-1971.

Yamamoto, M. and Yamamoto, K. T. (1998). Differential effects of 1-naphthaleneacetic acid, indole-3-acetic acid and 2,4-dichlorophenoxyacetic acidon the gravitropic response of roots in an auxin-resistant mutant of Arabidopsis,aux1. Plant Cell Physiol. 39, 660-664.

Yogosawa, S., Makino, Y., Yoshida, T., Kishimoto, T., Muramatsu, M. andTamura, T. (1996). Molecular cloning of a novel 120-kDa TBP-interactingprotein. Biochem. Biophys. Res. Commun. 229, 612-617.

Zheng, J., Yang, X., Harrell, J. M., Ryzhikov, S., Shim, E., Lykke-Andersen, K.,Wei, N., Sun, H., Kobayashi, R. and Zhang, H. (2002). CAND1 binds tounneddylated CUL1 and regulates the formation of SCF ubiquitin E3 ligasecomplex. Mol. Cell 10, 1519-1526.
