Metabolite Profiling Reveals Distinct Changes in Carbon and Nitrogen
Metabolism in Phosphate-Deficient Barley Plants (Hordeum vulgare L)
Chun Y Huang1 Ute Roessner
2 Ira Eickmeier
3 Yusuf Genc
4 Damien L Callahan
5
Neil Shirley1 Peter Langridge
1and Antony Bacic
2
1 Australian Centre for Plant Functional Genomics The University of Adelaide Waite Campus PMB1 Glen OsmondSouth Australia 5064 Australia2 Australian Centre for Plant Functional Genomics School of Botany The University of Melbourne Victoria 3010 Australia3 Max-Planck-Institut fur Molekulare Pflanzenphysiologie Am Muhlenberg 1 D-14476 Golm Germany4 Molecular Plant Breeding Cooperative Research Centre The University of Adelaide South Australia 5005 Australia5 Metabolomics Australia School of Botany The University of Melbourne Victoria 3010 Australia
Plants modify metabolic processes for adaptation to low
phosphate (P) conditions Whilst transcriptomic analyses
show that P deficiency changes hundreds of genes related to
various metabolic processes there is limited information
available for global metabolite changes of P-deficient plants
especially for cereals As changes in metabolites are the
ultimate lsquoreadoutrsquo of changes in gene expression we profiled
polar metabolites from both shoots and roots of P-deficient
barley (Hordeum vulgare) using gas chromatographyndashmass
spectrometry (GC-MS) The results showed that mildly
P-deficient plants accumulated di- and trisaccharides
(sucrose maltose raffinose and 6-kestose) especially in
shoots Severe P deficiency increased the levels of metabolites
related to ammonium metabolism in addition to di- and
trisaccharides but reduced the levels of phosphorylated
intermediates (glucose-6-P fructose-6-P inositol-1-P and
glycerol-3-P) and organic acids (a-ketoglutarate succinatefumarate and malate) The results revealed that P-deficient
plants modify carbohydrate metabolism initially to reduce
P consumption and salvage P from small P-containing
metabolites when P deficiency is severe which consequently
reduced levels of organic acids in the tricarboxylic acid (TCA)
cycle The extent of the effect of severe P deficiency
on ammonium metabolism was also revealed by liquid
chromatographyndashmass spectrometry (LC-MS) quantitative
analysis of free amino acids A sharp increase in the
concentrations of glutamine and asparagine was observed in
both shoots and roots of severely P-deficient plants Based on
these data a strategy for improving the ability of cereals to
adapt to low P environments is proposed that involves
alteration in partitioning of carbohydrates into organic
acids and amino acids to enable more efficient utilization of
carbon in P-deficient plants
Keywords Ammonium mdash Barley (Hordeum vulgare L) mdash
Carbohydrate mdash Metabolite profile mdash Phosphate
deficiency
Abbreviations GC-MS gas chromatographyndashmass spec-trometry LC-MS liquid chromatographyndashmass spectrometryTCA tricarboxylic acid
Introduction
Inorganic phosphorus (Pi) is an essential macronutrient
for plant growth and development It influences virtually all
biochemical processes in plants Pi is a component of many
cellular molecules such as ATP nucleic acids phospholipids
and phosphorylated sugars and thus plays a crucial role in
carbon and nitrogen metabolism Plant cells have to main-
tain Pi concentrations within a critical range (Schachtman
et al 1998) Although phosphorus (P) is abundant in
most soils P availability and mobility often are low
(Raghothama 1999) which limits crop growth and produc-
tivity Large amounts of Pi fertilizers are applied to achieve
high crop yields which has led to the rapid depletion of
non-renewable P resources and environmental pollution
(Vance et al 2003) Therefore improving the Pi acquisition
and utilization efficiency of crop species is important for
sustainable agriculture
Plants modify metabolic processes to reprioritize
utilization of internal Pi and maximize acquisition of
external Pi in low Pi environments (Vance et al 2003)
Thus plants increase root surface area and root shoot
ratios to enable exploration of more soil volume under low
Pi conditions Furthermore P-deficient plants optimize
P utilization through mobilization of P from different
subcellular compartments and organs and through the
modification of metabolic processes and hydrolysis of many
P-containing molecules such as nucleic acids phospholipids
and small phosphorylated metabolites (Mimura 1999
Plaxton 2004 Cruz-Ramirez et al 2006) Plant roots also
modify their rhizosphere by the secretion of organic acids
(Lopez-Bucio et al 2000) and enzymes to increase P
availability (Vance et al 2003) and simultaneously
Corresponding author E-mail chunyuanhuangadelaideeduau Fax thorn61-8-8303-7102
Plant Cell Physiol 49(5) 691ndash703 (2008)doi101093pcppcn044 available online at wwwpcpoxfordjournalsorg The Author 2008 Published by Oxford University Press on behalf of Japanese Society of Plant PhysiologistsAll rights reserved For permissions please email journalspermissionsoxfordjournalsorg
691
synthesize more Pi transporter proteins in the plasma
membrane of root epidermal cells for higher Pi uptake
capacity (Muchhal and Raghothama 1999) Transcriptomic
analyses in Arabidopsis rice and lupin have shown that
coordinated changes in the expression of several hundred
genes take place in P-deficient plants (Uhde-Stone et al
2003 Wasaki et al 2003a Wu et al 2003 Mission et al
2005 Morcuende et al 2007) These genes are involved in
various metabolic pathways such as photosynthesis carbon
metabolism nitrogen assimilation and synthesis of protein
and nucleic acids (Wu et al 2003 Misson et al 2005
Morcuende et al 2007) which could lead to adaptive
changes in metabolite profiles
Recent advances in analytical technologies such as gas
and liquid chromatography coupled to mass spectrometry
(GC-MS and LC-MS) have allowed the analysis of a large
number of compounds from a single plant sample (for a
review see Kopka 2006) Such metabolite profiles provide
not only a much broader view for a systematic adjustment
in metabolic processes than conventional biochemical
approaches but also an opportunity to reveal new insights
on metabolism Metabolite profiling with GC-MS has been
used for studies on nutrient deficiency including nitrogen
sulfate iron and P in a single-cell green alga (Bolling and
Fiehn 2005) and in higher plants such as Arabidopsis and
common beans (Hirai et al 2004 Nikiforova et al 2005
Hernandez et al 2007) A combination of transcriptomic
and metabolite analyses has also been made to increase
further our understanding of plant responses to various
environmental stresses such as sulfate and nitrogen (Hirai
et al 2004 Nikiforova et al 2004 Nikiforova et al 2005)
and P deficiency in Arabidopsis and common beans
(Hernandez et al 2007 Morcuende et al 2007) Despite
the agronomic importance of cereals such as wheat and
barley little information is available for metabolite changes
in response to P deficiency As Pi homeostasis is regulated
at the whole-plant level by translocating Pi from mature to
young tissues and from shoots to roots under Pi-limiting
conditions (Jeschke et al 1997 Mimura 1999) it is
necessary to determine alterations in both shoots and
roots to increase our understanding of the biochemical
mechanisms involved in whole-plant adaptation to the low
Pi environment
In this report barley (Hordeum vulgare L) was used as
a model plant for cereal crops We measured approximately
100 metabolites from both shoots and roots of mildly or
severely P-deficient barley plants using a recently developed
GC-MS method (Roessner et al 2006) Metabolite profiles
reveal distinct changes in carbon and nitrogen metabolism
in P-deficient barley plants leading to accumulation of
di- and trisaccharides and free amino acids The distinct
metabolite profiles suggested that the severely P-deficient
barley plants are confronted with an increased level of
ammonium Thus the effect of severe P deficiency on
ammonium metabolism was further investigated through
quantitative analysis of amino acid profiles using LC-MS
(Callahan et al 2007) Our results provide new insights
into the effects of P deficiency on carbon and nitrogen
metabolism in barley plants
Results
Plant responses to short- and long-term P starvation in
growth and P nutrition
Barley seedlings were grown from seeds for different
time periods in a nutrient solution either with no added
NH4H2PO4 (P) or with 01mM NH4H2PO4 (thornP control)
to obtain plants with different P status At the 10th day
after seed imbibition (day 10) shoot development was
similar in the two P treatments with both having a fully
expanded first leaf and a small second leaf There were no
apparent P deficiency symptoms in the shoots of P-treated
plants although a change in root appearance was evident
Shorter primary roots and more lateral roots were observed
in the P treatment Plant growth measured on a FW basis
was significantly different between P and thornP treatments
at day 10 (Fig 1A) but there was no difference in DW
between P and thornP treatments at day 10 (data not shown)
The P concentration of shoots in the P-treated plants was
26mg P gndash1 DW (Fig 1B) which was below the critical
P concentration of 4mg P gndash1 DW (Reuter and Robinson
1997) The concentration of P in the roots was 32mg gndash1
DW (Fig 1B) In contrast the P concentration in the
thornP-treated plants was adequate at day 10 (Fig 1B) The
P-treated plants at day 10 suffered from mild P deficiency
and henceforth were referred to as mildly P-deficient plants
Plant growth was severely retarded when the plants
were grown in the P treatment for an additional 7 d
(Fig 1A day 17) There were two small fully expanded
leaves with the third leaf emerging in the P-treated plants
whereas there were three large fully expanded leaves in the
thornP-treated plants The seminal roots of the P-treated
plants were much shorter than those in the thornP-treated
plants P concentrations in the P-treated plants further
declined to 12mg P gndash1 DW in shoots and 20mg P gndash1 DW
in roots at day 17 (Fig 1B) Therefore the P-treated
plants at day 17 were inferred to be severely P-deficient
plants in this study
Expression of HvIPS1 and HvPht16 in P-deficient plants
The TPSI1At4 genes are sensitive to P deficiency and
widely used as a molecular indicator for P deficiency
(Burleigh and Harrison 1997 Liu et al 1997 Martin et al
2000 Wasaki et al 2003b Hou et al 2005) HvIPS1 is a
barley homolog of the TPSI1At4 genes (Hou et al 2005)
and HvPht16 is a low-affinity Pi transporter of barley
692 Metabolite profiles in P-deficient barley plants
(Rae et al 2003) Both HvIPS1 and HvPht16 are sensitive
to P deficiency and are highly expressed in both shoots
and roots of Lofty Nijo barley plants The transcript levels
of HvIPS1 and HvPht16 therefore were determined by
quantitative real-time PCR to monitor the response of both
shoots and roots to P deficiency As shown in Fig 2A a low
level of HvIPS1 (12 106 normalized copies mg1 RNA)
was detected in the shoots of thornP-treated plants at day 10
but a 277-fold increase (343 106 normalized copies mg1
RNA) was observed in the shoots of the P-treated plants
The enhanced expression of HvPht16 (32-fold increase)
was also observed in the shoots of P-treated plants at day
10 compared with that in the shoots of thornP-treated plants
(Fig 2A) In contrast a 415-fold increase in the transcript
level of HvIPS1 was observed in the roots of P-treated
plants (Fig 2B) which was similar to the enhanced level
in the shoots (Fig 2A) However no difference in the
HvPht16 transcript level was found in the roots receiving
the two P treatments at day 10 (Fig 2B) suggesting that the
shoots of barley plants are more sensitive to P deficiency
than the roots Severe P deficiency sharply increased the
transcript levels of HvIPS1 and HvPht16 in both shoots
and roots at day 17 (Fig 2)
Metabolite profiles of shoots and roots in mildly P-deficient
plants
A GC-MS-based method developed by Roessner et al
(2006) was used for the analysis of polar metabolites from
barley plants More than 400 compounds were detected
in barley plants subjected to both thornP and P treatments
1800A
B
1600
1400
1200
1000
800
600
400
200
0
1800
1600
1400
1200
1000
800
600
400
200
0
No
rmal
ized
co
pie
s mg
minus1 R
NA
(times1
06 )N
orm
aliz
ed c
op
ies
mgminus1
RN
A (
times106 ) minus P
+ P
HvIPS1 HvPht16Day 10 Day 17
HvIPS1 HvPht16
Fig 2 Effect of P supply on transcript levels of HvIPS1 andHvPht16 in shoots (A) and roots (B) of barley seedlings Barleyseedlings were grown in a nutrient solution with 01mMNH4H2PO4
(thornP) or without NH4H2PO4 addition (P) The levels of transcriptsare presented as normalized copies per mg RNA Plants wereharvested at the 10th day after seed imbibition (day 10) and at the17th day (day 17) Standard errors (nfrac14 3) are shown as vertical bars
140A
B
120
100
080
060
040
020
0
10
8
6
4
2
0
Fre
sh w
eig
ht
(g p
lan
tminus1)
P c
on
cen
trat
ion
s (m
g g
minus1 D
W)
Shoots Roots
minusP
+P
minusP
+P
Criticallevel
Day 10 Day 17 Day 10 Day 17
Fig 1 Effect of P supply on plant growth and P nutrition (A) Freshweight of shoots and roots (B) P concentration in shoots and rootsBarley seedlings were grown in a nutrient solution with 01mMNH4H2PO4 (thornP) or without NH4H2PO4 addition (P) Plantswere harvested at the 10th day after seed imbibition (day 10)and at the 17th day (day 17) Standard errors (nfrac14 4) are shown asvertical bars
Metabolite profiles in P-deficient barley plants 693
of which approximately 130 compounds could be assigned a
chemical structure A total of 98 metabolites were identified
as known compounds including 23 amino acids 15 organic
acids 25 sugars and 35 non-polar compounds (Supplemen-
tary Tables S1 S2) Metabolite levels from both shoots and
roots and the ratios of PthornP are presented in Supplemen-
tary Table S1 for the mildly P-deficient plants at day 10
and in Supplementary Table S2 for the severely P-deficient
plants at day 17
The PthornP ratios for metabolite levels for mildly
P-deficient plants are summarized in Fig 3 The levels
of approximately half of the sugars analyzed were
significantly increased in the shoots of the mildly
P-deficient plants (PSD10 Supplementary Table S1)
A significant increase in the levels of di- and trisaccharides
(sucrose 11-fold maltose 27-fold raffinose 42-fold and
6-kestose 119-fold) and one aromatic compound (shiki-
mate 22-fold) was observed (Fig 3) Little change in
amino acids and organic acids was observed in the shoots
of the mildly P-deficient plants (PSD10 Supplementary
Table S1) In contrast only a few metabolites were
significantly changed in the roots of mildly P-deficient
plants compared with thornP-treated roots (PRD10
Supplementary Table S1 Fig 3) One sugar maltose rose
to 15-fold in the roots (PthornPRD10 Supplementary
Table S1) The Pi level in the polar fraction of mildly
P-deficient plants was not significantly affected either in
shoots or in roots (phosphoric acid in the polar fraction
of Supplementary Table S1) These results indicate that the
metabolites involved in sugar metabolism are more sensitive
di- and tri-saccharides
raffinose(419plusmn017)312plusmn041
sucrose(114plusmn008)159plusmn011
glc(144plusmn004)070plusmn011
shikimate(222plusmn014)161plusmn018
fru(120plusmn008)079plusmn011
glycerol(103plusmn006)115plusmn011
6-kestose(1186plusmn020)
292plusmn037
maltose(269plusmn016)149plusmn006
ribose(128plusmn012)052plusmn012
inositol-1-P(097plusmn010)103plusmn039
glycine(103plusmn006)091plusmn012
serine(089plusmn004)121plusmn016
gly-6-P(082plusmn009)112plusmn027
glycerol-3-P(030plusmn048)197plusmn052
tryptophan(117plusmn017)396plusmn075
fru-6-P(073plusmn008)127plusmn025
inositol(136plusmn005)117plusmn007
b-alanine(148plusmn007)105plusmn015
alanine(088plusmn006)193plusmn037
asparagine(115plusmn010)079plusmn012
succinate(125plusmn010)104plusmn003
fumarate(073plusmn009)086plusmn003
aspartate(084plusmn008)209plusmn017
malate (115plusmn005)275plusmn018
citrate (131plusmn023)173plusmn026
glutamate(486plusmn032)1258plusmn097
a-ketoglutarate(101plusmn009)118plusmn021
urea(106plusmn008)128plusmn008
lipids
fructanstarch
glycerate-3-P
PEP
pyruvate
oxaloacetate
aromatic compounds
Fig 3 Effect of P supply on the levels of primary polar metabolites from shoots and roots of 10-day-old plants Barley seedlings weregrown in a nutrient solution with 01mM NH4H2PO4 (thornP) or without NH4H2PO4 addition (P) and harvested at the 10th day after seedimbibition A simplified metabolic pathway is used to show the levels of the primary metabolites determined by GC-MS The metabolitesmeasured by GC-MS are shown in bold and undetermined metabolites in a regular font Relative ratios (PthornP) of metabolites in theshoots (in parentheses) and roots (no parentheses) are presented as means SE (nfrac14 4) Significant differences (P 005) in the ratiosbetween the P and thornP treatments are indicated in green for the increased ratios and in red for the reduced ratios
694 Metabolite profiles in P-deficient barley plants
to mild P deficiency than others such as amino acids and
organic acids In addition it is obvious that shoots are more
responsive than roots to mild P deficiency
Metabolite profiles of shoots and roots in severely P-deficient
plants
The ratios (PthornP) of a wide spectrum of polar
metabolites were altered in 17-day-old P-deficient plants
(Supplementary Table S2) The elevated levels of di- and
trisaccharides remained in the shoots of severely P-deficient
plants (Fig 3) and more changes in di- and trisaccharides
including maltose (27-fold) sucrose (1374-fold) raffinose
(72-fold) and 6-kestose (70-fold) occurred in the roots
(Fig 4) Although the ratio of sucrose (PthornP) in the roots
of 17-day-old plants was extremely high the level of sucrose
(183) in the roots of the severely P-deficient plants
(Supplementary Table S2) was only slightly lower than
that (231) in the mildly P-deficient plants (Supplementary
Table S1) The extremely high ratio of sucrose in the roots
of the severely P-deficient plants is mainly due to the largely
reduced level of sucrose (01) in thornP-treated roots at day 17
(Fig 4 and Supplementary Table S2) In addition a large
increase in shikimate (120-fold) was observed in the roots
Ribose was the only monosaccharide which was reduced
03- to 06-fold in both shoots and roots of severely
P-deficient plants The levels of other monosaccharides
were either unaffected or increased (Fig 4) However Pi
levels in the polar fraction of the severely P-deficient plants
were sharply reduced to approximately 10 of those in
thornP-treated plants (phosphoric acid in the polar fraction of
di- and tri-saccharidesraffinose(335plusmn008)721plusmn012
glc(113plusmn004)095plusmn019
shikimate(199plusmn019)1204plusmn003
fru(151plusmn005)137plusmn010
inositol(116plusmn007)119plusmn005
serine(267plusmn009)125plusmn011
glycine(906plusmn002)157plusmn011
glc-6-P(014plusmn012)007plusmn010
fru-6-P(011plusmn005)008plusmn012
glyserol-3-P(015plusmn029)088plusmn008
inositol-1-P(040plusmn012)026plusmn024
glycerol(088plusmn004)198plusmn008
ribose(061plusmn020)030plusmn008
tryptophan(5454plusmn042)
ndb-alanine(083plusmn005)038plusmn007
alanine(296plusmn007)064plusmn011
asparagine(194plusmn024)295plusmn016
succinate(082plusmn005)068plusmn005
fumarate(082plusmn003)054plusmn007
aspartate(085plusmn005)051plusmn022
malate (074plusmn003)073plusmn019
citrate (122plusmn020)139plusmn007
glutamate(148plusmn016)243plusmn006
a-ketoglutarate(036plusmn015)075plusmn015
urea(nd)
3315plusmn009
sucrose(114plusmn005)13741plusmn007
6-kestose(1248plusmn009)
695plusmn014
maltose(612plusmn020)273plusmn008
fructan
lipids
starch
glycerate-3-P
PEP
pyruvate
oxaloacetate
aromatic compounds
Fig 4 Effect of P supply on the levels of primary polar metabolites from shoots and roots of 17-day-old plants Barley seedlings weregrown in a nutrient solution with 01mM NH4H2PO4 (thornPi) or without NH4H2PO4 addition (P) harvested at day 17 after seed imbibitionand separated into shoots and roots A metabolic pathway is used to show the levels of the primary metabolites determined by GC-MS Themetabolites measured by GC-MS are shown in bold and undetermined metabolites in a regular font Relative ratios (PthornP) of metabolitein the shoots (in parentheses) and roots (no parentheses) are presented as means SE (nfrac14 4) Significant differences (P 005) in the ratiosbetween the P and thornP treatments are indicated in green for the increased ratios and in red for the reduced ratios
Metabolite profiles in P-deficient barley plants 695
Supplementary Table S2) and the concomitant reduction in
phosphorylated sugars including glucose-6-P fructose-6-P
glycerol-3-P and inositol-1-P was also observed in both
shoots and roots of the severely P-deficient plants at day 17
(Fig 4 and Supplementary Table S2) The levels of seve-
ral organic acids of the TCA cycle were also reduced in
the severely P-deficient plants including a-ketoglutarate(04-fold) and malate (07-fold) in the shoots and succinic
acid (07-fold) and fumaric acid (05-fold) in the roots
(Fig 4)
There were hardly any changes in the levels of amino
acids in both shoots and roots of the mildly P-deficient
plants when compared with thornP-treated plants (Supplemen-
tary Table S1) but the levels of two-thirds of the amino
acids were increased in the shoots of the severely P-deficient
plants (PSD17 Supplementary Table S2) In addition
the polyamine putrescine was increased in shoots (PSD17
Supplementary Table S2) Similarly dramatic changes in
the levels of the amino acids and metabolites related to
ammonium metabolism were also observed in the roots of
severely P-deficient plants There was an increase in the
levels of asparagine (30-fold) glutamate (24-fold) and
putrescine (23-fold) in the roots of the severely P-deficient
plants as well as a sharp increase in the level of urea up to
332-fold in roots (Fig 4) This high ratio of the urea level
was due to the combination of an increase of urea (25-fold)
in the roots of the severely P-deficient plants (PRD17
Supplementary Table S2) compared with that of the mildly
P-deficient plants (PRD10 Supplementary Table S1)
and a reduction of the urea level from 08 in the roots of
thornP-treated plants at day 10 (thornPRD10 Supplementary
Table S1) to 01 at day 17 (thornPRD17 Supplementary
Table S2) These data should be viewed cautiously as the
quantification of urea by GC-MS can be unreliable so an
alternative approach would need to be utilized to explore
this effect further Furthermore the level of aspartate in the
roots of the severely P-deficient plants was reduced to
05-fold (Fig 4) The significant change in the metabolites
related to ammonium assimilation suggests that the severe
P deficiency increases levels of ammonium leading to
alterations in ammonium assimilation
Effect of severe P deficiency on the concentrations of free
amino acids
The observations described above led us to conduct
an additional experiment to determine the effect of severe P
deficiency on amino acid metabolism Absolute concentra-
tions of free amino acids were determined using LC-MS to
complement the data obtained by GC-MS In the additional
experiment the nutrient solutions were supplemented with
two levels of ammonium (01 and 04mM) The low
ammonium treatment (01mM) was the same as that used
for plant growth in the first experiment (Fig 1) The high
ammonium treatment (04mM) is designed to investigate
the effect of external ammonium supply on the accumula-
tion of free amino acids in P-deficient plants and to prevent
possible depletion of ammonium in the nutrient solution
when only low concentrations (01mM) were supplied
Barley is an ammonium-sensitive species (Britto and
Kronzucker 2002) We determined that the maximum
level of ammonium that could be added to the nutrient
solution without obvious adverse effect on plant growth
was 04mM with co-provision of ammonium and nitrate
In thornP treatments shoot fresh weights for the 01 and
04mM ammonium treatments were similar (Fig 5A) but
the fresh weight of roots in the 04mM ammonium
treatment was 072 g plantndash1 which was slightly lower
than that of 081 g plantndash1 in the 01mM treatment (Fig 5B)
In contrast plant growth in the P treatment supplied with
either 01 or 04mM ammonium was severely retarded
compared with that of thornP treatment (Fig 5A B) The
growth inhibition in both shoots and roots was similar to
that shown in Fig 1A P concentrations in the shoots
of thornP-treated plants supplemented with either 01 or
04mM ammonium were above the critical levels (Reuter
and Robinson 1997) whereas those in the shoots of
P-treated plants were 12mg P gndash1 DW for the 01mM
ammonium treatment which is equal to that observed
in the severely P-deficient plants in the first experiment
(Fig 1B) but slightly lower (10mg P gndash1 DW) in the
04mM ammonium treatment than that in the 01mM
ammonium treatment (Fig 5C)
The concentrations of all 20 amino acids and GABA
(g-aminobutyric acid) were obtained by LC-MS (Supple-
mentary Table S3) and the results were compared with
those determined by GC-MS (Supplementary Table S2)
The extent of the effect of severe P deficiency on the
concentrations of free amino acids was confirmed by the
LC-MS analysis (Supplementary Table S3) In the shoots
severe P deficiency led to an increase in the concentrations
of half of the amino acids especially glutamine and
asparagine (Supplementary Table S3) and a large reduction
in the concentrations of glutamate and aspartate regardless
of the ammonium concentration (01 or 04mM) (Fig 6A)
The concentrations of glutamine and asparagine also
increased in the roots (Fig 6B) but the concentrations
of some of the abundant amino acids such as alanine
aspartate glutamate and serine were decreased in the
roots irrespective of the rate of ammonium supply
(Supplementary Table S3) The changes in the levels
of amino acids generally agreed with those obtained
by GC-MS in the first experiment (PSD17 Supple-
mentary Table S2) but there were some differences in the
relative levels of some of the amino acids such as
asparagine glutamate proline and phenylalanine between
the two experiments using these two different technologies
696 Metabolite profiles in P-deficient barley plants
(Supplementary Tables S2 S3) These differences in amino
acid levels reflect the differential stabilities of the respective
amino acids to the different derivatization and detection
methodologies
The concentrations of glutamine and asparagine in
both shoots and roots were sensitive to ammonium
supplied They increased from approximately 10 mmol g1
DW in the shoots of the thornP treatment with 01mM
ammonium to 40 mmol g1 DW in the shoots of the thornP
treatment with 04mM ammonium (Fig 6A) In the
severely P-deficient plants the concentrations of glutamine
and asparagine in the shoots rose above 60 mmol g1 DW in
01mM ammonium and above 90 mmol g1 DW in 04mM
ammonium (Fig 6A) A similar magnitude of increase in
the concentrations of glutamine and asparagine was also
observed in the roots of the severely P-deficient plants
(Fig 6B) These results indicate that severe P deficiency
further increases the concentrations of glutamine and
asparagine in both shoots and roots When PthornP ratios
of amino acids in both shoots and roots of the plants treated
with 04mM ammonium were compared with those treated
with 01mM ammonium the high ammonium supply had
little effect on the PthornP ratios of amino acids except for
a reduction in the ratios of glutamine and asparagine and
140
120
100
Fre
sh w
eig
ht
(g p
lan
tminus1)
Fre
sh w
eig
ht
(g p
lan
tminus1)
P c
on
cen
trat
ion
(m
g g
minus1 D
W)
080
060
040
020
0
140minusP
+P120
100
080
060
040
Critical level
020
0
10
8
6
4
2
001 mM 04 mM
A
B
C
Fig 5 Effect of P and ammonium supply on plant growth andP nutrition (A) Fresh weight of shoots (B) Fresh weight of roots(C) P concentration of shoots Barley seedlings grown in a nutrientsolution containing either no NH4H2PO4 (P) or 01mMNH4H2PO4 (thornP) with two rates of ammonium (01 and 04mM)Plants were harvested at the 16th day after seed imbibitionStandard errors (nfrac14 4) are shown as vertical bars
1200Glu
Gln
Asp
Asn
1000
800
600
400
200
0
1200
1000
800
600
400
200
001N+P 04N+P01NminusP 04NminusP
Co
nce
ntr
atio
n (
mg g
minus1 D
W)
Co
nce
ntr
atio
n (
mg g
minus1 D
W)
A
B
Fig 6 Effect of P and ammonium supply on concentrations of fouramino acids (A) Concentrations of four amino acids in shoots(B) Concentrations of four amino acids in roots Barley seedlingsgrown in a nutrient solution containing either no NH4H2PO4 (P)or 01mM NH4H2PO4 (thornP) with two rates of ammonium (01 and04mM) Plants were harvested at the 16th day after seedimbibition The concentrations of amino acids were determinedby LC-MS (see Supplementary Table S3) Standard errors (nfrac14 4) areshown as vertical bars
Metabolite profiles in P-deficient barley plants 697
a couple of other amino acids (Supplementary Table S3)
These results indicate that the effect of severe P deficiency
on the concentrations of free amino acids in both shoots
and roots is largely independent of ammonium supply
In addition the concentrations of both glutamate
and aspartate precursors for synthesis of glutamine and
asparagine were affected by severe P deficiency The con-
centrations of glutamate and aspartate were reduced by
approximately 50 and 25 respectively in the shoots
of P treatments with either 01 or 04mM ammonium
relative to those of thornP treatments (Fig 6A and Supple-
mentary Table S3) The greater reductions in the concen-
trations of glutamate and aspartate were also observed in
the roots of P treatments with two rates of ammonium
supplied compared with those of thornP treatments (Fig 6B
and Supplementary Table S3) Interestingly the high
ammonium supplied did not reduce the concentrations of
glutamate and aspartate either in the shoots or in the roots
of thornP-treated plants (Fig 6A B Supplementary Table S3)
These results suggest that severely P-deficient plants utilize
amino acids as an alternative carbon resource especially in
the roots
Discussion
P deficiency in barley plants results in increases in di- and
trisaccharides and decreases in small P-containing
metabolites
P deficiency initially enhanced the accumulation of
di- and trisaccharides especially for maltose raffinose and
6-kestose in the shoots of the moderately P-deficient plants
(Fig 3) Only maltose increased in the roots (Fig 3
Supplementary Table S1) The transcript levels of HvPht16
(Fig 2) also indicate that roots are less sensitive to P
deficiency Severe P deficiency leads to a further increase in
di- and trisaccharides in both shoots and roots These data
are consistent with previous reports that P deficiency led
to an increase in the levels of starch sucrose and mono-
saccharides in common beans and Arabidopsis (Ciereszko
and Barbachowska 2000 Hernandez et al 2007 Nilsson
et al 2007) and a graminaceous plant Brachiaria hybrid
(Nanamori et al 2004) It also is consistent with the reduced
level of sucrose synthase in P-deficient maize roots (Li et al
2007) The increased levels of mono- di- and polysaccha-
rides suggest that glycolysis may be hindered in both shoots
and roots of P-deficient barley plants In contrast the
cDNA array analyses from lupin and rice suggest that P
deficiency stimulates glycolysis (Uhde-Stone et al 2003
Wasaki et al 2003a) It is conceivable that to maintain
a high level of organic acid secretion in the proteoid roots
of lupin a enhanced level of glycolysis is necessary under
P-deficient conditions (Pearse et al 2006) but it is not clear
why rice did not show enhanced accumulation of di- and
polysaccharides under P-deficient conditions (Nanamori
et al 2004) It appears that metabolic changes in glycolysis
in response to P deficiency differ among plant species
Severe P deficiency depleted inorganic Pi storage pools
as indicated by the sharp reduction of phosphoric acid
in the polar fractions of plant tissues to 510 of
the controls (PDS17thornPDS17 and PDR17thornPDS17
Supplementary Table S2) Under these conditions organic
P is an alternative resource of P for plant cells RNA
phospholipids and small phosphorylated metabolites are
three main classes of compounds containing phosphoesters
Degradation of RNA by increased RNase activity under
Pi-limiting conditions is well documented (Plaxton 2004)
The RNA content in the shoots of severely P-deficient
Arabidopsis plants was reduced to 13 of that in the
P-sufficient plants (Hewitt et al 2005) Considerable
amounts of organic P are present in small phosphorylated
metabolites which is approximately equivalent to that
in RNA or in phospholipids (Bieleski and Ferguson
1983 Doermann and Benning 2002) The levels of
small phosphorylated metabolites including glucose-6-P
fructose-6-P and inositol-1-P were largely reduced in both
shoots and roots of the severely P-deficient plants and the
level of glycerol-3-P in the polar fraction was also sharply
reduced in the shoots of the severely P-deficient plants
(Fig 4) The reduction of phosphorylated sugars was also
observed in bean roots and Arabidopsis under P-deficient
conditions (Rychter and Randall 1994 Morcuende et al
2007) These results indicate that severely P-deficient plants
salvage P from small phosphorylated metabolites for
essential cellular functions These small phosphorylated
metabolites are important intermediates in glycolysis and
synthesis of polysaccharides (glucose-6-P and fructose-6-P)
phospholipids (glycerol-3-P and inositol-1-P) amino acids
and nucleotides and in energy production Thus a depletion
of these phosphorylated metabolites would have a severe
impact not only on carbohydrate and nitrogen metabolism
but also on other metabolic processes
The enhanced accumulation of di- and tri-saccharides
in P-deficient plants can reduce the consumption of Pi in
phosphorylation of sugar metabolites and convert the small
phosphorylated metabolites to non-P-containing di- and
trisaccharides and other compounds such as aromatic
compounds (Figs 3 4) This could be a strategy to reduce
Pi consumption but may also have a benefit in osmotic
protection for stressed plants Increased accumulation of
di- and trisaccharides such as raffinose has been described
in plants exposed to heat stress (Panikulangara et al 2004)
and sulfate deficiency (Nikiforova et al 2005) maltose in
acute temperature stress (Kaplan and Guy 2004) and
6-kestose a precursor for synthesis of fructans under
drought conditions (Hendry 1993 Amiard et al 2003)
However carbohydrate formed as di- and trisaccharides
698 Metabolite profiles in P-deficient barley plants
shown to accumulate in P-deficient plants cannot be utilized
readily for energy metabolism without involvement of Pi
to provide carbon metabolites for the TCA cycle An
alternative storage form of carbon such as organic acids
and amino acids would be preferred for survival of
P-deficient plants (Nanamori et al 2004)
P deficiency reduces organic acids in the TCA cycle
The reduced levels of several organic acids of the TCA
cycle including a-ketoglutarate succinate fumarate and
malate (Fig 4) and the reduction in the concentrations
of glutamate and aspartate especially in the roots of
the severely P-deficient plants (Fig 6B) suggest that the
shortage in carbohydrate supply is more apparent in the
roots than in the shoots of severely P-deficient plants
Reduced levels of fumarate were also observed in
P-deficient Arabidopsis (Misson et al 2005) In addition P
deficiency increases the secretion of organic acids into the
rhizosphere although cereals are weak secretors of organic
acids compared with legumes under low P conditions
(Neumann and Romheld 1999 Pearse et al 2006) The
secretion of organic acids could also contribute to
the reduction of the organic acids in the root tissues The
roots of severely P-deficient plants have to adjust metabolic
processes to utilize possible carbon metabolites such as
amino acids Some of the amino acids could be utilized as
an alternative carbon resource for energy production
reassimilation of the released ammonium and synthesis of
organic acids for secretion Interestingly the levels of several
organic acids in the TCA cycle were also reduced in
the roots of P-deficient common beans (Hernandez et al
2007) As legumes are efficient secretors of organic acids
(Neumann and Romheld 1999 Pearse et al 2006) secretion
could be a significant contributor to the reduced levels of
organic acids in the roots Nevertheless no reduction in
small P-containing metabolites nor organic acids in the
TCA cycle is observed in sulfate-deficient Arabidopsis plants
(Hirai et al 2004 Nikiforova et al 2005) indicating that
the reduction in the organic acids is unique to P-deficient
plant species
Severe P deficiency alters nitrogen metabolism
In P-deficient conditions transcript levels of the
genes coding for enzymes involved in protein degradation
were enhanced and the genes for protein synthesis were
suppressed in both Arabidopsis and common beans
(Wu et al 2003 Misson et al 2005 Hernandez et al
2007) The abundance of proteins related to protein
degradation through the ubiquitinndash26S proteasome path-
way was found to have increased in P-deficient roots of
maize (Li et al 2007) The reduced transcript levels of genes
related to nitrate reduction (Wu et al 2003) and reduced
activities for nitrate reduction have also been described in
P-deficient plants (Gniazdowska and Rychter 2000)
The increased concentrations of total free amino acids in
the shoots of severely P-deficient plants (Supplementary
Table S3) are likely to result from increased protein
degradation and repressed protein synthesis Various
metabolic reactions involved in either synthesis or degrada-
tion of amino acids produce ammonia such as aspara-
gine to aspartate glutamine to glutamate glutamate to
a-ketoglutarate and glycine to serine P deficiency enhances
the transcript levels of alanine aminotransferase genes
in both Arabidopsis and common beans (Wu et al 2003
Hernandez et al 2007) and the protein abundance of
glutamate dehydrogenase and phenylalanine ammonia-
lyase in maize roots (Li et al 2007) A high concentration
of ammonium is harmful to plants especially for barley an
ammonium-sensitive plant (Britto and Kronzucker 2002)
Thus it is critical to avoid excessive accumulation of
ammonium in P-deficient plants The levels of glutamine
and asparagine were elevated in both shoots and roots of
severely P-deficient plants and other metabolites related to
ammonium metabolism including putrescine and tyramine
were also enhanced in the severely P-deficient plants
especially in the roots (Supplementary Table S2) The
increased level of putrescine was also observed in P-deficient
rice cells (Shih and Kao 1996) These data suggest that
deamination of amino acids occurs in the severely
P-deficient plants for utilization in carbon metabolism
and a concomitant increase in assimilation of ammonium
takes place to ensure a reduction in levels of ammonium
The increased activities of glutamate dehydrogenase and
glutamine synthase in Arabidopsis plants (Morcuende et al
2007) and the enhanced protein abundance of root
glutamate dehydrogenase and glutamine synthase observed
in P-deficient maize plants (Li et al 2007) support this
interpretation It is interesting to note that the transcript
levels of glutamate synthase were down-regulated by P
deficiency in rice (Wasaki et al 2003a) Rice is an
ammonium-tolerant species which is in contrast to barley
that is an ammonium-sensitive species (Britto and
Kronzucker 2002) The difference in the metabolite levels
related to ammonium metabolism between P-deficient
barley and rice may be due to this different mechanism of
tolerance to ammonium
The synthesis of glutamine and asparagine requires
a carbon skeleton The enhanced levels of glutamine
and asparagine will require additional molecules of
a-ketoglutarate and oxaloacetate withdrawn from the
TCA cycle leading to a further reduction in the levels
of organic acids and restriction in energy production
in severely P-deficient plants The increased levels of
glutamine asparagine and other metabolites closely
related to ammonium metabolism are also observed in
other nutrient stresses such as nitrogen and sulfate
Metabolite profiles in P-deficient barley plants 699
deficiency (Hirai et al 2004 Nikiforova et al 2005) but
the specific reduction in glutamate and aspartate is
only observed in P-deficient barley plants As synthesis
of glutamine and asparagine can incorporate two ammo-
nium molecules into one organic acid this is a highly
effective ammonium assimilation mechanism under the
carbohydrate-limiting conditions caused by P deficiency
Our metabolite analyses provide indirect evidence that
P-deficient plants are confronted with increased ammonium
To establish a direct link of P deficiency to the increased
accumulation of ammonium in barley tissues further
experiments are required by supplying low concentrations
of ammonium and monitoring ammonium levels in plant
tissues
The increased levels of glycine and serine in the shoots
of the severely P-deficient plants indicate that photorespira-
tion is enhanced in the shoots of the severely P-deficient
plants because glycine and serine are intermediates for
photorespiration (Wingler et al 2000) and the increased
levels of glycine and serine correlate well with the rate of
photorespiration in P-deficient bean plants (Kondracka and
Rychter 1997) Increases in the levels of glycine and serine
were also observed in sulfur-deficient Arabidopsis plants
(Nikiforava et al 2005) indicating that the increase in
photorespiration is a general stress response (Wingler et al
2000)
Carbohydrate partitioning in P-deficient barley differs
from a P-efficient Gramineae grass
P deficiency results in the enhanced accumulation of
di- and trisaccharides and reduced organic acids in barley
plants which generally is similar to rice a P-inefficient
plant (Nanamori et al 2004) A P-efficient grass (Brachiaria
hybrid) is very different from rice in carbohydrate par-
titioning under P-deficient conditions (Nanamori et al
2004) The Brachiaria hybrid can allocate more carbohy-
drates into organic acids and amino acids Maintaining high
activities of phosphoenolpyruvate carboxylase and phos-
phoenolpyruvate phosphatase under the low P condition
appears to be critical for allocating a large proportion of
carbohydrate into organic acids and amino acids Our data
suggest that barley behaves as a P-inefficient plant in
metabolic adaptation to low P environments Thus to
improve P efficiency in barley and perhaps other cereal
crops manipulation of metabolism through a shift in
carbohydrate partitioning could provide a logical strategy
In summary the metabolite profiles generated from
both shoots and roots provide an overview of the metabolic
adjustments that occur in P-deficient barley plants As
illustrated in Fig 7 P-deficient barley plants alter the levels
of many key metabolites which affect various metabolic
pathways including glycolysis photorespiration and
metabolism of nitrogen and phospholipids These adaptive
P inefficiency
P efficiency
ribose
inositol-1-P
glycine(shoots)
serine(shoots)
alanine(shoots)
aspartate
asparagine malate
fumarate
succinate
citrate
a-ketoglutarate
glutamine
glutamate
urea(roots)
glc
glc-6-P
fru
glycerol-3-P
aromaticcompounds
fru-6-P
di- and tri-saccharides
Carbohydratepartitioning
glycerate-3-P
PEP
pyruvate
oxaloacetate
Fig 7 Schematic summary of metabolic adjustments in P-deficient plants and the proposed carbohydrate partitioning for improvementof P efficiency in cereals Thick arrows in green indicate an increase in metabolite levels and thin arrows in red indicate a decreasein metabolite levels The dashed line indicates carbohydrate partitioning for high P efficiency (below the line) and for low P efficiency(above the line)
700 Metabolite profiles in P-deficient barley plants
adjustments reduce Pi consumption by increasing the
levels of di- and trisaccharides and salvage Pi from various
P-containing compounds including small P-containing
metabolites to maintain essential cellular functions An
immediate consequence which is unique to P deficiency is
greatlly reduced levels of the key metabolites in glycolysis
leading to the decrease in carbohydrate supply to the TCA
cycle especially in the roots In addition P-deficient plants
are likely to be confronted with the challenge of increased
ammonium derived from the degradation of protein The
assimilation of the increased ammonium requires additional
organic acids from the TCA cycle which depletes the
organic acid supply further It is noteworthy that although
there are di- and trisaccharides present in the P-deficient
plants they cannot be readily utilized Organic acids and
amino acids are the preferred storage metabolites in
P-deficient plants (Nanamori et al 2004) as they can be
readily utilized as the carbon resource by P-deficient plants
Therefore if barley (and other cereals) are to be engineered
to be better adapted to growth in P-deficient soils there
is a need to shift the partitioning of carbohydrate from
di- and tri-saccharides to organic acids and amino acids
Investigating the expression of genes (transcriptome) and
proteins (proteome) in barley under P-deficient conditions
would provide additional evidence to support this strategy
for enhancing the P efficiency
Materials and Methods
Plant materials
Barley (H vulgare L cv Lofty Nijo) seeds were surface-sterilized with 70 ethanol for 1min and 3 hypochlorite for5min rinsed with deionized water and incubated in Petri dishes for2 d at room temperature Two seeds with an emerged radicle wereput into a seedling cup which was placed in the lid of a black plasticcontainer Each container contained either four seedling cups fortwo harvests or two seedling cups for one harvest and were filledwith 1 liter of nutrient solution The basal nutrients were as follows(in mM) Ca(NO3)2 1000 KNO3 1000 MgSO4 250 KCl 50H3BO3 125 Fe-HEDTA 10 MnSO4 04 CuSO4 01 ZnSO405 NiSO4 01 and MoO3 01 with NH4H2PO4 100 (thornPtreatment) or without NH4H2PO4 (P treatment) To balanceNH4 ions added in the thornP treatment 100 mM NH4NO3 was addedinto the nutrient solution of the P treatment In the additionalexperiment with two levels of ammonium either 100 or 400 mMNH4NO3 was added in the thornP treatment and either nil or 300 mMNH4NO3 was added in the P treatment All treatments werereplicated four times Half-strength nutrient solution was useduntil the 10th day after seed imbibition for the plants harvested atday 10 and day 17 but the eighth day for the plants harvestedat day 16 Full strength was applied thereafter The full-strengthnutrient solution was replaced at day 14 for the plants harvested atday 17 but at day 12 for the plants harvested at day 16 The pH ofthe nutrient solution was adjusted to 60 with 1M KOH and thesolution was aerated continuously
Plants were grown in a controlled environment at 208Cday158C night with a photoperiod regime of 14 h day10 h nightat 300 mmolm2 sndash1 photon flux intensity at the plant level At each
harvest two seedling cups were removed from each containerPlants were collected in 5ndash6 h of the light period to eliminatediurnal changes in metabolite levels The roots of plants from oneseedling cup were rinsed briefly in deionized water excess waterwas blotted on fresh laboratory tissues and the roots and shootswere separated and oven-dried at 658C for 48 h The dry plantsamples were used for mineral element analysis by inductivelycoupled plasma spectrophotometry (Zarcinas et al 1987) Anothercup of plants was separated into roots and shoots frozenimmediately in liquid nitrogen and stored at 808C for metaboliteand transcript analyses
Real-time quantitative RTndashPCR
Shoots and roots of three replicates from each P treatmentwere used for transcript analysis Total RNA was prepared usingTrizol reagent according to the manufacturerrsquos instructions(Invitrogen Carlsbad CA USA) Total RNA was treated withDNase I using the DNA free kit (Ambion Austin TX USA) toremove any contaminating genomic DNA and then RNA integritywas checked on an agarose gel cDNA was prepared from 2mg oftotal RNA using SuperScriptTM III reverse transcriptase accord-ing to the manufacturerrsquos instructions (Invitrogen) The reactionwas incubated at 508C for 45min and at 708C for 15min toinactivate the enzyme
The transcript levels of HvIPS1 and HvPht16 weredetermined by real-time quantitative PCR essentially as describedby Burton et al (2004) The transcript levels of three control genes(barley a-tubulin heat shock protein 70 and cyclophilin) weredetermined and used for normalization Normalization was carriedout as described by Vandesompele et al (2002) and Burtonet al (2004) The normalized copies mg RNA1 are presentedThe primers 50 GCGGCGACTTCTCACCTCTACTAAG and50 CGAAGGATTCAAACAGGATCACACA (GenBank acces-sion No BI780234) were used for amplification of HvIPS1 and50 GGTCAAGAACTCGCTATTCATCC and 50 CCATACATCCATCCAAACCTG (GenBank accession No AF543198) foramplification of HvPht16
Analysis of metabolites with GC-MS
Metabolite analysis was carried out by a GC-MS-basedmethod modified from Roessner et al (2006) Fresh tissues of rootsand shoots from barley plants were homogenized using a mortarand pestle with liquid nitrogen Frozen tissue powder (100 10mgexact fresh weight was recorded) was extracted with methanol(350 ml) A polar internal standard (20 ml of 02mgmlndash1 ribitol inwater) and a non-polar internal standard (30 ml of 2mgmlndash1
nonadecanoic acid methylester in chloroform) were subsequentlyadded as quantification standards The mixture was extracted for15min at 708C and then mixed vigorously with 1 vol of waterIn order to separate polar and non-polar metabolites 300 ml ofchloroform was added to the mixture and centrifuged at 2200gfor 10min The upper methanolwater phase was collected andwashed with chloroform (300 ml) The polar phase of shoot extracts(100 ml) and root extracts (250 ml) was separately dried undervacuum Both lipid layers were combined and dried under vacuumIn order to methylate fatty acids the residues of the non-polarfractions were further incubated with chloroform (100 ml) andacidified methanol (300 ml of 125N HCl in methanol) for 24 h at508C and afterwards dried under vacuum The dry polar residuewas redissolved and derivatized for 120min at 378C in methox-yamine hydrochloride (40 ml of 20mgml1 in pyridine) followedby a 30min treatment with N-methyl-N-[trimethylsilyl] trifluoro-acetamide (MSTFA) (70 ml) at 378C The dry non-polar residue
Metabolite profiles in P-deficient barley plants 701
was derivatized for 60min at 378C in pyridine (70 ml) and MSTFA(40 ml) To both a retention time standard mixture [10 ml of 0029(vv) n-dodecane n-pentadecane n-nonadecane n-docosanen-octacosane n-dotracontane n-hexatriacontane dissolved inpyridine] was added prior to trimethylsilylation Sample volumesof 1ml were then injected using the splitless mode onto a GCcolumn using a hot needle technique
The GC-MS system and conditions were as described inRoessner et al (2006) Acquired total ion chromatograms andmass spectra were evaluated using the Xcalibur program(ThermoFinnigan Manchester UK) and the resulting data areprepared normalized and presented as described by Roessner et al(2001) Mass spectra of eluting compounds were identified usingthe commercial mass spectra library NIST (httpwwwnistgov)and the public domain mass spectra library of the Max-Planck-Institute for Plant Physiology Golm Germany (httpcsbdbmpimp-golmmpgdecsbdbdbmamsrihtml) All matchingmass spectra were additionally co-verified by determination of theretention time and mass spectra by analysis of authentic standardsubstances
Analysis of free amino acids with LC-MS
Leaf material (15mg) was accurately weighed intoEppendorf tubes (2ml) and a solution of EDTA (400 ml 5mM)was added to each sample The samples were sonicated for15min then heated in a water bath (808C 15min) centrifuged(14500 rpm 5min) and the supernatant derivatized Thederivatization of the amino acids is based on a procedure outlinedby Cohen and Michaud (1993) and involved mixing the super-natant obtained above (20 ml) with borate buffer (200 ml 02MpH 88) followed by the addition of 10mM 6-aminoquinolyl-N-hydroxysuccinimidyl carbamate solution (50 ml) in dry aceto-nitrile The reaction mixture was then heated at 558C in a waterbath for 10min and analyzed by LC-MS as described by Callahanet al (2007)
The LC-MS system comprised a Surveyor LC PumpSurveyor Auto Sampler and LCQ Deca XP Max ion trapMS (Thermo Finnigan USA) The ESI (electron spray ionization)source was optimized by infusing a derivatized amino acidstandard in line with the mobile phase then tuning the sourceconditions and ion optics to optimize the signals for the derivatizedamino acids This resulted in the following conditions sheath gas30 arbitrary units auxiliary gas 10 arbitrary units spray voltage30 kV capillary temperature 2508C capillary voltage 56V andtube lens 53V
Derivatized amino acids were eluted on an Altantis dC18150 21mm 3mm (Waters Melbourne Australia) HPLC columnusing a three-step gradient of deionized water (01 formic acid)and acetonitrile (01 formic acid) at a flow rate of 025mlminndash1
and a column temperature of 308C (Callahan et al 2007)
Statistical analysis
Students t-test at P 005 was applied for the means (nfrac14 4) ofmetabolites presented in Supplementary Tables S1ndashS3 Statisticalanalyses were carried using the Pirouette 311 software (InfometrixInc Woodinville WA USA)
Supplementary material
Supplementary material mentioned in the article is avail-able to online subscribers at the journal website wwwpcpoxfordjournalsorg
Funding
The Grains Research and Development Corporation
the Australian Research Council the South Australian
Government the University of Adelaide and the University
of Melbourne to the Australian Center for Plant Functional
Genomics (CYH UR NS PL AB) the Molecular
Plant Breeding CRC to YG Metabolomics Australia to
(UR DC AB)
Acknowledgments
We are grateful to M Tester for discussion and to T Fowlesand L Palmer for ICP analysis
References
Amiard V Morvan-Bertrand A Billard JP Huault C Keller F andPrudrsquohomme MP (2003) Fructans but not the sucrosyl-galactosidesraffinose and loliose are affected by drought stress in perennial ryegrassPlant Physiol 132 2218ndash29
Bieleski RL and Ferguson IB (1983) Physiology and metabolism ofphosphate and its compounds In Encyclopedia of Plant PhysiologyEdited by Lauchli A and Bieleski RL Vol 15a pp 422ndash449 SpringerVerlag Berlin
Bolling C and Fiehn O (2005) Metabolite profiling of Chlamydomonasreinhardtii under nutrient deprivation Plant Physiol 139 1995ndash2005
Britto DT and Kronzucker HJ (2002) NH4thorn toxicity in higher plants
a critical review J Plant Physiol 159 567ndash584Burleigh SH and Harrison MJ (1997) A novel gene whose expression in
Medicago truncatula roots is suppressed in response to colonization byvesicularndasharbuscular mycorrhizal (VAM) fungi and to phosphatenutrition Plant Mol Biol 34 199ndash208
Burton RA Shirley NJ King BJ Harvey AJ and Fincher GB(2004) The CesA gene family of barley Quantitative analysis oftranscripts reveals two groups of co-expressed genes Plant Physiol134 224ndash236
Callahan DL Kolev SD OrsquoHair RAJ Salt DE and Baker AJM(2007) Relationships between nicotianamine and other amino acids withnickel zinc and iron in Thlaspi hyperaccumulators New Phytol 176836ndash848
Ciereszko I and Barbachowska A (2000) Sucrose metabolism in leavesand roots of bean (Phaseolus vulgaris L) during phosphate deficiencyJ Plant Physiol 156 640ndash644
Cohen SA and Michaud DP (1993) Synthesis of a fluorescentderivatizing reagent 6-aminoquinolyl-N-hydroxysuccinimidyl carba-mate and its application for the analysis of hydrolysate amino acidsvia high-performance liquid chromatography Anal Biochem 211279ndash287
Cruz-Ramirez A Oropeza-Aburto A Razo-Hernandez F Ramirez-Chavez E and Herrera-Estrella L (2006) Phospholipase DZ2 playsan important role in extraplastidic galactolipid biosynthesis andphosphate recycling in Arabidopsis roots Proc Natl Acad Sci USA103 6765ndash6770
Doermann P and Benning C (2002) Galactolipids rule in seed plantsTrends Plant Sci 7 112ndash118
Gniazdowska A and Rychter AM (2000) Nitrate uptake by bean(Phaseolus vulgaris L) roots under phosphate deficiency Plant Soil 22679ndash85
Hendry GAF (1993) Evolutionary origins and natural functions offructansmdasha climatological biogeographic and mechanistic appraisalNew Phytol 123 3ndash14
Hernandez G Ramirez M Valdes-Lopez O Tesfaye MGraham MA et al (2007) Phosphorus stress in common bean roottranscript and metabolic responses Plant Physiol 144 752ndash767
702 Metabolite profiles in P-deficient barley plants
Hewitt MM Carr JM Williamson CL and Slocum RD (2005)Effects of phosphate limitation on expression of genes involved in
pyrimidine synthesis and salvaging in Arabidopsis Plant Physiol
Biochem 43 91ndash99Hirai MY Yano M Goodenowe DB Kanaya S Kimura T
Awazuhara M Arita M Fujiwara T and Saito K (2004) Integration
of transcriptomics and metabolomics for understanding of global
responses to nutritional stresses in Arabidopsis thaliana Proc Natl
Acad Sci USA 101 10205ndash10210Hou XL Wu P Jiao FC Jia QJ Chen HM Yu J Song XW
and Yi KK (2005) Regulation of the expression of OsIPS1 and OsIPS2in rice via systemic and local Pi signaling and hormones Plant Cell
Environ 28 353ndash364Jeschke WD Kirkby EA Peuke AD Pate JS and Hartung W
(1997) Effects of P deficiency on assimilation and transport of nitrate andphosphate in intact plants of castor bean (Ricinus communis L) J Exp
Bot 48 75ndash91Kaplan F and Guy CL (2004) Beta-amylase induction and the protective
role of maltose during temperature shock Plant Physiol 135 1674ndash1684Kondracka A and Rychter AM (1997) The role of Pi recycling processes
during photosynthesis in phosphate-deficient bean plants J Exp Bot 48
1461ndash1468Kopka J (2006) Current challenges and developments in GC-MS based
metabolite profiling technology J Biotechnol 124 312ndash322Li K Xu C Zhang K Yang A and Zhang J (2007) Proteomic
analysis of roots growth and metabolic changes under phosphorus deficitin maize (Zea mays L) plants Proteomics 7 1501ndash1512
Liu CM Muchhal US and Raghothama KG (1997) Differential
expression of TPS11 a phosphate starvation-induced gene in tomatoPlant Mol Biol 33 867ndash874
Martin AC del Pozo JC Inglesias J Rubio V Solano Rde la Pena A Leyva A and Paz-Ares J (2000) Influence of cytokinins
on the expression of phosphate starvation responsive genes inArabidopsis Plant J 24 559ndash567
Mimura T (1999) Regulation of phosphate transport and homeostasis inplant cells Int Rev Cytol Cell Biol 191 149ndash200
Misson J Raghothama KG Jain A Jouhet J Block MA et al
(2005) A genome-wide transcriptional analysis using Arabidopsis thaliana
Affymetrix gene chips determined plant responses to phosphate depriva-
tion Proc Natl Acad Sci USA 102 11934ndash11939Morcuende R Bari R Gibon Y Zheng WM Pant BD Blasing O
Usadel B Czechowski T Udvardi MK Stitt M and Scheible WR(2007) Genome-wide reprogramming of metabolism and regulatory
networks of Arabidopsis in response to phosphorus Plant Cell Environ
30 85ndash112Muchhal US and Raghothama KG (1999) Transcriptional regulation of
plant phosphate transporters Proc Natl Acad Sci USA 96 5868ndash72Nanamori M Shinano T Wasaki J Yamamura T Rao IM and
Osaki M (2004) Low phosphorus tolerance mechanisms phosphorus
recycling and photosynthate partitioning in the tropical forage grassBrachiaria hybrid cultivar mulato compared with rice Plant Cell Environ
45 460ndash469Neumann G and Romheld V (1999) Root excretion of carboxylic acids
and protons in phosphorus-deficient plants Plant Soil 211 121ndash130Nikiforova VJ Gakiere B Kempa S Adamik M Willmitzer L
Hesse H and Hoefgen R (2004) Towards dissecting nutrient
metabolism in plants a systems biology case study on sulphur
metabolism J Exp Bot 55 1861ndash1870Nikiforova VJ Kopka J Tolstikov V Fiehn O Hopkins L
Hawkesford MJ Hesse H and Hoefgen R (2005) Systems rebalan-
cing of metabolism in response to sulfur deprivation as revealed bymetabolome analysis of Arabidopsis plants Plant Physiol 138 304ndash318
Nilsson L Muller R and Nielsen TH (2007) Increased expression of theMYB-related transcription factor PHR1 leads to enhanced phosphate
uptake in Arabidopsis thaliana Plant Cell Environ 30 1499ndash1512
Panikulangara TJ Eggers-Schumacher G Wunderlich M Stransky Hand Schoffl F (2004) Galactinol synthase 1 A novel heat shock factortarget gene responsible for heat-induced synthesis of raffinose familyoligosaccharides in Arabidopsis Plant Physiol 136 3148ndash3158
Pearse SJ Veneklaas EJ Cawthray G Bolland MDA andLambers H (2006) Triticum aestivum shows a greater biomass responseto a supply of aluminium phosphate than Lupinus albus despite releasingfewer carboxylates into the rhizosphere New Phytol 169 515ndash524
Plaxton WC (2004) Plant response to stress biochemical adaptations tophosphate deficiency In Encyclopedia of Plant and Crop Science Editedby Goodman R pp 976ndash980 Marcel Dekker Inc New York
Plaxton WC and Carswell MC (1999) Metabolic aspects of thephosphate starvation response in plants In Plant Response toEnvironmental Stresses From Photohormones to GenomeReorganization Edited by Lerner HR pp 349ndash372 Marcel DekkerInc New York
Rae AL Cybinski DH Jarmey JM and Smith FW (2003)Characterization of two phosphate transporters from barley evidencefor diverse function and kinetic properties among members of the Pht1family Plant Mol Biol 53 27ndash36
Raghothama KG (1999) Phosphate acquisition Annu Rev Plant PhysiolPlant Mol Biol 50 665ndash693
Reuter DJ and Robinson JB (1997) Plant Analysis An InterpretationManual 2nd edn pp 86ndash92 CSIRO Australia Melbourne
Roessner U Luedemann A Brust D Fiehn O Linke TWillmitzer L and Fernie AR (2001) Metabolic profiling allowscomprehensive phenotyping of genetically or environmentally modifiedplant systems Plant Cell 13 11ndash29
Roessner U Patterson JH Forbes MG Fincher GB Langridge Pand Bacic A (2006) An investigation of boron toxicity in barley usingmetabolomics Plant Physiol 142 1087ndash1101
Rychter AM and Randall DD (1994) The effect of phosphate deficiencyon carbohydrate metabolism in bean roots Physiol Plant 91 383ndash388
Schachtman DP Reid RJ and Ayling SM (1998) Phosphorus uptakeby plants from soil to cell Plant Physiol 116 447ndash453
Shih CY and Kao CH (1996) Growth inhibition in suspension-culturedrice cells under phosphate deprivation is mediated through putrescineaccumulation Plant Physiol 111 721ndash724
Uhde-Stone C Zinn KE Ramirez-Yanez M Li AG Vance CP andAllan DL (2003) Nylon filter arrays reveal differential gene expressionin proteoid roots of white lupin in response to phosphorus deficiencyPlant Physiol 131 1064ndash1079
Vance CP Uhde-Stone C and Allan DL (2003) Phosphorus acquisitionand use critical adaptations by plants for securing a non renewableresource New Phytol 157 423ndash447
Vandesompele J De Preter K Pattyn F Poppe B Van Roy NDe Paepe A and Speleman F (2002) Accurate normalization of real-time quantitative RTPCR data by geometric averaging of multipleinternal control genes Genome Biol 3 1ndash11
Wasaki J Yonetani R Kuroda S Shinano T Yazaki J et al (2003a)Transcriptomic analysis of metabolic changes by phosphorus stress in riceplant roots Plant Cell Environ 26 1515ndash1523
Wasaki J Yonetani R Shinano T Kai M and Osaki M (2003b)Expression of the OsPI1 gene cloned from rice roots using cDNAmicroarray rapidly responds to phosphorus status New Phytol 158239ndash248
Wingler A Lea PJ Quick WP and Leegood RC (2000)Photorespiration metabolic pathways and their role in stress protectionPhilos Trans R Soc B Biol Sci 355 1517ndash1529
Wu P Ma L Hou X Wang M Wu Y Liu F and Deng XW (2003)Phosphate starvation triggers distinct alterations of genome expression inArabidopsis roots and leaves Plant Physiol 132 1260ndash1271
Zarcinas BA Cartwright B and Spouncer LR (1987) Nitric aciddigestion and multi-element analysis of plant material by induc-tively coupled plasma spectrometry Commun Soil Sci Plant Anal 18131ndash146
(Received February 21 2008 Accepted March 13 2008)
Metabolite profiles in P-deficient barley plants 703
synthesize more Pi transporter proteins in the plasma
membrane of root epidermal cells for higher Pi uptake
capacity (Muchhal and Raghothama 1999) Transcriptomic
analyses in Arabidopsis rice and lupin have shown that
coordinated changes in the expression of several hundred
genes take place in P-deficient plants (Uhde-Stone et al
2003 Wasaki et al 2003a Wu et al 2003 Mission et al
2005 Morcuende et al 2007) These genes are involved in
various metabolic pathways such as photosynthesis carbon
metabolism nitrogen assimilation and synthesis of protein
and nucleic acids (Wu et al 2003 Misson et al 2005
Morcuende et al 2007) which could lead to adaptive
changes in metabolite profiles
Recent advances in analytical technologies such as gas
and liquid chromatography coupled to mass spectrometry
(GC-MS and LC-MS) have allowed the analysis of a large
number of compounds from a single plant sample (for a
review see Kopka 2006) Such metabolite profiles provide
not only a much broader view for a systematic adjustment
in metabolic processes than conventional biochemical
approaches but also an opportunity to reveal new insights
on metabolism Metabolite profiling with GC-MS has been
used for studies on nutrient deficiency including nitrogen
sulfate iron and P in a single-cell green alga (Bolling and
Fiehn 2005) and in higher plants such as Arabidopsis and
common beans (Hirai et al 2004 Nikiforova et al 2005
Hernandez et al 2007) A combination of transcriptomic
and metabolite analyses has also been made to increase
further our understanding of plant responses to various
environmental stresses such as sulfate and nitrogen (Hirai
et al 2004 Nikiforova et al 2004 Nikiforova et al 2005)
and P deficiency in Arabidopsis and common beans
(Hernandez et al 2007 Morcuende et al 2007) Despite
the agronomic importance of cereals such as wheat and
barley little information is available for metabolite changes
in response to P deficiency As Pi homeostasis is regulated
at the whole-plant level by translocating Pi from mature to
young tissues and from shoots to roots under Pi-limiting
conditions (Jeschke et al 1997 Mimura 1999) it is
necessary to determine alterations in both shoots and
roots to increase our understanding of the biochemical
mechanisms involved in whole-plant adaptation to the low
Pi environment
In this report barley (Hordeum vulgare L) was used as
a model plant for cereal crops We measured approximately
100 metabolites from both shoots and roots of mildly or
severely P-deficient barley plants using a recently developed
GC-MS method (Roessner et al 2006) Metabolite profiles
reveal distinct changes in carbon and nitrogen metabolism
in P-deficient barley plants leading to accumulation of
di- and trisaccharides and free amino acids The distinct
metabolite profiles suggested that the severely P-deficient
barley plants are confronted with an increased level of
ammonium Thus the effect of severe P deficiency on
ammonium metabolism was further investigated through
quantitative analysis of amino acid profiles using LC-MS
(Callahan et al 2007) Our results provide new insights
into the effects of P deficiency on carbon and nitrogen
metabolism in barley plants
Results
Plant responses to short- and long-term P starvation in
growth and P nutrition
Barley seedlings were grown from seeds for different
time periods in a nutrient solution either with no added
NH4H2PO4 (P) or with 01mM NH4H2PO4 (thornP control)
to obtain plants with different P status At the 10th day
after seed imbibition (day 10) shoot development was
similar in the two P treatments with both having a fully
expanded first leaf and a small second leaf There were no
apparent P deficiency symptoms in the shoots of P-treated
plants although a change in root appearance was evident
Shorter primary roots and more lateral roots were observed
in the P treatment Plant growth measured on a FW basis
was significantly different between P and thornP treatments
at day 10 (Fig 1A) but there was no difference in DW
between P and thornP treatments at day 10 (data not shown)
The P concentration of shoots in the P-treated plants was
26mg P gndash1 DW (Fig 1B) which was below the critical
P concentration of 4mg P gndash1 DW (Reuter and Robinson
1997) The concentration of P in the roots was 32mg gndash1
DW (Fig 1B) In contrast the P concentration in the
thornP-treated plants was adequate at day 10 (Fig 1B) The
P-treated plants at day 10 suffered from mild P deficiency
and henceforth were referred to as mildly P-deficient plants
Plant growth was severely retarded when the plants
were grown in the P treatment for an additional 7 d
(Fig 1A day 17) There were two small fully expanded
leaves with the third leaf emerging in the P-treated plants
whereas there were three large fully expanded leaves in the
thornP-treated plants The seminal roots of the P-treated
plants were much shorter than those in the thornP-treated
plants P concentrations in the P-treated plants further
declined to 12mg P gndash1 DW in shoots and 20mg P gndash1 DW
in roots at day 17 (Fig 1B) Therefore the P-treated
plants at day 17 were inferred to be severely P-deficient
plants in this study
Expression of HvIPS1 and HvPht16 in P-deficient plants
The TPSI1At4 genes are sensitive to P deficiency and
widely used as a molecular indicator for P deficiency
(Burleigh and Harrison 1997 Liu et al 1997 Martin et al
2000 Wasaki et al 2003b Hou et al 2005) HvIPS1 is a
barley homolog of the TPSI1At4 genes (Hou et al 2005)
and HvPht16 is a low-affinity Pi transporter of barley
692 Metabolite profiles in P-deficient barley plants
(Rae et al 2003) Both HvIPS1 and HvPht16 are sensitive
to P deficiency and are highly expressed in both shoots
and roots of Lofty Nijo barley plants The transcript levels
of HvIPS1 and HvPht16 therefore were determined by
quantitative real-time PCR to monitor the response of both
shoots and roots to P deficiency As shown in Fig 2A a low
level of HvIPS1 (12 106 normalized copies mg1 RNA)
was detected in the shoots of thornP-treated plants at day 10
but a 277-fold increase (343 106 normalized copies mg1
RNA) was observed in the shoots of the P-treated plants
The enhanced expression of HvPht16 (32-fold increase)
was also observed in the shoots of P-treated plants at day
10 compared with that in the shoots of thornP-treated plants
(Fig 2A) In contrast a 415-fold increase in the transcript
level of HvIPS1 was observed in the roots of P-treated
plants (Fig 2B) which was similar to the enhanced level
in the shoots (Fig 2A) However no difference in the
HvPht16 transcript level was found in the roots receiving
the two P treatments at day 10 (Fig 2B) suggesting that the
shoots of barley plants are more sensitive to P deficiency
than the roots Severe P deficiency sharply increased the
transcript levels of HvIPS1 and HvPht16 in both shoots
and roots at day 17 (Fig 2)
Metabolite profiles of shoots and roots in mildly P-deficient
plants
A GC-MS-based method developed by Roessner et al
(2006) was used for the analysis of polar metabolites from
barley plants More than 400 compounds were detected
in barley plants subjected to both thornP and P treatments
1800A
B
1600
1400
1200
1000
800
600
400
200
0
1800
1600
1400
1200
1000
800
600
400
200
0
No
rmal
ized
co
pie
s mg
minus1 R
NA
(times1
06 )N
orm
aliz
ed c
op
ies
mgminus1
RN
A (
times106 ) minus P
+ P
HvIPS1 HvPht16Day 10 Day 17
HvIPS1 HvPht16
Fig 2 Effect of P supply on transcript levels of HvIPS1 andHvPht16 in shoots (A) and roots (B) of barley seedlings Barleyseedlings were grown in a nutrient solution with 01mMNH4H2PO4
(thornP) or without NH4H2PO4 addition (P) The levels of transcriptsare presented as normalized copies per mg RNA Plants wereharvested at the 10th day after seed imbibition (day 10) and at the17th day (day 17) Standard errors (nfrac14 3) are shown as vertical bars
140A
B
120
100
080
060
040
020
0
10
8
6
4
2
0
Fre
sh w
eig
ht
(g p
lan
tminus1)
P c
on
cen
trat
ion
s (m
g g
minus1 D
W)
Shoots Roots
minusP
+P
minusP
+P
Criticallevel
Day 10 Day 17 Day 10 Day 17
Fig 1 Effect of P supply on plant growth and P nutrition (A) Freshweight of shoots and roots (B) P concentration in shoots and rootsBarley seedlings were grown in a nutrient solution with 01mMNH4H2PO4 (thornP) or without NH4H2PO4 addition (P) Plantswere harvested at the 10th day after seed imbibition (day 10)and at the 17th day (day 17) Standard errors (nfrac14 4) are shown asvertical bars
Metabolite profiles in P-deficient barley plants 693
of which approximately 130 compounds could be assigned a
chemical structure A total of 98 metabolites were identified
as known compounds including 23 amino acids 15 organic
acids 25 sugars and 35 non-polar compounds (Supplemen-
tary Tables S1 S2) Metabolite levels from both shoots and
roots and the ratios of PthornP are presented in Supplemen-
tary Table S1 for the mildly P-deficient plants at day 10
and in Supplementary Table S2 for the severely P-deficient
plants at day 17
The PthornP ratios for metabolite levels for mildly
P-deficient plants are summarized in Fig 3 The levels
of approximately half of the sugars analyzed were
significantly increased in the shoots of the mildly
P-deficient plants (PSD10 Supplementary Table S1)
A significant increase in the levels of di- and trisaccharides
(sucrose 11-fold maltose 27-fold raffinose 42-fold and
6-kestose 119-fold) and one aromatic compound (shiki-
mate 22-fold) was observed (Fig 3) Little change in
amino acids and organic acids was observed in the shoots
of the mildly P-deficient plants (PSD10 Supplementary
Table S1) In contrast only a few metabolites were
significantly changed in the roots of mildly P-deficient
plants compared with thornP-treated roots (PRD10
Supplementary Table S1 Fig 3) One sugar maltose rose
to 15-fold in the roots (PthornPRD10 Supplementary
Table S1) The Pi level in the polar fraction of mildly
P-deficient plants was not significantly affected either in
shoots or in roots (phosphoric acid in the polar fraction
of Supplementary Table S1) These results indicate that the
metabolites involved in sugar metabolism are more sensitive
di- and tri-saccharides
raffinose(419plusmn017)312plusmn041
sucrose(114plusmn008)159plusmn011
glc(144plusmn004)070plusmn011
shikimate(222plusmn014)161plusmn018
fru(120plusmn008)079plusmn011
glycerol(103plusmn006)115plusmn011
6-kestose(1186plusmn020)
292plusmn037
maltose(269plusmn016)149plusmn006
ribose(128plusmn012)052plusmn012
inositol-1-P(097plusmn010)103plusmn039
glycine(103plusmn006)091plusmn012
serine(089plusmn004)121plusmn016
gly-6-P(082plusmn009)112plusmn027
glycerol-3-P(030plusmn048)197plusmn052
tryptophan(117plusmn017)396plusmn075
fru-6-P(073plusmn008)127plusmn025
inositol(136plusmn005)117plusmn007
b-alanine(148plusmn007)105plusmn015
alanine(088plusmn006)193plusmn037
asparagine(115plusmn010)079plusmn012
succinate(125plusmn010)104plusmn003
fumarate(073plusmn009)086plusmn003
aspartate(084plusmn008)209plusmn017
malate (115plusmn005)275plusmn018
citrate (131plusmn023)173plusmn026
glutamate(486plusmn032)1258plusmn097
a-ketoglutarate(101plusmn009)118plusmn021
urea(106plusmn008)128plusmn008
lipids
fructanstarch
glycerate-3-P
PEP
pyruvate
oxaloacetate
aromatic compounds
Fig 3 Effect of P supply on the levels of primary polar metabolites from shoots and roots of 10-day-old plants Barley seedlings weregrown in a nutrient solution with 01mM NH4H2PO4 (thornP) or without NH4H2PO4 addition (P) and harvested at the 10th day after seedimbibition A simplified metabolic pathway is used to show the levels of the primary metabolites determined by GC-MS The metabolitesmeasured by GC-MS are shown in bold and undetermined metabolites in a regular font Relative ratios (PthornP) of metabolites in theshoots (in parentheses) and roots (no parentheses) are presented as means SE (nfrac14 4) Significant differences (P 005) in the ratiosbetween the P and thornP treatments are indicated in green for the increased ratios and in red for the reduced ratios
694 Metabolite profiles in P-deficient barley plants
to mild P deficiency than others such as amino acids and
organic acids In addition it is obvious that shoots are more
responsive than roots to mild P deficiency
Metabolite profiles of shoots and roots in severely P-deficient
plants
The ratios (PthornP) of a wide spectrum of polar
metabolites were altered in 17-day-old P-deficient plants
(Supplementary Table S2) The elevated levels of di- and
trisaccharides remained in the shoots of severely P-deficient
plants (Fig 3) and more changes in di- and trisaccharides
including maltose (27-fold) sucrose (1374-fold) raffinose
(72-fold) and 6-kestose (70-fold) occurred in the roots
(Fig 4) Although the ratio of sucrose (PthornP) in the roots
of 17-day-old plants was extremely high the level of sucrose
(183) in the roots of the severely P-deficient plants
(Supplementary Table S2) was only slightly lower than
that (231) in the mildly P-deficient plants (Supplementary
Table S1) The extremely high ratio of sucrose in the roots
of the severely P-deficient plants is mainly due to the largely
reduced level of sucrose (01) in thornP-treated roots at day 17
(Fig 4 and Supplementary Table S2) In addition a large
increase in shikimate (120-fold) was observed in the roots
Ribose was the only monosaccharide which was reduced
03- to 06-fold in both shoots and roots of severely
P-deficient plants The levels of other monosaccharides
were either unaffected or increased (Fig 4) However Pi
levels in the polar fraction of the severely P-deficient plants
were sharply reduced to approximately 10 of those in
thornP-treated plants (phosphoric acid in the polar fraction of
di- and tri-saccharidesraffinose(335plusmn008)721plusmn012
glc(113plusmn004)095plusmn019
shikimate(199plusmn019)1204plusmn003
fru(151plusmn005)137plusmn010
inositol(116plusmn007)119plusmn005
serine(267plusmn009)125plusmn011
glycine(906plusmn002)157plusmn011
glc-6-P(014plusmn012)007plusmn010
fru-6-P(011plusmn005)008plusmn012
glyserol-3-P(015plusmn029)088plusmn008
inositol-1-P(040plusmn012)026plusmn024
glycerol(088plusmn004)198plusmn008
ribose(061plusmn020)030plusmn008
tryptophan(5454plusmn042)
ndb-alanine(083plusmn005)038plusmn007
alanine(296plusmn007)064plusmn011
asparagine(194plusmn024)295plusmn016
succinate(082plusmn005)068plusmn005
fumarate(082plusmn003)054plusmn007
aspartate(085plusmn005)051plusmn022
malate (074plusmn003)073plusmn019
citrate (122plusmn020)139plusmn007
glutamate(148plusmn016)243plusmn006
a-ketoglutarate(036plusmn015)075plusmn015
urea(nd)
3315plusmn009
sucrose(114plusmn005)13741plusmn007
6-kestose(1248plusmn009)
695plusmn014
maltose(612plusmn020)273plusmn008
fructan
lipids
starch
glycerate-3-P
PEP
pyruvate
oxaloacetate
aromatic compounds
Fig 4 Effect of P supply on the levels of primary polar metabolites from shoots and roots of 17-day-old plants Barley seedlings weregrown in a nutrient solution with 01mM NH4H2PO4 (thornPi) or without NH4H2PO4 addition (P) harvested at day 17 after seed imbibitionand separated into shoots and roots A metabolic pathway is used to show the levels of the primary metabolites determined by GC-MS Themetabolites measured by GC-MS are shown in bold and undetermined metabolites in a regular font Relative ratios (PthornP) of metabolitein the shoots (in parentheses) and roots (no parentheses) are presented as means SE (nfrac14 4) Significant differences (P 005) in the ratiosbetween the P and thornP treatments are indicated in green for the increased ratios and in red for the reduced ratios
Metabolite profiles in P-deficient barley plants 695
Supplementary Table S2) and the concomitant reduction in
phosphorylated sugars including glucose-6-P fructose-6-P
glycerol-3-P and inositol-1-P was also observed in both
shoots and roots of the severely P-deficient plants at day 17
(Fig 4 and Supplementary Table S2) The levels of seve-
ral organic acids of the TCA cycle were also reduced in
the severely P-deficient plants including a-ketoglutarate(04-fold) and malate (07-fold) in the shoots and succinic
acid (07-fold) and fumaric acid (05-fold) in the roots
(Fig 4)
There were hardly any changes in the levels of amino
acids in both shoots and roots of the mildly P-deficient
plants when compared with thornP-treated plants (Supplemen-
tary Table S1) but the levels of two-thirds of the amino
acids were increased in the shoots of the severely P-deficient
plants (PSD17 Supplementary Table S2) In addition
the polyamine putrescine was increased in shoots (PSD17
Supplementary Table S2) Similarly dramatic changes in
the levels of the amino acids and metabolites related to
ammonium metabolism were also observed in the roots of
severely P-deficient plants There was an increase in the
levels of asparagine (30-fold) glutamate (24-fold) and
putrescine (23-fold) in the roots of the severely P-deficient
plants as well as a sharp increase in the level of urea up to
332-fold in roots (Fig 4) This high ratio of the urea level
was due to the combination of an increase of urea (25-fold)
in the roots of the severely P-deficient plants (PRD17
Supplementary Table S2) compared with that of the mildly
P-deficient plants (PRD10 Supplementary Table S1)
and a reduction of the urea level from 08 in the roots of
thornP-treated plants at day 10 (thornPRD10 Supplementary
Table S1) to 01 at day 17 (thornPRD17 Supplementary
Table S2) These data should be viewed cautiously as the
quantification of urea by GC-MS can be unreliable so an
alternative approach would need to be utilized to explore
this effect further Furthermore the level of aspartate in the
roots of the severely P-deficient plants was reduced to
05-fold (Fig 4) The significant change in the metabolites
related to ammonium assimilation suggests that the severe
P deficiency increases levels of ammonium leading to
alterations in ammonium assimilation
Effect of severe P deficiency on the concentrations of free
amino acids
The observations described above led us to conduct
an additional experiment to determine the effect of severe P
deficiency on amino acid metabolism Absolute concentra-
tions of free amino acids were determined using LC-MS to
complement the data obtained by GC-MS In the additional
experiment the nutrient solutions were supplemented with
two levels of ammonium (01 and 04mM) The low
ammonium treatment (01mM) was the same as that used
for plant growth in the first experiment (Fig 1) The high
ammonium treatment (04mM) is designed to investigate
the effect of external ammonium supply on the accumula-
tion of free amino acids in P-deficient plants and to prevent
possible depletion of ammonium in the nutrient solution
when only low concentrations (01mM) were supplied
Barley is an ammonium-sensitive species (Britto and
Kronzucker 2002) We determined that the maximum
level of ammonium that could be added to the nutrient
solution without obvious adverse effect on plant growth
was 04mM with co-provision of ammonium and nitrate
In thornP treatments shoot fresh weights for the 01 and
04mM ammonium treatments were similar (Fig 5A) but
the fresh weight of roots in the 04mM ammonium
treatment was 072 g plantndash1 which was slightly lower
than that of 081 g plantndash1 in the 01mM treatment (Fig 5B)
In contrast plant growth in the P treatment supplied with
either 01 or 04mM ammonium was severely retarded
compared with that of thornP treatment (Fig 5A B) The
growth inhibition in both shoots and roots was similar to
that shown in Fig 1A P concentrations in the shoots
of thornP-treated plants supplemented with either 01 or
04mM ammonium were above the critical levels (Reuter
and Robinson 1997) whereas those in the shoots of
P-treated plants were 12mg P gndash1 DW for the 01mM
ammonium treatment which is equal to that observed
in the severely P-deficient plants in the first experiment
(Fig 1B) but slightly lower (10mg P gndash1 DW) in the
04mM ammonium treatment than that in the 01mM
ammonium treatment (Fig 5C)
The concentrations of all 20 amino acids and GABA
(g-aminobutyric acid) were obtained by LC-MS (Supple-
mentary Table S3) and the results were compared with
those determined by GC-MS (Supplementary Table S2)
The extent of the effect of severe P deficiency on the
concentrations of free amino acids was confirmed by the
LC-MS analysis (Supplementary Table S3) In the shoots
severe P deficiency led to an increase in the concentrations
of half of the amino acids especially glutamine and
asparagine (Supplementary Table S3) and a large reduction
in the concentrations of glutamate and aspartate regardless
of the ammonium concentration (01 or 04mM) (Fig 6A)
The concentrations of glutamine and asparagine also
increased in the roots (Fig 6B) but the concentrations
of some of the abundant amino acids such as alanine
aspartate glutamate and serine were decreased in the
roots irrespective of the rate of ammonium supply
(Supplementary Table S3) The changes in the levels
of amino acids generally agreed with those obtained
by GC-MS in the first experiment (PSD17 Supple-
mentary Table S2) but there were some differences in the
relative levels of some of the amino acids such as
asparagine glutamate proline and phenylalanine between
the two experiments using these two different technologies
696 Metabolite profiles in P-deficient barley plants
(Supplementary Tables S2 S3) These differences in amino
acid levels reflect the differential stabilities of the respective
amino acids to the different derivatization and detection
methodologies
The concentrations of glutamine and asparagine in
both shoots and roots were sensitive to ammonium
supplied They increased from approximately 10 mmol g1
DW in the shoots of the thornP treatment with 01mM
ammonium to 40 mmol g1 DW in the shoots of the thornP
treatment with 04mM ammonium (Fig 6A) In the
severely P-deficient plants the concentrations of glutamine
and asparagine in the shoots rose above 60 mmol g1 DW in
01mM ammonium and above 90 mmol g1 DW in 04mM
ammonium (Fig 6A) A similar magnitude of increase in
the concentrations of glutamine and asparagine was also
observed in the roots of the severely P-deficient plants
(Fig 6B) These results indicate that severe P deficiency
further increases the concentrations of glutamine and
asparagine in both shoots and roots When PthornP ratios
of amino acids in both shoots and roots of the plants treated
with 04mM ammonium were compared with those treated
with 01mM ammonium the high ammonium supply had
little effect on the PthornP ratios of amino acids except for
a reduction in the ratios of glutamine and asparagine and
140
120
100
Fre
sh w
eig
ht
(g p
lan
tminus1)
Fre
sh w
eig
ht
(g p
lan
tminus1)
P c
on
cen
trat
ion
(m
g g
minus1 D
W)
080
060
040
020
0
140minusP
+P120
100
080
060
040
Critical level
020
0
10
8
6
4
2
001 mM 04 mM
A
B
C
Fig 5 Effect of P and ammonium supply on plant growth andP nutrition (A) Fresh weight of shoots (B) Fresh weight of roots(C) P concentration of shoots Barley seedlings grown in a nutrientsolution containing either no NH4H2PO4 (P) or 01mMNH4H2PO4 (thornP) with two rates of ammonium (01 and 04mM)Plants were harvested at the 16th day after seed imbibitionStandard errors (nfrac14 4) are shown as vertical bars
1200Glu
Gln
Asp
Asn
1000
800
600
400
200
0
1200
1000
800
600
400
200
001N+P 04N+P01NminusP 04NminusP
Co
nce
ntr
atio
n (
mg g
minus1 D
W)
Co
nce
ntr
atio
n (
mg g
minus1 D
W)
A
B
Fig 6 Effect of P and ammonium supply on concentrations of fouramino acids (A) Concentrations of four amino acids in shoots(B) Concentrations of four amino acids in roots Barley seedlingsgrown in a nutrient solution containing either no NH4H2PO4 (P)or 01mM NH4H2PO4 (thornP) with two rates of ammonium (01 and04mM) Plants were harvested at the 16th day after seedimbibition The concentrations of amino acids were determinedby LC-MS (see Supplementary Table S3) Standard errors (nfrac14 4) areshown as vertical bars
Metabolite profiles in P-deficient barley plants 697
a couple of other amino acids (Supplementary Table S3)
These results indicate that the effect of severe P deficiency
on the concentrations of free amino acids in both shoots
and roots is largely independent of ammonium supply
In addition the concentrations of both glutamate
and aspartate precursors for synthesis of glutamine and
asparagine were affected by severe P deficiency The con-
centrations of glutamate and aspartate were reduced by
approximately 50 and 25 respectively in the shoots
of P treatments with either 01 or 04mM ammonium
relative to those of thornP treatments (Fig 6A and Supple-
mentary Table S3) The greater reductions in the concen-
trations of glutamate and aspartate were also observed in
the roots of P treatments with two rates of ammonium
supplied compared with those of thornP treatments (Fig 6B
and Supplementary Table S3) Interestingly the high
ammonium supplied did not reduce the concentrations of
glutamate and aspartate either in the shoots or in the roots
of thornP-treated plants (Fig 6A B Supplementary Table S3)
These results suggest that severely P-deficient plants utilize
amino acids as an alternative carbon resource especially in
the roots
Discussion
P deficiency in barley plants results in increases in di- and
trisaccharides and decreases in small P-containing
metabolites
P deficiency initially enhanced the accumulation of
di- and trisaccharides especially for maltose raffinose and
6-kestose in the shoots of the moderately P-deficient plants
(Fig 3) Only maltose increased in the roots (Fig 3
Supplementary Table S1) The transcript levels of HvPht16
(Fig 2) also indicate that roots are less sensitive to P
deficiency Severe P deficiency leads to a further increase in
di- and trisaccharides in both shoots and roots These data
are consistent with previous reports that P deficiency led
to an increase in the levels of starch sucrose and mono-
saccharides in common beans and Arabidopsis (Ciereszko
and Barbachowska 2000 Hernandez et al 2007 Nilsson
et al 2007) and a graminaceous plant Brachiaria hybrid
(Nanamori et al 2004) It also is consistent with the reduced
level of sucrose synthase in P-deficient maize roots (Li et al
2007) The increased levels of mono- di- and polysaccha-
rides suggest that glycolysis may be hindered in both shoots
and roots of P-deficient barley plants In contrast the
cDNA array analyses from lupin and rice suggest that P
deficiency stimulates glycolysis (Uhde-Stone et al 2003
Wasaki et al 2003a) It is conceivable that to maintain
a high level of organic acid secretion in the proteoid roots
of lupin a enhanced level of glycolysis is necessary under
P-deficient conditions (Pearse et al 2006) but it is not clear
why rice did not show enhanced accumulation of di- and
polysaccharides under P-deficient conditions (Nanamori
et al 2004) It appears that metabolic changes in glycolysis
in response to P deficiency differ among plant species
Severe P deficiency depleted inorganic Pi storage pools
as indicated by the sharp reduction of phosphoric acid
in the polar fractions of plant tissues to 510 of
the controls (PDS17thornPDS17 and PDR17thornPDS17
Supplementary Table S2) Under these conditions organic
P is an alternative resource of P for plant cells RNA
phospholipids and small phosphorylated metabolites are
three main classes of compounds containing phosphoesters
Degradation of RNA by increased RNase activity under
Pi-limiting conditions is well documented (Plaxton 2004)
The RNA content in the shoots of severely P-deficient
Arabidopsis plants was reduced to 13 of that in the
P-sufficient plants (Hewitt et al 2005) Considerable
amounts of organic P are present in small phosphorylated
metabolites which is approximately equivalent to that
in RNA or in phospholipids (Bieleski and Ferguson
1983 Doermann and Benning 2002) The levels of
small phosphorylated metabolites including glucose-6-P
fructose-6-P and inositol-1-P were largely reduced in both
shoots and roots of the severely P-deficient plants and the
level of glycerol-3-P in the polar fraction was also sharply
reduced in the shoots of the severely P-deficient plants
(Fig 4) The reduction of phosphorylated sugars was also
observed in bean roots and Arabidopsis under P-deficient
conditions (Rychter and Randall 1994 Morcuende et al
2007) These results indicate that severely P-deficient plants
salvage P from small phosphorylated metabolites for
essential cellular functions These small phosphorylated
metabolites are important intermediates in glycolysis and
synthesis of polysaccharides (glucose-6-P and fructose-6-P)
phospholipids (glycerol-3-P and inositol-1-P) amino acids
and nucleotides and in energy production Thus a depletion
of these phosphorylated metabolites would have a severe
impact not only on carbohydrate and nitrogen metabolism
but also on other metabolic processes
The enhanced accumulation of di- and tri-saccharides
in P-deficient plants can reduce the consumption of Pi in
phosphorylation of sugar metabolites and convert the small
phosphorylated metabolites to non-P-containing di- and
trisaccharides and other compounds such as aromatic
compounds (Figs 3 4) This could be a strategy to reduce
Pi consumption but may also have a benefit in osmotic
protection for stressed plants Increased accumulation of
di- and trisaccharides such as raffinose has been described
in plants exposed to heat stress (Panikulangara et al 2004)
and sulfate deficiency (Nikiforova et al 2005) maltose in
acute temperature stress (Kaplan and Guy 2004) and
6-kestose a precursor for synthesis of fructans under
drought conditions (Hendry 1993 Amiard et al 2003)
However carbohydrate formed as di- and trisaccharides
698 Metabolite profiles in P-deficient barley plants
shown to accumulate in P-deficient plants cannot be utilized
readily for energy metabolism without involvement of Pi
to provide carbon metabolites for the TCA cycle An
alternative storage form of carbon such as organic acids
and amino acids would be preferred for survival of
P-deficient plants (Nanamori et al 2004)
P deficiency reduces organic acids in the TCA cycle
The reduced levels of several organic acids of the TCA
cycle including a-ketoglutarate succinate fumarate and
malate (Fig 4) and the reduction in the concentrations
of glutamate and aspartate especially in the roots of
the severely P-deficient plants (Fig 6B) suggest that the
shortage in carbohydrate supply is more apparent in the
roots than in the shoots of severely P-deficient plants
Reduced levels of fumarate were also observed in
P-deficient Arabidopsis (Misson et al 2005) In addition P
deficiency increases the secretion of organic acids into the
rhizosphere although cereals are weak secretors of organic
acids compared with legumes under low P conditions
(Neumann and Romheld 1999 Pearse et al 2006) The
secretion of organic acids could also contribute to
the reduction of the organic acids in the root tissues The
roots of severely P-deficient plants have to adjust metabolic
processes to utilize possible carbon metabolites such as
amino acids Some of the amino acids could be utilized as
an alternative carbon resource for energy production
reassimilation of the released ammonium and synthesis of
organic acids for secretion Interestingly the levels of several
organic acids in the TCA cycle were also reduced in
the roots of P-deficient common beans (Hernandez et al
2007) As legumes are efficient secretors of organic acids
(Neumann and Romheld 1999 Pearse et al 2006) secretion
could be a significant contributor to the reduced levels of
organic acids in the roots Nevertheless no reduction in
small P-containing metabolites nor organic acids in the
TCA cycle is observed in sulfate-deficient Arabidopsis plants
(Hirai et al 2004 Nikiforova et al 2005) indicating that
the reduction in the organic acids is unique to P-deficient
plant species
Severe P deficiency alters nitrogen metabolism
In P-deficient conditions transcript levels of the
genes coding for enzymes involved in protein degradation
were enhanced and the genes for protein synthesis were
suppressed in both Arabidopsis and common beans
(Wu et al 2003 Misson et al 2005 Hernandez et al
2007) The abundance of proteins related to protein
degradation through the ubiquitinndash26S proteasome path-
way was found to have increased in P-deficient roots of
maize (Li et al 2007) The reduced transcript levels of genes
related to nitrate reduction (Wu et al 2003) and reduced
activities for nitrate reduction have also been described in
P-deficient plants (Gniazdowska and Rychter 2000)
The increased concentrations of total free amino acids in
the shoots of severely P-deficient plants (Supplementary
Table S3) are likely to result from increased protein
degradation and repressed protein synthesis Various
metabolic reactions involved in either synthesis or degrada-
tion of amino acids produce ammonia such as aspara-
gine to aspartate glutamine to glutamate glutamate to
a-ketoglutarate and glycine to serine P deficiency enhances
the transcript levels of alanine aminotransferase genes
in both Arabidopsis and common beans (Wu et al 2003
Hernandez et al 2007) and the protein abundance of
glutamate dehydrogenase and phenylalanine ammonia-
lyase in maize roots (Li et al 2007) A high concentration
of ammonium is harmful to plants especially for barley an
ammonium-sensitive plant (Britto and Kronzucker 2002)
Thus it is critical to avoid excessive accumulation of
ammonium in P-deficient plants The levels of glutamine
and asparagine were elevated in both shoots and roots of
severely P-deficient plants and other metabolites related to
ammonium metabolism including putrescine and tyramine
were also enhanced in the severely P-deficient plants
especially in the roots (Supplementary Table S2) The
increased level of putrescine was also observed in P-deficient
rice cells (Shih and Kao 1996) These data suggest that
deamination of amino acids occurs in the severely
P-deficient plants for utilization in carbon metabolism
and a concomitant increase in assimilation of ammonium
takes place to ensure a reduction in levels of ammonium
The increased activities of glutamate dehydrogenase and
glutamine synthase in Arabidopsis plants (Morcuende et al
2007) and the enhanced protein abundance of root
glutamate dehydrogenase and glutamine synthase observed
in P-deficient maize plants (Li et al 2007) support this
interpretation It is interesting to note that the transcript
levels of glutamate synthase were down-regulated by P
deficiency in rice (Wasaki et al 2003a) Rice is an
ammonium-tolerant species which is in contrast to barley
that is an ammonium-sensitive species (Britto and
Kronzucker 2002) The difference in the metabolite levels
related to ammonium metabolism between P-deficient
barley and rice may be due to this different mechanism of
tolerance to ammonium
The synthesis of glutamine and asparagine requires
a carbon skeleton The enhanced levels of glutamine
and asparagine will require additional molecules of
a-ketoglutarate and oxaloacetate withdrawn from the
TCA cycle leading to a further reduction in the levels
of organic acids and restriction in energy production
in severely P-deficient plants The increased levels of
glutamine asparagine and other metabolites closely
related to ammonium metabolism are also observed in
other nutrient stresses such as nitrogen and sulfate
Metabolite profiles in P-deficient barley plants 699
deficiency (Hirai et al 2004 Nikiforova et al 2005) but
the specific reduction in glutamate and aspartate is
only observed in P-deficient barley plants As synthesis
of glutamine and asparagine can incorporate two ammo-
nium molecules into one organic acid this is a highly
effective ammonium assimilation mechanism under the
carbohydrate-limiting conditions caused by P deficiency
Our metabolite analyses provide indirect evidence that
P-deficient plants are confronted with increased ammonium
To establish a direct link of P deficiency to the increased
accumulation of ammonium in barley tissues further
experiments are required by supplying low concentrations
of ammonium and monitoring ammonium levels in plant
tissues
The increased levels of glycine and serine in the shoots
of the severely P-deficient plants indicate that photorespira-
tion is enhanced in the shoots of the severely P-deficient
plants because glycine and serine are intermediates for
photorespiration (Wingler et al 2000) and the increased
levels of glycine and serine correlate well with the rate of
photorespiration in P-deficient bean plants (Kondracka and
Rychter 1997) Increases in the levels of glycine and serine
were also observed in sulfur-deficient Arabidopsis plants
(Nikiforava et al 2005) indicating that the increase in
photorespiration is a general stress response (Wingler et al
2000)
Carbohydrate partitioning in P-deficient barley differs
from a P-efficient Gramineae grass
P deficiency results in the enhanced accumulation of
di- and trisaccharides and reduced organic acids in barley
plants which generally is similar to rice a P-inefficient
plant (Nanamori et al 2004) A P-efficient grass (Brachiaria
hybrid) is very different from rice in carbohydrate par-
titioning under P-deficient conditions (Nanamori et al
2004) The Brachiaria hybrid can allocate more carbohy-
drates into organic acids and amino acids Maintaining high
activities of phosphoenolpyruvate carboxylase and phos-
phoenolpyruvate phosphatase under the low P condition
appears to be critical for allocating a large proportion of
carbohydrate into organic acids and amino acids Our data
suggest that barley behaves as a P-inefficient plant in
metabolic adaptation to low P environments Thus to
improve P efficiency in barley and perhaps other cereal
crops manipulation of metabolism through a shift in
carbohydrate partitioning could provide a logical strategy
In summary the metabolite profiles generated from
both shoots and roots provide an overview of the metabolic
adjustments that occur in P-deficient barley plants As
illustrated in Fig 7 P-deficient barley plants alter the levels
of many key metabolites which affect various metabolic
pathways including glycolysis photorespiration and
metabolism of nitrogen and phospholipids These adaptive
P inefficiency
P efficiency
ribose
inositol-1-P
glycine(shoots)
serine(shoots)
alanine(shoots)
aspartate
asparagine malate
fumarate
succinate
citrate
a-ketoglutarate
glutamine
glutamate
urea(roots)
glc
glc-6-P
fru
glycerol-3-P
aromaticcompounds
fru-6-P
di- and tri-saccharides
Carbohydratepartitioning
glycerate-3-P
PEP
pyruvate
oxaloacetate
Fig 7 Schematic summary of metabolic adjustments in P-deficient plants and the proposed carbohydrate partitioning for improvementof P efficiency in cereals Thick arrows in green indicate an increase in metabolite levels and thin arrows in red indicate a decreasein metabolite levels The dashed line indicates carbohydrate partitioning for high P efficiency (below the line) and for low P efficiency(above the line)
700 Metabolite profiles in P-deficient barley plants
adjustments reduce Pi consumption by increasing the
levels of di- and trisaccharides and salvage Pi from various
P-containing compounds including small P-containing
metabolites to maintain essential cellular functions An
immediate consequence which is unique to P deficiency is
greatlly reduced levels of the key metabolites in glycolysis
leading to the decrease in carbohydrate supply to the TCA
cycle especially in the roots In addition P-deficient plants
are likely to be confronted with the challenge of increased
ammonium derived from the degradation of protein The
assimilation of the increased ammonium requires additional
organic acids from the TCA cycle which depletes the
organic acid supply further It is noteworthy that although
there are di- and trisaccharides present in the P-deficient
plants they cannot be readily utilized Organic acids and
amino acids are the preferred storage metabolites in
P-deficient plants (Nanamori et al 2004) as they can be
readily utilized as the carbon resource by P-deficient plants
Therefore if barley (and other cereals) are to be engineered
to be better adapted to growth in P-deficient soils there
is a need to shift the partitioning of carbohydrate from
di- and tri-saccharides to organic acids and amino acids
Investigating the expression of genes (transcriptome) and
proteins (proteome) in barley under P-deficient conditions
would provide additional evidence to support this strategy
for enhancing the P efficiency
Materials and Methods
Plant materials
Barley (H vulgare L cv Lofty Nijo) seeds were surface-sterilized with 70 ethanol for 1min and 3 hypochlorite for5min rinsed with deionized water and incubated in Petri dishes for2 d at room temperature Two seeds with an emerged radicle wereput into a seedling cup which was placed in the lid of a black plasticcontainer Each container contained either four seedling cups fortwo harvests or two seedling cups for one harvest and were filledwith 1 liter of nutrient solution The basal nutrients were as follows(in mM) Ca(NO3)2 1000 KNO3 1000 MgSO4 250 KCl 50H3BO3 125 Fe-HEDTA 10 MnSO4 04 CuSO4 01 ZnSO405 NiSO4 01 and MoO3 01 with NH4H2PO4 100 (thornPtreatment) or without NH4H2PO4 (P treatment) To balanceNH4 ions added in the thornP treatment 100 mM NH4NO3 was addedinto the nutrient solution of the P treatment In the additionalexperiment with two levels of ammonium either 100 or 400 mMNH4NO3 was added in the thornP treatment and either nil or 300 mMNH4NO3 was added in the P treatment All treatments werereplicated four times Half-strength nutrient solution was useduntil the 10th day after seed imbibition for the plants harvested atday 10 and day 17 but the eighth day for the plants harvestedat day 16 Full strength was applied thereafter The full-strengthnutrient solution was replaced at day 14 for the plants harvested atday 17 but at day 12 for the plants harvested at day 16 The pH ofthe nutrient solution was adjusted to 60 with 1M KOH and thesolution was aerated continuously
Plants were grown in a controlled environment at 208Cday158C night with a photoperiod regime of 14 h day10 h nightat 300 mmolm2 sndash1 photon flux intensity at the plant level At each
harvest two seedling cups were removed from each containerPlants were collected in 5ndash6 h of the light period to eliminatediurnal changes in metabolite levels The roots of plants from oneseedling cup were rinsed briefly in deionized water excess waterwas blotted on fresh laboratory tissues and the roots and shootswere separated and oven-dried at 658C for 48 h The dry plantsamples were used for mineral element analysis by inductivelycoupled plasma spectrophotometry (Zarcinas et al 1987) Anothercup of plants was separated into roots and shoots frozenimmediately in liquid nitrogen and stored at 808C for metaboliteand transcript analyses
Real-time quantitative RTndashPCR
Shoots and roots of three replicates from each P treatmentwere used for transcript analysis Total RNA was prepared usingTrizol reagent according to the manufacturerrsquos instructions(Invitrogen Carlsbad CA USA) Total RNA was treated withDNase I using the DNA free kit (Ambion Austin TX USA) toremove any contaminating genomic DNA and then RNA integritywas checked on an agarose gel cDNA was prepared from 2mg oftotal RNA using SuperScriptTM III reverse transcriptase accord-ing to the manufacturerrsquos instructions (Invitrogen) The reactionwas incubated at 508C for 45min and at 708C for 15min toinactivate the enzyme
The transcript levels of HvIPS1 and HvPht16 weredetermined by real-time quantitative PCR essentially as describedby Burton et al (2004) The transcript levels of three control genes(barley a-tubulin heat shock protein 70 and cyclophilin) weredetermined and used for normalization Normalization was carriedout as described by Vandesompele et al (2002) and Burtonet al (2004) The normalized copies mg RNA1 are presentedThe primers 50 GCGGCGACTTCTCACCTCTACTAAG and50 CGAAGGATTCAAACAGGATCACACA (GenBank acces-sion No BI780234) were used for amplification of HvIPS1 and50 GGTCAAGAACTCGCTATTCATCC and 50 CCATACATCCATCCAAACCTG (GenBank accession No AF543198) foramplification of HvPht16
Analysis of metabolites with GC-MS
Metabolite analysis was carried out by a GC-MS-basedmethod modified from Roessner et al (2006) Fresh tissues of rootsand shoots from barley plants were homogenized using a mortarand pestle with liquid nitrogen Frozen tissue powder (100 10mgexact fresh weight was recorded) was extracted with methanol(350 ml) A polar internal standard (20 ml of 02mgmlndash1 ribitol inwater) and a non-polar internal standard (30 ml of 2mgmlndash1
nonadecanoic acid methylester in chloroform) were subsequentlyadded as quantification standards The mixture was extracted for15min at 708C and then mixed vigorously with 1 vol of waterIn order to separate polar and non-polar metabolites 300 ml ofchloroform was added to the mixture and centrifuged at 2200gfor 10min The upper methanolwater phase was collected andwashed with chloroform (300 ml) The polar phase of shoot extracts(100 ml) and root extracts (250 ml) was separately dried undervacuum Both lipid layers were combined and dried under vacuumIn order to methylate fatty acids the residues of the non-polarfractions were further incubated with chloroform (100 ml) andacidified methanol (300 ml of 125N HCl in methanol) for 24 h at508C and afterwards dried under vacuum The dry polar residuewas redissolved and derivatized for 120min at 378C in methox-yamine hydrochloride (40 ml of 20mgml1 in pyridine) followedby a 30min treatment with N-methyl-N-[trimethylsilyl] trifluoro-acetamide (MSTFA) (70 ml) at 378C The dry non-polar residue
Metabolite profiles in P-deficient barley plants 701
was derivatized for 60min at 378C in pyridine (70 ml) and MSTFA(40 ml) To both a retention time standard mixture [10 ml of 0029(vv) n-dodecane n-pentadecane n-nonadecane n-docosanen-octacosane n-dotracontane n-hexatriacontane dissolved inpyridine] was added prior to trimethylsilylation Sample volumesof 1ml were then injected using the splitless mode onto a GCcolumn using a hot needle technique
The GC-MS system and conditions were as described inRoessner et al (2006) Acquired total ion chromatograms andmass spectra were evaluated using the Xcalibur program(ThermoFinnigan Manchester UK) and the resulting data areprepared normalized and presented as described by Roessner et al(2001) Mass spectra of eluting compounds were identified usingthe commercial mass spectra library NIST (httpwwwnistgov)and the public domain mass spectra library of the Max-Planck-Institute for Plant Physiology Golm Germany (httpcsbdbmpimp-golmmpgdecsbdbdbmamsrihtml) All matchingmass spectra were additionally co-verified by determination of theretention time and mass spectra by analysis of authentic standardsubstances
Analysis of free amino acids with LC-MS
Leaf material (15mg) was accurately weighed intoEppendorf tubes (2ml) and a solution of EDTA (400 ml 5mM)was added to each sample The samples were sonicated for15min then heated in a water bath (808C 15min) centrifuged(14500 rpm 5min) and the supernatant derivatized Thederivatization of the amino acids is based on a procedure outlinedby Cohen and Michaud (1993) and involved mixing the super-natant obtained above (20 ml) with borate buffer (200 ml 02MpH 88) followed by the addition of 10mM 6-aminoquinolyl-N-hydroxysuccinimidyl carbamate solution (50 ml) in dry aceto-nitrile The reaction mixture was then heated at 558C in a waterbath for 10min and analyzed by LC-MS as described by Callahanet al (2007)
The LC-MS system comprised a Surveyor LC PumpSurveyor Auto Sampler and LCQ Deca XP Max ion trapMS (Thermo Finnigan USA) The ESI (electron spray ionization)source was optimized by infusing a derivatized amino acidstandard in line with the mobile phase then tuning the sourceconditions and ion optics to optimize the signals for the derivatizedamino acids This resulted in the following conditions sheath gas30 arbitrary units auxiliary gas 10 arbitrary units spray voltage30 kV capillary temperature 2508C capillary voltage 56V andtube lens 53V
Derivatized amino acids were eluted on an Altantis dC18150 21mm 3mm (Waters Melbourne Australia) HPLC columnusing a three-step gradient of deionized water (01 formic acid)and acetonitrile (01 formic acid) at a flow rate of 025mlminndash1
and a column temperature of 308C (Callahan et al 2007)
Statistical analysis
Students t-test at P 005 was applied for the means (nfrac14 4) ofmetabolites presented in Supplementary Tables S1ndashS3 Statisticalanalyses were carried using the Pirouette 311 software (InfometrixInc Woodinville WA USA)
Supplementary material
Supplementary material mentioned in the article is avail-able to online subscribers at the journal website wwwpcpoxfordjournalsorg
Funding
The Grains Research and Development Corporation
the Australian Research Council the South Australian
Government the University of Adelaide and the University
of Melbourne to the Australian Center for Plant Functional
Genomics (CYH UR NS PL AB) the Molecular
Plant Breeding CRC to YG Metabolomics Australia to
(UR DC AB)
Acknowledgments
We are grateful to M Tester for discussion and to T Fowlesand L Palmer for ICP analysis
References
Amiard V Morvan-Bertrand A Billard JP Huault C Keller F andPrudrsquohomme MP (2003) Fructans but not the sucrosyl-galactosidesraffinose and loliose are affected by drought stress in perennial ryegrassPlant Physiol 132 2218ndash29
Bieleski RL and Ferguson IB (1983) Physiology and metabolism ofphosphate and its compounds In Encyclopedia of Plant PhysiologyEdited by Lauchli A and Bieleski RL Vol 15a pp 422ndash449 SpringerVerlag Berlin
Bolling C and Fiehn O (2005) Metabolite profiling of Chlamydomonasreinhardtii under nutrient deprivation Plant Physiol 139 1995ndash2005
Britto DT and Kronzucker HJ (2002) NH4thorn toxicity in higher plants
a critical review J Plant Physiol 159 567ndash584Burleigh SH and Harrison MJ (1997) A novel gene whose expression in
Medicago truncatula roots is suppressed in response to colonization byvesicularndasharbuscular mycorrhizal (VAM) fungi and to phosphatenutrition Plant Mol Biol 34 199ndash208
Burton RA Shirley NJ King BJ Harvey AJ and Fincher GB(2004) The CesA gene family of barley Quantitative analysis oftranscripts reveals two groups of co-expressed genes Plant Physiol134 224ndash236
Callahan DL Kolev SD OrsquoHair RAJ Salt DE and Baker AJM(2007) Relationships between nicotianamine and other amino acids withnickel zinc and iron in Thlaspi hyperaccumulators New Phytol 176836ndash848
Ciereszko I and Barbachowska A (2000) Sucrose metabolism in leavesand roots of bean (Phaseolus vulgaris L) during phosphate deficiencyJ Plant Physiol 156 640ndash644
Cohen SA and Michaud DP (1993) Synthesis of a fluorescentderivatizing reagent 6-aminoquinolyl-N-hydroxysuccinimidyl carba-mate and its application for the analysis of hydrolysate amino acidsvia high-performance liquid chromatography Anal Biochem 211279ndash287
Cruz-Ramirez A Oropeza-Aburto A Razo-Hernandez F Ramirez-Chavez E and Herrera-Estrella L (2006) Phospholipase DZ2 playsan important role in extraplastidic galactolipid biosynthesis andphosphate recycling in Arabidopsis roots Proc Natl Acad Sci USA103 6765ndash6770
Doermann P and Benning C (2002) Galactolipids rule in seed plantsTrends Plant Sci 7 112ndash118
Gniazdowska A and Rychter AM (2000) Nitrate uptake by bean(Phaseolus vulgaris L) roots under phosphate deficiency Plant Soil 22679ndash85
Hendry GAF (1993) Evolutionary origins and natural functions offructansmdasha climatological biogeographic and mechanistic appraisalNew Phytol 123 3ndash14
Hernandez G Ramirez M Valdes-Lopez O Tesfaye MGraham MA et al (2007) Phosphorus stress in common bean roottranscript and metabolic responses Plant Physiol 144 752ndash767
702 Metabolite profiles in P-deficient barley plants
Hewitt MM Carr JM Williamson CL and Slocum RD (2005)Effects of phosphate limitation on expression of genes involved in
pyrimidine synthesis and salvaging in Arabidopsis Plant Physiol
Biochem 43 91ndash99Hirai MY Yano M Goodenowe DB Kanaya S Kimura T
Awazuhara M Arita M Fujiwara T and Saito K (2004) Integration
of transcriptomics and metabolomics for understanding of global
responses to nutritional stresses in Arabidopsis thaliana Proc Natl
Acad Sci USA 101 10205ndash10210Hou XL Wu P Jiao FC Jia QJ Chen HM Yu J Song XW
and Yi KK (2005) Regulation of the expression of OsIPS1 and OsIPS2in rice via systemic and local Pi signaling and hormones Plant Cell
Environ 28 353ndash364Jeschke WD Kirkby EA Peuke AD Pate JS and Hartung W
(1997) Effects of P deficiency on assimilation and transport of nitrate andphosphate in intact plants of castor bean (Ricinus communis L) J Exp
Bot 48 75ndash91Kaplan F and Guy CL (2004) Beta-amylase induction and the protective
role of maltose during temperature shock Plant Physiol 135 1674ndash1684Kondracka A and Rychter AM (1997) The role of Pi recycling processes
during photosynthesis in phosphate-deficient bean plants J Exp Bot 48
1461ndash1468Kopka J (2006) Current challenges and developments in GC-MS based
metabolite profiling technology J Biotechnol 124 312ndash322Li K Xu C Zhang K Yang A and Zhang J (2007) Proteomic
analysis of roots growth and metabolic changes under phosphorus deficitin maize (Zea mays L) plants Proteomics 7 1501ndash1512
Liu CM Muchhal US and Raghothama KG (1997) Differential
expression of TPS11 a phosphate starvation-induced gene in tomatoPlant Mol Biol 33 867ndash874
Martin AC del Pozo JC Inglesias J Rubio V Solano Rde la Pena A Leyva A and Paz-Ares J (2000) Influence of cytokinins
on the expression of phosphate starvation responsive genes inArabidopsis Plant J 24 559ndash567
Mimura T (1999) Regulation of phosphate transport and homeostasis inplant cells Int Rev Cytol Cell Biol 191 149ndash200
Misson J Raghothama KG Jain A Jouhet J Block MA et al
(2005) A genome-wide transcriptional analysis using Arabidopsis thaliana
Affymetrix gene chips determined plant responses to phosphate depriva-
tion Proc Natl Acad Sci USA 102 11934ndash11939Morcuende R Bari R Gibon Y Zheng WM Pant BD Blasing O
Usadel B Czechowski T Udvardi MK Stitt M and Scheible WR(2007) Genome-wide reprogramming of metabolism and regulatory
networks of Arabidopsis in response to phosphorus Plant Cell Environ
30 85ndash112Muchhal US and Raghothama KG (1999) Transcriptional regulation of
plant phosphate transporters Proc Natl Acad Sci USA 96 5868ndash72Nanamori M Shinano T Wasaki J Yamamura T Rao IM and
Osaki M (2004) Low phosphorus tolerance mechanisms phosphorus
recycling and photosynthate partitioning in the tropical forage grassBrachiaria hybrid cultivar mulato compared with rice Plant Cell Environ
45 460ndash469Neumann G and Romheld V (1999) Root excretion of carboxylic acids
and protons in phosphorus-deficient plants Plant Soil 211 121ndash130Nikiforova VJ Gakiere B Kempa S Adamik M Willmitzer L
Hesse H and Hoefgen R (2004) Towards dissecting nutrient
metabolism in plants a systems biology case study on sulphur
metabolism J Exp Bot 55 1861ndash1870Nikiforova VJ Kopka J Tolstikov V Fiehn O Hopkins L
Hawkesford MJ Hesse H and Hoefgen R (2005) Systems rebalan-
cing of metabolism in response to sulfur deprivation as revealed bymetabolome analysis of Arabidopsis plants Plant Physiol 138 304ndash318
Nilsson L Muller R and Nielsen TH (2007) Increased expression of theMYB-related transcription factor PHR1 leads to enhanced phosphate
uptake in Arabidopsis thaliana Plant Cell Environ 30 1499ndash1512
Panikulangara TJ Eggers-Schumacher G Wunderlich M Stransky Hand Schoffl F (2004) Galactinol synthase 1 A novel heat shock factortarget gene responsible for heat-induced synthesis of raffinose familyoligosaccharides in Arabidopsis Plant Physiol 136 3148ndash3158
Pearse SJ Veneklaas EJ Cawthray G Bolland MDA andLambers H (2006) Triticum aestivum shows a greater biomass responseto a supply of aluminium phosphate than Lupinus albus despite releasingfewer carboxylates into the rhizosphere New Phytol 169 515ndash524
Plaxton WC (2004) Plant response to stress biochemical adaptations tophosphate deficiency In Encyclopedia of Plant and Crop Science Editedby Goodman R pp 976ndash980 Marcel Dekker Inc New York
Plaxton WC and Carswell MC (1999) Metabolic aspects of thephosphate starvation response in plants In Plant Response toEnvironmental Stresses From Photohormones to GenomeReorganization Edited by Lerner HR pp 349ndash372 Marcel DekkerInc New York
Rae AL Cybinski DH Jarmey JM and Smith FW (2003)Characterization of two phosphate transporters from barley evidencefor diverse function and kinetic properties among members of the Pht1family Plant Mol Biol 53 27ndash36
Raghothama KG (1999) Phosphate acquisition Annu Rev Plant PhysiolPlant Mol Biol 50 665ndash693
Reuter DJ and Robinson JB (1997) Plant Analysis An InterpretationManual 2nd edn pp 86ndash92 CSIRO Australia Melbourne
Roessner U Luedemann A Brust D Fiehn O Linke TWillmitzer L and Fernie AR (2001) Metabolic profiling allowscomprehensive phenotyping of genetically or environmentally modifiedplant systems Plant Cell 13 11ndash29
Roessner U Patterson JH Forbes MG Fincher GB Langridge Pand Bacic A (2006) An investigation of boron toxicity in barley usingmetabolomics Plant Physiol 142 1087ndash1101
Rychter AM and Randall DD (1994) The effect of phosphate deficiencyon carbohydrate metabolism in bean roots Physiol Plant 91 383ndash388
Schachtman DP Reid RJ and Ayling SM (1998) Phosphorus uptakeby plants from soil to cell Plant Physiol 116 447ndash453
Shih CY and Kao CH (1996) Growth inhibition in suspension-culturedrice cells under phosphate deprivation is mediated through putrescineaccumulation Plant Physiol 111 721ndash724
Uhde-Stone C Zinn KE Ramirez-Yanez M Li AG Vance CP andAllan DL (2003) Nylon filter arrays reveal differential gene expressionin proteoid roots of white lupin in response to phosphorus deficiencyPlant Physiol 131 1064ndash1079
Vance CP Uhde-Stone C and Allan DL (2003) Phosphorus acquisitionand use critical adaptations by plants for securing a non renewableresource New Phytol 157 423ndash447
Vandesompele J De Preter K Pattyn F Poppe B Van Roy NDe Paepe A and Speleman F (2002) Accurate normalization of real-time quantitative RTPCR data by geometric averaging of multipleinternal control genes Genome Biol 3 1ndash11
Wasaki J Yonetani R Kuroda S Shinano T Yazaki J et al (2003a)Transcriptomic analysis of metabolic changes by phosphorus stress in riceplant roots Plant Cell Environ 26 1515ndash1523
Wasaki J Yonetani R Shinano T Kai M and Osaki M (2003b)Expression of the OsPI1 gene cloned from rice roots using cDNAmicroarray rapidly responds to phosphorus status New Phytol 158239ndash248
Wingler A Lea PJ Quick WP and Leegood RC (2000)Photorespiration metabolic pathways and their role in stress protectionPhilos Trans R Soc B Biol Sci 355 1517ndash1529
Wu P Ma L Hou X Wang M Wu Y Liu F and Deng XW (2003)Phosphate starvation triggers distinct alterations of genome expression inArabidopsis roots and leaves Plant Physiol 132 1260ndash1271
Zarcinas BA Cartwright B and Spouncer LR (1987) Nitric aciddigestion and multi-element analysis of plant material by induc-tively coupled plasma spectrometry Commun Soil Sci Plant Anal 18131ndash146
(Received February 21 2008 Accepted March 13 2008)
Metabolite profiles in P-deficient barley plants 703
(Rae et al 2003) Both HvIPS1 and HvPht16 are sensitive
to P deficiency and are highly expressed in both shoots
and roots of Lofty Nijo barley plants The transcript levels
of HvIPS1 and HvPht16 therefore were determined by
quantitative real-time PCR to monitor the response of both
shoots and roots to P deficiency As shown in Fig 2A a low
level of HvIPS1 (12 106 normalized copies mg1 RNA)
was detected in the shoots of thornP-treated plants at day 10
but a 277-fold increase (343 106 normalized copies mg1
RNA) was observed in the shoots of the P-treated plants
The enhanced expression of HvPht16 (32-fold increase)
was also observed in the shoots of P-treated plants at day
10 compared with that in the shoots of thornP-treated plants
(Fig 2A) In contrast a 415-fold increase in the transcript
level of HvIPS1 was observed in the roots of P-treated
plants (Fig 2B) which was similar to the enhanced level
in the shoots (Fig 2A) However no difference in the
HvPht16 transcript level was found in the roots receiving
the two P treatments at day 10 (Fig 2B) suggesting that the
shoots of barley plants are more sensitive to P deficiency
than the roots Severe P deficiency sharply increased the
transcript levels of HvIPS1 and HvPht16 in both shoots
and roots at day 17 (Fig 2)
Metabolite profiles of shoots and roots in mildly P-deficient
plants
A GC-MS-based method developed by Roessner et al
(2006) was used for the analysis of polar metabolites from
barley plants More than 400 compounds were detected
in barley plants subjected to both thornP and P treatments
1800A
B
1600
1400
1200
1000
800
600
400
200
0
1800
1600
1400
1200
1000
800
600
400
200
0
No
rmal
ized
co
pie
s mg
minus1 R
NA
(times1
06 )N
orm
aliz
ed c
op
ies
mgminus1
RN
A (
times106 ) minus P
+ P
HvIPS1 HvPht16Day 10 Day 17
HvIPS1 HvPht16
Fig 2 Effect of P supply on transcript levels of HvIPS1 andHvPht16 in shoots (A) and roots (B) of barley seedlings Barleyseedlings were grown in a nutrient solution with 01mMNH4H2PO4
(thornP) or without NH4H2PO4 addition (P) The levels of transcriptsare presented as normalized copies per mg RNA Plants wereharvested at the 10th day after seed imbibition (day 10) and at the17th day (day 17) Standard errors (nfrac14 3) are shown as vertical bars
140A
B
120
100
080
060
040
020
0
10
8
6
4
2
0
Fre
sh w
eig
ht
(g p
lan
tminus1)
P c
on
cen
trat
ion
s (m
g g
minus1 D
W)
Shoots Roots
minusP
+P
minusP
+P
Criticallevel
Day 10 Day 17 Day 10 Day 17
Fig 1 Effect of P supply on plant growth and P nutrition (A) Freshweight of shoots and roots (B) P concentration in shoots and rootsBarley seedlings were grown in a nutrient solution with 01mMNH4H2PO4 (thornP) or without NH4H2PO4 addition (P) Plantswere harvested at the 10th day after seed imbibition (day 10)and at the 17th day (day 17) Standard errors (nfrac14 4) are shown asvertical bars
Metabolite profiles in P-deficient barley plants 693
of which approximately 130 compounds could be assigned a
chemical structure A total of 98 metabolites were identified
as known compounds including 23 amino acids 15 organic
acids 25 sugars and 35 non-polar compounds (Supplemen-
tary Tables S1 S2) Metabolite levels from both shoots and
roots and the ratios of PthornP are presented in Supplemen-
tary Table S1 for the mildly P-deficient plants at day 10
and in Supplementary Table S2 for the severely P-deficient
plants at day 17
The PthornP ratios for metabolite levels for mildly
P-deficient plants are summarized in Fig 3 The levels
of approximately half of the sugars analyzed were
significantly increased in the shoots of the mildly
P-deficient plants (PSD10 Supplementary Table S1)
A significant increase in the levels of di- and trisaccharides
(sucrose 11-fold maltose 27-fold raffinose 42-fold and
6-kestose 119-fold) and one aromatic compound (shiki-
mate 22-fold) was observed (Fig 3) Little change in
amino acids and organic acids was observed in the shoots
of the mildly P-deficient plants (PSD10 Supplementary
Table S1) In contrast only a few metabolites were
significantly changed in the roots of mildly P-deficient
plants compared with thornP-treated roots (PRD10
Supplementary Table S1 Fig 3) One sugar maltose rose
to 15-fold in the roots (PthornPRD10 Supplementary
Table S1) The Pi level in the polar fraction of mildly
P-deficient plants was not significantly affected either in
shoots or in roots (phosphoric acid in the polar fraction
of Supplementary Table S1) These results indicate that the
metabolites involved in sugar metabolism are more sensitive
di- and tri-saccharides
raffinose(419plusmn017)312plusmn041
sucrose(114plusmn008)159plusmn011
glc(144plusmn004)070plusmn011
shikimate(222plusmn014)161plusmn018
fru(120plusmn008)079plusmn011
glycerol(103plusmn006)115plusmn011
6-kestose(1186plusmn020)
292plusmn037
maltose(269plusmn016)149plusmn006
ribose(128plusmn012)052plusmn012
inositol-1-P(097plusmn010)103plusmn039
glycine(103plusmn006)091plusmn012
serine(089plusmn004)121plusmn016
gly-6-P(082plusmn009)112plusmn027
glycerol-3-P(030plusmn048)197plusmn052
tryptophan(117plusmn017)396plusmn075
fru-6-P(073plusmn008)127plusmn025
inositol(136plusmn005)117plusmn007
b-alanine(148plusmn007)105plusmn015
alanine(088plusmn006)193plusmn037
asparagine(115plusmn010)079plusmn012
succinate(125plusmn010)104plusmn003
fumarate(073plusmn009)086plusmn003
aspartate(084plusmn008)209plusmn017
malate (115plusmn005)275plusmn018
citrate (131plusmn023)173plusmn026
glutamate(486plusmn032)1258plusmn097
a-ketoglutarate(101plusmn009)118plusmn021
urea(106plusmn008)128plusmn008
lipids
fructanstarch
glycerate-3-P
PEP
pyruvate
oxaloacetate
aromatic compounds
Fig 3 Effect of P supply on the levels of primary polar metabolites from shoots and roots of 10-day-old plants Barley seedlings weregrown in a nutrient solution with 01mM NH4H2PO4 (thornP) or without NH4H2PO4 addition (P) and harvested at the 10th day after seedimbibition A simplified metabolic pathway is used to show the levels of the primary metabolites determined by GC-MS The metabolitesmeasured by GC-MS are shown in bold and undetermined metabolites in a regular font Relative ratios (PthornP) of metabolites in theshoots (in parentheses) and roots (no parentheses) are presented as means SE (nfrac14 4) Significant differences (P 005) in the ratiosbetween the P and thornP treatments are indicated in green for the increased ratios and in red for the reduced ratios
694 Metabolite profiles in P-deficient barley plants
to mild P deficiency than others such as amino acids and
organic acids In addition it is obvious that shoots are more
responsive than roots to mild P deficiency
Metabolite profiles of shoots and roots in severely P-deficient
plants
The ratios (PthornP) of a wide spectrum of polar
metabolites were altered in 17-day-old P-deficient plants
(Supplementary Table S2) The elevated levels of di- and
trisaccharides remained in the shoots of severely P-deficient
plants (Fig 3) and more changes in di- and trisaccharides
including maltose (27-fold) sucrose (1374-fold) raffinose
(72-fold) and 6-kestose (70-fold) occurred in the roots
(Fig 4) Although the ratio of sucrose (PthornP) in the roots
of 17-day-old plants was extremely high the level of sucrose
(183) in the roots of the severely P-deficient plants
(Supplementary Table S2) was only slightly lower than
that (231) in the mildly P-deficient plants (Supplementary
Table S1) The extremely high ratio of sucrose in the roots
of the severely P-deficient plants is mainly due to the largely
reduced level of sucrose (01) in thornP-treated roots at day 17
(Fig 4 and Supplementary Table S2) In addition a large
increase in shikimate (120-fold) was observed in the roots
Ribose was the only monosaccharide which was reduced
03- to 06-fold in both shoots and roots of severely
P-deficient plants The levels of other monosaccharides
were either unaffected or increased (Fig 4) However Pi
levels in the polar fraction of the severely P-deficient plants
were sharply reduced to approximately 10 of those in
thornP-treated plants (phosphoric acid in the polar fraction of
di- and tri-saccharidesraffinose(335plusmn008)721plusmn012
glc(113plusmn004)095plusmn019
shikimate(199plusmn019)1204plusmn003
fru(151plusmn005)137plusmn010
inositol(116plusmn007)119plusmn005
serine(267plusmn009)125plusmn011
glycine(906plusmn002)157plusmn011
glc-6-P(014plusmn012)007plusmn010
fru-6-P(011plusmn005)008plusmn012
glyserol-3-P(015plusmn029)088plusmn008
inositol-1-P(040plusmn012)026plusmn024
glycerol(088plusmn004)198plusmn008
ribose(061plusmn020)030plusmn008
tryptophan(5454plusmn042)
ndb-alanine(083plusmn005)038plusmn007
alanine(296plusmn007)064plusmn011
asparagine(194plusmn024)295plusmn016
succinate(082plusmn005)068plusmn005
fumarate(082plusmn003)054plusmn007
aspartate(085plusmn005)051plusmn022
malate (074plusmn003)073plusmn019
citrate (122plusmn020)139plusmn007
glutamate(148plusmn016)243plusmn006
a-ketoglutarate(036plusmn015)075plusmn015
urea(nd)
3315plusmn009
sucrose(114plusmn005)13741plusmn007
6-kestose(1248plusmn009)
695plusmn014
maltose(612plusmn020)273plusmn008
fructan
lipids
starch
glycerate-3-P
PEP
pyruvate
oxaloacetate
aromatic compounds
Fig 4 Effect of P supply on the levels of primary polar metabolites from shoots and roots of 17-day-old plants Barley seedlings weregrown in a nutrient solution with 01mM NH4H2PO4 (thornPi) or without NH4H2PO4 addition (P) harvested at day 17 after seed imbibitionand separated into shoots and roots A metabolic pathway is used to show the levels of the primary metabolites determined by GC-MS Themetabolites measured by GC-MS are shown in bold and undetermined metabolites in a regular font Relative ratios (PthornP) of metabolitein the shoots (in parentheses) and roots (no parentheses) are presented as means SE (nfrac14 4) Significant differences (P 005) in the ratiosbetween the P and thornP treatments are indicated in green for the increased ratios and in red for the reduced ratios
Metabolite profiles in P-deficient barley plants 695
Supplementary Table S2) and the concomitant reduction in
phosphorylated sugars including glucose-6-P fructose-6-P
glycerol-3-P and inositol-1-P was also observed in both
shoots and roots of the severely P-deficient plants at day 17
(Fig 4 and Supplementary Table S2) The levels of seve-
ral organic acids of the TCA cycle were also reduced in
the severely P-deficient plants including a-ketoglutarate(04-fold) and malate (07-fold) in the shoots and succinic
acid (07-fold) and fumaric acid (05-fold) in the roots
(Fig 4)
There were hardly any changes in the levels of amino
acids in both shoots and roots of the mildly P-deficient
plants when compared with thornP-treated plants (Supplemen-
tary Table S1) but the levels of two-thirds of the amino
acids were increased in the shoots of the severely P-deficient
plants (PSD17 Supplementary Table S2) In addition
the polyamine putrescine was increased in shoots (PSD17
Supplementary Table S2) Similarly dramatic changes in
the levels of the amino acids and metabolites related to
ammonium metabolism were also observed in the roots of
severely P-deficient plants There was an increase in the
levels of asparagine (30-fold) glutamate (24-fold) and
putrescine (23-fold) in the roots of the severely P-deficient
plants as well as a sharp increase in the level of urea up to
332-fold in roots (Fig 4) This high ratio of the urea level
was due to the combination of an increase of urea (25-fold)
in the roots of the severely P-deficient plants (PRD17
Supplementary Table S2) compared with that of the mildly
P-deficient plants (PRD10 Supplementary Table S1)
and a reduction of the urea level from 08 in the roots of
thornP-treated plants at day 10 (thornPRD10 Supplementary
Table S1) to 01 at day 17 (thornPRD17 Supplementary
Table S2) These data should be viewed cautiously as the
quantification of urea by GC-MS can be unreliable so an
alternative approach would need to be utilized to explore
this effect further Furthermore the level of aspartate in the
roots of the severely P-deficient plants was reduced to
05-fold (Fig 4) The significant change in the metabolites
related to ammonium assimilation suggests that the severe
P deficiency increases levels of ammonium leading to
alterations in ammonium assimilation
Effect of severe P deficiency on the concentrations of free
amino acids
The observations described above led us to conduct
an additional experiment to determine the effect of severe P
deficiency on amino acid metabolism Absolute concentra-
tions of free amino acids were determined using LC-MS to
complement the data obtained by GC-MS In the additional
experiment the nutrient solutions were supplemented with
two levels of ammonium (01 and 04mM) The low
ammonium treatment (01mM) was the same as that used
for plant growth in the first experiment (Fig 1) The high
ammonium treatment (04mM) is designed to investigate
the effect of external ammonium supply on the accumula-
tion of free amino acids in P-deficient plants and to prevent
possible depletion of ammonium in the nutrient solution
when only low concentrations (01mM) were supplied
Barley is an ammonium-sensitive species (Britto and
Kronzucker 2002) We determined that the maximum
level of ammonium that could be added to the nutrient
solution without obvious adverse effect on plant growth
was 04mM with co-provision of ammonium and nitrate
In thornP treatments shoot fresh weights for the 01 and
04mM ammonium treatments were similar (Fig 5A) but
the fresh weight of roots in the 04mM ammonium
treatment was 072 g plantndash1 which was slightly lower
than that of 081 g plantndash1 in the 01mM treatment (Fig 5B)
In contrast plant growth in the P treatment supplied with
either 01 or 04mM ammonium was severely retarded
compared with that of thornP treatment (Fig 5A B) The
growth inhibition in both shoots and roots was similar to
that shown in Fig 1A P concentrations in the shoots
of thornP-treated plants supplemented with either 01 or
04mM ammonium were above the critical levels (Reuter
and Robinson 1997) whereas those in the shoots of
P-treated plants were 12mg P gndash1 DW for the 01mM
ammonium treatment which is equal to that observed
in the severely P-deficient plants in the first experiment
(Fig 1B) but slightly lower (10mg P gndash1 DW) in the
04mM ammonium treatment than that in the 01mM
ammonium treatment (Fig 5C)
The concentrations of all 20 amino acids and GABA
(g-aminobutyric acid) were obtained by LC-MS (Supple-
mentary Table S3) and the results were compared with
those determined by GC-MS (Supplementary Table S2)
The extent of the effect of severe P deficiency on the
concentrations of free amino acids was confirmed by the
LC-MS analysis (Supplementary Table S3) In the shoots
severe P deficiency led to an increase in the concentrations
of half of the amino acids especially glutamine and
asparagine (Supplementary Table S3) and a large reduction
in the concentrations of glutamate and aspartate regardless
of the ammonium concentration (01 or 04mM) (Fig 6A)
The concentrations of glutamine and asparagine also
increased in the roots (Fig 6B) but the concentrations
of some of the abundant amino acids such as alanine
aspartate glutamate and serine were decreased in the
roots irrespective of the rate of ammonium supply
(Supplementary Table S3) The changes in the levels
of amino acids generally agreed with those obtained
by GC-MS in the first experiment (PSD17 Supple-
mentary Table S2) but there were some differences in the
relative levels of some of the amino acids such as
asparagine glutamate proline and phenylalanine between
the two experiments using these two different technologies
696 Metabolite profiles in P-deficient barley plants
(Supplementary Tables S2 S3) These differences in amino
acid levels reflect the differential stabilities of the respective
amino acids to the different derivatization and detection
methodologies
The concentrations of glutamine and asparagine in
both shoots and roots were sensitive to ammonium
supplied They increased from approximately 10 mmol g1
DW in the shoots of the thornP treatment with 01mM
ammonium to 40 mmol g1 DW in the shoots of the thornP
treatment with 04mM ammonium (Fig 6A) In the
severely P-deficient plants the concentrations of glutamine
and asparagine in the shoots rose above 60 mmol g1 DW in
01mM ammonium and above 90 mmol g1 DW in 04mM
ammonium (Fig 6A) A similar magnitude of increase in
the concentrations of glutamine and asparagine was also
observed in the roots of the severely P-deficient plants
(Fig 6B) These results indicate that severe P deficiency
further increases the concentrations of glutamine and
asparagine in both shoots and roots When PthornP ratios
of amino acids in both shoots and roots of the plants treated
with 04mM ammonium were compared with those treated
with 01mM ammonium the high ammonium supply had
little effect on the PthornP ratios of amino acids except for
a reduction in the ratios of glutamine and asparagine and
140
120
100
Fre
sh w
eig
ht
(g p
lan
tminus1)
Fre
sh w
eig
ht
(g p
lan
tminus1)
P c
on
cen
trat
ion
(m
g g
minus1 D
W)
080
060
040
020
0
140minusP
+P120
100
080
060
040
Critical level
020
0
10
8
6
4
2
001 mM 04 mM
A
B
C
Fig 5 Effect of P and ammonium supply on plant growth andP nutrition (A) Fresh weight of shoots (B) Fresh weight of roots(C) P concentration of shoots Barley seedlings grown in a nutrientsolution containing either no NH4H2PO4 (P) or 01mMNH4H2PO4 (thornP) with two rates of ammonium (01 and 04mM)Plants were harvested at the 16th day after seed imbibitionStandard errors (nfrac14 4) are shown as vertical bars
1200Glu
Gln
Asp
Asn
1000
800
600
400
200
0
1200
1000
800
600
400
200
001N+P 04N+P01NminusP 04NminusP
Co
nce
ntr
atio
n (
mg g
minus1 D
W)
Co
nce
ntr
atio
n (
mg g
minus1 D
W)
A
B
Fig 6 Effect of P and ammonium supply on concentrations of fouramino acids (A) Concentrations of four amino acids in shoots(B) Concentrations of four amino acids in roots Barley seedlingsgrown in a nutrient solution containing either no NH4H2PO4 (P)or 01mM NH4H2PO4 (thornP) with two rates of ammonium (01 and04mM) Plants were harvested at the 16th day after seedimbibition The concentrations of amino acids were determinedby LC-MS (see Supplementary Table S3) Standard errors (nfrac14 4) areshown as vertical bars
Metabolite profiles in P-deficient barley plants 697
a couple of other amino acids (Supplementary Table S3)
These results indicate that the effect of severe P deficiency
on the concentrations of free amino acids in both shoots
and roots is largely independent of ammonium supply
In addition the concentrations of both glutamate
and aspartate precursors for synthesis of glutamine and
asparagine were affected by severe P deficiency The con-
centrations of glutamate and aspartate were reduced by
approximately 50 and 25 respectively in the shoots
of P treatments with either 01 or 04mM ammonium
relative to those of thornP treatments (Fig 6A and Supple-
mentary Table S3) The greater reductions in the concen-
trations of glutamate and aspartate were also observed in
the roots of P treatments with two rates of ammonium
supplied compared with those of thornP treatments (Fig 6B
and Supplementary Table S3) Interestingly the high
ammonium supplied did not reduce the concentrations of
glutamate and aspartate either in the shoots or in the roots
of thornP-treated plants (Fig 6A B Supplementary Table S3)
These results suggest that severely P-deficient plants utilize
amino acids as an alternative carbon resource especially in
the roots
Discussion
P deficiency in barley plants results in increases in di- and
trisaccharides and decreases in small P-containing
metabolites
P deficiency initially enhanced the accumulation of
di- and trisaccharides especially for maltose raffinose and
6-kestose in the shoots of the moderately P-deficient plants
(Fig 3) Only maltose increased in the roots (Fig 3
Supplementary Table S1) The transcript levels of HvPht16
(Fig 2) also indicate that roots are less sensitive to P
deficiency Severe P deficiency leads to a further increase in
di- and trisaccharides in both shoots and roots These data
are consistent with previous reports that P deficiency led
to an increase in the levels of starch sucrose and mono-
saccharides in common beans and Arabidopsis (Ciereszko
and Barbachowska 2000 Hernandez et al 2007 Nilsson
et al 2007) and a graminaceous plant Brachiaria hybrid
(Nanamori et al 2004) It also is consistent with the reduced
level of sucrose synthase in P-deficient maize roots (Li et al
2007) The increased levels of mono- di- and polysaccha-
rides suggest that glycolysis may be hindered in both shoots
and roots of P-deficient barley plants In contrast the
cDNA array analyses from lupin and rice suggest that P
deficiency stimulates glycolysis (Uhde-Stone et al 2003
Wasaki et al 2003a) It is conceivable that to maintain
a high level of organic acid secretion in the proteoid roots
of lupin a enhanced level of glycolysis is necessary under
P-deficient conditions (Pearse et al 2006) but it is not clear
why rice did not show enhanced accumulation of di- and
polysaccharides under P-deficient conditions (Nanamori
et al 2004) It appears that metabolic changes in glycolysis
in response to P deficiency differ among plant species
Severe P deficiency depleted inorganic Pi storage pools
as indicated by the sharp reduction of phosphoric acid
in the polar fractions of plant tissues to 510 of
the controls (PDS17thornPDS17 and PDR17thornPDS17
Supplementary Table S2) Under these conditions organic
P is an alternative resource of P for plant cells RNA
phospholipids and small phosphorylated metabolites are
three main classes of compounds containing phosphoesters
Degradation of RNA by increased RNase activity under
Pi-limiting conditions is well documented (Plaxton 2004)
The RNA content in the shoots of severely P-deficient
Arabidopsis plants was reduced to 13 of that in the
P-sufficient plants (Hewitt et al 2005) Considerable
amounts of organic P are present in small phosphorylated
metabolites which is approximately equivalent to that
in RNA or in phospholipids (Bieleski and Ferguson
1983 Doermann and Benning 2002) The levels of
small phosphorylated metabolites including glucose-6-P
fructose-6-P and inositol-1-P were largely reduced in both
shoots and roots of the severely P-deficient plants and the
level of glycerol-3-P in the polar fraction was also sharply
reduced in the shoots of the severely P-deficient plants
(Fig 4) The reduction of phosphorylated sugars was also
observed in bean roots and Arabidopsis under P-deficient
conditions (Rychter and Randall 1994 Morcuende et al
2007) These results indicate that severely P-deficient plants
salvage P from small phosphorylated metabolites for
essential cellular functions These small phosphorylated
metabolites are important intermediates in glycolysis and
synthesis of polysaccharides (glucose-6-P and fructose-6-P)
phospholipids (glycerol-3-P and inositol-1-P) amino acids
and nucleotides and in energy production Thus a depletion
of these phosphorylated metabolites would have a severe
impact not only on carbohydrate and nitrogen metabolism
but also on other metabolic processes
The enhanced accumulation of di- and tri-saccharides
in P-deficient plants can reduce the consumption of Pi in
phosphorylation of sugar metabolites and convert the small
phosphorylated metabolites to non-P-containing di- and
trisaccharides and other compounds such as aromatic
compounds (Figs 3 4) This could be a strategy to reduce
Pi consumption but may also have a benefit in osmotic
protection for stressed plants Increased accumulation of
di- and trisaccharides such as raffinose has been described
in plants exposed to heat stress (Panikulangara et al 2004)
and sulfate deficiency (Nikiforova et al 2005) maltose in
acute temperature stress (Kaplan and Guy 2004) and
6-kestose a precursor for synthesis of fructans under
drought conditions (Hendry 1993 Amiard et al 2003)
However carbohydrate formed as di- and trisaccharides
698 Metabolite profiles in P-deficient barley plants
shown to accumulate in P-deficient plants cannot be utilized
readily for energy metabolism without involvement of Pi
to provide carbon metabolites for the TCA cycle An
alternative storage form of carbon such as organic acids
and amino acids would be preferred for survival of
P-deficient plants (Nanamori et al 2004)
P deficiency reduces organic acids in the TCA cycle
The reduced levels of several organic acids of the TCA
cycle including a-ketoglutarate succinate fumarate and
malate (Fig 4) and the reduction in the concentrations
of glutamate and aspartate especially in the roots of
the severely P-deficient plants (Fig 6B) suggest that the
shortage in carbohydrate supply is more apparent in the
roots than in the shoots of severely P-deficient plants
Reduced levels of fumarate were also observed in
P-deficient Arabidopsis (Misson et al 2005) In addition P
deficiency increases the secretion of organic acids into the
rhizosphere although cereals are weak secretors of organic
acids compared with legumes under low P conditions
(Neumann and Romheld 1999 Pearse et al 2006) The
secretion of organic acids could also contribute to
the reduction of the organic acids in the root tissues The
roots of severely P-deficient plants have to adjust metabolic
processes to utilize possible carbon metabolites such as
amino acids Some of the amino acids could be utilized as
an alternative carbon resource for energy production
reassimilation of the released ammonium and synthesis of
organic acids for secretion Interestingly the levels of several
organic acids in the TCA cycle were also reduced in
the roots of P-deficient common beans (Hernandez et al
2007) As legumes are efficient secretors of organic acids
(Neumann and Romheld 1999 Pearse et al 2006) secretion
could be a significant contributor to the reduced levels of
organic acids in the roots Nevertheless no reduction in
small P-containing metabolites nor organic acids in the
TCA cycle is observed in sulfate-deficient Arabidopsis plants
(Hirai et al 2004 Nikiforova et al 2005) indicating that
the reduction in the organic acids is unique to P-deficient
plant species
Severe P deficiency alters nitrogen metabolism
In P-deficient conditions transcript levels of the
genes coding for enzymes involved in protein degradation
were enhanced and the genes for protein synthesis were
suppressed in both Arabidopsis and common beans
(Wu et al 2003 Misson et al 2005 Hernandez et al
2007) The abundance of proteins related to protein
degradation through the ubiquitinndash26S proteasome path-
way was found to have increased in P-deficient roots of
maize (Li et al 2007) The reduced transcript levels of genes
related to nitrate reduction (Wu et al 2003) and reduced
activities for nitrate reduction have also been described in
P-deficient plants (Gniazdowska and Rychter 2000)
The increased concentrations of total free amino acids in
the shoots of severely P-deficient plants (Supplementary
Table S3) are likely to result from increased protein
degradation and repressed protein synthesis Various
metabolic reactions involved in either synthesis or degrada-
tion of amino acids produce ammonia such as aspara-
gine to aspartate glutamine to glutamate glutamate to
a-ketoglutarate and glycine to serine P deficiency enhances
the transcript levels of alanine aminotransferase genes
in both Arabidopsis and common beans (Wu et al 2003
Hernandez et al 2007) and the protein abundance of
glutamate dehydrogenase and phenylalanine ammonia-
lyase in maize roots (Li et al 2007) A high concentration
of ammonium is harmful to plants especially for barley an
ammonium-sensitive plant (Britto and Kronzucker 2002)
Thus it is critical to avoid excessive accumulation of
ammonium in P-deficient plants The levels of glutamine
and asparagine were elevated in both shoots and roots of
severely P-deficient plants and other metabolites related to
ammonium metabolism including putrescine and tyramine
were also enhanced in the severely P-deficient plants
especially in the roots (Supplementary Table S2) The
increased level of putrescine was also observed in P-deficient
rice cells (Shih and Kao 1996) These data suggest that
deamination of amino acids occurs in the severely
P-deficient plants for utilization in carbon metabolism
and a concomitant increase in assimilation of ammonium
takes place to ensure a reduction in levels of ammonium
The increased activities of glutamate dehydrogenase and
glutamine synthase in Arabidopsis plants (Morcuende et al
2007) and the enhanced protein abundance of root
glutamate dehydrogenase and glutamine synthase observed
in P-deficient maize plants (Li et al 2007) support this
interpretation It is interesting to note that the transcript
levels of glutamate synthase were down-regulated by P
deficiency in rice (Wasaki et al 2003a) Rice is an
ammonium-tolerant species which is in contrast to barley
that is an ammonium-sensitive species (Britto and
Kronzucker 2002) The difference in the metabolite levels
related to ammonium metabolism between P-deficient
barley and rice may be due to this different mechanism of
tolerance to ammonium
The synthesis of glutamine and asparagine requires
a carbon skeleton The enhanced levels of glutamine
and asparagine will require additional molecules of
a-ketoglutarate and oxaloacetate withdrawn from the
TCA cycle leading to a further reduction in the levels
of organic acids and restriction in energy production
in severely P-deficient plants The increased levels of
glutamine asparagine and other metabolites closely
related to ammonium metabolism are also observed in
other nutrient stresses such as nitrogen and sulfate
Metabolite profiles in P-deficient barley plants 699
deficiency (Hirai et al 2004 Nikiforova et al 2005) but
the specific reduction in glutamate and aspartate is
only observed in P-deficient barley plants As synthesis
of glutamine and asparagine can incorporate two ammo-
nium molecules into one organic acid this is a highly
effective ammonium assimilation mechanism under the
carbohydrate-limiting conditions caused by P deficiency
Our metabolite analyses provide indirect evidence that
P-deficient plants are confronted with increased ammonium
To establish a direct link of P deficiency to the increased
accumulation of ammonium in barley tissues further
experiments are required by supplying low concentrations
of ammonium and monitoring ammonium levels in plant
tissues
The increased levels of glycine and serine in the shoots
of the severely P-deficient plants indicate that photorespira-
tion is enhanced in the shoots of the severely P-deficient
plants because glycine and serine are intermediates for
photorespiration (Wingler et al 2000) and the increased
levels of glycine and serine correlate well with the rate of
photorespiration in P-deficient bean plants (Kondracka and
Rychter 1997) Increases in the levels of glycine and serine
were also observed in sulfur-deficient Arabidopsis plants
(Nikiforava et al 2005) indicating that the increase in
photorespiration is a general stress response (Wingler et al
2000)
Carbohydrate partitioning in P-deficient barley differs
from a P-efficient Gramineae grass
P deficiency results in the enhanced accumulation of
di- and trisaccharides and reduced organic acids in barley
plants which generally is similar to rice a P-inefficient
plant (Nanamori et al 2004) A P-efficient grass (Brachiaria
hybrid) is very different from rice in carbohydrate par-
titioning under P-deficient conditions (Nanamori et al
2004) The Brachiaria hybrid can allocate more carbohy-
drates into organic acids and amino acids Maintaining high
activities of phosphoenolpyruvate carboxylase and phos-
phoenolpyruvate phosphatase under the low P condition
appears to be critical for allocating a large proportion of
carbohydrate into organic acids and amino acids Our data
suggest that barley behaves as a P-inefficient plant in
metabolic adaptation to low P environments Thus to
improve P efficiency in barley and perhaps other cereal
crops manipulation of metabolism through a shift in
carbohydrate partitioning could provide a logical strategy
In summary the metabolite profiles generated from
both shoots and roots provide an overview of the metabolic
adjustments that occur in P-deficient barley plants As
illustrated in Fig 7 P-deficient barley plants alter the levels
of many key metabolites which affect various metabolic
pathways including glycolysis photorespiration and
metabolism of nitrogen and phospholipids These adaptive
P inefficiency
P efficiency
ribose
inositol-1-P
glycine(shoots)
serine(shoots)
alanine(shoots)
aspartate
asparagine malate
fumarate
succinate
citrate
a-ketoglutarate
glutamine
glutamate
urea(roots)
glc
glc-6-P
fru
glycerol-3-P
aromaticcompounds
fru-6-P
di- and tri-saccharides
Carbohydratepartitioning
glycerate-3-P
PEP
pyruvate
oxaloacetate
Fig 7 Schematic summary of metabolic adjustments in P-deficient plants and the proposed carbohydrate partitioning for improvementof P efficiency in cereals Thick arrows in green indicate an increase in metabolite levels and thin arrows in red indicate a decreasein metabolite levels The dashed line indicates carbohydrate partitioning for high P efficiency (below the line) and for low P efficiency(above the line)
700 Metabolite profiles in P-deficient barley plants
adjustments reduce Pi consumption by increasing the
levels of di- and trisaccharides and salvage Pi from various
P-containing compounds including small P-containing
metabolites to maintain essential cellular functions An
immediate consequence which is unique to P deficiency is
greatlly reduced levels of the key metabolites in glycolysis
leading to the decrease in carbohydrate supply to the TCA
cycle especially in the roots In addition P-deficient plants
are likely to be confronted with the challenge of increased
ammonium derived from the degradation of protein The
assimilation of the increased ammonium requires additional
organic acids from the TCA cycle which depletes the
organic acid supply further It is noteworthy that although
there are di- and trisaccharides present in the P-deficient
plants they cannot be readily utilized Organic acids and
amino acids are the preferred storage metabolites in
P-deficient plants (Nanamori et al 2004) as they can be
readily utilized as the carbon resource by P-deficient plants
Therefore if barley (and other cereals) are to be engineered
to be better adapted to growth in P-deficient soils there
is a need to shift the partitioning of carbohydrate from
di- and tri-saccharides to organic acids and amino acids
Investigating the expression of genes (transcriptome) and
proteins (proteome) in barley under P-deficient conditions
would provide additional evidence to support this strategy
for enhancing the P efficiency
Materials and Methods
Plant materials
Barley (H vulgare L cv Lofty Nijo) seeds were surface-sterilized with 70 ethanol for 1min and 3 hypochlorite for5min rinsed with deionized water and incubated in Petri dishes for2 d at room temperature Two seeds with an emerged radicle wereput into a seedling cup which was placed in the lid of a black plasticcontainer Each container contained either four seedling cups fortwo harvests or two seedling cups for one harvest and were filledwith 1 liter of nutrient solution The basal nutrients were as follows(in mM) Ca(NO3)2 1000 KNO3 1000 MgSO4 250 KCl 50H3BO3 125 Fe-HEDTA 10 MnSO4 04 CuSO4 01 ZnSO405 NiSO4 01 and MoO3 01 with NH4H2PO4 100 (thornPtreatment) or without NH4H2PO4 (P treatment) To balanceNH4 ions added in the thornP treatment 100 mM NH4NO3 was addedinto the nutrient solution of the P treatment In the additionalexperiment with two levels of ammonium either 100 or 400 mMNH4NO3 was added in the thornP treatment and either nil or 300 mMNH4NO3 was added in the P treatment All treatments werereplicated four times Half-strength nutrient solution was useduntil the 10th day after seed imbibition for the plants harvested atday 10 and day 17 but the eighth day for the plants harvestedat day 16 Full strength was applied thereafter The full-strengthnutrient solution was replaced at day 14 for the plants harvested atday 17 but at day 12 for the plants harvested at day 16 The pH ofthe nutrient solution was adjusted to 60 with 1M KOH and thesolution was aerated continuously
Plants were grown in a controlled environment at 208Cday158C night with a photoperiod regime of 14 h day10 h nightat 300 mmolm2 sndash1 photon flux intensity at the plant level At each
harvest two seedling cups were removed from each containerPlants were collected in 5ndash6 h of the light period to eliminatediurnal changes in metabolite levels The roots of plants from oneseedling cup were rinsed briefly in deionized water excess waterwas blotted on fresh laboratory tissues and the roots and shootswere separated and oven-dried at 658C for 48 h The dry plantsamples were used for mineral element analysis by inductivelycoupled plasma spectrophotometry (Zarcinas et al 1987) Anothercup of plants was separated into roots and shoots frozenimmediately in liquid nitrogen and stored at 808C for metaboliteand transcript analyses
Real-time quantitative RTndashPCR
Shoots and roots of three replicates from each P treatmentwere used for transcript analysis Total RNA was prepared usingTrizol reagent according to the manufacturerrsquos instructions(Invitrogen Carlsbad CA USA) Total RNA was treated withDNase I using the DNA free kit (Ambion Austin TX USA) toremove any contaminating genomic DNA and then RNA integritywas checked on an agarose gel cDNA was prepared from 2mg oftotal RNA using SuperScriptTM III reverse transcriptase accord-ing to the manufacturerrsquos instructions (Invitrogen) The reactionwas incubated at 508C for 45min and at 708C for 15min toinactivate the enzyme
The transcript levels of HvIPS1 and HvPht16 weredetermined by real-time quantitative PCR essentially as describedby Burton et al (2004) The transcript levels of three control genes(barley a-tubulin heat shock protein 70 and cyclophilin) weredetermined and used for normalization Normalization was carriedout as described by Vandesompele et al (2002) and Burtonet al (2004) The normalized copies mg RNA1 are presentedThe primers 50 GCGGCGACTTCTCACCTCTACTAAG and50 CGAAGGATTCAAACAGGATCACACA (GenBank acces-sion No BI780234) were used for amplification of HvIPS1 and50 GGTCAAGAACTCGCTATTCATCC and 50 CCATACATCCATCCAAACCTG (GenBank accession No AF543198) foramplification of HvPht16
Analysis of metabolites with GC-MS
Metabolite analysis was carried out by a GC-MS-basedmethod modified from Roessner et al (2006) Fresh tissues of rootsand shoots from barley plants were homogenized using a mortarand pestle with liquid nitrogen Frozen tissue powder (100 10mgexact fresh weight was recorded) was extracted with methanol(350 ml) A polar internal standard (20 ml of 02mgmlndash1 ribitol inwater) and a non-polar internal standard (30 ml of 2mgmlndash1
nonadecanoic acid methylester in chloroform) were subsequentlyadded as quantification standards The mixture was extracted for15min at 708C and then mixed vigorously with 1 vol of waterIn order to separate polar and non-polar metabolites 300 ml ofchloroform was added to the mixture and centrifuged at 2200gfor 10min The upper methanolwater phase was collected andwashed with chloroform (300 ml) The polar phase of shoot extracts(100 ml) and root extracts (250 ml) was separately dried undervacuum Both lipid layers were combined and dried under vacuumIn order to methylate fatty acids the residues of the non-polarfractions were further incubated with chloroform (100 ml) andacidified methanol (300 ml of 125N HCl in methanol) for 24 h at508C and afterwards dried under vacuum The dry polar residuewas redissolved and derivatized for 120min at 378C in methox-yamine hydrochloride (40 ml of 20mgml1 in pyridine) followedby a 30min treatment with N-methyl-N-[trimethylsilyl] trifluoro-acetamide (MSTFA) (70 ml) at 378C The dry non-polar residue
Metabolite profiles in P-deficient barley plants 701
was derivatized for 60min at 378C in pyridine (70 ml) and MSTFA(40 ml) To both a retention time standard mixture [10 ml of 0029(vv) n-dodecane n-pentadecane n-nonadecane n-docosanen-octacosane n-dotracontane n-hexatriacontane dissolved inpyridine] was added prior to trimethylsilylation Sample volumesof 1ml were then injected using the splitless mode onto a GCcolumn using a hot needle technique
The GC-MS system and conditions were as described inRoessner et al (2006) Acquired total ion chromatograms andmass spectra were evaluated using the Xcalibur program(ThermoFinnigan Manchester UK) and the resulting data areprepared normalized and presented as described by Roessner et al(2001) Mass spectra of eluting compounds were identified usingthe commercial mass spectra library NIST (httpwwwnistgov)and the public domain mass spectra library of the Max-Planck-Institute for Plant Physiology Golm Germany (httpcsbdbmpimp-golmmpgdecsbdbdbmamsrihtml) All matchingmass spectra were additionally co-verified by determination of theretention time and mass spectra by analysis of authentic standardsubstances
Analysis of free amino acids with LC-MS
Leaf material (15mg) was accurately weighed intoEppendorf tubes (2ml) and a solution of EDTA (400 ml 5mM)was added to each sample The samples were sonicated for15min then heated in a water bath (808C 15min) centrifuged(14500 rpm 5min) and the supernatant derivatized Thederivatization of the amino acids is based on a procedure outlinedby Cohen and Michaud (1993) and involved mixing the super-natant obtained above (20 ml) with borate buffer (200 ml 02MpH 88) followed by the addition of 10mM 6-aminoquinolyl-N-hydroxysuccinimidyl carbamate solution (50 ml) in dry aceto-nitrile The reaction mixture was then heated at 558C in a waterbath for 10min and analyzed by LC-MS as described by Callahanet al (2007)
The LC-MS system comprised a Surveyor LC PumpSurveyor Auto Sampler and LCQ Deca XP Max ion trapMS (Thermo Finnigan USA) The ESI (electron spray ionization)source was optimized by infusing a derivatized amino acidstandard in line with the mobile phase then tuning the sourceconditions and ion optics to optimize the signals for the derivatizedamino acids This resulted in the following conditions sheath gas30 arbitrary units auxiliary gas 10 arbitrary units spray voltage30 kV capillary temperature 2508C capillary voltage 56V andtube lens 53V
Derivatized amino acids were eluted on an Altantis dC18150 21mm 3mm (Waters Melbourne Australia) HPLC columnusing a three-step gradient of deionized water (01 formic acid)and acetonitrile (01 formic acid) at a flow rate of 025mlminndash1
and a column temperature of 308C (Callahan et al 2007)
Statistical analysis
Students t-test at P 005 was applied for the means (nfrac14 4) ofmetabolites presented in Supplementary Tables S1ndashS3 Statisticalanalyses were carried using the Pirouette 311 software (InfometrixInc Woodinville WA USA)
Supplementary material
Supplementary material mentioned in the article is avail-able to online subscribers at the journal website wwwpcpoxfordjournalsorg
Funding
The Grains Research and Development Corporation
the Australian Research Council the South Australian
Government the University of Adelaide and the University
of Melbourne to the Australian Center for Plant Functional
Genomics (CYH UR NS PL AB) the Molecular
Plant Breeding CRC to YG Metabolomics Australia to
(UR DC AB)
Acknowledgments
We are grateful to M Tester for discussion and to T Fowlesand L Palmer for ICP analysis
References
Amiard V Morvan-Bertrand A Billard JP Huault C Keller F andPrudrsquohomme MP (2003) Fructans but not the sucrosyl-galactosidesraffinose and loliose are affected by drought stress in perennial ryegrassPlant Physiol 132 2218ndash29
Bieleski RL and Ferguson IB (1983) Physiology and metabolism ofphosphate and its compounds In Encyclopedia of Plant PhysiologyEdited by Lauchli A and Bieleski RL Vol 15a pp 422ndash449 SpringerVerlag Berlin
Bolling C and Fiehn O (2005) Metabolite profiling of Chlamydomonasreinhardtii under nutrient deprivation Plant Physiol 139 1995ndash2005
Britto DT and Kronzucker HJ (2002) NH4thorn toxicity in higher plants
a critical review J Plant Physiol 159 567ndash584Burleigh SH and Harrison MJ (1997) A novel gene whose expression in
Medicago truncatula roots is suppressed in response to colonization byvesicularndasharbuscular mycorrhizal (VAM) fungi and to phosphatenutrition Plant Mol Biol 34 199ndash208
Burton RA Shirley NJ King BJ Harvey AJ and Fincher GB(2004) The CesA gene family of barley Quantitative analysis oftranscripts reveals two groups of co-expressed genes Plant Physiol134 224ndash236
Callahan DL Kolev SD OrsquoHair RAJ Salt DE and Baker AJM(2007) Relationships between nicotianamine and other amino acids withnickel zinc and iron in Thlaspi hyperaccumulators New Phytol 176836ndash848
Ciereszko I and Barbachowska A (2000) Sucrose metabolism in leavesand roots of bean (Phaseolus vulgaris L) during phosphate deficiencyJ Plant Physiol 156 640ndash644
Cohen SA and Michaud DP (1993) Synthesis of a fluorescentderivatizing reagent 6-aminoquinolyl-N-hydroxysuccinimidyl carba-mate and its application for the analysis of hydrolysate amino acidsvia high-performance liquid chromatography Anal Biochem 211279ndash287
Cruz-Ramirez A Oropeza-Aburto A Razo-Hernandez F Ramirez-Chavez E and Herrera-Estrella L (2006) Phospholipase DZ2 playsan important role in extraplastidic galactolipid biosynthesis andphosphate recycling in Arabidopsis roots Proc Natl Acad Sci USA103 6765ndash6770
Doermann P and Benning C (2002) Galactolipids rule in seed plantsTrends Plant Sci 7 112ndash118
Gniazdowska A and Rychter AM (2000) Nitrate uptake by bean(Phaseolus vulgaris L) roots under phosphate deficiency Plant Soil 22679ndash85
Hendry GAF (1993) Evolutionary origins and natural functions offructansmdasha climatological biogeographic and mechanistic appraisalNew Phytol 123 3ndash14
Hernandez G Ramirez M Valdes-Lopez O Tesfaye MGraham MA et al (2007) Phosphorus stress in common bean roottranscript and metabolic responses Plant Physiol 144 752ndash767
702 Metabolite profiles in P-deficient barley plants
Hewitt MM Carr JM Williamson CL and Slocum RD (2005)Effects of phosphate limitation on expression of genes involved in
pyrimidine synthesis and salvaging in Arabidopsis Plant Physiol
Biochem 43 91ndash99Hirai MY Yano M Goodenowe DB Kanaya S Kimura T
Awazuhara M Arita M Fujiwara T and Saito K (2004) Integration
of transcriptomics and metabolomics for understanding of global
responses to nutritional stresses in Arabidopsis thaliana Proc Natl
Acad Sci USA 101 10205ndash10210Hou XL Wu P Jiao FC Jia QJ Chen HM Yu J Song XW
and Yi KK (2005) Regulation of the expression of OsIPS1 and OsIPS2in rice via systemic and local Pi signaling and hormones Plant Cell
Environ 28 353ndash364Jeschke WD Kirkby EA Peuke AD Pate JS and Hartung W
(1997) Effects of P deficiency on assimilation and transport of nitrate andphosphate in intact plants of castor bean (Ricinus communis L) J Exp
Bot 48 75ndash91Kaplan F and Guy CL (2004) Beta-amylase induction and the protective
role of maltose during temperature shock Plant Physiol 135 1674ndash1684Kondracka A and Rychter AM (1997) The role of Pi recycling processes
during photosynthesis in phosphate-deficient bean plants J Exp Bot 48
1461ndash1468Kopka J (2006) Current challenges and developments in GC-MS based
metabolite profiling technology J Biotechnol 124 312ndash322Li K Xu C Zhang K Yang A and Zhang J (2007) Proteomic
analysis of roots growth and metabolic changes under phosphorus deficitin maize (Zea mays L) plants Proteomics 7 1501ndash1512
Liu CM Muchhal US and Raghothama KG (1997) Differential
expression of TPS11 a phosphate starvation-induced gene in tomatoPlant Mol Biol 33 867ndash874
Martin AC del Pozo JC Inglesias J Rubio V Solano Rde la Pena A Leyva A and Paz-Ares J (2000) Influence of cytokinins
on the expression of phosphate starvation responsive genes inArabidopsis Plant J 24 559ndash567
Mimura T (1999) Regulation of phosphate transport and homeostasis inplant cells Int Rev Cytol Cell Biol 191 149ndash200
Misson J Raghothama KG Jain A Jouhet J Block MA et al
(2005) A genome-wide transcriptional analysis using Arabidopsis thaliana
Affymetrix gene chips determined plant responses to phosphate depriva-
tion Proc Natl Acad Sci USA 102 11934ndash11939Morcuende R Bari R Gibon Y Zheng WM Pant BD Blasing O
Usadel B Czechowski T Udvardi MK Stitt M and Scheible WR(2007) Genome-wide reprogramming of metabolism and regulatory
networks of Arabidopsis in response to phosphorus Plant Cell Environ
30 85ndash112Muchhal US and Raghothama KG (1999) Transcriptional regulation of
plant phosphate transporters Proc Natl Acad Sci USA 96 5868ndash72Nanamori M Shinano T Wasaki J Yamamura T Rao IM and
Osaki M (2004) Low phosphorus tolerance mechanisms phosphorus
recycling and photosynthate partitioning in the tropical forage grassBrachiaria hybrid cultivar mulato compared with rice Plant Cell Environ
45 460ndash469Neumann G and Romheld V (1999) Root excretion of carboxylic acids
and protons in phosphorus-deficient plants Plant Soil 211 121ndash130Nikiforova VJ Gakiere B Kempa S Adamik M Willmitzer L
Hesse H and Hoefgen R (2004) Towards dissecting nutrient
metabolism in plants a systems biology case study on sulphur
metabolism J Exp Bot 55 1861ndash1870Nikiforova VJ Kopka J Tolstikov V Fiehn O Hopkins L
Hawkesford MJ Hesse H and Hoefgen R (2005) Systems rebalan-
cing of metabolism in response to sulfur deprivation as revealed bymetabolome analysis of Arabidopsis plants Plant Physiol 138 304ndash318
Nilsson L Muller R and Nielsen TH (2007) Increased expression of theMYB-related transcription factor PHR1 leads to enhanced phosphate
uptake in Arabidopsis thaliana Plant Cell Environ 30 1499ndash1512
Panikulangara TJ Eggers-Schumacher G Wunderlich M Stransky Hand Schoffl F (2004) Galactinol synthase 1 A novel heat shock factortarget gene responsible for heat-induced synthesis of raffinose familyoligosaccharides in Arabidopsis Plant Physiol 136 3148ndash3158
Pearse SJ Veneklaas EJ Cawthray G Bolland MDA andLambers H (2006) Triticum aestivum shows a greater biomass responseto a supply of aluminium phosphate than Lupinus albus despite releasingfewer carboxylates into the rhizosphere New Phytol 169 515ndash524
Plaxton WC (2004) Plant response to stress biochemical adaptations tophosphate deficiency In Encyclopedia of Plant and Crop Science Editedby Goodman R pp 976ndash980 Marcel Dekker Inc New York
Plaxton WC and Carswell MC (1999) Metabolic aspects of thephosphate starvation response in plants In Plant Response toEnvironmental Stresses From Photohormones to GenomeReorganization Edited by Lerner HR pp 349ndash372 Marcel DekkerInc New York
Rae AL Cybinski DH Jarmey JM and Smith FW (2003)Characterization of two phosphate transporters from barley evidencefor diverse function and kinetic properties among members of the Pht1family Plant Mol Biol 53 27ndash36
Raghothama KG (1999) Phosphate acquisition Annu Rev Plant PhysiolPlant Mol Biol 50 665ndash693
Reuter DJ and Robinson JB (1997) Plant Analysis An InterpretationManual 2nd edn pp 86ndash92 CSIRO Australia Melbourne
Roessner U Luedemann A Brust D Fiehn O Linke TWillmitzer L and Fernie AR (2001) Metabolic profiling allowscomprehensive phenotyping of genetically or environmentally modifiedplant systems Plant Cell 13 11ndash29
Roessner U Patterson JH Forbes MG Fincher GB Langridge Pand Bacic A (2006) An investigation of boron toxicity in barley usingmetabolomics Plant Physiol 142 1087ndash1101
Rychter AM and Randall DD (1994) The effect of phosphate deficiencyon carbohydrate metabolism in bean roots Physiol Plant 91 383ndash388
Schachtman DP Reid RJ and Ayling SM (1998) Phosphorus uptakeby plants from soil to cell Plant Physiol 116 447ndash453
Shih CY and Kao CH (1996) Growth inhibition in suspension-culturedrice cells under phosphate deprivation is mediated through putrescineaccumulation Plant Physiol 111 721ndash724
Uhde-Stone C Zinn KE Ramirez-Yanez M Li AG Vance CP andAllan DL (2003) Nylon filter arrays reveal differential gene expressionin proteoid roots of white lupin in response to phosphorus deficiencyPlant Physiol 131 1064ndash1079
Vance CP Uhde-Stone C and Allan DL (2003) Phosphorus acquisitionand use critical adaptations by plants for securing a non renewableresource New Phytol 157 423ndash447
Vandesompele J De Preter K Pattyn F Poppe B Van Roy NDe Paepe A and Speleman F (2002) Accurate normalization of real-time quantitative RTPCR data by geometric averaging of multipleinternal control genes Genome Biol 3 1ndash11
Wasaki J Yonetani R Kuroda S Shinano T Yazaki J et al (2003a)Transcriptomic analysis of metabolic changes by phosphorus stress in riceplant roots Plant Cell Environ 26 1515ndash1523
Wasaki J Yonetani R Shinano T Kai M and Osaki M (2003b)Expression of the OsPI1 gene cloned from rice roots using cDNAmicroarray rapidly responds to phosphorus status New Phytol 158239ndash248
Wingler A Lea PJ Quick WP and Leegood RC (2000)Photorespiration metabolic pathways and their role in stress protectionPhilos Trans R Soc B Biol Sci 355 1517ndash1529
Wu P Ma L Hou X Wang M Wu Y Liu F and Deng XW (2003)Phosphate starvation triggers distinct alterations of genome expression inArabidopsis roots and leaves Plant Physiol 132 1260ndash1271
Zarcinas BA Cartwright B and Spouncer LR (1987) Nitric aciddigestion and multi-element analysis of plant material by induc-tively coupled plasma spectrometry Commun Soil Sci Plant Anal 18131ndash146
(Received February 21 2008 Accepted March 13 2008)
Metabolite profiles in P-deficient barley plants 703
of which approximately 130 compounds could be assigned a
chemical structure A total of 98 metabolites were identified
as known compounds including 23 amino acids 15 organic
acids 25 sugars and 35 non-polar compounds (Supplemen-
tary Tables S1 S2) Metabolite levels from both shoots and
roots and the ratios of PthornP are presented in Supplemen-
tary Table S1 for the mildly P-deficient plants at day 10
and in Supplementary Table S2 for the severely P-deficient
plants at day 17
The PthornP ratios for metabolite levels for mildly
P-deficient plants are summarized in Fig 3 The levels
of approximately half of the sugars analyzed were
significantly increased in the shoots of the mildly
P-deficient plants (PSD10 Supplementary Table S1)
A significant increase in the levels of di- and trisaccharides
(sucrose 11-fold maltose 27-fold raffinose 42-fold and
6-kestose 119-fold) and one aromatic compound (shiki-
mate 22-fold) was observed (Fig 3) Little change in
amino acids and organic acids was observed in the shoots
of the mildly P-deficient plants (PSD10 Supplementary
Table S1) In contrast only a few metabolites were
significantly changed in the roots of mildly P-deficient
plants compared with thornP-treated roots (PRD10
Supplementary Table S1 Fig 3) One sugar maltose rose
to 15-fold in the roots (PthornPRD10 Supplementary
Table S1) The Pi level in the polar fraction of mildly
P-deficient plants was not significantly affected either in
shoots or in roots (phosphoric acid in the polar fraction
of Supplementary Table S1) These results indicate that the
metabolites involved in sugar metabolism are more sensitive
di- and tri-saccharides
raffinose(419plusmn017)312plusmn041
sucrose(114plusmn008)159plusmn011
glc(144plusmn004)070plusmn011
shikimate(222plusmn014)161plusmn018
fru(120plusmn008)079plusmn011
glycerol(103plusmn006)115plusmn011
6-kestose(1186plusmn020)
292plusmn037
maltose(269plusmn016)149plusmn006
ribose(128plusmn012)052plusmn012
inositol-1-P(097plusmn010)103plusmn039
glycine(103plusmn006)091plusmn012
serine(089plusmn004)121plusmn016
gly-6-P(082plusmn009)112plusmn027
glycerol-3-P(030plusmn048)197plusmn052
tryptophan(117plusmn017)396plusmn075
fru-6-P(073plusmn008)127plusmn025
inositol(136plusmn005)117plusmn007
b-alanine(148plusmn007)105plusmn015
alanine(088plusmn006)193plusmn037
asparagine(115plusmn010)079plusmn012
succinate(125plusmn010)104plusmn003
fumarate(073plusmn009)086plusmn003
aspartate(084plusmn008)209plusmn017
malate (115plusmn005)275plusmn018
citrate (131plusmn023)173plusmn026
glutamate(486plusmn032)1258plusmn097
a-ketoglutarate(101plusmn009)118plusmn021
urea(106plusmn008)128plusmn008
lipids
fructanstarch
glycerate-3-P
PEP
pyruvate
oxaloacetate
aromatic compounds
Fig 3 Effect of P supply on the levels of primary polar metabolites from shoots and roots of 10-day-old plants Barley seedlings weregrown in a nutrient solution with 01mM NH4H2PO4 (thornP) or without NH4H2PO4 addition (P) and harvested at the 10th day after seedimbibition A simplified metabolic pathway is used to show the levels of the primary metabolites determined by GC-MS The metabolitesmeasured by GC-MS are shown in bold and undetermined metabolites in a regular font Relative ratios (PthornP) of metabolites in theshoots (in parentheses) and roots (no parentheses) are presented as means SE (nfrac14 4) Significant differences (P 005) in the ratiosbetween the P and thornP treatments are indicated in green for the increased ratios and in red for the reduced ratios
694 Metabolite profiles in P-deficient barley plants
to mild P deficiency than others such as amino acids and
organic acids In addition it is obvious that shoots are more
responsive than roots to mild P deficiency
Metabolite profiles of shoots and roots in severely P-deficient
plants
The ratios (PthornP) of a wide spectrum of polar
metabolites were altered in 17-day-old P-deficient plants
(Supplementary Table S2) The elevated levels of di- and
trisaccharides remained in the shoots of severely P-deficient
plants (Fig 3) and more changes in di- and trisaccharides
including maltose (27-fold) sucrose (1374-fold) raffinose
(72-fold) and 6-kestose (70-fold) occurred in the roots
(Fig 4) Although the ratio of sucrose (PthornP) in the roots
of 17-day-old plants was extremely high the level of sucrose
(183) in the roots of the severely P-deficient plants
(Supplementary Table S2) was only slightly lower than
that (231) in the mildly P-deficient plants (Supplementary
Table S1) The extremely high ratio of sucrose in the roots
of the severely P-deficient plants is mainly due to the largely
reduced level of sucrose (01) in thornP-treated roots at day 17
(Fig 4 and Supplementary Table S2) In addition a large
increase in shikimate (120-fold) was observed in the roots
Ribose was the only monosaccharide which was reduced
03- to 06-fold in both shoots and roots of severely
P-deficient plants The levels of other monosaccharides
were either unaffected or increased (Fig 4) However Pi
levels in the polar fraction of the severely P-deficient plants
were sharply reduced to approximately 10 of those in
thornP-treated plants (phosphoric acid in the polar fraction of
di- and tri-saccharidesraffinose(335plusmn008)721plusmn012
glc(113plusmn004)095plusmn019
shikimate(199plusmn019)1204plusmn003
fru(151plusmn005)137plusmn010
inositol(116plusmn007)119plusmn005
serine(267plusmn009)125plusmn011
glycine(906plusmn002)157plusmn011
glc-6-P(014plusmn012)007plusmn010
fru-6-P(011plusmn005)008plusmn012
glyserol-3-P(015plusmn029)088plusmn008
inositol-1-P(040plusmn012)026plusmn024
glycerol(088plusmn004)198plusmn008
ribose(061plusmn020)030plusmn008
tryptophan(5454plusmn042)
ndb-alanine(083plusmn005)038plusmn007
alanine(296plusmn007)064plusmn011
asparagine(194plusmn024)295plusmn016
succinate(082plusmn005)068plusmn005
fumarate(082plusmn003)054plusmn007
aspartate(085plusmn005)051plusmn022
malate (074plusmn003)073plusmn019
citrate (122plusmn020)139plusmn007
glutamate(148plusmn016)243plusmn006
a-ketoglutarate(036plusmn015)075plusmn015
urea(nd)
3315plusmn009
sucrose(114plusmn005)13741plusmn007
6-kestose(1248plusmn009)
695plusmn014
maltose(612plusmn020)273plusmn008
fructan
lipids
starch
glycerate-3-P
PEP
pyruvate
oxaloacetate
aromatic compounds
Fig 4 Effect of P supply on the levels of primary polar metabolites from shoots and roots of 17-day-old plants Barley seedlings weregrown in a nutrient solution with 01mM NH4H2PO4 (thornPi) or without NH4H2PO4 addition (P) harvested at day 17 after seed imbibitionand separated into shoots and roots A metabolic pathway is used to show the levels of the primary metabolites determined by GC-MS Themetabolites measured by GC-MS are shown in bold and undetermined metabolites in a regular font Relative ratios (PthornP) of metabolitein the shoots (in parentheses) and roots (no parentheses) are presented as means SE (nfrac14 4) Significant differences (P 005) in the ratiosbetween the P and thornP treatments are indicated in green for the increased ratios and in red for the reduced ratios
Metabolite profiles in P-deficient barley plants 695
Supplementary Table S2) and the concomitant reduction in
phosphorylated sugars including glucose-6-P fructose-6-P
glycerol-3-P and inositol-1-P was also observed in both
shoots and roots of the severely P-deficient plants at day 17
(Fig 4 and Supplementary Table S2) The levels of seve-
ral organic acids of the TCA cycle were also reduced in
the severely P-deficient plants including a-ketoglutarate(04-fold) and malate (07-fold) in the shoots and succinic
acid (07-fold) and fumaric acid (05-fold) in the roots
(Fig 4)
There were hardly any changes in the levels of amino
acids in both shoots and roots of the mildly P-deficient
plants when compared with thornP-treated plants (Supplemen-
tary Table S1) but the levels of two-thirds of the amino
acids were increased in the shoots of the severely P-deficient
plants (PSD17 Supplementary Table S2) In addition
the polyamine putrescine was increased in shoots (PSD17
Supplementary Table S2) Similarly dramatic changes in
the levels of the amino acids and metabolites related to
ammonium metabolism were also observed in the roots of
severely P-deficient plants There was an increase in the
levels of asparagine (30-fold) glutamate (24-fold) and
putrescine (23-fold) in the roots of the severely P-deficient
plants as well as a sharp increase in the level of urea up to
332-fold in roots (Fig 4) This high ratio of the urea level
was due to the combination of an increase of urea (25-fold)
in the roots of the severely P-deficient plants (PRD17
Supplementary Table S2) compared with that of the mildly
P-deficient plants (PRD10 Supplementary Table S1)
and a reduction of the urea level from 08 in the roots of
thornP-treated plants at day 10 (thornPRD10 Supplementary
Table S1) to 01 at day 17 (thornPRD17 Supplementary
Table S2) These data should be viewed cautiously as the
quantification of urea by GC-MS can be unreliable so an
alternative approach would need to be utilized to explore
this effect further Furthermore the level of aspartate in the
roots of the severely P-deficient plants was reduced to
05-fold (Fig 4) The significant change in the metabolites
related to ammonium assimilation suggests that the severe
P deficiency increases levels of ammonium leading to
alterations in ammonium assimilation
Effect of severe P deficiency on the concentrations of free
amino acids
The observations described above led us to conduct
an additional experiment to determine the effect of severe P
deficiency on amino acid metabolism Absolute concentra-
tions of free amino acids were determined using LC-MS to
complement the data obtained by GC-MS In the additional
experiment the nutrient solutions were supplemented with
two levels of ammonium (01 and 04mM) The low
ammonium treatment (01mM) was the same as that used
for plant growth in the first experiment (Fig 1) The high
ammonium treatment (04mM) is designed to investigate
the effect of external ammonium supply on the accumula-
tion of free amino acids in P-deficient plants and to prevent
possible depletion of ammonium in the nutrient solution
when only low concentrations (01mM) were supplied
Barley is an ammonium-sensitive species (Britto and
Kronzucker 2002) We determined that the maximum
level of ammonium that could be added to the nutrient
solution without obvious adverse effect on plant growth
was 04mM with co-provision of ammonium and nitrate
In thornP treatments shoot fresh weights for the 01 and
04mM ammonium treatments were similar (Fig 5A) but
the fresh weight of roots in the 04mM ammonium
treatment was 072 g plantndash1 which was slightly lower
than that of 081 g plantndash1 in the 01mM treatment (Fig 5B)
In contrast plant growth in the P treatment supplied with
either 01 or 04mM ammonium was severely retarded
compared with that of thornP treatment (Fig 5A B) The
growth inhibition in both shoots and roots was similar to
that shown in Fig 1A P concentrations in the shoots
of thornP-treated plants supplemented with either 01 or
04mM ammonium were above the critical levels (Reuter
and Robinson 1997) whereas those in the shoots of
P-treated plants were 12mg P gndash1 DW for the 01mM
ammonium treatment which is equal to that observed
in the severely P-deficient plants in the first experiment
(Fig 1B) but slightly lower (10mg P gndash1 DW) in the
04mM ammonium treatment than that in the 01mM
ammonium treatment (Fig 5C)
The concentrations of all 20 amino acids and GABA
(g-aminobutyric acid) were obtained by LC-MS (Supple-
mentary Table S3) and the results were compared with
those determined by GC-MS (Supplementary Table S2)
The extent of the effect of severe P deficiency on the
concentrations of free amino acids was confirmed by the
LC-MS analysis (Supplementary Table S3) In the shoots
severe P deficiency led to an increase in the concentrations
of half of the amino acids especially glutamine and
asparagine (Supplementary Table S3) and a large reduction
in the concentrations of glutamate and aspartate regardless
of the ammonium concentration (01 or 04mM) (Fig 6A)
The concentrations of glutamine and asparagine also
increased in the roots (Fig 6B) but the concentrations
of some of the abundant amino acids such as alanine
aspartate glutamate and serine were decreased in the
roots irrespective of the rate of ammonium supply
(Supplementary Table S3) The changes in the levels
of amino acids generally agreed with those obtained
by GC-MS in the first experiment (PSD17 Supple-
mentary Table S2) but there were some differences in the
relative levels of some of the amino acids such as
asparagine glutamate proline and phenylalanine between
the two experiments using these two different technologies
696 Metabolite profiles in P-deficient barley plants
(Supplementary Tables S2 S3) These differences in amino
acid levels reflect the differential stabilities of the respective
amino acids to the different derivatization and detection
methodologies
The concentrations of glutamine and asparagine in
both shoots and roots were sensitive to ammonium
supplied They increased from approximately 10 mmol g1
DW in the shoots of the thornP treatment with 01mM
ammonium to 40 mmol g1 DW in the shoots of the thornP
treatment with 04mM ammonium (Fig 6A) In the
severely P-deficient plants the concentrations of glutamine
and asparagine in the shoots rose above 60 mmol g1 DW in
01mM ammonium and above 90 mmol g1 DW in 04mM
ammonium (Fig 6A) A similar magnitude of increase in
the concentrations of glutamine and asparagine was also
observed in the roots of the severely P-deficient plants
(Fig 6B) These results indicate that severe P deficiency
further increases the concentrations of glutamine and
asparagine in both shoots and roots When PthornP ratios
of amino acids in both shoots and roots of the plants treated
with 04mM ammonium were compared with those treated
with 01mM ammonium the high ammonium supply had
little effect on the PthornP ratios of amino acids except for
a reduction in the ratios of glutamine and asparagine and
140
120
100
Fre
sh w
eig
ht
(g p
lan
tminus1)
Fre
sh w
eig
ht
(g p
lan
tminus1)
P c
on
cen
trat
ion
(m
g g
minus1 D
W)
080
060
040
020
0
140minusP
+P120
100
080
060
040
Critical level
020
0
10
8
6
4
2
001 mM 04 mM
A
B
C
Fig 5 Effect of P and ammonium supply on plant growth andP nutrition (A) Fresh weight of shoots (B) Fresh weight of roots(C) P concentration of shoots Barley seedlings grown in a nutrientsolution containing either no NH4H2PO4 (P) or 01mMNH4H2PO4 (thornP) with two rates of ammonium (01 and 04mM)Plants were harvested at the 16th day after seed imbibitionStandard errors (nfrac14 4) are shown as vertical bars
1200Glu
Gln
Asp
Asn
1000
800
600
400
200
0
1200
1000
800
600
400
200
001N+P 04N+P01NminusP 04NminusP
Co
nce
ntr
atio
n (
mg g
minus1 D
W)
Co
nce
ntr
atio
n (
mg g
minus1 D
W)
A
B
Fig 6 Effect of P and ammonium supply on concentrations of fouramino acids (A) Concentrations of four amino acids in shoots(B) Concentrations of four amino acids in roots Barley seedlingsgrown in a nutrient solution containing either no NH4H2PO4 (P)or 01mM NH4H2PO4 (thornP) with two rates of ammonium (01 and04mM) Plants were harvested at the 16th day after seedimbibition The concentrations of amino acids were determinedby LC-MS (see Supplementary Table S3) Standard errors (nfrac14 4) areshown as vertical bars
Metabolite profiles in P-deficient barley plants 697
a couple of other amino acids (Supplementary Table S3)
These results indicate that the effect of severe P deficiency
on the concentrations of free amino acids in both shoots
and roots is largely independent of ammonium supply
In addition the concentrations of both glutamate
and aspartate precursors for synthesis of glutamine and
asparagine were affected by severe P deficiency The con-
centrations of glutamate and aspartate were reduced by
approximately 50 and 25 respectively in the shoots
of P treatments with either 01 or 04mM ammonium
relative to those of thornP treatments (Fig 6A and Supple-
mentary Table S3) The greater reductions in the concen-
trations of glutamate and aspartate were also observed in
the roots of P treatments with two rates of ammonium
supplied compared with those of thornP treatments (Fig 6B
and Supplementary Table S3) Interestingly the high
ammonium supplied did not reduce the concentrations of
glutamate and aspartate either in the shoots or in the roots
of thornP-treated plants (Fig 6A B Supplementary Table S3)
These results suggest that severely P-deficient plants utilize
amino acids as an alternative carbon resource especially in
the roots
Discussion
P deficiency in barley plants results in increases in di- and
trisaccharides and decreases in small P-containing
metabolites
P deficiency initially enhanced the accumulation of
di- and trisaccharides especially for maltose raffinose and
6-kestose in the shoots of the moderately P-deficient plants
(Fig 3) Only maltose increased in the roots (Fig 3
Supplementary Table S1) The transcript levels of HvPht16
(Fig 2) also indicate that roots are less sensitive to P
deficiency Severe P deficiency leads to a further increase in
di- and trisaccharides in both shoots and roots These data
are consistent with previous reports that P deficiency led
to an increase in the levels of starch sucrose and mono-
saccharides in common beans and Arabidopsis (Ciereszko
and Barbachowska 2000 Hernandez et al 2007 Nilsson
et al 2007) and a graminaceous plant Brachiaria hybrid
(Nanamori et al 2004) It also is consistent with the reduced
level of sucrose synthase in P-deficient maize roots (Li et al
2007) The increased levels of mono- di- and polysaccha-
rides suggest that glycolysis may be hindered in both shoots
and roots of P-deficient barley plants In contrast the
cDNA array analyses from lupin and rice suggest that P
deficiency stimulates glycolysis (Uhde-Stone et al 2003
Wasaki et al 2003a) It is conceivable that to maintain
a high level of organic acid secretion in the proteoid roots
of lupin a enhanced level of glycolysis is necessary under
P-deficient conditions (Pearse et al 2006) but it is not clear
why rice did not show enhanced accumulation of di- and
polysaccharides under P-deficient conditions (Nanamori
et al 2004) It appears that metabolic changes in glycolysis
in response to P deficiency differ among plant species
Severe P deficiency depleted inorganic Pi storage pools
as indicated by the sharp reduction of phosphoric acid
in the polar fractions of plant tissues to 510 of
the controls (PDS17thornPDS17 and PDR17thornPDS17
Supplementary Table S2) Under these conditions organic
P is an alternative resource of P for plant cells RNA
phospholipids and small phosphorylated metabolites are
three main classes of compounds containing phosphoesters
Degradation of RNA by increased RNase activity under
Pi-limiting conditions is well documented (Plaxton 2004)
The RNA content in the shoots of severely P-deficient
Arabidopsis plants was reduced to 13 of that in the
P-sufficient plants (Hewitt et al 2005) Considerable
amounts of organic P are present in small phosphorylated
metabolites which is approximately equivalent to that
in RNA or in phospholipids (Bieleski and Ferguson
1983 Doermann and Benning 2002) The levels of
small phosphorylated metabolites including glucose-6-P
fructose-6-P and inositol-1-P were largely reduced in both
shoots and roots of the severely P-deficient plants and the
level of glycerol-3-P in the polar fraction was also sharply
reduced in the shoots of the severely P-deficient plants
(Fig 4) The reduction of phosphorylated sugars was also
observed in bean roots and Arabidopsis under P-deficient
conditions (Rychter and Randall 1994 Morcuende et al
2007) These results indicate that severely P-deficient plants
salvage P from small phosphorylated metabolites for
essential cellular functions These small phosphorylated
metabolites are important intermediates in glycolysis and
synthesis of polysaccharides (glucose-6-P and fructose-6-P)
phospholipids (glycerol-3-P and inositol-1-P) amino acids
and nucleotides and in energy production Thus a depletion
of these phosphorylated metabolites would have a severe
impact not only on carbohydrate and nitrogen metabolism
but also on other metabolic processes
The enhanced accumulation of di- and tri-saccharides
in P-deficient plants can reduce the consumption of Pi in
phosphorylation of sugar metabolites and convert the small
phosphorylated metabolites to non-P-containing di- and
trisaccharides and other compounds such as aromatic
compounds (Figs 3 4) This could be a strategy to reduce
Pi consumption but may also have a benefit in osmotic
protection for stressed plants Increased accumulation of
di- and trisaccharides such as raffinose has been described
in plants exposed to heat stress (Panikulangara et al 2004)
and sulfate deficiency (Nikiforova et al 2005) maltose in
acute temperature stress (Kaplan and Guy 2004) and
6-kestose a precursor for synthesis of fructans under
drought conditions (Hendry 1993 Amiard et al 2003)
However carbohydrate formed as di- and trisaccharides
698 Metabolite profiles in P-deficient barley plants
shown to accumulate in P-deficient plants cannot be utilized
readily for energy metabolism without involvement of Pi
to provide carbon metabolites for the TCA cycle An
alternative storage form of carbon such as organic acids
and amino acids would be preferred for survival of
P-deficient plants (Nanamori et al 2004)
P deficiency reduces organic acids in the TCA cycle
The reduced levels of several organic acids of the TCA
cycle including a-ketoglutarate succinate fumarate and
malate (Fig 4) and the reduction in the concentrations
of glutamate and aspartate especially in the roots of
the severely P-deficient plants (Fig 6B) suggest that the
shortage in carbohydrate supply is more apparent in the
roots than in the shoots of severely P-deficient plants
Reduced levels of fumarate were also observed in
P-deficient Arabidopsis (Misson et al 2005) In addition P
deficiency increases the secretion of organic acids into the
rhizosphere although cereals are weak secretors of organic
acids compared with legumes under low P conditions
(Neumann and Romheld 1999 Pearse et al 2006) The
secretion of organic acids could also contribute to
the reduction of the organic acids in the root tissues The
roots of severely P-deficient plants have to adjust metabolic
processes to utilize possible carbon metabolites such as
amino acids Some of the amino acids could be utilized as
an alternative carbon resource for energy production
reassimilation of the released ammonium and synthesis of
organic acids for secretion Interestingly the levels of several
organic acids in the TCA cycle were also reduced in
the roots of P-deficient common beans (Hernandez et al
2007) As legumes are efficient secretors of organic acids
(Neumann and Romheld 1999 Pearse et al 2006) secretion
could be a significant contributor to the reduced levels of
organic acids in the roots Nevertheless no reduction in
small P-containing metabolites nor organic acids in the
TCA cycle is observed in sulfate-deficient Arabidopsis plants
(Hirai et al 2004 Nikiforova et al 2005) indicating that
the reduction in the organic acids is unique to P-deficient
plant species
Severe P deficiency alters nitrogen metabolism
In P-deficient conditions transcript levels of the
genes coding for enzymes involved in protein degradation
were enhanced and the genes for protein synthesis were
suppressed in both Arabidopsis and common beans
(Wu et al 2003 Misson et al 2005 Hernandez et al
2007) The abundance of proteins related to protein
degradation through the ubiquitinndash26S proteasome path-
way was found to have increased in P-deficient roots of
maize (Li et al 2007) The reduced transcript levels of genes
related to nitrate reduction (Wu et al 2003) and reduced
activities for nitrate reduction have also been described in
P-deficient plants (Gniazdowska and Rychter 2000)
The increased concentrations of total free amino acids in
the shoots of severely P-deficient plants (Supplementary
Table S3) are likely to result from increased protein
degradation and repressed protein synthesis Various
metabolic reactions involved in either synthesis or degrada-
tion of amino acids produce ammonia such as aspara-
gine to aspartate glutamine to glutamate glutamate to
a-ketoglutarate and glycine to serine P deficiency enhances
the transcript levels of alanine aminotransferase genes
in both Arabidopsis and common beans (Wu et al 2003
Hernandez et al 2007) and the protein abundance of
glutamate dehydrogenase and phenylalanine ammonia-
lyase in maize roots (Li et al 2007) A high concentration
of ammonium is harmful to plants especially for barley an
ammonium-sensitive plant (Britto and Kronzucker 2002)
Thus it is critical to avoid excessive accumulation of
ammonium in P-deficient plants The levels of glutamine
and asparagine were elevated in both shoots and roots of
severely P-deficient plants and other metabolites related to
ammonium metabolism including putrescine and tyramine
were also enhanced in the severely P-deficient plants
especially in the roots (Supplementary Table S2) The
increased level of putrescine was also observed in P-deficient
rice cells (Shih and Kao 1996) These data suggest that
deamination of amino acids occurs in the severely
P-deficient plants for utilization in carbon metabolism
and a concomitant increase in assimilation of ammonium
takes place to ensure a reduction in levels of ammonium
The increased activities of glutamate dehydrogenase and
glutamine synthase in Arabidopsis plants (Morcuende et al
2007) and the enhanced protein abundance of root
glutamate dehydrogenase and glutamine synthase observed
in P-deficient maize plants (Li et al 2007) support this
interpretation It is interesting to note that the transcript
levels of glutamate synthase were down-regulated by P
deficiency in rice (Wasaki et al 2003a) Rice is an
ammonium-tolerant species which is in contrast to barley
that is an ammonium-sensitive species (Britto and
Kronzucker 2002) The difference in the metabolite levels
related to ammonium metabolism between P-deficient
barley and rice may be due to this different mechanism of
tolerance to ammonium
The synthesis of glutamine and asparagine requires
a carbon skeleton The enhanced levels of glutamine
and asparagine will require additional molecules of
a-ketoglutarate and oxaloacetate withdrawn from the
TCA cycle leading to a further reduction in the levels
of organic acids and restriction in energy production
in severely P-deficient plants The increased levels of
glutamine asparagine and other metabolites closely
related to ammonium metabolism are also observed in
other nutrient stresses such as nitrogen and sulfate
Metabolite profiles in P-deficient barley plants 699
deficiency (Hirai et al 2004 Nikiforova et al 2005) but
the specific reduction in glutamate and aspartate is
only observed in P-deficient barley plants As synthesis
of glutamine and asparagine can incorporate two ammo-
nium molecules into one organic acid this is a highly
effective ammonium assimilation mechanism under the
carbohydrate-limiting conditions caused by P deficiency
Our metabolite analyses provide indirect evidence that
P-deficient plants are confronted with increased ammonium
To establish a direct link of P deficiency to the increased
accumulation of ammonium in barley tissues further
experiments are required by supplying low concentrations
of ammonium and monitoring ammonium levels in plant
tissues
The increased levels of glycine and serine in the shoots
of the severely P-deficient plants indicate that photorespira-
tion is enhanced in the shoots of the severely P-deficient
plants because glycine and serine are intermediates for
photorespiration (Wingler et al 2000) and the increased
levels of glycine and serine correlate well with the rate of
photorespiration in P-deficient bean plants (Kondracka and
Rychter 1997) Increases in the levels of glycine and serine
were also observed in sulfur-deficient Arabidopsis plants
(Nikiforava et al 2005) indicating that the increase in
photorespiration is a general stress response (Wingler et al
2000)
Carbohydrate partitioning in P-deficient barley differs
from a P-efficient Gramineae grass
P deficiency results in the enhanced accumulation of
di- and trisaccharides and reduced organic acids in barley
plants which generally is similar to rice a P-inefficient
plant (Nanamori et al 2004) A P-efficient grass (Brachiaria
hybrid) is very different from rice in carbohydrate par-
titioning under P-deficient conditions (Nanamori et al
2004) The Brachiaria hybrid can allocate more carbohy-
drates into organic acids and amino acids Maintaining high
activities of phosphoenolpyruvate carboxylase and phos-
phoenolpyruvate phosphatase under the low P condition
appears to be critical for allocating a large proportion of
carbohydrate into organic acids and amino acids Our data
suggest that barley behaves as a P-inefficient plant in
metabolic adaptation to low P environments Thus to
improve P efficiency in barley and perhaps other cereal
crops manipulation of metabolism through a shift in
carbohydrate partitioning could provide a logical strategy
In summary the metabolite profiles generated from
both shoots and roots provide an overview of the metabolic
adjustments that occur in P-deficient barley plants As
illustrated in Fig 7 P-deficient barley plants alter the levels
of many key metabolites which affect various metabolic
pathways including glycolysis photorespiration and
metabolism of nitrogen and phospholipids These adaptive
P inefficiency
P efficiency
ribose
inositol-1-P
glycine(shoots)
serine(shoots)
alanine(shoots)
aspartate
asparagine malate
fumarate
succinate
citrate
a-ketoglutarate
glutamine
glutamate
urea(roots)
glc
glc-6-P
fru
glycerol-3-P
aromaticcompounds
fru-6-P
di- and tri-saccharides
Carbohydratepartitioning
glycerate-3-P
PEP
pyruvate
oxaloacetate
Fig 7 Schematic summary of metabolic adjustments in P-deficient plants and the proposed carbohydrate partitioning for improvementof P efficiency in cereals Thick arrows in green indicate an increase in metabolite levels and thin arrows in red indicate a decreasein metabolite levels The dashed line indicates carbohydrate partitioning for high P efficiency (below the line) and for low P efficiency(above the line)
700 Metabolite profiles in P-deficient barley plants
adjustments reduce Pi consumption by increasing the
levels of di- and trisaccharides and salvage Pi from various
P-containing compounds including small P-containing
metabolites to maintain essential cellular functions An
immediate consequence which is unique to P deficiency is
greatlly reduced levels of the key metabolites in glycolysis
leading to the decrease in carbohydrate supply to the TCA
cycle especially in the roots In addition P-deficient plants
are likely to be confronted with the challenge of increased
ammonium derived from the degradation of protein The
assimilation of the increased ammonium requires additional
organic acids from the TCA cycle which depletes the
organic acid supply further It is noteworthy that although
there are di- and trisaccharides present in the P-deficient
plants they cannot be readily utilized Organic acids and
amino acids are the preferred storage metabolites in
P-deficient plants (Nanamori et al 2004) as they can be
readily utilized as the carbon resource by P-deficient plants
Therefore if barley (and other cereals) are to be engineered
to be better adapted to growth in P-deficient soils there
is a need to shift the partitioning of carbohydrate from
di- and tri-saccharides to organic acids and amino acids
Investigating the expression of genes (transcriptome) and
proteins (proteome) in barley under P-deficient conditions
would provide additional evidence to support this strategy
for enhancing the P efficiency
Materials and Methods
Plant materials
Barley (H vulgare L cv Lofty Nijo) seeds were surface-sterilized with 70 ethanol for 1min and 3 hypochlorite for5min rinsed with deionized water and incubated in Petri dishes for2 d at room temperature Two seeds with an emerged radicle wereput into a seedling cup which was placed in the lid of a black plasticcontainer Each container contained either four seedling cups fortwo harvests or two seedling cups for one harvest and were filledwith 1 liter of nutrient solution The basal nutrients were as follows(in mM) Ca(NO3)2 1000 KNO3 1000 MgSO4 250 KCl 50H3BO3 125 Fe-HEDTA 10 MnSO4 04 CuSO4 01 ZnSO405 NiSO4 01 and MoO3 01 with NH4H2PO4 100 (thornPtreatment) or without NH4H2PO4 (P treatment) To balanceNH4 ions added in the thornP treatment 100 mM NH4NO3 was addedinto the nutrient solution of the P treatment In the additionalexperiment with two levels of ammonium either 100 or 400 mMNH4NO3 was added in the thornP treatment and either nil or 300 mMNH4NO3 was added in the P treatment All treatments werereplicated four times Half-strength nutrient solution was useduntil the 10th day after seed imbibition for the plants harvested atday 10 and day 17 but the eighth day for the plants harvestedat day 16 Full strength was applied thereafter The full-strengthnutrient solution was replaced at day 14 for the plants harvested atday 17 but at day 12 for the plants harvested at day 16 The pH ofthe nutrient solution was adjusted to 60 with 1M KOH and thesolution was aerated continuously
Plants were grown in a controlled environment at 208Cday158C night with a photoperiod regime of 14 h day10 h nightat 300 mmolm2 sndash1 photon flux intensity at the plant level At each
harvest two seedling cups were removed from each containerPlants were collected in 5ndash6 h of the light period to eliminatediurnal changes in metabolite levels The roots of plants from oneseedling cup were rinsed briefly in deionized water excess waterwas blotted on fresh laboratory tissues and the roots and shootswere separated and oven-dried at 658C for 48 h The dry plantsamples were used for mineral element analysis by inductivelycoupled plasma spectrophotometry (Zarcinas et al 1987) Anothercup of plants was separated into roots and shoots frozenimmediately in liquid nitrogen and stored at 808C for metaboliteand transcript analyses
Real-time quantitative RTndashPCR
Shoots and roots of three replicates from each P treatmentwere used for transcript analysis Total RNA was prepared usingTrizol reagent according to the manufacturerrsquos instructions(Invitrogen Carlsbad CA USA) Total RNA was treated withDNase I using the DNA free kit (Ambion Austin TX USA) toremove any contaminating genomic DNA and then RNA integritywas checked on an agarose gel cDNA was prepared from 2mg oftotal RNA using SuperScriptTM III reverse transcriptase accord-ing to the manufacturerrsquos instructions (Invitrogen) The reactionwas incubated at 508C for 45min and at 708C for 15min toinactivate the enzyme
The transcript levels of HvIPS1 and HvPht16 weredetermined by real-time quantitative PCR essentially as describedby Burton et al (2004) The transcript levels of three control genes(barley a-tubulin heat shock protein 70 and cyclophilin) weredetermined and used for normalization Normalization was carriedout as described by Vandesompele et al (2002) and Burtonet al (2004) The normalized copies mg RNA1 are presentedThe primers 50 GCGGCGACTTCTCACCTCTACTAAG and50 CGAAGGATTCAAACAGGATCACACA (GenBank acces-sion No BI780234) were used for amplification of HvIPS1 and50 GGTCAAGAACTCGCTATTCATCC and 50 CCATACATCCATCCAAACCTG (GenBank accession No AF543198) foramplification of HvPht16
Analysis of metabolites with GC-MS
Metabolite analysis was carried out by a GC-MS-basedmethod modified from Roessner et al (2006) Fresh tissues of rootsand shoots from barley plants were homogenized using a mortarand pestle with liquid nitrogen Frozen tissue powder (100 10mgexact fresh weight was recorded) was extracted with methanol(350 ml) A polar internal standard (20 ml of 02mgmlndash1 ribitol inwater) and a non-polar internal standard (30 ml of 2mgmlndash1
nonadecanoic acid methylester in chloroform) were subsequentlyadded as quantification standards The mixture was extracted for15min at 708C and then mixed vigorously with 1 vol of waterIn order to separate polar and non-polar metabolites 300 ml ofchloroform was added to the mixture and centrifuged at 2200gfor 10min The upper methanolwater phase was collected andwashed with chloroform (300 ml) The polar phase of shoot extracts(100 ml) and root extracts (250 ml) was separately dried undervacuum Both lipid layers were combined and dried under vacuumIn order to methylate fatty acids the residues of the non-polarfractions were further incubated with chloroform (100 ml) andacidified methanol (300 ml of 125N HCl in methanol) for 24 h at508C and afterwards dried under vacuum The dry polar residuewas redissolved and derivatized for 120min at 378C in methox-yamine hydrochloride (40 ml of 20mgml1 in pyridine) followedby a 30min treatment with N-methyl-N-[trimethylsilyl] trifluoro-acetamide (MSTFA) (70 ml) at 378C The dry non-polar residue
Metabolite profiles in P-deficient barley plants 701
was derivatized for 60min at 378C in pyridine (70 ml) and MSTFA(40 ml) To both a retention time standard mixture [10 ml of 0029(vv) n-dodecane n-pentadecane n-nonadecane n-docosanen-octacosane n-dotracontane n-hexatriacontane dissolved inpyridine] was added prior to trimethylsilylation Sample volumesof 1ml were then injected using the splitless mode onto a GCcolumn using a hot needle technique
The GC-MS system and conditions were as described inRoessner et al (2006) Acquired total ion chromatograms andmass spectra were evaluated using the Xcalibur program(ThermoFinnigan Manchester UK) and the resulting data areprepared normalized and presented as described by Roessner et al(2001) Mass spectra of eluting compounds were identified usingthe commercial mass spectra library NIST (httpwwwnistgov)and the public domain mass spectra library of the Max-Planck-Institute for Plant Physiology Golm Germany (httpcsbdbmpimp-golmmpgdecsbdbdbmamsrihtml) All matchingmass spectra were additionally co-verified by determination of theretention time and mass spectra by analysis of authentic standardsubstances
Analysis of free amino acids with LC-MS
Leaf material (15mg) was accurately weighed intoEppendorf tubes (2ml) and a solution of EDTA (400 ml 5mM)was added to each sample The samples were sonicated for15min then heated in a water bath (808C 15min) centrifuged(14500 rpm 5min) and the supernatant derivatized Thederivatization of the amino acids is based on a procedure outlinedby Cohen and Michaud (1993) and involved mixing the super-natant obtained above (20 ml) with borate buffer (200 ml 02MpH 88) followed by the addition of 10mM 6-aminoquinolyl-N-hydroxysuccinimidyl carbamate solution (50 ml) in dry aceto-nitrile The reaction mixture was then heated at 558C in a waterbath for 10min and analyzed by LC-MS as described by Callahanet al (2007)
The LC-MS system comprised a Surveyor LC PumpSurveyor Auto Sampler and LCQ Deca XP Max ion trapMS (Thermo Finnigan USA) The ESI (electron spray ionization)source was optimized by infusing a derivatized amino acidstandard in line with the mobile phase then tuning the sourceconditions and ion optics to optimize the signals for the derivatizedamino acids This resulted in the following conditions sheath gas30 arbitrary units auxiliary gas 10 arbitrary units spray voltage30 kV capillary temperature 2508C capillary voltage 56V andtube lens 53V
Derivatized amino acids were eluted on an Altantis dC18150 21mm 3mm (Waters Melbourne Australia) HPLC columnusing a three-step gradient of deionized water (01 formic acid)and acetonitrile (01 formic acid) at a flow rate of 025mlminndash1
and a column temperature of 308C (Callahan et al 2007)
Statistical analysis
Students t-test at P 005 was applied for the means (nfrac14 4) ofmetabolites presented in Supplementary Tables S1ndashS3 Statisticalanalyses were carried using the Pirouette 311 software (InfometrixInc Woodinville WA USA)
Supplementary material
Supplementary material mentioned in the article is avail-able to online subscribers at the journal website wwwpcpoxfordjournalsorg
Funding
The Grains Research and Development Corporation
the Australian Research Council the South Australian
Government the University of Adelaide and the University
of Melbourne to the Australian Center for Plant Functional
Genomics (CYH UR NS PL AB) the Molecular
Plant Breeding CRC to YG Metabolomics Australia to
(UR DC AB)
Acknowledgments
We are grateful to M Tester for discussion and to T Fowlesand L Palmer for ICP analysis
References
Amiard V Morvan-Bertrand A Billard JP Huault C Keller F andPrudrsquohomme MP (2003) Fructans but not the sucrosyl-galactosidesraffinose and loliose are affected by drought stress in perennial ryegrassPlant Physiol 132 2218ndash29
Bieleski RL and Ferguson IB (1983) Physiology and metabolism ofphosphate and its compounds In Encyclopedia of Plant PhysiologyEdited by Lauchli A and Bieleski RL Vol 15a pp 422ndash449 SpringerVerlag Berlin
Bolling C and Fiehn O (2005) Metabolite profiling of Chlamydomonasreinhardtii under nutrient deprivation Plant Physiol 139 1995ndash2005
Britto DT and Kronzucker HJ (2002) NH4thorn toxicity in higher plants
a critical review J Plant Physiol 159 567ndash584Burleigh SH and Harrison MJ (1997) A novel gene whose expression in
Medicago truncatula roots is suppressed in response to colonization byvesicularndasharbuscular mycorrhizal (VAM) fungi and to phosphatenutrition Plant Mol Biol 34 199ndash208
Burton RA Shirley NJ King BJ Harvey AJ and Fincher GB(2004) The CesA gene family of barley Quantitative analysis oftranscripts reveals two groups of co-expressed genes Plant Physiol134 224ndash236
Callahan DL Kolev SD OrsquoHair RAJ Salt DE and Baker AJM(2007) Relationships between nicotianamine and other amino acids withnickel zinc and iron in Thlaspi hyperaccumulators New Phytol 176836ndash848
Ciereszko I and Barbachowska A (2000) Sucrose metabolism in leavesand roots of bean (Phaseolus vulgaris L) during phosphate deficiencyJ Plant Physiol 156 640ndash644
Cohen SA and Michaud DP (1993) Synthesis of a fluorescentderivatizing reagent 6-aminoquinolyl-N-hydroxysuccinimidyl carba-mate and its application for the analysis of hydrolysate amino acidsvia high-performance liquid chromatography Anal Biochem 211279ndash287
Cruz-Ramirez A Oropeza-Aburto A Razo-Hernandez F Ramirez-Chavez E and Herrera-Estrella L (2006) Phospholipase DZ2 playsan important role in extraplastidic galactolipid biosynthesis andphosphate recycling in Arabidopsis roots Proc Natl Acad Sci USA103 6765ndash6770
Doermann P and Benning C (2002) Galactolipids rule in seed plantsTrends Plant Sci 7 112ndash118
Gniazdowska A and Rychter AM (2000) Nitrate uptake by bean(Phaseolus vulgaris L) roots under phosphate deficiency Plant Soil 22679ndash85
Hendry GAF (1993) Evolutionary origins and natural functions offructansmdasha climatological biogeographic and mechanistic appraisalNew Phytol 123 3ndash14
Hernandez G Ramirez M Valdes-Lopez O Tesfaye MGraham MA et al (2007) Phosphorus stress in common bean roottranscript and metabolic responses Plant Physiol 144 752ndash767
702 Metabolite profiles in P-deficient barley plants
Hewitt MM Carr JM Williamson CL and Slocum RD (2005)Effects of phosphate limitation on expression of genes involved in
pyrimidine synthesis and salvaging in Arabidopsis Plant Physiol
Biochem 43 91ndash99Hirai MY Yano M Goodenowe DB Kanaya S Kimura T
Awazuhara M Arita M Fujiwara T and Saito K (2004) Integration
of transcriptomics and metabolomics for understanding of global
responses to nutritional stresses in Arabidopsis thaliana Proc Natl
Acad Sci USA 101 10205ndash10210Hou XL Wu P Jiao FC Jia QJ Chen HM Yu J Song XW
and Yi KK (2005) Regulation of the expression of OsIPS1 and OsIPS2in rice via systemic and local Pi signaling and hormones Plant Cell
Environ 28 353ndash364Jeschke WD Kirkby EA Peuke AD Pate JS and Hartung W
(1997) Effects of P deficiency on assimilation and transport of nitrate andphosphate in intact plants of castor bean (Ricinus communis L) J Exp
Bot 48 75ndash91Kaplan F and Guy CL (2004) Beta-amylase induction and the protective
role of maltose during temperature shock Plant Physiol 135 1674ndash1684Kondracka A and Rychter AM (1997) The role of Pi recycling processes
during photosynthesis in phosphate-deficient bean plants J Exp Bot 48
1461ndash1468Kopka J (2006) Current challenges and developments in GC-MS based
metabolite profiling technology J Biotechnol 124 312ndash322Li K Xu C Zhang K Yang A and Zhang J (2007) Proteomic
analysis of roots growth and metabolic changes under phosphorus deficitin maize (Zea mays L) plants Proteomics 7 1501ndash1512
Liu CM Muchhal US and Raghothama KG (1997) Differential
expression of TPS11 a phosphate starvation-induced gene in tomatoPlant Mol Biol 33 867ndash874
Martin AC del Pozo JC Inglesias J Rubio V Solano Rde la Pena A Leyva A and Paz-Ares J (2000) Influence of cytokinins
on the expression of phosphate starvation responsive genes inArabidopsis Plant J 24 559ndash567
Mimura T (1999) Regulation of phosphate transport and homeostasis inplant cells Int Rev Cytol Cell Biol 191 149ndash200
Misson J Raghothama KG Jain A Jouhet J Block MA et al
(2005) A genome-wide transcriptional analysis using Arabidopsis thaliana
Affymetrix gene chips determined plant responses to phosphate depriva-
tion Proc Natl Acad Sci USA 102 11934ndash11939Morcuende R Bari R Gibon Y Zheng WM Pant BD Blasing O
Usadel B Czechowski T Udvardi MK Stitt M and Scheible WR(2007) Genome-wide reprogramming of metabolism and regulatory
networks of Arabidopsis in response to phosphorus Plant Cell Environ
30 85ndash112Muchhal US and Raghothama KG (1999) Transcriptional regulation of
plant phosphate transporters Proc Natl Acad Sci USA 96 5868ndash72Nanamori M Shinano T Wasaki J Yamamura T Rao IM and
Osaki M (2004) Low phosphorus tolerance mechanisms phosphorus
recycling and photosynthate partitioning in the tropical forage grassBrachiaria hybrid cultivar mulato compared with rice Plant Cell Environ
45 460ndash469Neumann G and Romheld V (1999) Root excretion of carboxylic acids
and protons in phosphorus-deficient plants Plant Soil 211 121ndash130Nikiforova VJ Gakiere B Kempa S Adamik M Willmitzer L
Hesse H and Hoefgen R (2004) Towards dissecting nutrient
metabolism in plants a systems biology case study on sulphur
metabolism J Exp Bot 55 1861ndash1870Nikiforova VJ Kopka J Tolstikov V Fiehn O Hopkins L
Hawkesford MJ Hesse H and Hoefgen R (2005) Systems rebalan-
cing of metabolism in response to sulfur deprivation as revealed bymetabolome analysis of Arabidopsis plants Plant Physiol 138 304ndash318
Nilsson L Muller R and Nielsen TH (2007) Increased expression of theMYB-related transcription factor PHR1 leads to enhanced phosphate
uptake in Arabidopsis thaliana Plant Cell Environ 30 1499ndash1512
Panikulangara TJ Eggers-Schumacher G Wunderlich M Stransky Hand Schoffl F (2004) Galactinol synthase 1 A novel heat shock factortarget gene responsible for heat-induced synthesis of raffinose familyoligosaccharides in Arabidopsis Plant Physiol 136 3148ndash3158
Pearse SJ Veneklaas EJ Cawthray G Bolland MDA andLambers H (2006) Triticum aestivum shows a greater biomass responseto a supply of aluminium phosphate than Lupinus albus despite releasingfewer carboxylates into the rhizosphere New Phytol 169 515ndash524
Plaxton WC (2004) Plant response to stress biochemical adaptations tophosphate deficiency In Encyclopedia of Plant and Crop Science Editedby Goodman R pp 976ndash980 Marcel Dekker Inc New York
Plaxton WC and Carswell MC (1999) Metabolic aspects of thephosphate starvation response in plants In Plant Response toEnvironmental Stresses From Photohormones to GenomeReorganization Edited by Lerner HR pp 349ndash372 Marcel DekkerInc New York
Rae AL Cybinski DH Jarmey JM and Smith FW (2003)Characterization of two phosphate transporters from barley evidencefor diverse function and kinetic properties among members of the Pht1family Plant Mol Biol 53 27ndash36
Raghothama KG (1999) Phosphate acquisition Annu Rev Plant PhysiolPlant Mol Biol 50 665ndash693
Reuter DJ and Robinson JB (1997) Plant Analysis An InterpretationManual 2nd edn pp 86ndash92 CSIRO Australia Melbourne
Roessner U Luedemann A Brust D Fiehn O Linke TWillmitzer L and Fernie AR (2001) Metabolic profiling allowscomprehensive phenotyping of genetically or environmentally modifiedplant systems Plant Cell 13 11ndash29
Roessner U Patterson JH Forbes MG Fincher GB Langridge Pand Bacic A (2006) An investigation of boron toxicity in barley usingmetabolomics Plant Physiol 142 1087ndash1101
Rychter AM and Randall DD (1994) The effect of phosphate deficiencyon carbohydrate metabolism in bean roots Physiol Plant 91 383ndash388
Schachtman DP Reid RJ and Ayling SM (1998) Phosphorus uptakeby plants from soil to cell Plant Physiol 116 447ndash453
Shih CY and Kao CH (1996) Growth inhibition in suspension-culturedrice cells under phosphate deprivation is mediated through putrescineaccumulation Plant Physiol 111 721ndash724
Uhde-Stone C Zinn KE Ramirez-Yanez M Li AG Vance CP andAllan DL (2003) Nylon filter arrays reveal differential gene expressionin proteoid roots of white lupin in response to phosphorus deficiencyPlant Physiol 131 1064ndash1079
Vance CP Uhde-Stone C and Allan DL (2003) Phosphorus acquisitionand use critical adaptations by plants for securing a non renewableresource New Phytol 157 423ndash447
Vandesompele J De Preter K Pattyn F Poppe B Van Roy NDe Paepe A and Speleman F (2002) Accurate normalization of real-time quantitative RTPCR data by geometric averaging of multipleinternal control genes Genome Biol 3 1ndash11
Wasaki J Yonetani R Kuroda S Shinano T Yazaki J et al (2003a)Transcriptomic analysis of metabolic changes by phosphorus stress in riceplant roots Plant Cell Environ 26 1515ndash1523
Wasaki J Yonetani R Shinano T Kai M and Osaki M (2003b)Expression of the OsPI1 gene cloned from rice roots using cDNAmicroarray rapidly responds to phosphorus status New Phytol 158239ndash248
Wingler A Lea PJ Quick WP and Leegood RC (2000)Photorespiration metabolic pathways and their role in stress protectionPhilos Trans R Soc B Biol Sci 355 1517ndash1529
Wu P Ma L Hou X Wang M Wu Y Liu F and Deng XW (2003)Phosphate starvation triggers distinct alterations of genome expression inArabidopsis roots and leaves Plant Physiol 132 1260ndash1271
Zarcinas BA Cartwright B and Spouncer LR (1987) Nitric aciddigestion and multi-element analysis of plant material by induc-tively coupled plasma spectrometry Commun Soil Sci Plant Anal 18131ndash146
(Received February 21 2008 Accepted March 13 2008)
Metabolite profiles in P-deficient barley plants 703
to mild P deficiency than others such as amino acids and
organic acids In addition it is obvious that shoots are more
responsive than roots to mild P deficiency
Metabolite profiles of shoots and roots in severely P-deficient
plants
The ratios (PthornP) of a wide spectrum of polar
metabolites were altered in 17-day-old P-deficient plants
(Supplementary Table S2) The elevated levels of di- and
trisaccharides remained in the shoots of severely P-deficient
plants (Fig 3) and more changes in di- and trisaccharides
including maltose (27-fold) sucrose (1374-fold) raffinose
(72-fold) and 6-kestose (70-fold) occurred in the roots
(Fig 4) Although the ratio of sucrose (PthornP) in the roots
of 17-day-old plants was extremely high the level of sucrose
(183) in the roots of the severely P-deficient plants
(Supplementary Table S2) was only slightly lower than
that (231) in the mildly P-deficient plants (Supplementary
Table S1) The extremely high ratio of sucrose in the roots
of the severely P-deficient plants is mainly due to the largely
reduced level of sucrose (01) in thornP-treated roots at day 17
(Fig 4 and Supplementary Table S2) In addition a large
increase in shikimate (120-fold) was observed in the roots
Ribose was the only monosaccharide which was reduced
03- to 06-fold in both shoots and roots of severely
P-deficient plants The levels of other monosaccharides
were either unaffected or increased (Fig 4) However Pi
levels in the polar fraction of the severely P-deficient plants
were sharply reduced to approximately 10 of those in
thornP-treated plants (phosphoric acid in the polar fraction of
di- and tri-saccharidesraffinose(335plusmn008)721plusmn012
glc(113plusmn004)095plusmn019
shikimate(199plusmn019)1204plusmn003
fru(151plusmn005)137plusmn010
inositol(116plusmn007)119plusmn005
serine(267plusmn009)125plusmn011
glycine(906plusmn002)157plusmn011
glc-6-P(014plusmn012)007plusmn010
fru-6-P(011plusmn005)008plusmn012
glyserol-3-P(015plusmn029)088plusmn008
inositol-1-P(040plusmn012)026plusmn024
glycerol(088plusmn004)198plusmn008
ribose(061plusmn020)030plusmn008
tryptophan(5454plusmn042)
ndb-alanine(083plusmn005)038plusmn007
alanine(296plusmn007)064plusmn011
asparagine(194plusmn024)295plusmn016
succinate(082plusmn005)068plusmn005
fumarate(082plusmn003)054plusmn007
aspartate(085plusmn005)051plusmn022
malate (074plusmn003)073plusmn019
citrate (122plusmn020)139plusmn007
glutamate(148plusmn016)243plusmn006
a-ketoglutarate(036plusmn015)075plusmn015
urea(nd)
3315plusmn009
sucrose(114plusmn005)13741plusmn007
6-kestose(1248plusmn009)
695plusmn014
maltose(612plusmn020)273plusmn008
fructan
lipids
starch
glycerate-3-P
PEP
pyruvate
oxaloacetate
aromatic compounds
Fig 4 Effect of P supply on the levels of primary polar metabolites from shoots and roots of 17-day-old plants Barley seedlings weregrown in a nutrient solution with 01mM NH4H2PO4 (thornPi) or without NH4H2PO4 addition (P) harvested at day 17 after seed imbibitionand separated into shoots and roots A metabolic pathway is used to show the levels of the primary metabolites determined by GC-MS Themetabolites measured by GC-MS are shown in bold and undetermined metabolites in a regular font Relative ratios (PthornP) of metabolitein the shoots (in parentheses) and roots (no parentheses) are presented as means SE (nfrac14 4) Significant differences (P 005) in the ratiosbetween the P and thornP treatments are indicated in green for the increased ratios and in red for the reduced ratios
Metabolite profiles in P-deficient barley plants 695
Supplementary Table S2) and the concomitant reduction in
phosphorylated sugars including glucose-6-P fructose-6-P
glycerol-3-P and inositol-1-P was also observed in both
shoots and roots of the severely P-deficient plants at day 17
(Fig 4 and Supplementary Table S2) The levels of seve-
ral organic acids of the TCA cycle were also reduced in
the severely P-deficient plants including a-ketoglutarate(04-fold) and malate (07-fold) in the shoots and succinic
acid (07-fold) and fumaric acid (05-fold) in the roots
(Fig 4)
There were hardly any changes in the levels of amino
acids in both shoots and roots of the mildly P-deficient
plants when compared with thornP-treated plants (Supplemen-
tary Table S1) but the levels of two-thirds of the amino
acids were increased in the shoots of the severely P-deficient
plants (PSD17 Supplementary Table S2) In addition
the polyamine putrescine was increased in shoots (PSD17
Supplementary Table S2) Similarly dramatic changes in
the levels of the amino acids and metabolites related to
ammonium metabolism were also observed in the roots of
severely P-deficient plants There was an increase in the
levels of asparagine (30-fold) glutamate (24-fold) and
putrescine (23-fold) in the roots of the severely P-deficient
plants as well as a sharp increase in the level of urea up to
332-fold in roots (Fig 4) This high ratio of the urea level
was due to the combination of an increase of urea (25-fold)
in the roots of the severely P-deficient plants (PRD17
Supplementary Table S2) compared with that of the mildly
P-deficient plants (PRD10 Supplementary Table S1)
and a reduction of the urea level from 08 in the roots of
thornP-treated plants at day 10 (thornPRD10 Supplementary
Table S1) to 01 at day 17 (thornPRD17 Supplementary
Table S2) These data should be viewed cautiously as the
quantification of urea by GC-MS can be unreliable so an
alternative approach would need to be utilized to explore
this effect further Furthermore the level of aspartate in the
roots of the severely P-deficient plants was reduced to
05-fold (Fig 4) The significant change in the metabolites
related to ammonium assimilation suggests that the severe
P deficiency increases levels of ammonium leading to
alterations in ammonium assimilation
Effect of severe P deficiency on the concentrations of free
amino acids
The observations described above led us to conduct
an additional experiment to determine the effect of severe P
deficiency on amino acid metabolism Absolute concentra-
tions of free amino acids were determined using LC-MS to
complement the data obtained by GC-MS In the additional
experiment the nutrient solutions were supplemented with
two levels of ammonium (01 and 04mM) The low
ammonium treatment (01mM) was the same as that used
for plant growth in the first experiment (Fig 1) The high
ammonium treatment (04mM) is designed to investigate
the effect of external ammonium supply on the accumula-
tion of free amino acids in P-deficient plants and to prevent
possible depletion of ammonium in the nutrient solution
when only low concentrations (01mM) were supplied
Barley is an ammonium-sensitive species (Britto and
Kronzucker 2002) We determined that the maximum
level of ammonium that could be added to the nutrient
solution without obvious adverse effect on plant growth
was 04mM with co-provision of ammonium and nitrate
In thornP treatments shoot fresh weights for the 01 and
04mM ammonium treatments were similar (Fig 5A) but
the fresh weight of roots in the 04mM ammonium
treatment was 072 g plantndash1 which was slightly lower
than that of 081 g plantndash1 in the 01mM treatment (Fig 5B)
In contrast plant growth in the P treatment supplied with
either 01 or 04mM ammonium was severely retarded
compared with that of thornP treatment (Fig 5A B) The
growth inhibition in both shoots and roots was similar to
that shown in Fig 1A P concentrations in the shoots
of thornP-treated plants supplemented with either 01 or
04mM ammonium were above the critical levels (Reuter
and Robinson 1997) whereas those in the shoots of
P-treated plants were 12mg P gndash1 DW for the 01mM
ammonium treatment which is equal to that observed
in the severely P-deficient plants in the first experiment
(Fig 1B) but slightly lower (10mg P gndash1 DW) in the
04mM ammonium treatment than that in the 01mM
ammonium treatment (Fig 5C)
The concentrations of all 20 amino acids and GABA
(g-aminobutyric acid) were obtained by LC-MS (Supple-
mentary Table S3) and the results were compared with
those determined by GC-MS (Supplementary Table S2)
The extent of the effect of severe P deficiency on the
concentrations of free amino acids was confirmed by the
LC-MS analysis (Supplementary Table S3) In the shoots
severe P deficiency led to an increase in the concentrations
of half of the amino acids especially glutamine and
asparagine (Supplementary Table S3) and a large reduction
in the concentrations of glutamate and aspartate regardless
of the ammonium concentration (01 or 04mM) (Fig 6A)
The concentrations of glutamine and asparagine also
increased in the roots (Fig 6B) but the concentrations
of some of the abundant amino acids such as alanine
aspartate glutamate and serine were decreased in the
roots irrespective of the rate of ammonium supply
(Supplementary Table S3) The changes in the levels
of amino acids generally agreed with those obtained
by GC-MS in the first experiment (PSD17 Supple-
mentary Table S2) but there were some differences in the
relative levels of some of the amino acids such as
asparagine glutamate proline and phenylalanine between
the two experiments using these two different technologies
696 Metabolite profiles in P-deficient barley plants
(Supplementary Tables S2 S3) These differences in amino
acid levels reflect the differential stabilities of the respective
amino acids to the different derivatization and detection
methodologies
The concentrations of glutamine and asparagine in
both shoots and roots were sensitive to ammonium
supplied They increased from approximately 10 mmol g1
DW in the shoots of the thornP treatment with 01mM
ammonium to 40 mmol g1 DW in the shoots of the thornP
treatment with 04mM ammonium (Fig 6A) In the
severely P-deficient plants the concentrations of glutamine
and asparagine in the shoots rose above 60 mmol g1 DW in
01mM ammonium and above 90 mmol g1 DW in 04mM
ammonium (Fig 6A) A similar magnitude of increase in
the concentrations of glutamine and asparagine was also
observed in the roots of the severely P-deficient plants
(Fig 6B) These results indicate that severe P deficiency
further increases the concentrations of glutamine and
asparagine in both shoots and roots When PthornP ratios
of amino acids in both shoots and roots of the plants treated
with 04mM ammonium were compared with those treated
with 01mM ammonium the high ammonium supply had
little effect on the PthornP ratios of amino acids except for
a reduction in the ratios of glutamine and asparagine and
140
120
100
Fre
sh w
eig
ht
(g p
lan
tminus1)
Fre
sh w
eig
ht
(g p
lan
tminus1)
P c
on
cen
trat
ion
(m
g g
minus1 D
W)
080
060
040
020
0
140minusP
+P120
100
080
060
040
Critical level
020
0
10
8
6
4
2
001 mM 04 mM
A
B
C
Fig 5 Effect of P and ammonium supply on plant growth andP nutrition (A) Fresh weight of shoots (B) Fresh weight of roots(C) P concentration of shoots Barley seedlings grown in a nutrientsolution containing either no NH4H2PO4 (P) or 01mMNH4H2PO4 (thornP) with two rates of ammonium (01 and 04mM)Plants were harvested at the 16th day after seed imbibitionStandard errors (nfrac14 4) are shown as vertical bars
1200Glu
Gln
Asp
Asn
1000
800
600
400
200
0
1200
1000
800
600
400
200
001N+P 04N+P01NminusP 04NminusP
Co
nce
ntr
atio
n (
mg g
minus1 D
W)
Co
nce
ntr
atio
n (
mg g
minus1 D
W)
A
B
Fig 6 Effect of P and ammonium supply on concentrations of fouramino acids (A) Concentrations of four amino acids in shoots(B) Concentrations of four amino acids in roots Barley seedlingsgrown in a nutrient solution containing either no NH4H2PO4 (P)or 01mM NH4H2PO4 (thornP) with two rates of ammonium (01 and04mM) Plants were harvested at the 16th day after seedimbibition The concentrations of amino acids were determinedby LC-MS (see Supplementary Table S3) Standard errors (nfrac14 4) areshown as vertical bars
Metabolite profiles in P-deficient barley plants 697
a couple of other amino acids (Supplementary Table S3)
These results indicate that the effect of severe P deficiency
on the concentrations of free amino acids in both shoots
and roots is largely independent of ammonium supply
In addition the concentrations of both glutamate
and aspartate precursors for synthesis of glutamine and
asparagine were affected by severe P deficiency The con-
centrations of glutamate and aspartate were reduced by
approximately 50 and 25 respectively in the shoots
of P treatments with either 01 or 04mM ammonium
relative to those of thornP treatments (Fig 6A and Supple-
mentary Table S3) The greater reductions in the concen-
trations of glutamate and aspartate were also observed in
the roots of P treatments with two rates of ammonium
supplied compared with those of thornP treatments (Fig 6B
and Supplementary Table S3) Interestingly the high
ammonium supplied did not reduce the concentrations of
glutamate and aspartate either in the shoots or in the roots
of thornP-treated plants (Fig 6A B Supplementary Table S3)
These results suggest that severely P-deficient plants utilize
amino acids as an alternative carbon resource especially in
the roots
Discussion
P deficiency in barley plants results in increases in di- and
trisaccharides and decreases in small P-containing
metabolites
P deficiency initially enhanced the accumulation of
di- and trisaccharides especially for maltose raffinose and
6-kestose in the shoots of the moderately P-deficient plants
(Fig 3) Only maltose increased in the roots (Fig 3
Supplementary Table S1) The transcript levels of HvPht16
(Fig 2) also indicate that roots are less sensitive to P
deficiency Severe P deficiency leads to a further increase in
di- and trisaccharides in both shoots and roots These data
are consistent with previous reports that P deficiency led
to an increase in the levels of starch sucrose and mono-
saccharides in common beans and Arabidopsis (Ciereszko
and Barbachowska 2000 Hernandez et al 2007 Nilsson
et al 2007) and a graminaceous plant Brachiaria hybrid
(Nanamori et al 2004) It also is consistent with the reduced
level of sucrose synthase in P-deficient maize roots (Li et al
2007) The increased levels of mono- di- and polysaccha-
rides suggest that glycolysis may be hindered in both shoots
and roots of P-deficient barley plants In contrast the
cDNA array analyses from lupin and rice suggest that P
deficiency stimulates glycolysis (Uhde-Stone et al 2003
Wasaki et al 2003a) It is conceivable that to maintain
a high level of organic acid secretion in the proteoid roots
of lupin a enhanced level of glycolysis is necessary under
P-deficient conditions (Pearse et al 2006) but it is not clear
why rice did not show enhanced accumulation of di- and
polysaccharides under P-deficient conditions (Nanamori
et al 2004) It appears that metabolic changes in glycolysis
in response to P deficiency differ among plant species
Severe P deficiency depleted inorganic Pi storage pools
as indicated by the sharp reduction of phosphoric acid
in the polar fractions of plant tissues to 510 of
the controls (PDS17thornPDS17 and PDR17thornPDS17
Supplementary Table S2) Under these conditions organic
P is an alternative resource of P for plant cells RNA
phospholipids and small phosphorylated metabolites are
three main classes of compounds containing phosphoesters
Degradation of RNA by increased RNase activity under
Pi-limiting conditions is well documented (Plaxton 2004)
The RNA content in the shoots of severely P-deficient
Arabidopsis plants was reduced to 13 of that in the
P-sufficient plants (Hewitt et al 2005) Considerable
amounts of organic P are present in small phosphorylated
metabolites which is approximately equivalent to that
in RNA or in phospholipids (Bieleski and Ferguson
1983 Doermann and Benning 2002) The levels of
small phosphorylated metabolites including glucose-6-P
fructose-6-P and inositol-1-P were largely reduced in both
shoots and roots of the severely P-deficient plants and the
level of glycerol-3-P in the polar fraction was also sharply
reduced in the shoots of the severely P-deficient plants
(Fig 4) The reduction of phosphorylated sugars was also
observed in bean roots and Arabidopsis under P-deficient
conditions (Rychter and Randall 1994 Morcuende et al
2007) These results indicate that severely P-deficient plants
salvage P from small phosphorylated metabolites for
essential cellular functions These small phosphorylated
metabolites are important intermediates in glycolysis and
synthesis of polysaccharides (glucose-6-P and fructose-6-P)
phospholipids (glycerol-3-P and inositol-1-P) amino acids
and nucleotides and in energy production Thus a depletion
of these phosphorylated metabolites would have a severe
impact not only on carbohydrate and nitrogen metabolism
but also on other metabolic processes
The enhanced accumulation of di- and tri-saccharides
in P-deficient plants can reduce the consumption of Pi in
phosphorylation of sugar metabolites and convert the small
phosphorylated metabolites to non-P-containing di- and
trisaccharides and other compounds such as aromatic
compounds (Figs 3 4) This could be a strategy to reduce
Pi consumption but may also have a benefit in osmotic
protection for stressed plants Increased accumulation of
di- and trisaccharides such as raffinose has been described
in plants exposed to heat stress (Panikulangara et al 2004)
and sulfate deficiency (Nikiforova et al 2005) maltose in
acute temperature stress (Kaplan and Guy 2004) and
6-kestose a precursor for synthesis of fructans under
drought conditions (Hendry 1993 Amiard et al 2003)
However carbohydrate formed as di- and trisaccharides
698 Metabolite profiles in P-deficient barley plants
shown to accumulate in P-deficient plants cannot be utilized
readily for energy metabolism without involvement of Pi
to provide carbon metabolites for the TCA cycle An
alternative storage form of carbon such as organic acids
and amino acids would be preferred for survival of
P-deficient plants (Nanamori et al 2004)
P deficiency reduces organic acids in the TCA cycle
The reduced levels of several organic acids of the TCA
cycle including a-ketoglutarate succinate fumarate and
malate (Fig 4) and the reduction in the concentrations
of glutamate and aspartate especially in the roots of
the severely P-deficient plants (Fig 6B) suggest that the
shortage in carbohydrate supply is more apparent in the
roots than in the shoots of severely P-deficient plants
Reduced levels of fumarate were also observed in
P-deficient Arabidopsis (Misson et al 2005) In addition P
deficiency increases the secretion of organic acids into the
rhizosphere although cereals are weak secretors of organic
acids compared with legumes under low P conditions
(Neumann and Romheld 1999 Pearse et al 2006) The
secretion of organic acids could also contribute to
the reduction of the organic acids in the root tissues The
roots of severely P-deficient plants have to adjust metabolic
processes to utilize possible carbon metabolites such as
amino acids Some of the amino acids could be utilized as
an alternative carbon resource for energy production
reassimilation of the released ammonium and synthesis of
organic acids for secretion Interestingly the levels of several
organic acids in the TCA cycle were also reduced in
the roots of P-deficient common beans (Hernandez et al
2007) As legumes are efficient secretors of organic acids
(Neumann and Romheld 1999 Pearse et al 2006) secretion
could be a significant contributor to the reduced levels of
organic acids in the roots Nevertheless no reduction in
small P-containing metabolites nor organic acids in the
TCA cycle is observed in sulfate-deficient Arabidopsis plants
(Hirai et al 2004 Nikiforova et al 2005) indicating that
the reduction in the organic acids is unique to P-deficient
plant species
Severe P deficiency alters nitrogen metabolism
In P-deficient conditions transcript levels of the
genes coding for enzymes involved in protein degradation
were enhanced and the genes for protein synthesis were
suppressed in both Arabidopsis and common beans
(Wu et al 2003 Misson et al 2005 Hernandez et al
2007) The abundance of proteins related to protein
degradation through the ubiquitinndash26S proteasome path-
way was found to have increased in P-deficient roots of
maize (Li et al 2007) The reduced transcript levels of genes
related to nitrate reduction (Wu et al 2003) and reduced
activities for nitrate reduction have also been described in
P-deficient plants (Gniazdowska and Rychter 2000)
The increased concentrations of total free amino acids in
the shoots of severely P-deficient plants (Supplementary
Table S3) are likely to result from increased protein
degradation and repressed protein synthesis Various
metabolic reactions involved in either synthesis or degrada-
tion of amino acids produce ammonia such as aspara-
gine to aspartate glutamine to glutamate glutamate to
a-ketoglutarate and glycine to serine P deficiency enhances
the transcript levels of alanine aminotransferase genes
in both Arabidopsis and common beans (Wu et al 2003
Hernandez et al 2007) and the protein abundance of
glutamate dehydrogenase and phenylalanine ammonia-
lyase in maize roots (Li et al 2007) A high concentration
of ammonium is harmful to plants especially for barley an
ammonium-sensitive plant (Britto and Kronzucker 2002)
Thus it is critical to avoid excessive accumulation of
ammonium in P-deficient plants The levels of glutamine
and asparagine were elevated in both shoots and roots of
severely P-deficient plants and other metabolites related to
ammonium metabolism including putrescine and tyramine
were also enhanced in the severely P-deficient plants
especially in the roots (Supplementary Table S2) The
increased level of putrescine was also observed in P-deficient
rice cells (Shih and Kao 1996) These data suggest that
deamination of amino acids occurs in the severely
P-deficient plants for utilization in carbon metabolism
and a concomitant increase in assimilation of ammonium
takes place to ensure a reduction in levels of ammonium
The increased activities of glutamate dehydrogenase and
glutamine synthase in Arabidopsis plants (Morcuende et al
2007) and the enhanced protein abundance of root
glutamate dehydrogenase and glutamine synthase observed
in P-deficient maize plants (Li et al 2007) support this
interpretation It is interesting to note that the transcript
levels of glutamate synthase were down-regulated by P
deficiency in rice (Wasaki et al 2003a) Rice is an
ammonium-tolerant species which is in contrast to barley
that is an ammonium-sensitive species (Britto and
Kronzucker 2002) The difference in the metabolite levels
related to ammonium metabolism between P-deficient
barley and rice may be due to this different mechanism of
tolerance to ammonium
The synthesis of glutamine and asparagine requires
a carbon skeleton The enhanced levels of glutamine
and asparagine will require additional molecules of
a-ketoglutarate and oxaloacetate withdrawn from the
TCA cycle leading to a further reduction in the levels
of organic acids and restriction in energy production
in severely P-deficient plants The increased levels of
glutamine asparagine and other metabolites closely
related to ammonium metabolism are also observed in
other nutrient stresses such as nitrogen and sulfate
Metabolite profiles in P-deficient barley plants 699
deficiency (Hirai et al 2004 Nikiforova et al 2005) but
the specific reduction in glutamate and aspartate is
only observed in P-deficient barley plants As synthesis
of glutamine and asparagine can incorporate two ammo-
nium molecules into one organic acid this is a highly
effective ammonium assimilation mechanism under the
carbohydrate-limiting conditions caused by P deficiency
Our metabolite analyses provide indirect evidence that
P-deficient plants are confronted with increased ammonium
To establish a direct link of P deficiency to the increased
accumulation of ammonium in barley tissues further
experiments are required by supplying low concentrations
of ammonium and monitoring ammonium levels in plant
tissues
The increased levels of glycine and serine in the shoots
of the severely P-deficient plants indicate that photorespira-
tion is enhanced in the shoots of the severely P-deficient
plants because glycine and serine are intermediates for
photorespiration (Wingler et al 2000) and the increased
levels of glycine and serine correlate well with the rate of
photorespiration in P-deficient bean plants (Kondracka and
Rychter 1997) Increases in the levels of glycine and serine
were also observed in sulfur-deficient Arabidopsis plants
(Nikiforava et al 2005) indicating that the increase in
photorespiration is a general stress response (Wingler et al
2000)
Carbohydrate partitioning in P-deficient barley differs
from a P-efficient Gramineae grass
P deficiency results in the enhanced accumulation of
di- and trisaccharides and reduced organic acids in barley
plants which generally is similar to rice a P-inefficient
plant (Nanamori et al 2004) A P-efficient grass (Brachiaria
hybrid) is very different from rice in carbohydrate par-
titioning under P-deficient conditions (Nanamori et al
2004) The Brachiaria hybrid can allocate more carbohy-
drates into organic acids and amino acids Maintaining high
activities of phosphoenolpyruvate carboxylase and phos-
phoenolpyruvate phosphatase under the low P condition
appears to be critical for allocating a large proportion of
carbohydrate into organic acids and amino acids Our data
suggest that barley behaves as a P-inefficient plant in
metabolic adaptation to low P environments Thus to
improve P efficiency in barley and perhaps other cereal
crops manipulation of metabolism through a shift in
carbohydrate partitioning could provide a logical strategy
In summary the metabolite profiles generated from
both shoots and roots provide an overview of the metabolic
adjustments that occur in P-deficient barley plants As
illustrated in Fig 7 P-deficient barley plants alter the levels
of many key metabolites which affect various metabolic
pathways including glycolysis photorespiration and
metabolism of nitrogen and phospholipids These adaptive
P inefficiency
P efficiency
ribose
inositol-1-P
glycine(shoots)
serine(shoots)
alanine(shoots)
aspartate
asparagine malate
fumarate
succinate
citrate
a-ketoglutarate
glutamine
glutamate
urea(roots)
glc
glc-6-P
fru
glycerol-3-P
aromaticcompounds
fru-6-P
di- and tri-saccharides
Carbohydratepartitioning
glycerate-3-P
PEP
pyruvate
oxaloacetate
Fig 7 Schematic summary of metabolic adjustments in P-deficient plants and the proposed carbohydrate partitioning for improvementof P efficiency in cereals Thick arrows in green indicate an increase in metabolite levels and thin arrows in red indicate a decreasein metabolite levels The dashed line indicates carbohydrate partitioning for high P efficiency (below the line) and for low P efficiency(above the line)
700 Metabolite profiles in P-deficient barley plants
adjustments reduce Pi consumption by increasing the
levels of di- and trisaccharides and salvage Pi from various
P-containing compounds including small P-containing
metabolites to maintain essential cellular functions An
immediate consequence which is unique to P deficiency is
greatlly reduced levels of the key metabolites in glycolysis
leading to the decrease in carbohydrate supply to the TCA
cycle especially in the roots In addition P-deficient plants
are likely to be confronted with the challenge of increased
ammonium derived from the degradation of protein The
assimilation of the increased ammonium requires additional
organic acids from the TCA cycle which depletes the
organic acid supply further It is noteworthy that although
there are di- and trisaccharides present in the P-deficient
plants they cannot be readily utilized Organic acids and
amino acids are the preferred storage metabolites in
P-deficient plants (Nanamori et al 2004) as they can be
readily utilized as the carbon resource by P-deficient plants
Therefore if barley (and other cereals) are to be engineered
to be better adapted to growth in P-deficient soils there
is a need to shift the partitioning of carbohydrate from
di- and tri-saccharides to organic acids and amino acids
Investigating the expression of genes (transcriptome) and
proteins (proteome) in barley under P-deficient conditions
would provide additional evidence to support this strategy
for enhancing the P efficiency
Materials and Methods
Plant materials
Barley (H vulgare L cv Lofty Nijo) seeds were surface-sterilized with 70 ethanol for 1min and 3 hypochlorite for5min rinsed with deionized water and incubated in Petri dishes for2 d at room temperature Two seeds with an emerged radicle wereput into a seedling cup which was placed in the lid of a black plasticcontainer Each container contained either four seedling cups fortwo harvests or two seedling cups for one harvest and were filledwith 1 liter of nutrient solution The basal nutrients were as follows(in mM) Ca(NO3)2 1000 KNO3 1000 MgSO4 250 KCl 50H3BO3 125 Fe-HEDTA 10 MnSO4 04 CuSO4 01 ZnSO405 NiSO4 01 and MoO3 01 with NH4H2PO4 100 (thornPtreatment) or without NH4H2PO4 (P treatment) To balanceNH4 ions added in the thornP treatment 100 mM NH4NO3 was addedinto the nutrient solution of the P treatment In the additionalexperiment with two levels of ammonium either 100 or 400 mMNH4NO3 was added in the thornP treatment and either nil or 300 mMNH4NO3 was added in the P treatment All treatments werereplicated four times Half-strength nutrient solution was useduntil the 10th day after seed imbibition for the plants harvested atday 10 and day 17 but the eighth day for the plants harvestedat day 16 Full strength was applied thereafter The full-strengthnutrient solution was replaced at day 14 for the plants harvested atday 17 but at day 12 for the plants harvested at day 16 The pH ofthe nutrient solution was adjusted to 60 with 1M KOH and thesolution was aerated continuously
Plants were grown in a controlled environment at 208Cday158C night with a photoperiod regime of 14 h day10 h nightat 300 mmolm2 sndash1 photon flux intensity at the plant level At each
harvest two seedling cups were removed from each containerPlants were collected in 5ndash6 h of the light period to eliminatediurnal changes in metabolite levels The roots of plants from oneseedling cup were rinsed briefly in deionized water excess waterwas blotted on fresh laboratory tissues and the roots and shootswere separated and oven-dried at 658C for 48 h The dry plantsamples were used for mineral element analysis by inductivelycoupled plasma spectrophotometry (Zarcinas et al 1987) Anothercup of plants was separated into roots and shoots frozenimmediately in liquid nitrogen and stored at 808C for metaboliteand transcript analyses
Real-time quantitative RTndashPCR
Shoots and roots of three replicates from each P treatmentwere used for transcript analysis Total RNA was prepared usingTrizol reagent according to the manufacturerrsquos instructions(Invitrogen Carlsbad CA USA) Total RNA was treated withDNase I using the DNA free kit (Ambion Austin TX USA) toremove any contaminating genomic DNA and then RNA integritywas checked on an agarose gel cDNA was prepared from 2mg oftotal RNA using SuperScriptTM III reverse transcriptase accord-ing to the manufacturerrsquos instructions (Invitrogen) The reactionwas incubated at 508C for 45min and at 708C for 15min toinactivate the enzyme
The transcript levels of HvIPS1 and HvPht16 weredetermined by real-time quantitative PCR essentially as describedby Burton et al (2004) The transcript levels of three control genes(barley a-tubulin heat shock protein 70 and cyclophilin) weredetermined and used for normalization Normalization was carriedout as described by Vandesompele et al (2002) and Burtonet al (2004) The normalized copies mg RNA1 are presentedThe primers 50 GCGGCGACTTCTCACCTCTACTAAG and50 CGAAGGATTCAAACAGGATCACACA (GenBank acces-sion No BI780234) were used for amplification of HvIPS1 and50 GGTCAAGAACTCGCTATTCATCC and 50 CCATACATCCATCCAAACCTG (GenBank accession No AF543198) foramplification of HvPht16
Analysis of metabolites with GC-MS
Metabolite analysis was carried out by a GC-MS-basedmethod modified from Roessner et al (2006) Fresh tissues of rootsand shoots from barley plants were homogenized using a mortarand pestle with liquid nitrogen Frozen tissue powder (100 10mgexact fresh weight was recorded) was extracted with methanol(350 ml) A polar internal standard (20 ml of 02mgmlndash1 ribitol inwater) and a non-polar internal standard (30 ml of 2mgmlndash1
nonadecanoic acid methylester in chloroform) were subsequentlyadded as quantification standards The mixture was extracted for15min at 708C and then mixed vigorously with 1 vol of waterIn order to separate polar and non-polar metabolites 300 ml ofchloroform was added to the mixture and centrifuged at 2200gfor 10min The upper methanolwater phase was collected andwashed with chloroform (300 ml) The polar phase of shoot extracts(100 ml) and root extracts (250 ml) was separately dried undervacuum Both lipid layers were combined and dried under vacuumIn order to methylate fatty acids the residues of the non-polarfractions were further incubated with chloroform (100 ml) andacidified methanol (300 ml of 125N HCl in methanol) for 24 h at508C and afterwards dried under vacuum The dry polar residuewas redissolved and derivatized for 120min at 378C in methox-yamine hydrochloride (40 ml of 20mgml1 in pyridine) followedby a 30min treatment with N-methyl-N-[trimethylsilyl] trifluoro-acetamide (MSTFA) (70 ml) at 378C The dry non-polar residue
Metabolite profiles in P-deficient barley plants 701
was derivatized for 60min at 378C in pyridine (70 ml) and MSTFA(40 ml) To both a retention time standard mixture [10 ml of 0029(vv) n-dodecane n-pentadecane n-nonadecane n-docosanen-octacosane n-dotracontane n-hexatriacontane dissolved inpyridine] was added prior to trimethylsilylation Sample volumesof 1ml were then injected using the splitless mode onto a GCcolumn using a hot needle technique
The GC-MS system and conditions were as described inRoessner et al (2006) Acquired total ion chromatograms andmass spectra were evaluated using the Xcalibur program(ThermoFinnigan Manchester UK) and the resulting data areprepared normalized and presented as described by Roessner et al(2001) Mass spectra of eluting compounds were identified usingthe commercial mass spectra library NIST (httpwwwnistgov)and the public domain mass spectra library of the Max-Planck-Institute for Plant Physiology Golm Germany (httpcsbdbmpimp-golmmpgdecsbdbdbmamsrihtml) All matchingmass spectra were additionally co-verified by determination of theretention time and mass spectra by analysis of authentic standardsubstances
Analysis of free amino acids with LC-MS
Leaf material (15mg) was accurately weighed intoEppendorf tubes (2ml) and a solution of EDTA (400 ml 5mM)was added to each sample The samples were sonicated for15min then heated in a water bath (808C 15min) centrifuged(14500 rpm 5min) and the supernatant derivatized Thederivatization of the amino acids is based on a procedure outlinedby Cohen and Michaud (1993) and involved mixing the super-natant obtained above (20 ml) with borate buffer (200 ml 02MpH 88) followed by the addition of 10mM 6-aminoquinolyl-N-hydroxysuccinimidyl carbamate solution (50 ml) in dry aceto-nitrile The reaction mixture was then heated at 558C in a waterbath for 10min and analyzed by LC-MS as described by Callahanet al (2007)
The LC-MS system comprised a Surveyor LC PumpSurveyor Auto Sampler and LCQ Deca XP Max ion trapMS (Thermo Finnigan USA) The ESI (electron spray ionization)source was optimized by infusing a derivatized amino acidstandard in line with the mobile phase then tuning the sourceconditions and ion optics to optimize the signals for the derivatizedamino acids This resulted in the following conditions sheath gas30 arbitrary units auxiliary gas 10 arbitrary units spray voltage30 kV capillary temperature 2508C capillary voltage 56V andtube lens 53V
Derivatized amino acids were eluted on an Altantis dC18150 21mm 3mm (Waters Melbourne Australia) HPLC columnusing a three-step gradient of deionized water (01 formic acid)and acetonitrile (01 formic acid) at a flow rate of 025mlminndash1
and a column temperature of 308C (Callahan et al 2007)
Statistical analysis
Students t-test at P 005 was applied for the means (nfrac14 4) ofmetabolites presented in Supplementary Tables S1ndashS3 Statisticalanalyses were carried using the Pirouette 311 software (InfometrixInc Woodinville WA USA)
Supplementary material
Supplementary material mentioned in the article is avail-able to online subscribers at the journal website wwwpcpoxfordjournalsorg
Funding
The Grains Research and Development Corporation
the Australian Research Council the South Australian
Government the University of Adelaide and the University
of Melbourne to the Australian Center for Plant Functional
Genomics (CYH UR NS PL AB) the Molecular
Plant Breeding CRC to YG Metabolomics Australia to
(UR DC AB)
Acknowledgments
We are grateful to M Tester for discussion and to T Fowlesand L Palmer for ICP analysis
References
Amiard V Morvan-Bertrand A Billard JP Huault C Keller F andPrudrsquohomme MP (2003) Fructans but not the sucrosyl-galactosidesraffinose and loliose are affected by drought stress in perennial ryegrassPlant Physiol 132 2218ndash29
Bieleski RL and Ferguson IB (1983) Physiology and metabolism ofphosphate and its compounds In Encyclopedia of Plant PhysiologyEdited by Lauchli A and Bieleski RL Vol 15a pp 422ndash449 SpringerVerlag Berlin
Bolling C and Fiehn O (2005) Metabolite profiling of Chlamydomonasreinhardtii under nutrient deprivation Plant Physiol 139 1995ndash2005
Britto DT and Kronzucker HJ (2002) NH4thorn toxicity in higher plants
a critical review J Plant Physiol 159 567ndash584Burleigh SH and Harrison MJ (1997) A novel gene whose expression in
Medicago truncatula roots is suppressed in response to colonization byvesicularndasharbuscular mycorrhizal (VAM) fungi and to phosphatenutrition Plant Mol Biol 34 199ndash208
Burton RA Shirley NJ King BJ Harvey AJ and Fincher GB(2004) The CesA gene family of barley Quantitative analysis oftranscripts reveals two groups of co-expressed genes Plant Physiol134 224ndash236
Callahan DL Kolev SD OrsquoHair RAJ Salt DE and Baker AJM(2007) Relationships between nicotianamine and other amino acids withnickel zinc and iron in Thlaspi hyperaccumulators New Phytol 176836ndash848
Ciereszko I and Barbachowska A (2000) Sucrose metabolism in leavesand roots of bean (Phaseolus vulgaris L) during phosphate deficiencyJ Plant Physiol 156 640ndash644
Cohen SA and Michaud DP (1993) Synthesis of a fluorescentderivatizing reagent 6-aminoquinolyl-N-hydroxysuccinimidyl carba-mate and its application for the analysis of hydrolysate amino acidsvia high-performance liquid chromatography Anal Biochem 211279ndash287
Cruz-Ramirez A Oropeza-Aburto A Razo-Hernandez F Ramirez-Chavez E and Herrera-Estrella L (2006) Phospholipase DZ2 playsan important role in extraplastidic galactolipid biosynthesis andphosphate recycling in Arabidopsis roots Proc Natl Acad Sci USA103 6765ndash6770
Doermann P and Benning C (2002) Galactolipids rule in seed plantsTrends Plant Sci 7 112ndash118
Gniazdowska A and Rychter AM (2000) Nitrate uptake by bean(Phaseolus vulgaris L) roots under phosphate deficiency Plant Soil 22679ndash85
Hendry GAF (1993) Evolutionary origins and natural functions offructansmdasha climatological biogeographic and mechanistic appraisalNew Phytol 123 3ndash14
Hernandez G Ramirez M Valdes-Lopez O Tesfaye MGraham MA et al (2007) Phosphorus stress in common bean roottranscript and metabolic responses Plant Physiol 144 752ndash767
702 Metabolite profiles in P-deficient barley plants
Hewitt MM Carr JM Williamson CL and Slocum RD (2005)Effects of phosphate limitation on expression of genes involved in
pyrimidine synthesis and salvaging in Arabidopsis Plant Physiol
Biochem 43 91ndash99Hirai MY Yano M Goodenowe DB Kanaya S Kimura T
Awazuhara M Arita M Fujiwara T and Saito K (2004) Integration
of transcriptomics and metabolomics for understanding of global
responses to nutritional stresses in Arabidopsis thaliana Proc Natl
Acad Sci USA 101 10205ndash10210Hou XL Wu P Jiao FC Jia QJ Chen HM Yu J Song XW
and Yi KK (2005) Regulation of the expression of OsIPS1 and OsIPS2in rice via systemic and local Pi signaling and hormones Plant Cell
Environ 28 353ndash364Jeschke WD Kirkby EA Peuke AD Pate JS and Hartung W
(1997) Effects of P deficiency on assimilation and transport of nitrate andphosphate in intact plants of castor bean (Ricinus communis L) J Exp
Bot 48 75ndash91Kaplan F and Guy CL (2004) Beta-amylase induction and the protective
role of maltose during temperature shock Plant Physiol 135 1674ndash1684Kondracka A and Rychter AM (1997) The role of Pi recycling processes
during photosynthesis in phosphate-deficient bean plants J Exp Bot 48
1461ndash1468Kopka J (2006) Current challenges and developments in GC-MS based
metabolite profiling technology J Biotechnol 124 312ndash322Li K Xu C Zhang K Yang A and Zhang J (2007) Proteomic
analysis of roots growth and metabolic changes under phosphorus deficitin maize (Zea mays L) plants Proteomics 7 1501ndash1512
Liu CM Muchhal US and Raghothama KG (1997) Differential
expression of TPS11 a phosphate starvation-induced gene in tomatoPlant Mol Biol 33 867ndash874
Martin AC del Pozo JC Inglesias J Rubio V Solano Rde la Pena A Leyva A and Paz-Ares J (2000) Influence of cytokinins
on the expression of phosphate starvation responsive genes inArabidopsis Plant J 24 559ndash567
Mimura T (1999) Regulation of phosphate transport and homeostasis inplant cells Int Rev Cytol Cell Biol 191 149ndash200
Misson J Raghothama KG Jain A Jouhet J Block MA et al
(2005) A genome-wide transcriptional analysis using Arabidopsis thaliana
Affymetrix gene chips determined plant responses to phosphate depriva-
tion Proc Natl Acad Sci USA 102 11934ndash11939Morcuende R Bari R Gibon Y Zheng WM Pant BD Blasing O
Usadel B Czechowski T Udvardi MK Stitt M and Scheible WR(2007) Genome-wide reprogramming of metabolism and regulatory
networks of Arabidopsis in response to phosphorus Plant Cell Environ
30 85ndash112Muchhal US and Raghothama KG (1999) Transcriptional regulation of
plant phosphate transporters Proc Natl Acad Sci USA 96 5868ndash72Nanamori M Shinano T Wasaki J Yamamura T Rao IM and
Osaki M (2004) Low phosphorus tolerance mechanisms phosphorus
recycling and photosynthate partitioning in the tropical forage grassBrachiaria hybrid cultivar mulato compared with rice Plant Cell Environ
45 460ndash469Neumann G and Romheld V (1999) Root excretion of carboxylic acids
and protons in phosphorus-deficient plants Plant Soil 211 121ndash130Nikiforova VJ Gakiere B Kempa S Adamik M Willmitzer L
Hesse H and Hoefgen R (2004) Towards dissecting nutrient
metabolism in plants a systems biology case study on sulphur
metabolism J Exp Bot 55 1861ndash1870Nikiforova VJ Kopka J Tolstikov V Fiehn O Hopkins L
Hawkesford MJ Hesse H and Hoefgen R (2005) Systems rebalan-
cing of metabolism in response to sulfur deprivation as revealed bymetabolome analysis of Arabidopsis plants Plant Physiol 138 304ndash318
Nilsson L Muller R and Nielsen TH (2007) Increased expression of theMYB-related transcription factor PHR1 leads to enhanced phosphate
uptake in Arabidopsis thaliana Plant Cell Environ 30 1499ndash1512
Panikulangara TJ Eggers-Schumacher G Wunderlich M Stransky Hand Schoffl F (2004) Galactinol synthase 1 A novel heat shock factortarget gene responsible for heat-induced synthesis of raffinose familyoligosaccharides in Arabidopsis Plant Physiol 136 3148ndash3158
Pearse SJ Veneklaas EJ Cawthray G Bolland MDA andLambers H (2006) Triticum aestivum shows a greater biomass responseto a supply of aluminium phosphate than Lupinus albus despite releasingfewer carboxylates into the rhizosphere New Phytol 169 515ndash524
Plaxton WC (2004) Plant response to stress biochemical adaptations tophosphate deficiency In Encyclopedia of Plant and Crop Science Editedby Goodman R pp 976ndash980 Marcel Dekker Inc New York
Plaxton WC and Carswell MC (1999) Metabolic aspects of thephosphate starvation response in plants In Plant Response toEnvironmental Stresses From Photohormones to GenomeReorganization Edited by Lerner HR pp 349ndash372 Marcel DekkerInc New York
Rae AL Cybinski DH Jarmey JM and Smith FW (2003)Characterization of two phosphate transporters from barley evidencefor diverse function and kinetic properties among members of the Pht1family Plant Mol Biol 53 27ndash36
Raghothama KG (1999) Phosphate acquisition Annu Rev Plant PhysiolPlant Mol Biol 50 665ndash693
Reuter DJ and Robinson JB (1997) Plant Analysis An InterpretationManual 2nd edn pp 86ndash92 CSIRO Australia Melbourne
Roessner U Luedemann A Brust D Fiehn O Linke TWillmitzer L and Fernie AR (2001) Metabolic profiling allowscomprehensive phenotyping of genetically or environmentally modifiedplant systems Plant Cell 13 11ndash29
Roessner U Patterson JH Forbes MG Fincher GB Langridge Pand Bacic A (2006) An investigation of boron toxicity in barley usingmetabolomics Plant Physiol 142 1087ndash1101
Rychter AM and Randall DD (1994) The effect of phosphate deficiencyon carbohydrate metabolism in bean roots Physiol Plant 91 383ndash388
Schachtman DP Reid RJ and Ayling SM (1998) Phosphorus uptakeby plants from soil to cell Plant Physiol 116 447ndash453
Shih CY and Kao CH (1996) Growth inhibition in suspension-culturedrice cells under phosphate deprivation is mediated through putrescineaccumulation Plant Physiol 111 721ndash724
Uhde-Stone C Zinn KE Ramirez-Yanez M Li AG Vance CP andAllan DL (2003) Nylon filter arrays reveal differential gene expressionin proteoid roots of white lupin in response to phosphorus deficiencyPlant Physiol 131 1064ndash1079
Vance CP Uhde-Stone C and Allan DL (2003) Phosphorus acquisitionand use critical adaptations by plants for securing a non renewableresource New Phytol 157 423ndash447
Vandesompele J De Preter K Pattyn F Poppe B Van Roy NDe Paepe A and Speleman F (2002) Accurate normalization of real-time quantitative RTPCR data by geometric averaging of multipleinternal control genes Genome Biol 3 1ndash11
Wasaki J Yonetani R Kuroda S Shinano T Yazaki J et al (2003a)Transcriptomic analysis of metabolic changes by phosphorus stress in riceplant roots Plant Cell Environ 26 1515ndash1523
Wasaki J Yonetani R Shinano T Kai M and Osaki M (2003b)Expression of the OsPI1 gene cloned from rice roots using cDNAmicroarray rapidly responds to phosphorus status New Phytol 158239ndash248
Wingler A Lea PJ Quick WP and Leegood RC (2000)Photorespiration metabolic pathways and their role in stress protectionPhilos Trans R Soc B Biol Sci 355 1517ndash1529
Wu P Ma L Hou X Wang M Wu Y Liu F and Deng XW (2003)Phosphate starvation triggers distinct alterations of genome expression inArabidopsis roots and leaves Plant Physiol 132 1260ndash1271
Zarcinas BA Cartwright B and Spouncer LR (1987) Nitric aciddigestion and multi-element analysis of plant material by induc-tively coupled plasma spectrometry Commun Soil Sci Plant Anal 18131ndash146
(Received February 21 2008 Accepted March 13 2008)
Metabolite profiles in P-deficient barley plants 703
Supplementary Table S2) and the concomitant reduction in
phosphorylated sugars including glucose-6-P fructose-6-P
glycerol-3-P and inositol-1-P was also observed in both
shoots and roots of the severely P-deficient plants at day 17
(Fig 4 and Supplementary Table S2) The levels of seve-
ral organic acids of the TCA cycle were also reduced in
the severely P-deficient plants including a-ketoglutarate(04-fold) and malate (07-fold) in the shoots and succinic
acid (07-fold) and fumaric acid (05-fold) in the roots
(Fig 4)
There were hardly any changes in the levels of amino
acids in both shoots and roots of the mildly P-deficient
plants when compared with thornP-treated plants (Supplemen-
tary Table S1) but the levels of two-thirds of the amino
acids were increased in the shoots of the severely P-deficient
plants (PSD17 Supplementary Table S2) In addition
the polyamine putrescine was increased in shoots (PSD17
Supplementary Table S2) Similarly dramatic changes in
the levels of the amino acids and metabolites related to
ammonium metabolism were also observed in the roots of
severely P-deficient plants There was an increase in the
levels of asparagine (30-fold) glutamate (24-fold) and
putrescine (23-fold) in the roots of the severely P-deficient
plants as well as a sharp increase in the level of urea up to
332-fold in roots (Fig 4) This high ratio of the urea level
was due to the combination of an increase of urea (25-fold)
in the roots of the severely P-deficient plants (PRD17
Supplementary Table S2) compared with that of the mildly
P-deficient plants (PRD10 Supplementary Table S1)
and a reduction of the urea level from 08 in the roots of
thornP-treated plants at day 10 (thornPRD10 Supplementary
Table S1) to 01 at day 17 (thornPRD17 Supplementary
Table S2) These data should be viewed cautiously as the
quantification of urea by GC-MS can be unreliable so an
alternative approach would need to be utilized to explore
this effect further Furthermore the level of aspartate in the
roots of the severely P-deficient plants was reduced to
05-fold (Fig 4) The significant change in the metabolites
related to ammonium assimilation suggests that the severe
P deficiency increases levels of ammonium leading to
alterations in ammonium assimilation
Effect of severe P deficiency on the concentrations of free
amino acids
The observations described above led us to conduct
an additional experiment to determine the effect of severe P
deficiency on amino acid metabolism Absolute concentra-
tions of free amino acids were determined using LC-MS to
complement the data obtained by GC-MS In the additional
experiment the nutrient solutions were supplemented with
two levels of ammonium (01 and 04mM) The low
ammonium treatment (01mM) was the same as that used
for plant growth in the first experiment (Fig 1) The high
ammonium treatment (04mM) is designed to investigate
the effect of external ammonium supply on the accumula-
tion of free amino acids in P-deficient plants and to prevent
possible depletion of ammonium in the nutrient solution
when only low concentrations (01mM) were supplied
Barley is an ammonium-sensitive species (Britto and
Kronzucker 2002) We determined that the maximum
level of ammonium that could be added to the nutrient
solution without obvious adverse effect on plant growth
was 04mM with co-provision of ammonium and nitrate
In thornP treatments shoot fresh weights for the 01 and
04mM ammonium treatments were similar (Fig 5A) but
the fresh weight of roots in the 04mM ammonium
treatment was 072 g plantndash1 which was slightly lower
than that of 081 g plantndash1 in the 01mM treatment (Fig 5B)
In contrast plant growth in the P treatment supplied with
either 01 or 04mM ammonium was severely retarded
compared with that of thornP treatment (Fig 5A B) The
growth inhibition in both shoots and roots was similar to
that shown in Fig 1A P concentrations in the shoots
of thornP-treated plants supplemented with either 01 or
04mM ammonium were above the critical levels (Reuter
and Robinson 1997) whereas those in the shoots of
P-treated plants were 12mg P gndash1 DW for the 01mM
ammonium treatment which is equal to that observed
in the severely P-deficient plants in the first experiment
(Fig 1B) but slightly lower (10mg P gndash1 DW) in the
04mM ammonium treatment than that in the 01mM
ammonium treatment (Fig 5C)
The concentrations of all 20 amino acids and GABA
(g-aminobutyric acid) were obtained by LC-MS (Supple-
mentary Table S3) and the results were compared with
those determined by GC-MS (Supplementary Table S2)
The extent of the effect of severe P deficiency on the
concentrations of free amino acids was confirmed by the
LC-MS analysis (Supplementary Table S3) In the shoots
severe P deficiency led to an increase in the concentrations
of half of the amino acids especially glutamine and
asparagine (Supplementary Table S3) and a large reduction
in the concentrations of glutamate and aspartate regardless
of the ammonium concentration (01 or 04mM) (Fig 6A)
The concentrations of glutamine and asparagine also
increased in the roots (Fig 6B) but the concentrations
of some of the abundant amino acids such as alanine
aspartate glutamate and serine were decreased in the
roots irrespective of the rate of ammonium supply
(Supplementary Table S3) The changes in the levels
of amino acids generally agreed with those obtained
by GC-MS in the first experiment (PSD17 Supple-
mentary Table S2) but there were some differences in the
relative levels of some of the amino acids such as
asparagine glutamate proline and phenylalanine between
the two experiments using these two different technologies
696 Metabolite profiles in P-deficient barley plants
(Supplementary Tables S2 S3) These differences in amino
acid levels reflect the differential stabilities of the respective
amino acids to the different derivatization and detection
methodologies
The concentrations of glutamine and asparagine in
both shoots and roots were sensitive to ammonium
supplied They increased from approximately 10 mmol g1
DW in the shoots of the thornP treatment with 01mM
ammonium to 40 mmol g1 DW in the shoots of the thornP
treatment with 04mM ammonium (Fig 6A) In the
severely P-deficient plants the concentrations of glutamine
and asparagine in the shoots rose above 60 mmol g1 DW in
01mM ammonium and above 90 mmol g1 DW in 04mM
ammonium (Fig 6A) A similar magnitude of increase in
the concentrations of glutamine and asparagine was also
observed in the roots of the severely P-deficient plants
(Fig 6B) These results indicate that severe P deficiency
further increases the concentrations of glutamine and
asparagine in both shoots and roots When PthornP ratios
of amino acids in both shoots and roots of the plants treated
with 04mM ammonium were compared with those treated
with 01mM ammonium the high ammonium supply had
little effect on the PthornP ratios of amino acids except for
a reduction in the ratios of glutamine and asparagine and
140
120
100
Fre
sh w
eig
ht
(g p
lan
tminus1)
Fre
sh w
eig
ht
(g p
lan
tminus1)
P c
on
cen
trat
ion
(m
g g
minus1 D
W)
080
060
040
020
0
140minusP
+P120
100
080
060
040
Critical level
020
0
10
8
6
4
2
001 mM 04 mM
A
B
C
Fig 5 Effect of P and ammonium supply on plant growth andP nutrition (A) Fresh weight of shoots (B) Fresh weight of roots(C) P concentration of shoots Barley seedlings grown in a nutrientsolution containing either no NH4H2PO4 (P) or 01mMNH4H2PO4 (thornP) with two rates of ammonium (01 and 04mM)Plants were harvested at the 16th day after seed imbibitionStandard errors (nfrac14 4) are shown as vertical bars
1200Glu
Gln
Asp
Asn
1000
800
600
400
200
0
1200
1000
800
600
400
200
001N+P 04N+P01NminusP 04NminusP
Co
nce
ntr
atio
n (
mg g
minus1 D
W)
Co
nce
ntr
atio
n (
mg g
minus1 D
W)
A
B
Fig 6 Effect of P and ammonium supply on concentrations of fouramino acids (A) Concentrations of four amino acids in shoots(B) Concentrations of four amino acids in roots Barley seedlingsgrown in a nutrient solution containing either no NH4H2PO4 (P)or 01mM NH4H2PO4 (thornP) with two rates of ammonium (01 and04mM) Plants were harvested at the 16th day after seedimbibition The concentrations of amino acids were determinedby LC-MS (see Supplementary Table S3) Standard errors (nfrac14 4) areshown as vertical bars
Metabolite profiles in P-deficient barley plants 697
a couple of other amino acids (Supplementary Table S3)
These results indicate that the effect of severe P deficiency
on the concentrations of free amino acids in both shoots
and roots is largely independent of ammonium supply
In addition the concentrations of both glutamate
and aspartate precursors for synthesis of glutamine and
asparagine were affected by severe P deficiency The con-
centrations of glutamate and aspartate were reduced by
approximately 50 and 25 respectively in the shoots
of P treatments with either 01 or 04mM ammonium
relative to those of thornP treatments (Fig 6A and Supple-
mentary Table S3) The greater reductions in the concen-
trations of glutamate and aspartate were also observed in
the roots of P treatments with two rates of ammonium
supplied compared with those of thornP treatments (Fig 6B
and Supplementary Table S3) Interestingly the high
ammonium supplied did not reduce the concentrations of
glutamate and aspartate either in the shoots or in the roots
of thornP-treated plants (Fig 6A B Supplementary Table S3)
These results suggest that severely P-deficient plants utilize
amino acids as an alternative carbon resource especially in
the roots
Discussion
P deficiency in barley plants results in increases in di- and
trisaccharides and decreases in small P-containing
metabolites
P deficiency initially enhanced the accumulation of
di- and trisaccharides especially for maltose raffinose and
6-kestose in the shoots of the moderately P-deficient plants
(Fig 3) Only maltose increased in the roots (Fig 3
Supplementary Table S1) The transcript levels of HvPht16
(Fig 2) also indicate that roots are less sensitive to P
deficiency Severe P deficiency leads to a further increase in
di- and trisaccharides in both shoots and roots These data
are consistent with previous reports that P deficiency led
to an increase in the levels of starch sucrose and mono-
saccharides in common beans and Arabidopsis (Ciereszko
and Barbachowska 2000 Hernandez et al 2007 Nilsson
et al 2007) and a graminaceous plant Brachiaria hybrid
(Nanamori et al 2004) It also is consistent with the reduced
level of sucrose synthase in P-deficient maize roots (Li et al
2007) The increased levels of mono- di- and polysaccha-
rides suggest that glycolysis may be hindered in both shoots
and roots of P-deficient barley plants In contrast the
cDNA array analyses from lupin and rice suggest that P
deficiency stimulates glycolysis (Uhde-Stone et al 2003
Wasaki et al 2003a) It is conceivable that to maintain
a high level of organic acid secretion in the proteoid roots
of lupin a enhanced level of glycolysis is necessary under
P-deficient conditions (Pearse et al 2006) but it is not clear
why rice did not show enhanced accumulation of di- and
polysaccharides under P-deficient conditions (Nanamori
et al 2004) It appears that metabolic changes in glycolysis
in response to P deficiency differ among plant species
Severe P deficiency depleted inorganic Pi storage pools
as indicated by the sharp reduction of phosphoric acid
in the polar fractions of plant tissues to 510 of
the controls (PDS17thornPDS17 and PDR17thornPDS17
Supplementary Table S2) Under these conditions organic
P is an alternative resource of P for plant cells RNA
phospholipids and small phosphorylated metabolites are
three main classes of compounds containing phosphoesters
Degradation of RNA by increased RNase activity under
Pi-limiting conditions is well documented (Plaxton 2004)
The RNA content in the shoots of severely P-deficient
Arabidopsis plants was reduced to 13 of that in the
P-sufficient plants (Hewitt et al 2005) Considerable
amounts of organic P are present in small phosphorylated
metabolites which is approximately equivalent to that
in RNA or in phospholipids (Bieleski and Ferguson
1983 Doermann and Benning 2002) The levels of
small phosphorylated metabolites including glucose-6-P
fructose-6-P and inositol-1-P were largely reduced in both
shoots and roots of the severely P-deficient plants and the
level of glycerol-3-P in the polar fraction was also sharply
reduced in the shoots of the severely P-deficient plants
(Fig 4) The reduction of phosphorylated sugars was also
observed in bean roots and Arabidopsis under P-deficient
conditions (Rychter and Randall 1994 Morcuende et al
2007) These results indicate that severely P-deficient plants
salvage P from small phosphorylated metabolites for
essential cellular functions These small phosphorylated
metabolites are important intermediates in glycolysis and
synthesis of polysaccharides (glucose-6-P and fructose-6-P)
phospholipids (glycerol-3-P and inositol-1-P) amino acids
and nucleotides and in energy production Thus a depletion
of these phosphorylated metabolites would have a severe
impact not only on carbohydrate and nitrogen metabolism
but also on other metabolic processes
The enhanced accumulation of di- and tri-saccharides
in P-deficient plants can reduce the consumption of Pi in
phosphorylation of sugar metabolites and convert the small
phosphorylated metabolites to non-P-containing di- and
trisaccharides and other compounds such as aromatic
compounds (Figs 3 4) This could be a strategy to reduce
Pi consumption but may also have a benefit in osmotic
protection for stressed plants Increased accumulation of
di- and trisaccharides such as raffinose has been described
in plants exposed to heat stress (Panikulangara et al 2004)
and sulfate deficiency (Nikiforova et al 2005) maltose in
acute temperature stress (Kaplan and Guy 2004) and
6-kestose a precursor for synthesis of fructans under
drought conditions (Hendry 1993 Amiard et al 2003)
However carbohydrate formed as di- and trisaccharides
698 Metabolite profiles in P-deficient barley plants
shown to accumulate in P-deficient plants cannot be utilized
readily for energy metabolism without involvement of Pi
to provide carbon metabolites for the TCA cycle An
alternative storage form of carbon such as organic acids
and amino acids would be preferred for survival of
P-deficient plants (Nanamori et al 2004)
P deficiency reduces organic acids in the TCA cycle
The reduced levels of several organic acids of the TCA
cycle including a-ketoglutarate succinate fumarate and
malate (Fig 4) and the reduction in the concentrations
of glutamate and aspartate especially in the roots of
the severely P-deficient plants (Fig 6B) suggest that the
shortage in carbohydrate supply is more apparent in the
roots than in the shoots of severely P-deficient plants
Reduced levels of fumarate were also observed in
P-deficient Arabidopsis (Misson et al 2005) In addition P
deficiency increases the secretion of organic acids into the
rhizosphere although cereals are weak secretors of organic
acids compared with legumes under low P conditions
(Neumann and Romheld 1999 Pearse et al 2006) The
secretion of organic acids could also contribute to
the reduction of the organic acids in the root tissues The
roots of severely P-deficient plants have to adjust metabolic
processes to utilize possible carbon metabolites such as
amino acids Some of the amino acids could be utilized as
an alternative carbon resource for energy production
reassimilation of the released ammonium and synthesis of
organic acids for secretion Interestingly the levels of several
organic acids in the TCA cycle were also reduced in
the roots of P-deficient common beans (Hernandez et al
2007) As legumes are efficient secretors of organic acids
(Neumann and Romheld 1999 Pearse et al 2006) secretion
could be a significant contributor to the reduced levels of
organic acids in the roots Nevertheless no reduction in
small P-containing metabolites nor organic acids in the
TCA cycle is observed in sulfate-deficient Arabidopsis plants
(Hirai et al 2004 Nikiforova et al 2005) indicating that
the reduction in the organic acids is unique to P-deficient
plant species
Severe P deficiency alters nitrogen metabolism
In P-deficient conditions transcript levels of the
genes coding for enzymes involved in protein degradation
were enhanced and the genes for protein synthesis were
suppressed in both Arabidopsis and common beans
(Wu et al 2003 Misson et al 2005 Hernandez et al
2007) The abundance of proteins related to protein
degradation through the ubiquitinndash26S proteasome path-
way was found to have increased in P-deficient roots of
maize (Li et al 2007) The reduced transcript levels of genes
related to nitrate reduction (Wu et al 2003) and reduced
activities for nitrate reduction have also been described in
P-deficient plants (Gniazdowska and Rychter 2000)
The increased concentrations of total free amino acids in
the shoots of severely P-deficient plants (Supplementary
Table S3) are likely to result from increased protein
degradation and repressed protein synthesis Various
metabolic reactions involved in either synthesis or degrada-
tion of amino acids produce ammonia such as aspara-
gine to aspartate glutamine to glutamate glutamate to
a-ketoglutarate and glycine to serine P deficiency enhances
the transcript levels of alanine aminotransferase genes
in both Arabidopsis and common beans (Wu et al 2003
Hernandez et al 2007) and the protein abundance of
glutamate dehydrogenase and phenylalanine ammonia-
lyase in maize roots (Li et al 2007) A high concentration
of ammonium is harmful to plants especially for barley an
ammonium-sensitive plant (Britto and Kronzucker 2002)
Thus it is critical to avoid excessive accumulation of
ammonium in P-deficient plants The levels of glutamine
and asparagine were elevated in both shoots and roots of
severely P-deficient plants and other metabolites related to
ammonium metabolism including putrescine and tyramine
were also enhanced in the severely P-deficient plants
especially in the roots (Supplementary Table S2) The
increased level of putrescine was also observed in P-deficient
rice cells (Shih and Kao 1996) These data suggest that
deamination of amino acids occurs in the severely
P-deficient plants for utilization in carbon metabolism
and a concomitant increase in assimilation of ammonium
takes place to ensure a reduction in levels of ammonium
The increased activities of glutamate dehydrogenase and
glutamine synthase in Arabidopsis plants (Morcuende et al
2007) and the enhanced protein abundance of root
glutamate dehydrogenase and glutamine synthase observed
in P-deficient maize plants (Li et al 2007) support this
interpretation It is interesting to note that the transcript
levels of glutamate synthase were down-regulated by P
deficiency in rice (Wasaki et al 2003a) Rice is an
ammonium-tolerant species which is in contrast to barley
that is an ammonium-sensitive species (Britto and
Kronzucker 2002) The difference in the metabolite levels
related to ammonium metabolism between P-deficient
barley and rice may be due to this different mechanism of
tolerance to ammonium
The synthesis of glutamine and asparagine requires
a carbon skeleton The enhanced levels of glutamine
and asparagine will require additional molecules of
a-ketoglutarate and oxaloacetate withdrawn from the
TCA cycle leading to a further reduction in the levels
of organic acids and restriction in energy production
in severely P-deficient plants The increased levels of
glutamine asparagine and other metabolites closely
related to ammonium metabolism are also observed in
other nutrient stresses such as nitrogen and sulfate
Metabolite profiles in P-deficient barley plants 699
deficiency (Hirai et al 2004 Nikiforova et al 2005) but
the specific reduction in glutamate and aspartate is
only observed in P-deficient barley plants As synthesis
of glutamine and asparagine can incorporate two ammo-
nium molecules into one organic acid this is a highly
effective ammonium assimilation mechanism under the
carbohydrate-limiting conditions caused by P deficiency
Our metabolite analyses provide indirect evidence that
P-deficient plants are confronted with increased ammonium
To establish a direct link of P deficiency to the increased
accumulation of ammonium in barley tissues further
experiments are required by supplying low concentrations
of ammonium and monitoring ammonium levels in plant
tissues
The increased levels of glycine and serine in the shoots
of the severely P-deficient plants indicate that photorespira-
tion is enhanced in the shoots of the severely P-deficient
plants because glycine and serine are intermediates for
photorespiration (Wingler et al 2000) and the increased
levels of glycine and serine correlate well with the rate of
photorespiration in P-deficient bean plants (Kondracka and
Rychter 1997) Increases in the levels of glycine and serine
were also observed in sulfur-deficient Arabidopsis plants
(Nikiforava et al 2005) indicating that the increase in
photorespiration is a general stress response (Wingler et al
2000)
Carbohydrate partitioning in P-deficient barley differs
from a P-efficient Gramineae grass
P deficiency results in the enhanced accumulation of
di- and trisaccharides and reduced organic acids in barley
plants which generally is similar to rice a P-inefficient
plant (Nanamori et al 2004) A P-efficient grass (Brachiaria
hybrid) is very different from rice in carbohydrate par-
titioning under P-deficient conditions (Nanamori et al
2004) The Brachiaria hybrid can allocate more carbohy-
drates into organic acids and amino acids Maintaining high
activities of phosphoenolpyruvate carboxylase and phos-
phoenolpyruvate phosphatase under the low P condition
appears to be critical for allocating a large proportion of
carbohydrate into organic acids and amino acids Our data
suggest that barley behaves as a P-inefficient plant in
metabolic adaptation to low P environments Thus to
improve P efficiency in barley and perhaps other cereal
crops manipulation of metabolism through a shift in
carbohydrate partitioning could provide a logical strategy
In summary the metabolite profiles generated from
both shoots and roots provide an overview of the metabolic
adjustments that occur in P-deficient barley plants As
illustrated in Fig 7 P-deficient barley plants alter the levels
of many key metabolites which affect various metabolic
pathways including glycolysis photorespiration and
metabolism of nitrogen and phospholipids These adaptive
P inefficiency
P efficiency
ribose
inositol-1-P
glycine(shoots)
serine(shoots)
alanine(shoots)
aspartate
asparagine malate
fumarate
succinate
citrate
a-ketoglutarate
glutamine
glutamate
urea(roots)
glc
glc-6-P
fru
glycerol-3-P
aromaticcompounds
fru-6-P
di- and tri-saccharides
Carbohydratepartitioning
glycerate-3-P
PEP
pyruvate
oxaloacetate
Fig 7 Schematic summary of metabolic adjustments in P-deficient plants and the proposed carbohydrate partitioning for improvementof P efficiency in cereals Thick arrows in green indicate an increase in metabolite levels and thin arrows in red indicate a decreasein metabolite levels The dashed line indicates carbohydrate partitioning for high P efficiency (below the line) and for low P efficiency(above the line)
700 Metabolite profiles in P-deficient barley plants
adjustments reduce Pi consumption by increasing the
levels of di- and trisaccharides and salvage Pi from various
P-containing compounds including small P-containing
metabolites to maintain essential cellular functions An
immediate consequence which is unique to P deficiency is
greatlly reduced levels of the key metabolites in glycolysis
leading to the decrease in carbohydrate supply to the TCA
cycle especially in the roots In addition P-deficient plants
are likely to be confronted with the challenge of increased
ammonium derived from the degradation of protein The
assimilation of the increased ammonium requires additional
organic acids from the TCA cycle which depletes the
organic acid supply further It is noteworthy that although
there are di- and trisaccharides present in the P-deficient
plants they cannot be readily utilized Organic acids and
amino acids are the preferred storage metabolites in
P-deficient plants (Nanamori et al 2004) as they can be
readily utilized as the carbon resource by P-deficient plants
Therefore if barley (and other cereals) are to be engineered
to be better adapted to growth in P-deficient soils there
is a need to shift the partitioning of carbohydrate from
di- and tri-saccharides to organic acids and amino acids
Investigating the expression of genes (transcriptome) and
proteins (proteome) in barley under P-deficient conditions
would provide additional evidence to support this strategy
for enhancing the P efficiency
Materials and Methods
Plant materials
Barley (H vulgare L cv Lofty Nijo) seeds were surface-sterilized with 70 ethanol for 1min and 3 hypochlorite for5min rinsed with deionized water and incubated in Petri dishes for2 d at room temperature Two seeds with an emerged radicle wereput into a seedling cup which was placed in the lid of a black plasticcontainer Each container contained either four seedling cups fortwo harvests or two seedling cups for one harvest and were filledwith 1 liter of nutrient solution The basal nutrients were as follows(in mM) Ca(NO3)2 1000 KNO3 1000 MgSO4 250 KCl 50H3BO3 125 Fe-HEDTA 10 MnSO4 04 CuSO4 01 ZnSO405 NiSO4 01 and MoO3 01 with NH4H2PO4 100 (thornPtreatment) or without NH4H2PO4 (P treatment) To balanceNH4 ions added in the thornP treatment 100 mM NH4NO3 was addedinto the nutrient solution of the P treatment In the additionalexperiment with two levels of ammonium either 100 or 400 mMNH4NO3 was added in the thornP treatment and either nil or 300 mMNH4NO3 was added in the P treatment All treatments werereplicated four times Half-strength nutrient solution was useduntil the 10th day after seed imbibition for the plants harvested atday 10 and day 17 but the eighth day for the plants harvestedat day 16 Full strength was applied thereafter The full-strengthnutrient solution was replaced at day 14 for the plants harvested atday 17 but at day 12 for the plants harvested at day 16 The pH ofthe nutrient solution was adjusted to 60 with 1M KOH and thesolution was aerated continuously
Plants were grown in a controlled environment at 208Cday158C night with a photoperiod regime of 14 h day10 h nightat 300 mmolm2 sndash1 photon flux intensity at the plant level At each
harvest two seedling cups were removed from each containerPlants were collected in 5ndash6 h of the light period to eliminatediurnal changes in metabolite levels The roots of plants from oneseedling cup were rinsed briefly in deionized water excess waterwas blotted on fresh laboratory tissues and the roots and shootswere separated and oven-dried at 658C for 48 h The dry plantsamples were used for mineral element analysis by inductivelycoupled plasma spectrophotometry (Zarcinas et al 1987) Anothercup of plants was separated into roots and shoots frozenimmediately in liquid nitrogen and stored at 808C for metaboliteand transcript analyses
Real-time quantitative RTndashPCR
Shoots and roots of three replicates from each P treatmentwere used for transcript analysis Total RNA was prepared usingTrizol reagent according to the manufacturerrsquos instructions(Invitrogen Carlsbad CA USA) Total RNA was treated withDNase I using the DNA free kit (Ambion Austin TX USA) toremove any contaminating genomic DNA and then RNA integritywas checked on an agarose gel cDNA was prepared from 2mg oftotal RNA using SuperScriptTM III reverse transcriptase accord-ing to the manufacturerrsquos instructions (Invitrogen) The reactionwas incubated at 508C for 45min and at 708C for 15min toinactivate the enzyme
The transcript levels of HvIPS1 and HvPht16 weredetermined by real-time quantitative PCR essentially as describedby Burton et al (2004) The transcript levels of three control genes(barley a-tubulin heat shock protein 70 and cyclophilin) weredetermined and used for normalization Normalization was carriedout as described by Vandesompele et al (2002) and Burtonet al (2004) The normalized copies mg RNA1 are presentedThe primers 50 GCGGCGACTTCTCACCTCTACTAAG and50 CGAAGGATTCAAACAGGATCACACA (GenBank acces-sion No BI780234) were used for amplification of HvIPS1 and50 GGTCAAGAACTCGCTATTCATCC and 50 CCATACATCCATCCAAACCTG (GenBank accession No AF543198) foramplification of HvPht16
Analysis of metabolites with GC-MS
Metabolite analysis was carried out by a GC-MS-basedmethod modified from Roessner et al (2006) Fresh tissues of rootsand shoots from barley plants were homogenized using a mortarand pestle with liquid nitrogen Frozen tissue powder (100 10mgexact fresh weight was recorded) was extracted with methanol(350 ml) A polar internal standard (20 ml of 02mgmlndash1 ribitol inwater) and a non-polar internal standard (30 ml of 2mgmlndash1
nonadecanoic acid methylester in chloroform) were subsequentlyadded as quantification standards The mixture was extracted for15min at 708C and then mixed vigorously with 1 vol of waterIn order to separate polar and non-polar metabolites 300 ml ofchloroform was added to the mixture and centrifuged at 2200gfor 10min The upper methanolwater phase was collected andwashed with chloroform (300 ml) The polar phase of shoot extracts(100 ml) and root extracts (250 ml) was separately dried undervacuum Both lipid layers were combined and dried under vacuumIn order to methylate fatty acids the residues of the non-polarfractions were further incubated with chloroform (100 ml) andacidified methanol (300 ml of 125N HCl in methanol) for 24 h at508C and afterwards dried under vacuum The dry polar residuewas redissolved and derivatized for 120min at 378C in methox-yamine hydrochloride (40 ml of 20mgml1 in pyridine) followedby a 30min treatment with N-methyl-N-[trimethylsilyl] trifluoro-acetamide (MSTFA) (70 ml) at 378C The dry non-polar residue
Metabolite profiles in P-deficient barley plants 701
was derivatized for 60min at 378C in pyridine (70 ml) and MSTFA(40 ml) To both a retention time standard mixture [10 ml of 0029(vv) n-dodecane n-pentadecane n-nonadecane n-docosanen-octacosane n-dotracontane n-hexatriacontane dissolved inpyridine] was added prior to trimethylsilylation Sample volumesof 1ml were then injected using the splitless mode onto a GCcolumn using a hot needle technique
The GC-MS system and conditions were as described inRoessner et al (2006) Acquired total ion chromatograms andmass spectra were evaluated using the Xcalibur program(ThermoFinnigan Manchester UK) and the resulting data areprepared normalized and presented as described by Roessner et al(2001) Mass spectra of eluting compounds were identified usingthe commercial mass spectra library NIST (httpwwwnistgov)and the public domain mass spectra library of the Max-Planck-Institute for Plant Physiology Golm Germany (httpcsbdbmpimp-golmmpgdecsbdbdbmamsrihtml) All matchingmass spectra were additionally co-verified by determination of theretention time and mass spectra by analysis of authentic standardsubstances
Analysis of free amino acids with LC-MS
Leaf material (15mg) was accurately weighed intoEppendorf tubes (2ml) and a solution of EDTA (400 ml 5mM)was added to each sample The samples were sonicated for15min then heated in a water bath (808C 15min) centrifuged(14500 rpm 5min) and the supernatant derivatized Thederivatization of the amino acids is based on a procedure outlinedby Cohen and Michaud (1993) and involved mixing the super-natant obtained above (20 ml) with borate buffer (200 ml 02MpH 88) followed by the addition of 10mM 6-aminoquinolyl-N-hydroxysuccinimidyl carbamate solution (50 ml) in dry aceto-nitrile The reaction mixture was then heated at 558C in a waterbath for 10min and analyzed by LC-MS as described by Callahanet al (2007)
The LC-MS system comprised a Surveyor LC PumpSurveyor Auto Sampler and LCQ Deca XP Max ion trapMS (Thermo Finnigan USA) The ESI (electron spray ionization)source was optimized by infusing a derivatized amino acidstandard in line with the mobile phase then tuning the sourceconditions and ion optics to optimize the signals for the derivatizedamino acids This resulted in the following conditions sheath gas30 arbitrary units auxiliary gas 10 arbitrary units spray voltage30 kV capillary temperature 2508C capillary voltage 56V andtube lens 53V
Derivatized amino acids were eluted on an Altantis dC18150 21mm 3mm (Waters Melbourne Australia) HPLC columnusing a three-step gradient of deionized water (01 formic acid)and acetonitrile (01 formic acid) at a flow rate of 025mlminndash1
and a column temperature of 308C (Callahan et al 2007)
Statistical analysis
Students t-test at P 005 was applied for the means (nfrac14 4) ofmetabolites presented in Supplementary Tables S1ndashS3 Statisticalanalyses were carried using the Pirouette 311 software (InfometrixInc Woodinville WA USA)
Supplementary material
Supplementary material mentioned in the article is avail-able to online subscribers at the journal website wwwpcpoxfordjournalsorg
Funding
The Grains Research and Development Corporation
the Australian Research Council the South Australian
Government the University of Adelaide and the University
of Melbourne to the Australian Center for Plant Functional
Genomics (CYH UR NS PL AB) the Molecular
Plant Breeding CRC to YG Metabolomics Australia to
(UR DC AB)
Acknowledgments
We are grateful to M Tester for discussion and to T Fowlesand L Palmer for ICP analysis
References
Amiard V Morvan-Bertrand A Billard JP Huault C Keller F andPrudrsquohomme MP (2003) Fructans but not the sucrosyl-galactosidesraffinose and loliose are affected by drought stress in perennial ryegrassPlant Physiol 132 2218ndash29
Bieleski RL and Ferguson IB (1983) Physiology and metabolism ofphosphate and its compounds In Encyclopedia of Plant PhysiologyEdited by Lauchli A and Bieleski RL Vol 15a pp 422ndash449 SpringerVerlag Berlin
Bolling C and Fiehn O (2005) Metabolite profiling of Chlamydomonasreinhardtii under nutrient deprivation Plant Physiol 139 1995ndash2005
Britto DT and Kronzucker HJ (2002) NH4thorn toxicity in higher plants
a critical review J Plant Physiol 159 567ndash584Burleigh SH and Harrison MJ (1997) A novel gene whose expression in
Medicago truncatula roots is suppressed in response to colonization byvesicularndasharbuscular mycorrhizal (VAM) fungi and to phosphatenutrition Plant Mol Biol 34 199ndash208
Burton RA Shirley NJ King BJ Harvey AJ and Fincher GB(2004) The CesA gene family of barley Quantitative analysis oftranscripts reveals two groups of co-expressed genes Plant Physiol134 224ndash236
Callahan DL Kolev SD OrsquoHair RAJ Salt DE and Baker AJM(2007) Relationships between nicotianamine and other amino acids withnickel zinc and iron in Thlaspi hyperaccumulators New Phytol 176836ndash848
Ciereszko I and Barbachowska A (2000) Sucrose metabolism in leavesand roots of bean (Phaseolus vulgaris L) during phosphate deficiencyJ Plant Physiol 156 640ndash644
Cohen SA and Michaud DP (1993) Synthesis of a fluorescentderivatizing reagent 6-aminoquinolyl-N-hydroxysuccinimidyl carba-mate and its application for the analysis of hydrolysate amino acidsvia high-performance liquid chromatography Anal Biochem 211279ndash287
Cruz-Ramirez A Oropeza-Aburto A Razo-Hernandez F Ramirez-Chavez E and Herrera-Estrella L (2006) Phospholipase DZ2 playsan important role in extraplastidic galactolipid biosynthesis andphosphate recycling in Arabidopsis roots Proc Natl Acad Sci USA103 6765ndash6770
Doermann P and Benning C (2002) Galactolipids rule in seed plantsTrends Plant Sci 7 112ndash118
Gniazdowska A and Rychter AM (2000) Nitrate uptake by bean(Phaseolus vulgaris L) roots under phosphate deficiency Plant Soil 22679ndash85
Hendry GAF (1993) Evolutionary origins and natural functions offructansmdasha climatological biogeographic and mechanistic appraisalNew Phytol 123 3ndash14
Hernandez G Ramirez M Valdes-Lopez O Tesfaye MGraham MA et al (2007) Phosphorus stress in common bean roottranscript and metabolic responses Plant Physiol 144 752ndash767
702 Metabolite profiles in P-deficient barley plants
Hewitt MM Carr JM Williamson CL and Slocum RD (2005)Effects of phosphate limitation on expression of genes involved in
pyrimidine synthesis and salvaging in Arabidopsis Plant Physiol
Biochem 43 91ndash99Hirai MY Yano M Goodenowe DB Kanaya S Kimura T
Awazuhara M Arita M Fujiwara T and Saito K (2004) Integration
of transcriptomics and metabolomics for understanding of global
responses to nutritional stresses in Arabidopsis thaliana Proc Natl
Acad Sci USA 101 10205ndash10210Hou XL Wu P Jiao FC Jia QJ Chen HM Yu J Song XW
and Yi KK (2005) Regulation of the expression of OsIPS1 and OsIPS2in rice via systemic and local Pi signaling and hormones Plant Cell
Environ 28 353ndash364Jeschke WD Kirkby EA Peuke AD Pate JS and Hartung W
(1997) Effects of P deficiency on assimilation and transport of nitrate andphosphate in intact plants of castor bean (Ricinus communis L) J Exp
Bot 48 75ndash91Kaplan F and Guy CL (2004) Beta-amylase induction and the protective
role of maltose during temperature shock Plant Physiol 135 1674ndash1684Kondracka A and Rychter AM (1997) The role of Pi recycling processes
during photosynthesis in phosphate-deficient bean plants J Exp Bot 48
1461ndash1468Kopka J (2006) Current challenges and developments in GC-MS based
metabolite profiling technology J Biotechnol 124 312ndash322Li K Xu C Zhang K Yang A and Zhang J (2007) Proteomic
analysis of roots growth and metabolic changes under phosphorus deficitin maize (Zea mays L) plants Proteomics 7 1501ndash1512
Liu CM Muchhal US and Raghothama KG (1997) Differential
expression of TPS11 a phosphate starvation-induced gene in tomatoPlant Mol Biol 33 867ndash874
Martin AC del Pozo JC Inglesias J Rubio V Solano Rde la Pena A Leyva A and Paz-Ares J (2000) Influence of cytokinins
on the expression of phosphate starvation responsive genes inArabidopsis Plant J 24 559ndash567
Mimura T (1999) Regulation of phosphate transport and homeostasis inplant cells Int Rev Cytol Cell Biol 191 149ndash200
Misson J Raghothama KG Jain A Jouhet J Block MA et al
(2005) A genome-wide transcriptional analysis using Arabidopsis thaliana
Affymetrix gene chips determined plant responses to phosphate depriva-
tion Proc Natl Acad Sci USA 102 11934ndash11939Morcuende R Bari R Gibon Y Zheng WM Pant BD Blasing O
Usadel B Czechowski T Udvardi MK Stitt M and Scheible WR(2007) Genome-wide reprogramming of metabolism and regulatory
networks of Arabidopsis in response to phosphorus Plant Cell Environ
30 85ndash112Muchhal US and Raghothama KG (1999) Transcriptional regulation of
plant phosphate transporters Proc Natl Acad Sci USA 96 5868ndash72Nanamori M Shinano T Wasaki J Yamamura T Rao IM and
Osaki M (2004) Low phosphorus tolerance mechanisms phosphorus
recycling and photosynthate partitioning in the tropical forage grassBrachiaria hybrid cultivar mulato compared with rice Plant Cell Environ
45 460ndash469Neumann G and Romheld V (1999) Root excretion of carboxylic acids
and protons in phosphorus-deficient plants Plant Soil 211 121ndash130Nikiforova VJ Gakiere B Kempa S Adamik M Willmitzer L
Hesse H and Hoefgen R (2004) Towards dissecting nutrient
metabolism in plants a systems biology case study on sulphur
metabolism J Exp Bot 55 1861ndash1870Nikiforova VJ Kopka J Tolstikov V Fiehn O Hopkins L
Hawkesford MJ Hesse H and Hoefgen R (2005) Systems rebalan-
cing of metabolism in response to sulfur deprivation as revealed bymetabolome analysis of Arabidopsis plants Plant Physiol 138 304ndash318
Nilsson L Muller R and Nielsen TH (2007) Increased expression of theMYB-related transcription factor PHR1 leads to enhanced phosphate
uptake in Arabidopsis thaliana Plant Cell Environ 30 1499ndash1512
Panikulangara TJ Eggers-Schumacher G Wunderlich M Stransky Hand Schoffl F (2004) Galactinol synthase 1 A novel heat shock factortarget gene responsible for heat-induced synthesis of raffinose familyoligosaccharides in Arabidopsis Plant Physiol 136 3148ndash3158
Pearse SJ Veneklaas EJ Cawthray G Bolland MDA andLambers H (2006) Triticum aestivum shows a greater biomass responseto a supply of aluminium phosphate than Lupinus albus despite releasingfewer carboxylates into the rhizosphere New Phytol 169 515ndash524
Plaxton WC (2004) Plant response to stress biochemical adaptations tophosphate deficiency In Encyclopedia of Plant and Crop Science Editedby Goodman R pp 976ndash980 Marcel Dekker Inc New York
Plaxton WC and Carswell MC (1999) Metabolic aspects of thephosphate starvation response in plants In Plant Response toEnvironmental Stresses From Photohormones to GenomeReorganization Edited by Lerner HR pp 349ndash372 Marcel DekkerInc New York
Rae AL Cybinski DH Jarmey JM and Smith FW (2003)Characterization of two phosphate transporters from barley evidencefor diverse function and kinetic properties among members of the Pht1family Plant Mol Biol 53 27ndash36
Raghothama KG (1999) Phosphate acquisition Annu Rev Plant PhysiolPlant Mol Biol 50 665ndash693
Reuter DJ and Robinson JB (1997) Plant Analysis An InterpretationManual 2nd edn pp 86ndash92 CSIRO Australia Melbourne
Roessner U Luedemann A Brust D Fiehn O Linke TWillmitzer L and Fernie AR (2001) Metabolic profiling allowscomprehensive phenotyping of genetically or environmentally modifiedplant systems Plant Cell 13 11ndash29
Roessner U Patterson JH Forbes MG Fincher GB Langridge Pand Bacic A (2006) An investigation of boron toxicity in barley usingmetabolomics Plant Physiol 142 1087ndash1101
Rychter AM and Randall DD (1994) The effect of phosphate deficiencyon carbohydrate metabolism in bean roots Physiol Plant 91 383ndash388
Schachtman DP Reid RJ and Ayling SM (1998) Phosphorus uptakeby plants from soil to cell Plant Physiol 116 447ndash453
Shih CY and Kao CH (1996) Growth inhibition in suspension-culturedrice cells under phosphate deprivation is mediated through putrescineaccumulation Plant Physiol 111 721ndash724
Uhde-Stone C Zinn KE Ramirez-Yanez M Li AG Vance CP andAllan DL (2003) Nylon filter arrays reveal differential gene expressionin proteoid roots of white lupin in response to phosphorus deficiencyPlant Physiol 131 1064ndash1079
Vance CP Uhde-Stone C and Allan DL (2003) Phosphorus acquisitionand use critical adaptations by plants for securing a non renewableresource New Phytol 157 423ndash447
Vandesompele J De Preter K Pattyn F Poppe B Van Roy NDe Paepe A and Speleman F (2002) Accurate normalization of real-time quantitative RTPCR data by geometric averaging of multipleinternal control genes Genome Biol 3 1ndash11
Wasaki J Yonetani R Kuroda S Shinano T Yazaki J et al (2003a)Transcriptomic analysis of metabolic changes by phosphorus stress in riceplant roots Plant Cell Environ 26 1515ndash1523
Wasaki J Yonetani R Shinano T Kai M and Osaki M (2003b)Expression of the OsPI1 gene cloned from rice roots using cDNAmicroarray rapidly responds to phosphorus status New Phytol 158239ndash248
Wingler A Lea PJ Quick WP and Leegood RC (2000)Photorespiration metabolic pathways and their role in stress protectionPhilos Trans R Soc B Biol Sci 355 1517ndash1529
Wu P Ma L Hou X Wang M Wu Y Liu F and Deng XW (2003)Phosphate starvation triggers distinct alterations of genome expression inArabidopsis roots and leaves Plant Physiol 132 1260ndash1271
Zarcinas BA Cartwright B and Spouncer LR (1987) Nitric aciddigestion and multi-element analysis of plant material by induc-tively coupled plasma spectrometry Commun Soil Sci Plant Anal 18131ndash146
(Received February 21 2008 Accepted March 13 2008)
Metabolite profiles in P-deficient barley plants 703
(Supplementary Tables S2 S3) These differences in amino
acid levels reflect the differential stabilities of the respective
amino acids to the different derivatization and detection
methodologies
The concentrations of glutamine and asparagine in
both shoots and roots were sensitive to ammonium
supplied They increased from approximately 10 mmol g1
DW in the shoots of the thornP treatment with 01mM
ammonium to 40 mmol g1 DW in the shoots of the thornP
treatment with 04mM ammonium (Fig 6A) In the
severely P-deficient plants the concentrations of glutamine
and asparagine in the shoots rose above 60 mmol g1 DW in
01mM ammonium and above 90 mmol g1 DW in 04mM
ammonium (Fig 6A) A similar magnitude of increase in
the concentrations of glutamine and asparagine was also
observed in the roots of the severely P-deficient plants
(Fig 6B) These results indicate that severe P deficiency
further increases the concentrations of glutamine and
asparagine in both shoots and roots When PthornP ratios
of amino acids in both shoots and roots of the plants treated
with 04mM ammonium were compared with those treated
with 01mM ammonium the high ammonium supply had
little effect on the PthornP ratios of amino acids except for
a reduction in the ratios of glutamine and asparagine and
140
120
100
Fre
sh w
eig
ht
(g p
lan
tminus1)
Fre
sh w
eig
ht
(g p
lan
tminus1)
P c
on
cen
trat
ion
(m
g g
minus1 D
W)
080
060
040
020
0
140minusP
+P120
100
080
060
040
Critical level
020
0
10
8
6
4
2
001 mM 04 mM
A
B
C
Fig 5 Effect of P and ammonium supply on plant growth andP nutrition (A) Fresh weight of shoots (B) Fresh weight of roots(C) P concentration of shoots Barley seedlings grown in a nutrientsolution containing either no NH4H2PO4 (P) or 01mMNH4H2PO4 (thornP) with two rates of ammonium (01 and 04mM)Plants were harvested at the 16th day after seed imbibitionStandard errors (nfrac14 4) are shown as vertical bars
1200Glu
Gln
Asp
Asn
1000
800
600
400
200
0
1200
1000
800
600
400
200
001N+P 04N+P01NminusP 04NminusP
Co
nce
ntr
atio
n (
mg g
minus1 D
W)
Co
nce
ntr
atio
n (
mg g
minus1 D
W)
A
B
Fig 6 Effect of P and ammonium supply on concentrations of fouramino acids (A) Concentrations of four amino acids in shoots(B) Concentrations of four amino acids in roots Barley seedlingsgrown in a nutrient solution containing either no NH4H2PO4 (P)or 01mM NH4H2PO4 (thornP) with two rates of ammonium (01 and04mM) Plants were harvested at the 16th day after seedimbibition The concentrations of amino acids were determinedby LC-MS (see Supplementary Table S3) Standard errors (nfrac14 4) areshown as vertical bars
Metabolite profiles in P-deficient barley plants 697
a couple of other amino acids (Supplementary Table S3)
These results indicate that the effect of severe P deficiency
on the concentrations of free amino acids in both shoots
and roots is largely independent of ammonium supply
In addition the concentrations of both glutamate
and aspartate precursors for synthesis of glutamine and
asparagine were affected by severe P deficiency The con-
centrations of glutamate and aspartate were reduced by
approximately 50 and 25 respectively in the shoots
of P treatments with either 01 or 04mM ammonium
relative to those of thornP treatments (Fig 6A and Supple-
mentary Table S3) The greater reductions in the concen-
trations of glutamate and aspartate were also observed in
the roots of P treatments with two rates of ammonium
supplied compared with those of thornP treatments (Fig 6B
and Supplementary Table S3) Interestingly the high
ammonium supplied did not reduce the concentrations of
glutamate and aspartate either in the shoots or in the roots
of thornP-treated plants (Fig 6A B Supplementary Table S3)
These results suggest that severely P-deficient plants utilize
amino acids as an alternative carbon resource especially in
the roots
Discussion
P deficiency in barley plants results in increases in di- and
trisaccharides and decreases in small P-containing
metabolites
P deficiency initially enhanced the accumulation of
di- and trisaccharides especially for maltose raffinose and
6-kestose in the shoots of the moderately P-deficient plants
(Fig 3) Only maltose increased in the roots (Fig 3
Supplementary Table S1) The transcript levels of HvPht16
(Fig 2) also indicate that roots are less sensitive to P
deficiency Severe P deficiency leads to a further increase in
di- and trisaccharides in both shoots and roots These data
are consistent with previous reports that P deficiency led
to an increase in the levels of starch sucrose and mono-
saccharides in common beans and Arabidopsis (Ciereszko
and Barbachowska 2000 Hernandez et al 2007 Nilsson
et al 2007) and a graminaceous plant Brachiaria hybrid
(Nanamori et al 2004) It also is consistent with the reduced
level of sucrose synthase in P-deficient maize roots (Li et al
2007) The increased levels of mono- di- and polysaccha-
rides suggest that glycolysis may be hindered in both shoots
and roots of P-deficient barley plants In contrast the
cDNA array analyses from lupin and rice suggest that P
deficiency stimulates glycolysis (Uhde-Stone et al 2003
Wasaki et al 2003a) It is conceivable that to maintain
a high level of organic acid secretion in the proteoid roots
of lupin a enhanced level of glycolysis is necessary under
P-deficient conditions (Pearse et al 2006) but it is not clear
why rice did not show enhanced accumulation of di- and
polysaccharides under P-deficient conditions (Nanamori
et al 2004) It appears that metabolic changes in glycolysis
in response to P deficiency differ among plant species
Severe P deficiency depleted inorganic Pi storage pools
as indicated by the sharp reduction of phosphoric acid
in the polar fractions of plant tissues to 510 of
the controls (PDS17thornPDS17 and PDR17thornPDS17
Supplementary Table S2) Under these conditions organic
P is an alternative resource of P for plant cells RNA
phospholipids and small phosphorylated metabolites are
three main classes of compounds containing phosphoesters
Degradation of RNA by increased RNase activity under
Pi-limiting conditions is well documented (Plaxton 2004)
The RNA content in the shoots of severely P-deficient
Arabidopsis plants was reduced to 13 of that in the
P-sufficient plants (Hewitt et al 2005) Considerable
amounts of organic P are present in small phosphorylated
metabolites which is approximately equivalent to that
in RNA or in phospholipids (Bieleski and Ferguson
1983 Doermann and Benning 2002) The levels of
small phosphorylated metabolites including glucose-6-P
fructose-6-P and inositol-1-P were largely reduced in both
shoots and roots of the severely P-deficient plants and the
level of glycerol-3-P in the polar fraction was also sharply
reduced in the shoots of the severely P-deficient plants
(Fig 4) The reduction of phosphorylated sugars was also
observed in bean roots and Arabidopsis under P-deficient
conditions (Rychter and Randall 1994 Morcuende et al
2007) These results indicate that severely P-deficient plants
salvage P from small phosphorylated metabolites for
essential cellular functions These small phosphorylated
metabolites are important intermediates in glycolysis and
synthesis of polysaccharides (glucose-6-P and fructose-6-P)
phospholipids (glycerol-3-P and inositol-1-P) amino acids
and nucleotides and in energy production Thus a depletion
of these phosphorylated metabolites would have a severe
impact not only on carbohydrate and nitrogen metabolism
but also on other metabolic processes
The enhanced accumulation of di- and tri-saccharides
in P-deficient plants can reduce the consumption of Pi in
phosphorylation of sugar metabolites and convert the small
phosphorylated metabolites to non-P-containing di- and
trisaccharides and other compounds such as aromatic
compounds (Figs 3 4) This could be a strategy to reduce
Pi consumption but may also have a benefit in osmotic
protection for stressed plants Increased accumulation of
di- and trisaccharides such as raffinose has been described
in plants exposed to heat stress (Panikulangara et al 2004)
and sulfate deficiency (Nikiforova et al 2005) maltose in
acute temperature stress (Kaplan and Guy 2004) and
6-kestose a precursor for synthesis of fructans under
drought conditions (Hendry 1993 Amiard et al 2003)
However carbohydrate formed as di- and trisaccharides
698 Metabolite profiles in P-deficient barley plants
shown to accumulate in P-deficient plants cannot be utilized
readily for energy metabolism without involvement of Pi
to provide carbon metabolites for the TCA cycle An
alternative storage form of carbon such as organic acids
and amino acids would be preferred for survival of
P-deficient plants (Nanamori et al 2004)
P deficiency reduces organic acids in the TCA cycle
The reduced levels of several organic acids of the TCA
cycle including a-ketoglutarate succinate fumarate and
malate (Fig 4) and the reduction in the concentrations
of glutamate and aspartate especially in the roots of
the severely P-deficient plants (Fig 6B) suggest that the
shortage in carbohydrate supply is more apparent in the
roots than in the shoots of severely P-deficient plants
Reduced levels of fumarate were also observed in
P-deficient Arabidopsis (Misson et al 2005) In addition P
deficiency increases the secretion of organic acids into the
rhizosphere although cereals are weak secretors of organic
acids compared with legumes under low P conditions
(Neumann and Romheld 1999 Pearse et al 2006) The
secretion of organic acids could also contribute to
the reduction of the organic acids in the root tissues The
roots of severely P-deficient plants have to adjust metabolic
processes to utilize possible carbon metabolites such as
amino acids Some of the amino acids could be utilized as
an alternative carbon resource for energy production
reassimilation of the released ammonium and synthesis of
organic acids for secretion Interestingly the levels of several
organic acids in the TCA cycle were also reduced in
the roots of P-deficient common beans (Hernandez et al
2007) As legumes are efficient secretors of organic acids
(Neumann and Romheld 1999 Pearse et al 2006) secretion
could be a significant contributor to the reduced levels of
organic acids in the roots Nevertheless no reduction in
small P-containing metabolites nor organic acids in the
TCA cycle is observed in sulfate-deficient Arabidopsis plants
(Hirai et al 2004 Nikiforova et al 2005) indicating that
the reduction in the organic acids is unique to P-deficient
plant species
Severe P deficiency alters nitrogen metabolism
In P-deficient conditions transcript levels of the
genes coding for enzymes involved in protein degradation
were enhanced and the genes for protein synthesis were
suppressed in both Arabidopsis and common beans
(Wu et al 2003 Misson et al 2005 Hernandez et al
2007) The abundance of proteins related to protein
degradation through the ubiquitinndash26S proteasome path-
way was found to have increased in P-deficient roots of
maize (Li et al 2007) The reduced transcript levels of genes
related to nitrate reduction (Wu et al 2003) and reduced
activities for nitrate reduction have also been described in
P-deficient plants (Gniazdowska and Rychter 2000)
The increased concentrations of total free amino acids in
the shoots of severely P-deficient plants (Supplementary
Table S3) are likely to result from increased protein
degradation and repressed protein synthesis Various
metabolic reactions involved in either synthesis or degrada-
tion of amino acids produce ammonia such as aspara-
gine to aspartate glutamine to glutamate glutamate to
a-ketoglutarate and glycine to serine P deficiency enhances
the transcript levels of alanine aminotransferase genes
in both Arabidopsis and common beans (Wu et al 2003
Hernandez et al 2007) and the protein abundance of
glutamate dehydrogenase and phenylalanine ammonia-
lyase in maize roots (Li et al 2007) A high concentration
of ammonium is harmful to plants especially for barley an
ammonium-sensitive plant (Britto and Kronzucker 2002)
Thus it is critical to avoid excessive accumulation of
ammonium in P-deficient plants The levels of glutamine
and asparagine were elevated in both shoots and roots of
severely P-deficient plants and other metabolites related to
ammonium metabolism including putrescine and tyramine
were also enhanced in the severely P-deficient plants
especially in the roots (Supplementary Table S2) The
increased level of putrescine was also observed in P-deficient
rice cells (Shih and Kao 1996) These data suggest that
deamination of amino acids occurs in the severely
P-deficient plants for utilization in carbon metabolism
and a concomitant increase in assimilation of ammonium
takes place to ensure a reduction in levels of ammonium
The increased activities of glutamate dehydrogenase and
glutamine synthase in Arabidopsis plants (Morcuende et al
2007) and the enhanced protein abundance of root
glutamate dehydrogenase and glutamine synthase observed
in P-deficient maize plants (Li et al 2007) support this
interpretation It is interesting to note that the transcript
levels of glutamate synthase were down-regulated by P
deficiency in rice (Wasaki et al 2003a) Rice is an
ammonium-tolerant species which is in contrast to barley
that is an ammonium-sensitive species (Britto and
Kronzucker 2002) The difference in the metabolite levels
related to ammonium metabolism between P-deficient
barley and rice may be due to this different mechanism of
tolerance to ammonium
The synthesis of glutamine and asparagine requires
a carbon skeleton The enhanced levels of glutamine
and asparagine will require additional molecules of
a-ketoglutarate and oxaloacetate withdrawn from the
TCA cycle leading to a further reduction in the levels
of organic acids and restriction in energy production
in severely P-deficient plants The increased levels of
glutamine asparagine and other metabolites closely
related to ammonium metabolism are also observed in
other nutrient stresses such as nitrogen and sulfate
Metabolite profiles in P-deficient barley plants 699
deficiency (Hirai et al 2004 Nikiforova et al 2005) but
the specific reduction in glutamate and aspartate is
only observed in P-deficient barley plants As synthesis
of glutamine and asparagine can incorporate two ammo-
nium molecules into one organic acid this is a highly
effective ammonium assimilation mechanism under the
carbohydrate-limiting conditions caused by P deficiency
Our metabolite analyses provide indirect evidence that
P-deficient plants are confronted with increased ammonium
To establish a direct link of P deficiency to the increased
accumulation of ammonium in barley tissues further
experiments are required by supplying low concentrations
of ammonium and monitoring ammonium levels in plant
tissues
The increased levels of glycine and serine in the shoots
of the severely P-deficient plants indicate that photorespira-
tion is enhanced in the shoots of the severely P-deficient
plants because glycine and serine are intermediates for
photorespiration (Wingler et al 2000) and the increased
levels of glycine and serine correlate well with the rate of
photorespiration in P-deficient bean plants (Kondracka and
Rychter 1997) Increases in the levels of glycine and serine
were also observed in sulfur-deficient Arabidopsis plants
(Nikiforava et al 2005) indicating that the increase in
photorespiration is a general stress response (Wingler et al
2000)
Carbohydrate partitioning in P-deficient barley differs
from a P-efficient Gramineae grass
P deficiency results in the enhanced accumulation of
di- and trisaccharides and reduced organic acids in barley
plants which generally is similar to rice a P-inefficient
plant (Nanamori et al 2004) A P-efficient grass (Brachiaria
hybrid) is very different from rice in carbohydrate par-
titioning under P-deficient conditions (Nanamori et al
2004) The Brachiaria hybrid can allocate more carbohy-
drates into organic acids and amino acids Maintaining high
activities of phosphoenolpyruvate carboxylase and phos-
phoenolpyruvate phosphatase under the low P condition
appears to be critical for allocating a large proportion of
carbohydrate into organic acids and amino acids Our data
suggest that barley behaves as a P-inefficient plant in
metabolic adaptation to low P environments Thus to
improve P efficiency in barley and perhaps other cereal
crops manipulation of metabolism through a shift in
carbohydrate partitioning could provide a logical strategy
In summary the metabolite profiles generated from
both shoots and roots provide an overview of the metabolic
adjustments that occur in P-deficient barley plants As
illustrated in Fig 7 P-deficient barley plants alter the levels
of many key metabolites which affect various metabolic
pathways including glycolysis photorespiration and
metabolism of nitrogen and phospholipids These adaptive
P inefficiency
P efficiency
ribose
inositol-1-P
glycine(shoots)
serine(shoots)
alanine(shoots)
aspartate
asparagine malate
fumarate
succinate
citrate
a-ketoglutarate
glutamine
glutamate
urea(roots)
glc
glc-6-P
fru
glycerol-3-P
aromaticcompounds
fru-6-P
di- and tri-saccharides
Carbohydratepartitioning
glycerate-3-P
PEP
pyruvate
oxaloacetate
Fig 7 Schematic summary of metabolic adjustments in P-deficient plants and the proposed carbohydrate partitioning for improvementof P efficiency in cereals Thick arrows in green indicate an increase in metabolite levels and thin arrows in red indicate a decreasein metabolite levels The dashed line indicates carbohydrate partitioning for high P efficiency (below the line) and for low P efficiency(above the line)
700 Metabolite profiles in P-deficient barley plants
adjustments reduce Pi consumption by increasing the
levels of di- and trisaccharides and salvage Pi from various
P-containing compounds including small P-containing
metabolites to maintain essential cellular functions An
immediate consequence which is unique to P deficiency is
greatlly reduced levels of the key metabolites in glycolysis
leading to the decrease in carbohydrate supply to the TCA
cycle especially in the roots In addition P-deficient plants
are likely to be confronted with the challenge of increased
ammonium derived from the degradation of protein The
assimilation of the increased ammonium requires additional
organic acids from the TCA cycle which depletes the
organic acid supply further It is noteworthy that although
there are di- and trisaccharides present in the P-deficient
plants they cannot be readily utilized Organic acids and
amino acids are the preferred storage metabolites in
P-deficient plants (Nanamori et al 2004) as they can be
readily utilized as the carbon resource by P-deficient plants
Therefore if barley (and other cereals) are to be engineered
to be better adapted to growth in P-deficient soils there
is a need to shift the partitioning of carbohydrate from
di- and tri-saccharides to organic acids and amino acids
Investigating the expression of genes (transcriptome) and
proteins (proteome) in barley under P-deficient conditions
would provide additional evidence to support this strategy
for enhancing the P efficiency
Materials and Methods
Plant materials
Barley (H vulgare L cv Lofty Nijo) seeds were surface-sterilized with 70 ethanol for 1min and 3 hypochlorite for5min rinsed with deionized water and incubated in Petri dishes for2 d at room temperature Two seeds with an emerged radicle wereput into a seedling cup which was placed in the lid of a black plasticcontainer Each container contained either four seedling cups fortwo harvests or two seedling cups for one harvest and were filledwith 1 liter of nutrient solution The basal nutrients were as follows(in mM) Ca(NO3)2 1000 KNO3 1000 MgSO4 250 KCl 50H3BO3 125 Fe-HEDTA 10 MnSO4 04 CuSO4 01 ZnSO405 NiSO4 01 and MoO3 01 with NH4H2PO4 100 (thornPtreatment) or without NH4H2PO4 (P treatment) To balanceNH4 ions added in the thornP treatment 100 mM NH4NO3 was addedinto the nutrient solution of the P treatment In the additionalexperiment with two levels of ammonium either 100 or 400 mMNH4NO3 was added in the thornP treatment and either nil or 300 mMNH4NO3 was added in the P treatment All treatments werereplicated four times Half-strength nutrient solution was useduntil the 10th day after seed imbibition for the plants harvested atday 10 and day 17 but the eighth day for the plants harvestedat day 16 Full strength was applied thereafter The full-strengthnutrient solution was replaced at day 14 for the plants harvested atday 17 but at day 12 for the plants harvested at day 16 The pH ofthe nutrient solution was adjusted to 60 with 1M KOH and thesolution was aerated continuously
Plants were grown in a controlled environment at 208Cday158C night with a photoperiod regime of 14 h day10 h nightat 300 mmolm2 sndash1 photon flux intensity at the plant level At each
harvest two seedling cups were removed from each containerPlants were collected in 5ndash6 h of the light period to eliminatediurnal changes in metabolite levels The roots of plants from oneseedling cup were rinsed briefly in deionized water excess waterwas blotted on fresh laboratory tissues and the roots and shootswere separated and oven-dried at 658C for 48 h The dry plantsamples were used for mineral element analysis by inductivelycoupled plasma spectrophotometry (Zarcinas et al 1987) Anothercup of plants was separated into roots and shoots frozenimmediately in liquid nitrogen and stored at 808C for metaboliteand transcript analyses
Real-time quantitative RTndashPCR
Shoots and roots of three replicates from each P treatmentwere used for transcript analysis Total RNA was prepared usingTrizol reagent according to the manufacturerrsquos instructions(Invitrogen Carlsbad CA USA) Total RNA was treated withDNase I using the DNA free kit (Ambion Austin TX USA) toremove any contaminating genomic DNA and then RNA integritywas checked on an agarose gel cDNA was prepared from 2mg oftotal RNA using SuperScriptTM III reverse transcriptase accord-ing to the manufacturerrsquos instructions (Invitrogen) The reactionwas incubated at 508C for 45min and at 708C for 15min toinactivate the enzyme
The transcript levels of HvIPS1 and HvPht16 weredetermined by real-time quantitative PCR essentially as describedby Burton et al (2004) The transcript levels of three control genes(barley a-tubulin heat shock protein 70 and cyclophilin) weredetermined and used for normalization Normalization was carriedout as described by Vandesompele et al (2002) and Burtonet al (2004) The normalized copies mg RNA1 are presentedThe primers 50 GCGGCGACTTCTCACCTCTACTAAG and50 CGAAGGATTCAAACAGGATCACACA (GenBank acces-sion No BI780234) were used for amplification of HvIPS1 and50 GGTCAAGAACTCGCTATTCATCC and 50 CCATACATCCATCCAAACCTG (GenBank accession No AF543198) foramplification of HvPht16
Analysis of metabolites with GC-MS
Metabolite analysis was carried out by a GC-MS-basedmethod modified from Roessner et al (2006) Fresh tissues of rootsand shoots from barley plants were homogenized using a mortarand pestle with liquid nitrogen Frozen tissue powder (100 10mgexact fresh weight was recorded) was extracted with methanol(350 ml) A polar internal standard (20 ml of 02mgmlndash1 ribitol inwater) and a non-polar internal standard (30 ml of 2mgmlndash1
nonadecanoic acid methylester in chloroform) were subsequentlyadded as quantification standards The mixture was extracted for15min at 708C and then mixed vigorously with 1 vol of waterIn order to separate polar and non-polar metabolites 300 ml ofchloroform was added to the mixture and centrifuged at 2200gfor 10min The upper methanolwater phase was collected andwashed with chloroform (300 ml) The polar phase of shoot extracts(100 ml) and root extracts (250 ml) was separately dried undervacuum Both lipid layers were combined and dried under vacuumIn order to methylate fatty acids the residues of the non-polarfractions were further incubated with chloroform (100 ml) andacidified methanol (300 ml of 125N HCl in methanol) for 24 h at508C and afterwards dried under vacuum The dry polar residuewas redissolved and derivatized for 120min at 378C in methox-yamine hydrochloride (40 ml of 20mgml1 in pyridine) followedby a 30min treatment with N-methyl-N-[trimethylsilyl] trifluoro-acetamide (MSTFA) (70 ml) at 378C The dry non-polar residue
Metabolite profiles in P-deficient barley plants 701
was derivatized for 60min at 378C in pyridine (70 ml) and MSTFA(40 ml) To both a retention time standard mixture [10 ml of 0029(vv) n-dodecane n-pentadecane n-nonadecane n-docosanen-octacosane n-dotracontane n-hexatriacontane dissolved inpyridine] was added prior to trimethylsilylation Sample volumesof 1ml were then injected using the splitless mode onto a GCcolumn using a hot needle technique
The GC-MS system and conditions were as described inRoessner et al (2006) Acquired total ion chromatograms andmass spectra were evaluated using the Xcalibur program(ThermoFinnigan Manchester UK) and the resulting data areprepared normalized and presented as described by Roessner et al(2001) Mass spectra of eluting compounds were identified usingthe commercial mass spectra library NIST (httpwwwnistgov)and the public domain mass spectra library of the Max-Planck-Institute for Plant Physiology Golm Germany (httpcsbdbmpimp-golmmpgdecsbdbdbmamsrihtml) All matchingmass spectra were additionally co-verified by determination of theretention time and mass spectra by analysis of authentic standardsubstances
Analysis of free amino acids with LC-MS
Leaf material (15mg) was accurately weighed intoEppendorf tubes (2ml) and a solution of EDTA (400 ml 5mM)was added to each sample The samples were sonicated for15min then heated in a water bath (808C 15min) centrifuged(14500 rpm 5min) and the supernatant derivatized Thederivatization of the amino acids is based on a procedure outlinedby Cohen and Michaud (1993) and involved mixing the super-natant obtained above (20 ml) with borate buffer (200 ml 02MpH 88) followed by the addition of 10mM 6-aminoquinolyl-N-hydroxysuccinimidyl carbamate solution (50 ml) in dry aceto-nitrile The reaction mixture was then heated at 558C in a waterbath for 10min and analyzed by LC-MS as described by Callahanet al (2007)
The LC-MS system comprised a Surveyor LC PumpSurveyor Auto Sampler and LCQ Deca XP Max ion trapMS (Thermo Finnigan USA) The ESI (electron spray ionization)source was optimized by infusing a derivatized amino acidstandard in line with the mobile phase then tuning the sourceconditions and ion optics to optimize the signals for the derivatizedamino acids This resulted in the following conditions sheath gas30 arbitrary units auxiliary gas 10 arbitrary units spray voltage30 kV capillary temperature 2508C capillary voltage 56V andtube lens 53V
Derivatized amino acids were eluted on an Altantis dC18150 21mm 3mm (Waters Melbourne Australia) HPLC columnusing a three-step gradient of deionized water (01 formic acid)and acetonitrile (01 formic acid) at a flow rate of 025mlminndash1
and a column temperature of 308C (Callahan et al 2007)
Statistical analysis
Students t-test at P 005 was applied for the means (nfrac14 4) ofmetabolites presented in Supplementary Tables S1ndashS3 Statisticalanalyses were carried using the Pirouette 311 software (InfometrixInc Woodinville WA USA)
Supplementary material
Supplementary material mentioned in the article is avail-able to online subscribers at the journal website wwwpcpoxfordjournalsorg
Funding
The Grains Research and Development Corporation
the Australian Research Council the South Australian
Government the University of Adelaide and the University
of Melbourne to the Australian Center for Plant Functional
Genomics (CYH UR NS PL AB) the Molecular
Plant Breeding CRC to YG Metabolomics Australia to
(UR DC AB)
Acknowledgments
We are grateful to M Tester for discussion and to T Fowlesand L Palmer for ICP analysis
References
Amiard V Morvan-Bertrand A Billard JP Huault C Keller F andPrudrsquohomme MP (2003) Fructans but not the sucrosyl-galactosidesraffinose and loliose are affected by drought stress in perennial ryegrassPlant Physiol 132 2218ndash29
Bieleski RL and Ferguson IB (1983) Physiology and metabolism ofphosphate and its compounds In Encyclopedia of Plant PhysiologyEdited by Lauchli A and Bieleski RL Vol 15a pp 422ndash449 SpringerVerlag Berlin
Bolling C and Fiehn O (2005) Metabolite profiling of Chlamydomonasreinhardtii under nutrient deprivation Plant Physiol 139 1995ndash2005
Britto DT and Kronzucker HJ (2002) NH4thorn toxicity in higher plants
a critical review J Plant Physiol 159 567ndash584Burleigh SH and Harrison MJ (1997) A novel gene whose expression in
Medicago truncatula roots is suppressed in response to colonization byvesicularndasharbuscular mycorrhizal (VAM) fungi and to phosphatenutrition Plant Mol Biol 34 199ndash208
Burton RA Shirley NJ King BJ Harvey AJ and Fincher GB(2004) The CesA gene family of barley Quantitative analysis oftranscripts reveals two groups of co-expressed genes Plant Physiol134 224ndash236
Callahan DL Kolev SD OrsquoHair RAJ Salt DE and Baker AJM(2007) Relationships between nicotianamine and other amino acids withnickel zinc and iron in Thlaspi hyperaccumulators New Phytol 176836ndash848
Ciereszko I and Barbachowska A (2000) Sucrose metabolism in leavesand roots of bean (Phaseolus vulgaris L) during phosphate deficiencyJ Plant Physiol 156 640ndash644
Cohen SA and Michaud DP (1993) Synthesis of a fluorescentderivatizing reagent 6-aminoquinolyl-N-hydroxysuccinimidyl carba-mate and its application for the analysis of hydrolysate amino acidsvia high-performance liquid chromatography Anal Biochem 211279ndash287
Cruz-Ramirez A Oropeza-Aburto A Razo-Hernandez F Ramirez-Chavez E and Herrera-Estrella L (2006) Phospholipase DZ2 playsan important role in extraplastidic galactolipid biosynthesis andphosphate recycling in Arabidopsis roots Proc Natl Acad Sci USA103 6765ndash6770
Doermann P and Benning C (2002) Galactolipids rule in seed plantsTrends Plant Sci 7 112ndash118
Gniazdowska A and Rychter AM (2000) Nitrate uptake by bean(Phaseolus vulgaris L) roots under phosphate deficiency Plant Soil 22679ndash85
Hendry GAF (1993) Evolutionary origins and natural functions offructansmdasha climatological biogeographic and mechanistic appraisalNew Phytol 123 3ndash14
Hernandez G Ramirez M Valdes-Lopez O Tesfaye MGraham MA et al (2007) Phosphorus stress in common bean roottranscript and metabolic responses Plant Physiol 144 752ndash767
702 Metabolite profiles in P-deficient barley plants
Hewitt MM Carr JM Williamson CL and Slocum RD (2005)Effects of phosphate limitation on expression of genes involved in
pyrimidine synthesis and salvaging in Arabidopsis Plant Physiol
Biochem 43 91ndash99Hirai MY Yano M Goodenowe DB Kanaya S Kimura T
Awazuhara M Arita M Fujiwara T and Saito K (2004) Integration
of transcriptomics and metabolomics for understanding of global
responses to nutritional stresses in Arabidopsis thaliana Proc Natl
Acad Sci USA 101 10205ndash10210Hou XL Wu P Jiao FC Jia QJ Chen HM Yu J Song XW
and Yi KK (2005) Regulation of the expression of OsIPS1 and OsIPS2in rice via systemic and local Pi signaling and hormones Plant Cell
Environ 28 353ndash364Jeschke WD Kirkby EA Peuke AD Pate JS and Hartung W
(1997) Effects of P deficiency on assimilation and transport of nitrate andphosphate in intact plants of castor bean (Ricinus communis L) J Exp
Bot 48 75ndash91Kaplan F and Guy CL (2004) Beta-amylase induction and the protective
role of maltose during temperature shock Plant Physiol 135 1674ndash1684Kondracka A and Rychter AM (1997) The role of Pi recycling processes
during photosynthesis in phosphate-deficient bean plants J Exp Bot 48
1461ndash1468Kopka J (2006) Current challenges and developments in GC-MS based
metabolite profiling technology J Biotechnol 124 312ndash322Li K Xu C Zhang K Yang A and Zhang J (2007) Proteomic
analysis of roots growth and metabolic changes under phosphorus deficitin maize (Zea mays L) plants Proteomics 7 1501ndash1512
Liu CM Muchhal US and Raghothama KG (1997) Differential
expression of TPS11 a phosphate starvation-induced gene in tomatoPlant Mol Biol 33 867ndash874
Martin AC del Pozo JC Inglesias J Rubio V Solano Rde la Pena A Leyva A and Paz-Ares J (2000) Influence of cytokinins
on the expression of phosphate starvation responsive genes inArabidopsis Plant J 24 559ndash567
Mimura T (1999) Regulation of phosphate transport and homeostasis inplant cells Int Rev Cytol Cell Biol 191 149ndash200
Misson J Raghothama KG Jain A Jouhet J Block MA et al
(2005) A genome-wide transcriptional analysis using Arabidopsis thaliana
Affymetrix gene chips determined plant responses to phosphate depriva-
tion Proc Natl Acad Sci USA 102 11934ndash11939Morcuende R Bari R Gibon Y Zheng WM Pant BD Blasing O
Usadel B Czechowski T Udvardi MK Stitt M and Scheible WR(2007) Genome-wide reprogramming of metabolism and regulatory
networks of Arabidopsis in response to phosphorus Plant Cell Environ
30 85ndash112Muchhal US and Raghothama KG (1999) Transcriptional regulation of
plant phosphate transporters Proc Natl Acad Sci USA 96 5868ndash72Nanamori M Shinano T Wasaki J Yamamura T Rao IM and
Osaki M (2004) Low phosphorus tolerance mechanisms phosphorus
recycling and photosynthate partitioning in the tropical forage grassBrachiaria hybrid cultivar mulato compared with rice Plant Cell Environ
45 460ndash469Neumann G and Romheld V (1999) Root excretion of carboxylic acids
and protons in phosphorus-deficient plants Plant Soil 211 121ndash130Nikiforova VJ Gakiere B Kempa S Adamik M Willmitzer L
Hesse H and Hoefgen R (2004) Towards dissecting nutrient
metabolism in plants a systems biology case study on sulphur
metabolism J Exp Bot 55 1861ndash1870Nikiforova VJ Kopka J Tolstikov V Fiehn O Hopkins L
Hawkesford MJ Hesse H and Hoefgen R (2005) Systems rebalan-
cing of metabolism in response to sulfur deprivation as revealed bymetabolome analysis of Arabidopsis plants Plant Physiol 138 304ndash318
Nilsson L Muller R and Nielsen TH (2007) Increased expression of theMYB-related transcription factor PHR1 leads to enhanced phosphate
uptake in Arabidopsis thaliana Plant Cell Environ 30 1499ndash1512
Panikulangara TJ Eggers-Schumacher G Wunderlich M Stransky Hand Schoffl F (2004) Galactinol synthase 1 A novel heat shock factortarget gene responsible for heat-induced synthesis of raffinose familyoligosaccharides in Arabidopsis Plant Physiol 136 3148ndash3158
Pearse SJ Veneklaas EJ Cawthray G Bolland MDA andLambers H (2006) Triticum aestivum shows a greater biomass responseto a supply of aluminium phosphate than Lupinus albus despite releasingfewer carboxylates into the rhizosphere New Phytol 169 515ndash524
Plaxton WC (2004) Plant response to stress biochemical adaptations tophosphate deficiency In Encyclopedia of Plant and Crop Science Editedby Goodman R pp 976ndash980 Marcel Dekker Inc New York
Plaxton WC and Carswell MC (1999) Metabolic aspects of thephosphate starvation response in plants In Plant Response toEnvironmental Stresses From Photohormones to GenomeReorganization Edited by Lerner HR pp 349ndash372 Marcel DekkerInc New York
Rae AL Cybinski DH Jarmey JM and Smith FW (2003)Characterization of two phosphate transporters from barley evidencefor diverse function and kinetic properties among members of the Pht1family Plant Mol Biol 53 27ndash36
Raghothama KG (1999) Phosphate acquisition Annu Rev Plant PhysiolPlant Mol Biol 50 665ndash693
Reuter DJ and Robinson JB (1997) Plant Analysis An InterpretationManual 2nd edn pp 86ndash92 CSIRO Australia Melbourne
Roessner U Luedemann A Brust D Fiehn O Linke TWillmitzer L and Fernie AR (2001) Metabolic profiling allowscomprehensive phenotyping of genetically or environmentally modifiedplant systems Plant Cell 13 11ndash29
Roessner U Patterson JH Forbes MG Fincher GB Langridge Pand Bacic A (2006) An investigation of boron toxicity in barley usingmetabolomics Plant Physiol 142 1087ndash1101
Rychter AM and Randall DD (1994) The effect of phosphate deficiencyon carbohydrate metabolism in bean roots Physiol Plant 91 383ndash388
Schachtman DP Reid RJ and Ayling SM (1998) Phosphorus uptakeby plants from soil to cell Plant Physiol 116 447ndash453
Shih CY and Kao CH (1996) Growth inhibition in suspension-culturedrice cells under phosphate deprivation is mediated through putrescineaccumulation Plant Physiol 111 721ndash724
Uhde-Stone C Zinn KE Ramirez-Yanez M Li AG Vance CP andAllan DL (2003) Nylon filter arrays reveal differential gene expressionin proteoid roots of white lupin in response to phosphorus deficiencyPlant Physiol 131 1064ndash1079
Vance CP Uhde-Stone C and Allan DL (2003) Phosphorus acquisitionand use critical adaptations by plants for securing a non renewableresource New Phytol 157 423ndash447
Vandesompele J De Preter K Pattyn F Poppe B Van Roy NDe Paepe A and Speleman F (2002) Accurate normalization of real-time quantitative RTPCR data by geometric averaging of multipleinternal control genes Genome Biol 3 1ndash11
Wasaki J Yonetani R Kuroda S Shinano T Yazaki J et al (2003a)Transcriptomic analysis of metabolic changes by phosphorus stress in riceplant roots Plant Cell Environ 26 1515ndash1523
Wasaki J Yonetani R Shinano T Kai M and Osaki M (2003b)Expression of the OsPI1 gene cloned from rice roots using cDNAmicroarray rapidly responds to phosphorus status New Phytol 158239ndash248
Wingler A Lea PJ Quick WP and Leegood RC (2000)Photorespiration metabolic pathways and their role in stress protectionPhilos Trans R Soc B Biol Sci 355 1517ndash1529
Wu P Ma L Hou X Wang M Wu Y Liu F and Deng XW (2003)Phosphate starvation triggers distinct alterations of genome expression inArabidopsis roots and leaves Plant Physiol 132 1260ndash1271
Zarcinas BA Cartwright B and Spouncer LR (1987) Nitric aciddigestion and multi-element analysis of plant material by induc-tively coupled plasma spectrometry Commun Soil Sci Plant Anal 18131ndash146
(Received February 21 2008 Accepted March 13 2008)
Metabolite profiles in P-deficient barley plants 703
a couple of other amino acids (Supplementary Table S3)
These results indicate that the effect of severe P deficiency
on the concentrations of free amino acids in both shoots
and roots is largely independent of ammonium supply
In addition the concentrations of both glutamate
and aspartate precursors for synthesis of glutamine and
asparagine were affected by severe P deficiency The con-
centrations of glutamate and aspartate were reduced by
approximately 50 and 25 respectively in the shoots
of P treatments with either 01 or 04mM ammonium
relative to those of thornP treatments (Fig 6A and Supple-
mentary Table S3) The greater reductions in the concen-
trations of glutamate and aspartate were also observed in
the roots of P treatments with two rates of ammonium
supplied compared with those of thornP treatments (Fig 6B
and Supplementary Table S3) Interestingly the high
ammonium supplied did not reduce the concentrations of
glutamate and aspartate either in the shoots or in the roots
of thornP-treated plants (Fig 6A B Supplementary Table S3)
These results suggest that severely P-deficient plants utilize
amino acids as an alternative carbon resource especially in
the roots
Discussion
P deficiency in barley plants results in increases in di- and
trisaccharides and decreases in small P-containing
metabolites
P deficiency initially enhanced the accumulation of
di- and trisaccharides especially for maltose raffinose and
6-kestose in the shoots of the moderately P-deficient plants
(Fig 3) Only maltose increased in the roots (Fig 3
Supplementary Table S1) The transcript levels of HvPht16
(Fig 2) also indicate that roots are less sensitive to P
deficiency Severe P deficiency leads to a further increase in
di- and trisaccharides in both shoots and roots These data
are consistent with previous reports that P deficiency led
to an increase in the levels of starch sucrose and mono-
saccharides in common beans and Arabidopsis (Ciereszko
and Barbachowska 2000 Hernandez et al 2007 Nilsson
et al 2007) and a graminaceous plant Brachiaria hybrid
(Nanamori et al 2004) It also is consistent with the reduced
level of sucrose synthase in P-deficient maize roots (Li et al
2007) The increased levels of mono- di- and polysaccha-
rides suggest that glycolysis may be hindered in both shoots
and roots of P-deficient barley plants In contrast the
cDNA array analyses from lupin and rice suggest that P
deficiency stimulates glycolysis (Uhde-Stone et al 2003
Wasaki et al 2003a) It is conceivable that to maintain
a high level of organic acid secretion in the proteoid roots
of lupin a enhanced level of glycolysis is necessary under
P-deficient conditions (Pearse et al 2006) but it is not clear
why rice did not show enhanced accumulation of di- and
polysaccharides under P-deficient conditions (Nanamori
et al 2004) It appears that metabolic changes in glycolysis
in response to P deficiency differ among plant species
Severe P deficiency depleted inorganic Pi storage pools
as indicated by the sharp reduction of phosphoric acid
in the polar fractions of plant tissues to 510 of
the controls (PDS17thornPDS17 and PDR17thornPDS17
Supplementary Table S2) Under these conditions organic
P is an alternative resource of P for plant cells RNA
phospholipids and small phosphorylated metabolites are
three main classes of compounds containing phosphoesters
Degradation of RNA by increased RNase activity under
Pi-limiting conditions is well documented (Plaxton 2004)
The RNA content in the shoots of severely P-deficient
Arabidopsis plants was reduced to 13 of that in the
P-sufficient plants (Hewitt et al 2005) Considerable
amounts of organic P are present in small phosphorylated
metabolites which is approximately equivalent to that
in RNA or in phospholipids (Bieleski and Ferguson
1983 Doermann and Benning 2002) The levels of
small phosphorylated metabolites including glucose-6-P
fructose-6-P and inositol-1-P were largely reduced in both
shoots and roots of the severely P-deficient plants and the
level of glycerol-3-P in the polar fraction was also sharply
reduced in the shoots of the severely P-deficient plants
(Fig 4) The reduction of phosphorylated sugars was also
observed in bean roots and Arabidopsis under P-deficient
conditions (Rychter and Randall 1994 Morcuende et al
2007) These results indicate that severely P-deficient plants
salvage P from small phosphorylated metabolites for
essential cellular functions These small phosphorylated
metabolites are important intermediates in glycolysis and
synthesis of polysaccharides (glucose-6-P and fructose-6-P)
phospholipids (glycerol-3-P and inositol-1-P) amino acids
and nucleotides and in energy production Thus a depletion
of these phosphorylated metabolites would have a severe
impact not only on carbohydrate and nitrogen metabolism
but also on other metabolic processes
The enhanced accumulation of di- and tri-saccharides
in P-deficient plants can reduce the consumption of Pi in
phosphorylation of sugar metabolites and convert the small
phosphorylated metabolites to non-P-containing di- and
trisaccharides and other compounds such as aromatic
compounds (Figs 3 4) This could be a strategy to reduce
Pi consumption but may also have a benefit in osmotic
protection for stressed plants Increased accumulation of
di- and trisaccharides such as raffinose has been described
in plants exposed to heat stress (Panikulangara et al 2004)
and sulfate deficiency (Nikiforova et al 2005) maltose in
acute temperature stress (Kaplan and Guy 2004) and
6-kestose a precursor for synthesis of fructans under
drought conditions (Hendry 1993 Amiard et al 2003)
However carbohydrate formed as di- and trisaccharides
698 Metabolite profiles in P-deficient barley plants
shown to accumulate in P-deficient plants cannot be utilized
readily for energy metabolism without involvement of Pi
to provide carbon metabolites for the TCA cycle An
alternative storage form of carbon such as organic acids
and amino acids would be preferred for survival of
P-deficient plants (Nanamori et al 2004)
P deficiency reduces organic acids in the TCA cycle
The reduced levels of several organic acids of the TCA
cycle including a-ketoglutarate succinate fumarate and
malate (Fig 4) and the reduction in the concentrations
of glutamate and aspartate especially in the roots of
the severely P-deficient plants (Fig 6B) suggest that the
shortage in carbohydrate supply is more apparent in the
roots than in the shoots of severely P-deficient plants
Reduced levels of fumarate were also observed in
P-deficient Arabidopsis (Misson et al 2005) In addition P
deficiency increases the secretion of organic acids into the
rhizosphere although cereals are weak secretors of organic
acids compared with legumes under low P conditions
(Neumann and Romheld 1999 Pearse et al 2006) The
secretion of organic acids could also contribute to
the reduction of the organic acids in the root tissues The
roots of severely P-deficient plants have to adjust metabolic
processes to utilize possible carbon metabolites such as
amino acids Some of the amino acids could be utilized as
an alternative carbon resource for energy production
reassimilation of the released ammonium and synthesis of
organic acids for secretion Interestingly the levels of several
organic acids in the TCA cycle were also reduced in
the roots of P-deficient common beans (Hernandez et al
2007) As legumes are efficient secretors of organic acids
(Neumann and Romheld 1999 Pearse et al 2006) secretion
could be a significant contributor to the reduced levels of
organic acids in the roots Nevertheless no reduction in
small P-containing metabolites nor organic acids in the
TCA cycle is observed in sulfate-deficient Arabidopsis plants
(Hirai et al 2004 Nikiforova et al 2005) indicating that
the reduction in the organic acids is unique to P-deficient
plant species
Severe P deficiency alters nitrogen metabolism
In P-deficient conditions transcript levels of the
genes coding for enzymes involved in protein degradation
were enhanced and the genes for protein synthesis were
suppressed in both Arabidopsis and common beans
(Wu et al 2003 Misson et al 2005 Hernandez et al
2007) The abundance of proteins related to protein
degradation through the ubiquitinndash26S proteasome path-
way was found to have increased in P-deficient roots of
maize (Li et al 2007) The reduced transcript levels of genes
related to nitrate reduction (Wu et al 2003) and reduced
activities for nitrate reduction have also been described in
P-deficient plants (Gniazdowska and Rychter 2000)
The increased concentrations of total free amino acids in
the shoots of severely P-deficient plants (Supplementary
Table S3) are likely to result from increased protein
degradation and repressed protein synthesis Various
metabolic reactions involved in either synthesis or degrada-
tion of amino acids produce ammonia such as aspara-
gine to aspartate glutamine to glutamate glutamate to
a-ketoglutarate and glycine to serine P deficiency enhances
the transcript levels of alanine aminotransferase genes
in both Arabidopsis and common beans (Wu et al 2003
Hernandez et al 2007) and the protein abundance of
glutamate dehydrogenase and phenylalanine ammonia-
lyase in maize roots (Li et al 2007) A high concentration
of ammonium is harmful to plants especially for barley an
ammonium-sensitive plant (Britto and Kronzucker 2002)
Thus it is critical to avoid excessive accumulation of
ammonium in P-deficient plants The levels of glutamine
and asparagine were elevated in both shoots and roots of
severely P-deficient plants and other metabolites related to
ammonium metabolism including putrescine and tyramine
were also enhanced in the severely P-deficient plants
especially in the roots (Supplementary Table S2) The
increased level of putrescine was also observed in P-deficient
rice cells (Shih and Kao 1996) These data suggest that
deamination of amino acids occurs in the severely
P-deficient plants for utilization in carbon metabolism
and a concomitant increase in assimilation of ammonium
takes place to ensure a reduction in levels of ammonium
The increased activities of glutamate dehydrogenase and
glutamine synthase in Arabidopsis plants (Morcuende et al
2007) and the enhanced protein abundance of root
glutamate dehydrogenase and glutamine synthase observed
in P-deficient maize plants (Li et al 2007) support this
interpretation It is interesting to note that the transcript
levels of glutamate synthase were down-regulated by P
deficiency in rice (Wasaki et al 2003a) Rice is an
ammonium-tolerant species which is in contrast to barley
that is an ammonium-sensitive species (Britto and
Kronzucker 2002) The difference in the metabolite levels
related to ammonium metabolism between P-deficient
barley and rice may be due to this different mechanism of
tolerance to ammonium
The synthesis of glutamine and asparagine requires
a carbon skeleton The enhanced levels of glutamine
and asparagine will require additional molecules of
a-ketoglutarate and oxaloacetate withdrawn from the
TCA cycle leading to a further reduction in the levels
of organic acids and restriction in energy production
in severely P-deficient plants The increased levels of
glutamine asparagine and other metabolites closely
related to ammonium metabolism are also observed in
other nutrient stresses such as nitrogen and sulfate
Metabolite profiles in P-deficient barley plants 699
deficiency (Hirai et al 2004 Nikiforova et al 2005) but
the specific reduction in glutamate and aspartate is
only observed in P-deficient barley plants As synthesis
of glutamine and asparagine can incorporate two ammo-
nium molecules into one organic acid this is a highly
effective ammonium assimilation mechanism under the
carbohydrate-limiting conditions caused by P deficiency
Our metabolite analyses provide indirect evidence that
P-deficient plants are confronted with increased ammonium
To establish a direct link of P deficiency to the increased
accumulation of ammonium in barley tissues further
experiments are required by supplying low concentrations
of ammonium and monitoring ammonium levels in plant
tissues
The increased levels of glycine and serine in the shoots
of the severely P-deficient plants indicate that photorespira-
tion is enhanced in the shoots of the severely P-deficient
plants because glycine and serine are intermediates for
photorespiration (Wingler et al 2000) and the increased
levels of glycine and serine correlate well with the rate of
photorespiration in P-deficient bean plants (Kondracka and
Rychter 1997) Increases in the levels of glycine and serine
were also observed in sulfur-deficient Arabidopsis plants
(Nikiforava et al 2005) indicating that the increase in
photorespiration is a general stress response (Wingler et al
2000)
Carbohydrate partitioning in P-deficient barley differs
from a P-efficient Gramineae grass
P deficiency results in the enhanced accumulation of
di- and trisaccharides and reduced organic acids in barley
plants which generally is similar to rice a P-inefficient
plant (Nanamori et al 2004) A P-efficient grass (Brachiaria
hybrid) is very different from rice in carbohydrate par-
titioning under P-deficient conditions (Nanamori et al
2004) The Brachiaria hybrid can allocate more carbohy-
drates into organic acids and amino acids Maintaining high
activities of phosphoenolpyruvate carboxylase and phos-
phoenolpyruvate phosphatase under the low P condition
appears to be critical for allocating a large proportion of
carbohydrate into organic acids and amino acids Our data
suggest that barley behaves as a P-inefficient plant in
metabolic adaptation to low P environments Thus to
improve P efficiency in barley and perhaps other cereal
crops manipulation of metabolism through a shift in
carbohydrate partitioning could provide a logical strategy
In summary the metabolite profiles generated from
both shoots and roots provide an overview of the metabolic
adjustments that occur in P-deficient barley plants As
illustrated in Fig 7 P-deficient barley plants alter the levels
of many key metabolites which affect various metabolic
pathways including glycolysis photorespiration and
metabolism of nitrogen and phospholipids These adaptive
P inefficiency
P efficiency
ribose
inositol-1-P
glycine(shoots)
serine(shoots)
alanine(shoots)
aspartate
asparagine malate
fumarate
succinate
citrate
a-ketoglutarate
glutamine
glutamate
urea(roots)
glc
glc-6-P
fru
glycerol-3-P
aromaticcompounds
fru-6-P
di- and tri-saccharides
Carbohydratepartitioning
glycerate-3-P
PEP
pyruvate
oxaloacetate
Fig 7 Schematic summary of metabolic adjustments in P-deficient plants and the proposed carbohydrate partitioning for improvementof P efficiency in cereals Thick arrows in green indicate an increase in metabolite levels and thin arrows in red indicate a decreasein metabolite levels The dashed line indicates carbohydrate partitioning for high P efficiency (below the line) and for low P efficiency(above the line)
700 Metabolite profiles in P-deficient barley plants
adjustments reduce Pi consumption by increasing the
levels of di- and trisaccharides and salvage Pi from various
P-containing compounds including small P-containing
metabolites to maintain essential cellular functions An
immediate consequence which is unique to P deficiency is
greatlly reduced levels of the key metabolites in glycolysis
leading to the decrease in carbohydrate supply to the TCA
cycle especially in the roots In addition P-deficient plants
are likely to be confronted with the challenge of increased
ammonium derived from the degradation of protein The
assimilation of the increased ammonium requires additional
organic acids from the TCA cycle which depletes the
organic acid supply further It is noteworthy that although
there are di- and trisaccharides present in the P-deficient
plants they cannot be readily utilized Organic acids and
amino acids are the preferred storage metabolites in
P-deficient plants (Nanamori et al 2004) as they can be
readily utilized as the carbon resource by P-deficient plants
Therefore if barley (and other cereals) are to be engineered
to be better adapted to growth in P-deficient soils there
is a need to shift the partitioning of carbohydrate from
di- and tri-saccharides to organic acids and amino acids
Investigating the expression of genes (transcriptome) and
proteins (proteome) in barley under P-deficient conditions
would provide additional evidence to support this strategy
for enhancing the P efficiency
Materials and Methods
Plant materials
Barley (H vulgare L cv Lofty Nijo) seeds were surface-sterilized with 70 ethanol for 1min and 3 hypochlorite for5min rinsed with deionized water and incubated in Petri dishes for2 d at room temperature Two seeds with an emerged radicle wereput into a seedling cup which was placed in the lid of a black plasticcontainer Each container contained either four seedling cups fortwo harvests or two seedling cups for one harvest and were filledwith 1 liter of nutrient solution The basal nutrients were as follows(in mM) Ca(NO3)2 1000 KNO3 1000 MgSO4 250 KCl 50H3BO3 125 Fe-HEDTA 10 MnSO4 04 CuSO4 01 ZnSO405 NiSO4 01 and MoO3 01 with NH4H2PO4 100 (thornPtreatment) or without NH4H2PO4 (P treatment) To balanceNH4 ions added in the thornP treatment 100 mM NH4NO3 was addedinto the nutrient solution of the P treatment In the additionalexperiment with two levels of ammonium either 100 or 400 mMNH4NO3 was added in the thornP treatment and either nil or 300 mMNH4NO3 was added in the P treatment All treatments werereplicated four times Half-strength nutrient solution was useduntil the 10th day after seed imbibition for the plants harvested atday 10 and day 17 but the eighth day for the plants harvestedat day 16 Full strength was applied thereafter The full-strengthnutrient solution was replaced at day 14 for the plants harvested atday 17 but at day 12 for the plants harvested at day 16 The pH ofthe nutrient solution was adjusted to 60 with 1M KOH and thesolution was aerated continuously
Plants were grown in a controlled environment at 208Cday158C night with a photoperiod regime of 14 h day10 h nightat 300 mmolm2 sndash1 photon flux intensity at the plant level At each
harvest two seedling cups were removed from each containerPlants were collected in 5ndash6 h of the light period to eliminatediurnal changes in metabolite levels The roots of plants from oneseedling cup were rinsed briefly in deionized water excess waterwas blotted on fresh laboratory tissues and the roots and shootswere separated and oven-dried at 658C for 48 h The dry plantsamples were used for mineral element analysis by inductivelycoupled plasma spectrophotometry (Zarcinas et al 1987) Anothercup of plants was separated into roots and shoots frozenimmediately in liquid nitrogen and stored at 808C for metaboliteand transcript analyses
Real-time quantitative RTndashPCR
Shoots and roots of three replicates from each P treatmentwere used for transcript analysis Total RNA was prepared usingTrizol reagent according to the manufacturerrsquos instructions(Invitrogen Carlsbad CA USA) Total RNA was treated withDNase I using the DNA free kit (Ambion Austin TX USA) toremove any contaminating genomic DNA and then RNA integritywas checked on an agarose gel cDNA was prepared from 2mg oftotal RNA using SuperScriptTM III reverse transcriptase accord-ing to the manufacturerrsquos instructions (Invitrogen) The reactionwas incubated at 508C for 45min and at 708C for 15min toinactivate the enzyme
The transcript levels of HvIPS1 and HvPht16 weredetermined by real-time quantitative PCR essentially as describedby Burton et al (2004) The transcript levels of three control genes(barley a-tubulin heat shock protein 70 and cyclophilin) weredetermined and used for normalization Normalization was carriedout as described by Vandesompele et al (2002) and Burtonet al (2004) The normalized copies mg RNA1 are presentedThe primers 50 GCGGCGACTTCTCACCTCTACTAAG and50 CGAAGGATTCAAACAGGATCACACA (GenBank acces-sion No BI780234) were used for amplification of HvIPS1 and50 GGTCAAGAACTCGCTATTCATCC and 50 CCATACATCCATCCAAACCTG (GenBank accession No AF543198) foramplification of HvPht16
Analysis of metabolites with GC-MS
Metabolite analysis was carried out by a GC-MS-basedmethod modified from Roessner et al (2006) Fresh tissues of rootsand shoots from barley plants were homogenized using a mortarand pestle with liquid nitrogen Frozen tissue powder (100 10mgexact fresh weight was recorded) was extracted with methanol(350 ml) A polar internal standard (20 ml of 02mgmlndash1 ribitol inwater) and a non-polar internal standard (30 ml of 2mgmlndash1
nonadecanoic acid methylester in chloroform) were subsequentlyadded as quantification standards The mixture was extracted for15min at 708C and then mixed vigorously with 1 vol of waterIn order to separate polar and non-polar metabolites 300 ml ofchloroform was added to the mixture and centrifuged at 2200gfor 10min The upper methanolwater phase was collected andwashed with chloroform (300 ml) The polar phase of shoot extracts(100 ml) and root extracts (250 ml) was separately dried undervacuum Both lipid layers were combined and dried under vacuumIn order to methylate fatty acids the residues of the non-polarfractions were further incubated with chloroform (100 ml) andacidified methanol (300 ml of 125N HCl in methanol) for 24 h at508C and afterwards dried under vacuum The dry polar residuewas redissolved and derivatized for 120min at 378C in methox-yamine hydrochloride (40 ml of 20mgml1 in pyridine) followedby a 30min treatment with N-methyl-N-[trimethylsilyl] trifluoro-acetamide (MSTFA) (70 ml) at 378C The dry non-polar residue
Metabolite profiles in P-deficient barley plants 701
was derivatized for 60min at 378C in pyridine (70 ml) and MSTFA(40 ml) To both a retention time standard mixture [10 ml of 0029(vv) n-dodecane n-pentadecane n-nonadecane n-docosanen-octacosane n-dotracontane n-hexatriacontane dissolved inpyridine] was added prior to trimethylsilylation Sample volumesof 1ml were then injected using the splitless mode onto a GCcolumn using a hot needle technique
The GC-MS system and conditions were as described inRoessner et al (2006) Acquired total ion chromatograms andmass spectra were evaluated using the Xcalibur program(ThermoFinnigan Manchester UK) and the resulting data areprepared normalized and presented as described by Roessner et al(2001) Mass spectra of eluting compounds were identified usingthe commercial mass spectra library NIST (httpwwwnistgov)and the public domain mass spectra library of the Max-Planck-Institute for Plant Physiology Golm Germany (httpcsbdbmpimp-golmmpgdecsbdbdbmamsrihtml) All matchingmass spectra were additionally co-verified by determination of theretention time and mass spectra by analysis of authentic standardsubstances
Analysis of free amino acids with LC-MS
Leaf material (15mg) was accurately weighed intoEppendorf tubes (2ml) and a solution of EDTA (400 ml 5mM)was added to each sample The samples were sonicated for15min then heated in a water bath (808C 15min) centrifuged(14500 rpm 5min) and the supernatant derivatized Thederivatization of the amino acids is based on a procedure outlinedby Cohen and Michaud (1993) and involved mixing the super-natant obtained above (20 ml) with borate buffer (200 ml 02MpH 88) followed by the addition of 10mM 6-aminoquinolyl-N-hydroxysuccinimidyl carbamate solution (50 ml) in dry aceto-nitrile The reaction mixture was then heated at 558C in a waterbath for 10min and analyzed by LC-MS as described by Callahanet al (2007)
The LC-MS system comprised a Surveyor LC PumpSurveyor Auto Sampler and LCQ Deca XP Max ion trapMS (Thermo Finnigan USA) The ESI (electron spray ionization)source was optimized by infusing a derivatized amino acidstandard in line with the mobile phase then tuning the sourceconditions and ion optics to optimize the signals for the derivatizedamino acids This resulted in the following conditions sheath gas30 arbitrary units auxiliary gas 10 arbitrary units spray voltage30 kV capillary temperature 2508C capillary voltage 56V andtube lens 53V
Derivatized amino acids were eluted on an Altantis dC18150 21mm 3mm (Waters Melbourne Australia) HPLC columnusing a three-step gradient of deionized water (01 formic acid)and acetonitrile (01 formic acid) at a flow rate of 025mlminndash1
and a column temperature of 308C (Callahan et al 2007)
Statistical analysis
Students t-test at P 005 was applied for the means (nfrac14 4) ofmetabolites presented in Supplementary Tables S1ndashS3 Statisticalanalyses were carried using the Pirouette 311 software (InfometrixInc Woodinville WA USA)
Supplementary material
Supplementary material mentioned in the article is avail-able to online subscribers at the journal website wwwpcpoxfordjournalsorg
Funding
The Grains Research and Development Corporation
the Australian Research Council the South Australian
Government the University of Adelaide and the University
of Melbourne to the Australian Center for Plant Functional
Genomics (CYH UR NS PL AB) the Molecular
Plant Breeding CRC to YG Metabolomics Australia to
(UR DC AB)
Acknowledgments
We are grateful to M Tester for discussion and to T Fowlesand L Palmer for ICP analysis
References
Amiard V Morvan-Bertrand A Billard JP Huault C Keller F andPrudrsquohomme MP (2003) Fructans but not the sucrosyl-galactosidesraffinose and loliose are affected by drought stress in perennial ryegrassPlant Physiol 132 2218ndash29
Bieleski RL and Ferguson IB (1983) Physiology and metabolism ofphosphate and its compounds In Encyclopedia of Plant PhysiologyEdited by Lauchli A and Bieleski RL Vol 15a pp 422ndash449 SpringerVerlag Berlin
Bolling C and Fiehn O (2005) Metabolite profiling of Chlamydomonasreinhardtii under nutrient deprivation Plant Physiol 139 1995ndash2005
Britto DT and Kronzucker HJ (2002) NH4thorn toxicity in higher plants
a critical review J Plant Physiol 159 567ndash584Burleigh SH and Harrison MJ (1997) A novel gene whose expression in
Medicago truncatula roots is suppressed in response to colonization byvesicularndasharbuscular mycorrhizal (VAM) fungi and to phosphatenutrition Plant Mol Biol 34 199ndash208
Burton RA Shirley NJ King BJ Harvey AJ and Fincher GB(2004) The CesA gene family of barley Quantitative analysis oftranscripts reveals two groups of co-expressed genes Plant Physiol134 224ndash236
Callahan DL Kolev SD OrsquoHair RAJ Salt DE and Baker AJM(2007) Relationships between nicotianamine and other amino acids withnickel zinc and iron in Thlaspi hyperaccumulators New Phytol 176836ndash848
Ciereszko I and Barbachowska A (2000) Sucrose metabolism in leavesand roots of bean (Phaseolus vulgaris L) during phosphate deficiencyJ Plant Physiol 156 640ndash644
Cohen SA and Michaud DP (1993) Synthesis of a fluorescentderivatizing reagent 6-aminoquinolyl-N-hydroxysuccinimidyl carba-mate and its application for the analysis of hydrolysate amino acidsvia high-performance liquid chromatography Anal Biochem 211279ndash287
Cruz-Ramirez A Oropeza-Aburto A Razo-Hernandez F Ramirez-Chavez E and Herrera-Estrella L (2006) Phospholipase DZ2 playsan important role in extraplastidic galactolipid biosynthesis andphosphate recycling in Arabidopsis roots Proc Natl Acad Sci USA103 6765ndash6770
Doermann P and Benning C (2002) Galactolipids rule in seed plantsTrends Plant Sci 7 112ndash118
Gniazdowska A and Rychter AM (2000) Nitrate uptake by bean(Phaseolus vulgaris L) roots under phosphate deficiency Plant Soil 22679ndash85
Hendry GAF (1993) Evolutionary origins and natural functions offructansmdasha climatological biogeographic and mechanistic appraisalNew Phytol 123 3ndash14
Hernandez G Ramirez M Valdes-Lopez O Tesfaye MGraham MA et al (2007) Phosphorus stress in common bean roottranscript and metabolic responses Plant Physiol 144 752ndash767
702 Metabolite profiles in P-deficient barley plants
Hewitt MM Carr JM Williamson CL and Slocum RD (2005)Effects of phosphate limitation on expression of genes involved in
pyrimidine synthesis and salvaging in Arabidopsis Plant Physiol
Biochem 43 91ndash99Hirai MY Yano M Goodenowe DB Kanaya S Kimura T
Awazuhara M Arita M Fujiwara T and Saito K (2004) Integration
of transcriptomics and metabolomics for understanding of global
responses to nutritional stresses in Arabidopsis thaliana Proc Natl
Acad Sci USA 101 10205ndash10210Hou XL Wu P Jiao FC Jia QJ Chen HM Yu J Song XW
and Yi KK (2005) Regulation of the expression of OsIPS1 and OsIPS2in rice via systemic and local Pi signaling and hormones Plant Cell
Environ 28 353ndash364Jeschke WD Kirkby EA Peuke AD Pate JS and Hartung W
(1997) Effects of P deficiency on assimilation and transport of nitrate andphosphate in intact plants of castor bean (Ricinus communis L) J Exp
Bot 48 75ndash91Kaplan F and Guy CL (2004) Beta-amylase induction and the protective
role of maltose during temperature shock Plant Physiol 135 1674ndash1684Kondracka A and Rychter AM (1997) The role of Pi recycling processes
during photosynthesis in phosphate-deficient bean plants J Exp Bot 48
1461ndash1468Kopka J (2006) Current challenges and developments in GC-MS based
metabolite profiling technology J Biotechnol 124 312ndash322Li K Xu C Zhang K Yang A and Zhang J (2007) Proteomic
analysis of roots growth and metabolic changes under phosphorus deficitin maize (Zea mays L) plants Proteomics 7 1501ndash1512
Liu CM Muchhal US and Raghothama KG (1997) Differential
expression of TPS11 a phosphate starvation-induced gene in tomatoPlant Mol Biol 33 867ndash874
Martin AC del Pozo JC Inglesias J Rubio V Solano Rde la Pena A Leyva A and Paz-Ares J (2000) Influence of cytokinins
on the expression of phosphate starvation responsive genes inArabidopsis Plant J 24 559ndash567
Mimura T (1999) Regulation of phosphate transport and homeostasis inplant cells Int Rev Cytol Cell Biol 191 149ndash200
Misson J Raghothama KG Jain A Jouhet J Block MA et al
(2005) A genome-wide transcriptional analysis using Arabidopsis thaliana
Affymetrix gene chips determined plant responses to phosphate depriva-
tion Proc Natl Acad Sci USA 102 11934ndash11939Morcuende R Bari R Gibon Y Zheng WM Pant BD Blasing O
Usadel B Czechowski T Udvardi MK Stitt M and Scheible WR(2007) Genome-wide reprogramming of metabolism and regulatory
networks of Arabidopsis in response to phosphorus Plant Cell Environ
30 85ndash112Muchhal US and Raghothama KG (1999) Transcriptional regulation of
plant phosphate transporters Proc Natl Acad Sci USA 96 5868ndash72Nanamori M Shinano T Wasaki J Yamamura T Rao IM and
Osaki M (2004) Low phosphorus tolerance mechanisms phosphorus
recycling and photosynthate partitioning in the tropical forage grassBrachiaria hybrid cultivar mulato compared with rice Plant Cell Environ
45 460ndash469Neumann G and Romheld V (1999) Root excretion of carboxylic acids
and protons in phosphorus-deficient plants Plant Soil 211 121ndash130Nikiforova VJ Gakiere B Kempa S Adamik M Willmitzer L
Hesse H and Hoefgen R (2004) Towards dissecting nutrient
metabolism in plants a systems biology case study on sulphur
metabolism J Exp Bot 55 1861ndash1870Nikiforova VJ Kopka J Tolstikov V Fiehn O Hopkins L
Hawkesford MJ Hesse H and Hoefgen R (2005) Systems rebalan-
cing of metabolism in response to sulfur deprivation as revealed bymetabolome analysis of Arabidopsis plants Plant Physiol 138 304ndash318
Nilsson L Muller R and Nielsen TH (2007) Increased expression of theMYB-related transcription factor PHR1 leads to enhanced phosphate
uptake in Arabidopsis thaliana Plant Cell Environ 30 1499ndash1512
Panikulangara TJ Eggers-Schumacher G Wunderlich M Stransky Hand Schoffl F (2004) Galactinol synthase 1 A novel heat shock factortarget gene responsible for heat-induced synthesis of raffinose familyoligosaccharides in Arabidopsis Plant Physiol 136 3148ndash3158
Pearse SJ Veneklaas EJ Cawthray G Bolland MDA andLambers H (2006) Triticum aestivum shows a greater biomass responseto a supply of aluminium phosphate than Lupinus albus despite releasingfewer carboxylates into the rhizosphere New Phytol 169 515ndash524
Plaxton WC (2004) Plant response to stress biochemical adaptations tophosphate deficiency In Encyclopedia of Plant and Crop Science Editedby Goodman R pp 976ndash980 Marcel Dekker Inc New York
Plaxton WC and Carswell MC (1999) Metabolic aspects of thephosphate starvation response in plants In Plant Response toEnvironmental Stresses From Photohormones to GenomeReorganization Edited by Lerner HR pp 349ndash372 Marcel DekkerInc New York
Rae AL Cybinski DH Jarmey JM and Smith FW (2003)Characterization of two phosphate transporters from barley evidencefor diverse function and kinetic properties among members of the Pht1family Plant Mol Biol 53 27ndash36
Raghothama KG (1999) Phosphate acquisition Annu Rev Plant PhysiolPlant Mol Biol 50 665ndash693
Reuter DJ and Robinson JB (1997) Plant Analysis An InterpretationManual 2nd edn pp 86ndash92 CSIRO Australia Melbourne
Roessner U Luedemann A Brust D Fiehn O Linke TWillmitzer L and Fernie AR (2001) Metabolic profiling allowscomprehensive phenotyping of genetically or environmentally modifiedplant systems Plant Cell 13 11ndash29
Roessner U Patterson JH Forbes MG Fincher GB Langridge Pand Bacic A (2006) An investigation of boron toxicity in barley usingmetabolomics Plant Physiol 142 1087ndash1101
Rychter AM and Randall DD (1994) The effect of phosphate deficiencyon carbohydrate metabolism in bean roots Physiol Plant 91 383ndash388
Schachtman DP Reid RJ and Ayling SM (1998) Phosphorus uptakeby plants from soil to cell Plant Physiol 116 447ndash453
Shih CY and Kao CH (1996) Growth inhibition in suspension-culturedrice cells under phosphate deprivation is mediated through putrescineaccumulation Plant Physiol 111 721ndash724
Uhde-Stone C Zinn KE Ramirez-Yanez M Li AG Vance CP andAllan DL (2003) Nylon filter arrays reveal differential gene expressionin proteoid roots of white lupin in response to phosphorus deficiencyPlant Physiol 131 1064ndash1079
Vance CP Uhde-Stone C and Allan DL (2003) Phosphorus acquisitionand use critical adaptations by plants for securing a non renewableresource New Phytol 157 423ndash447
Vandesompele J De Preter K Pattyn F Poppe B Van Roy NDe Paepe A and Speleman F (2002) Accurate normalization of real-time quantitative RTPCR data by geometric averaging of multipleinternal control genes Genome Biol 3 1ndash11
Wasaki J Yonetani R Kuroda S Shinano T Yazaki J et al (2003a)Transcriptomic analysis of metabolic changes by phosphorus stress in riceplant roots Plant Cell Environ 26 1515ndash1523
Wasaki J Yonetani R Shinano T Kai M and Osaki M (2003b)Expression of the OsPI1 gene cloned from rice roots using cDNAmicroarray rapidly responds to phosphorus status New Phytol 158239ndash248
Wingler A Lea PJ Quick WP and Leegood RC (2000)Photorespiration metabolic pathways and their role in stress protectionPhilos Trans R Soc B Biol Sci 355 1517ndash1529
Wu P Ma L Hou X Wang M Wu Y Liu F and Deng XW (2003)Phosphate starvation triggers distinct alterations of genome expression inArabidopsis roots and leaves Plant Physiol 132 1260ndash1271
Zarcinas BA Cartwright B and Spouncer LR (1987) Nitric aciddigestion and multi-element analysis of plant material by induc-tively coupled plasma spectrometry Commun Soil Sci Plant Anal 18131ndash146
(Received February 21 2008 Accepted March 13 2008)
Metabolite profiles in P-deficient barley plants 703
shown to accumulate in P-deficient plants cannot be utilized
readily for energy metabolism without involvement of Pi
to provide carbon metabolites for the TCA cycle An
alternative storage form of carbon such as organic acids
and amino acids would be preferred for survival of
P-deficient plants (Nanamori et al 2004)
P deficiency reduces organic acids in the TCA cycle
The reduced levels of several organic acids of the TCA
cycle including a-ketoglutarate succinate fumarate and
malate (Fig 4) and the reduction in the concentrations
of glutamate and aspartate especially in the roots of
the severely P-deficient plants (Fig 6B) suggest that the
shortage in carbohydrate supply is more apparent in the
roots than in the shoots of severely P-deficient plants
Reduced levels of fumarate were also observed in
P-deficient Arabidopsis (Misson et al 2005) In addition P
deficiency increases the secretion of organic acids into the
rhizosphere although cereals are weak secretors of organic
acids compared with legumes under low P conditions
(Neumann and Romheld 1999 Pearse et al 2006) The
secretion of organic acids could also contribute to
the reduction of the organic acids in the root tissues The
roots of severely P-deficient plants have to adjust metabolic
processes to utilize possible carbon metabolites such as
amino acids Some of the amino acids could be utilized as
an alternative carbon resource for energy production
reassimilation of the released ammonium and synthesis of
organic acids for secretion Interestingly the levels of several
organic acids in the TCA cycle were also reduced in
the roots of P-deficient common beans (Hernandez et al
2007) As legumes are efficient secretors of organic acids
(Neumann and Romheld 1999 Pearse et al 2006) secretion
could be a significant contributor to the reduced levels of
organic acids in the roots Nevertheless no reduction in
small P-containing metabolites nor organic acids in the
TCA cycle is observed in sulfate-deficient Arabidopsis plants
(Hirai et al 2004 Nikiforova et al 2005) indicating that
the reduction in the organic acids is unique to P-deficient
plant species
Severe P deficiency alters nitrogen metabolism
In P-deficient conditions transcript levels of the
genes coding for enzymes involved in protein degradation
were enhanced and the genes for protein synthesis were
suppressed in both Arabidopsis and common beans
(Wu et al 2003 Misson et al 2005 Hernandez et al
2007) The abundance of proteins related to protein
degradation through the ubiquitinndash26S proteasome path-
way was found to have increased in P-deficient roots of
maize (Li et al 2007) The reduced transcript levels of genes
related to nitrate reduction (Wu et al 2003) and reduced
activities for nitrate reduction have also been described in
P-deficient plants (Gniazdowska and Rychter 2000)
The increased concentrations of total free amino acids in
the shoots of severely P-deficient plants (Supplementary
Table S3) are likely to result from increased protein
degradation and repressed protein synthesis Various
metabolic reactions involved in either synthesis or degrada-
tion of amino acids produce ammonia such as aspara-
gine to aspartate glutamine to glutamate glutamate to
a-ketoglutarate and glycine to serine P deficiency enhances
the transcript levels of alanine aminotransferase genes
in both Arabidopsis and common beans (Wu et al 2003
Hernandez et al 2007) and the protein abundance of
glutamate dehydrogenase and phenylalanine ammonia-
lyase in maize roots (Li et al 2007) A high concentration
of ammonium is harmful to plants especially for barley an
ammonium-sensitive plant (Britto and Kronzucker 2002)
Thus it is critical to avoid excessive accumulation of
ammonium in P-deficient plants The levels of glutamine
and asparagine were elevated in both shoots and roots of
severely P-deficient plants and other metabolites related to
ammonium metabolism including putrescine and tyramine
were also enhanced in the severely P-deficient plants
especially in the roots (Supplementary Table S2) The
increased level of putrescine was also observed in P-deficient
rice cells (Shih and Kao 1996) These data suggest that
deamination of amino acids occurs in the severely
P-deficient plants for utilization in carbon metabolism
and a concomitant increase in assimilation of ammonium
takes place to ensure a reduction in levels of ammonium
The increased activities of glutamate dehydrogenase and
glutamine synthase in Arabidopsis plants (Morcuende et al
2007) and the enhanced protein abundance of root
glutamate dehydrogenase and glutamine synthase observed
in P-deficient maize plants (Li et al 2007) support this
interpretation It is interesting to note that the transcript
levels of glutamate synthase were down-regulated by P
deficiency in rice (Wasaki et al 2003a) Rice is an
ammonium-tolerant species which is in contrast to barley
that is an ammonium-sensitive species (Britto and
Kronzucker 2002) The difference in the metabolite levels
related to ammonium metabolism between P-deficient
barley and rice may be due to this different mechanism of
tolerance to ammonium
The synthesis of glutamine and asparagine requires
a carbon skeleton The enhanced levels of glutamine
and asparagine will require additional molecules of
a-ketoglutarate and oxaloacetate withdrawn from the
TCA cycle leading to a further reduction in the levels
of organic acids and restriction in energy production
in severely P-deficient plants The increased levels of
glutamine asparagine and other metabolites closely
related to ammonium metabolism are also observed in
other nutrient stresses such as nitrogen and sulfate
Metabolite profiles in P-deficient barley plants 699
deficiency (Hirai et al 2004 Nikiforova et al 2005) but
the specific reduction in glutamate and aspartate is
only observed in P-deficient barley plants As synthesis
of glutamine and asparagine can incorporate two ammo-
nium molecules into one organic acid this is a highly
effective ammonium assimilation mechanism under the
carbohydrate-limiting conditions caused by P deficiency
Our metabolite analyses provide indirect evidence that
P-deficient plants are confronted with increased ammonium
To establish a direct link of P deficiency to the increased
accumulation of ammonium in barley tissues further
experiments are required by supplying low concentrations
of ammonium and monitoring ammonium levels in plant
tissues
The increased levels of glycine and serine in the shoots
of the severely P-deficient plants indicate that photorespira-
tion is enhanced in the shoots of the severely P-deficient
plants because glycine and serine are intermediates for
photorespiration (Wingler et al 2000) and the increased
levels of glycine and serine correlate well with the rate of
photorespiration in P-deficient bean plants (Kondracka and
Rychter 1997) Increases in the levels of glycine and serine
were also observed in sulfur-deficient Arabidopsis plants
(Nikiforava et al 2005) indicating that the increase in
photorespiration is a general stress response (Wingler et al
2000)
Carbohydrate partitioning in P-deficient barley differs
from a P-efficient Gramineae grass
P deficiency results in the enhanced accumulation of
di- and trisaccharides and reduced organic acids in barley
plants which generally is similar to rice a P-inefficient
plant (Nanamori et al 2004) A P-efficient grass (Brachiaria
hybrid) is very different from rice in carbohydrate par-
titioning under P-deficient conditions (Nanamori et al
2004) The Brachiaria hybrid can allocate more carbohy-
drates into organic acids and amino acids Maintaining high
activities of phosphoenolpyruvate carboxylase and phos-
phoenolpyruvate phosphatase under the low P condition
appears to be critical for allocating a large proportion of
carbohydrate into organic acids and amino acids Our data
suggest that barley behaves as a P-inefficient plant in
metabolic adaptation to low P environments Thus to
improve P efficiency in barley and perhaps other cereal
crops manipulation of metabolism through a shift in
carbohydrate partitioning could provide a logical strategy
In summary the metabolite profiles generated from
both shoots and roots provide an overview of the metabolic
adjustments that occur in P-deficient barley plants As
illustrated in Fig 7 P-deficient barley plants alter the levels
of many key metabolites which affect various metabolic
pathways including glycolysis photorespiration and
metabolism of nitrogen and phospholipids These adaptive
P inefficiency
P efficiency
ribose
inositol-1-P
glycine(shoots)
serine(shoots)
alanine(shoots)
aspartate
asparagine malate
fumarate
succinate
citrate
a-ketoglutarate
glutamine
glutamate
urea(roots)
glc
glc-6-P
fru
glycerol-3-P
aromaticcompounds
fru-6-P
di- and tri-saccharides
Carbohydratepartitioning
glycerate-3-P
PEP
pyruvate
oxaloacetate
Fig 7 Schematic summary of metabolic adjustments in P-deficient plants and the proposed carbohydrate partitioning for improvementof P efficiency in cereals Thick arrows in green indicate an increase in metabolite levels and thin arrows in red indicate a decreasein metabolite levels The dashed line indicates carbohydrate partitioning for high P efficiency (below the line) and for low P efficiency(above the line)
700 Metabolite profiles in P-deficient barley plants
adjustments reduce Pi consumption by increasing the
levels of di- and trisaccharides and salvage Pi from various
P-containing compounds including small P-containing
metabolites to maintain essential cellular functions An
immediate consequence which is unique to P deficiency is
greatlly reduced levels of the key metabolites in glycolysis
leading to the decrease in carbohydrate supply to the TCA
cycle especially in the roots In addition P-deficient plants
are likely to be confronted with the challenge of increased
ammonium derived from the degradation of protein The
assimilation of the increased ammonium requires additional
organic acids from the TCA cycle which depletes the
organic acid supply further It is noteworthy that although
there are di- and trisaccharides present in the P-deficient
plants they cannot be readily utilized Organic acids and
amino acids are the preferred storage metabolites in
P-deficient plants (Nanamori et al 2004) as they can be
readily utilized as the carbon resource by P-deficient plants
Therefore if barley (and other cereals) are to be engineered
to be better adapted to growth in P-deficient soils there
is a need to shift the partitioning of carbohydrate from
di- and tri-saccharides to organic acids and amino acids
Investigating the expression of genes (transcriptome) and
proteins (proteome) in barley under P-deficient conditions
would provide additional evidence to support this strategy
for enhancing the P efficiency
Materials and Methods
Plant materials
Barley (H vulgare L cv Lofty Nijo) seeds were surface-sterilized with 70 ethanol for 1min and 3 hypochlorite for5min rinsed with deionized water and incubated in Petri dishes for2 d at room temperature Two seeds with an emerged radicle wereput into a seedling cup which was placed in the lid of a black plasticcontainer Each container contained either four seedling cups fortwo harvests or two seedling cups for one harvest and were filledwith 1 liter of nutrient solution The basal nutrients were as follows(in mM) Ca(NO3)2 1000 KNO3 1000 MgSO4 250 KCl 50H3BO3 125 Fe-HEDTA 10 MnSO4 04 CuSO4 01 ZnSO405 NiSO4 01 and MoO3 01 with NH4H2PO4 100 (thornPtreatment) or without NH4H2PO4 (P treatment) To balanceNH4 ions added in the thornP treatment 100 mM NH4NO3 was addedinto the nutrient solution of the P treatment In the additionalexperiment with two levels of ammonium either 100 or 400 mMNH4NO3 was added in the thornP treatment and either nil or 300 mMNH4NO3 was added in the P treatment All treatments werereplicated four times Half-strength nutrient solution was useduntil the 10th day after seed imbibition for the plants harvested atday 10 and day 17 but the eighth day for the plants harvestedat day 16 Full strength was applied thereafter The full-strengthnutrient solution was replaced at day 14 for the plants harvested atday 17 but at day 12 for the plants harvested at day 16 The pH ofthe nutrient solution was adjusted to 60 with 1M KOH and thesolution was aerated continuously
Plants were grown in a controlled environment at 208Cday158C night with a photoperiod regime of 14 h day10 h nightat 300 mmolm2 sndash1 photon flux intensity at the plant level At each
harvest two seedling cups were removed from each containerPlants were collected in 5ndash6 h of the light period to eliminatediurnal changes in metabolite levels The roots of plants from oneseedling cup were rinsed briefly in deionized water excess waterwas blotted on fresh laboratory tissues and the roots and shootswere separated and oven-dried at 658C for 48 h The dry plantsamples were used for mineral element analysis by inductivelycoupled plasma spectrophotometry (Zarcinas et al 1987) Anothercup of plants was separated into roots and shoots frozenimmediately in liquid nitrogen and stored at 808C for metaboliteand transcript analyses
Real-time quantitative RTndashPCR
Shoots and roots of three replicates from each P treatmentwere used for transcript analysis Total RNA was prepared usingTrizol reagent according to the manufacturerrsquos instructions(Invitrogen Carlsbad CA USA) Total RNA was treated withDNase I using the DNA free kit (Ambion Austin TX USA) toremove any contaminating genomic DNA and then RNA integritywas checked on an agarose gel cDNA was prepared from 2mg oftotal RNA using SuperScriptTM III reverse transcriptase accord-ing to the manufacturerrsquos instructions (Invitrogen) The reactionwas incubated at 508C for 45min and at 708C for 15min toinactivate the enzyme
The transcript levels of HvIPS1 and HvPht16 weredetermined by real-time quantitative PCR essentially as describedby Burton et al (2004) The transcript levels of three control genes(barley a-tubulin heat shock protein 70 and cyclophilin) weredetermined and used for normalization Normalization was carriedout as described by Vandesompele et al (2002) and Burtonet al (2004) The normalized copies mg RNA1 are presentedThe primers 50 GCGGCGACTTCTCACCTCTACTAAG and50 CGAAGGATTCAAACAGGATCACACA (GenBank acces-sion No BI780234) were used for amplification of HvIPS1 and50 GGTCAAGAACTCGCTATTCATCC and 50 CCATACATCCATCCAAACCTG (GenBank accession No AF543198) foramplification of HvPht16
Analysis of metabolites with GC-MS
Metabolite analysis was carried out by a GC-MS-basedmethod modified from Roessner et al (2006) Fresh tissues of rootsand shoots from barley plants were homogenized using a mortarand pestle with liquid nitrogen Frozen tissue powder (100 10mgexact fresh weight was recorded) was extracted with methanol(350 ml) A polar internal standard (20 ml of 02mgmlndash1 ribitol inwater) and a non-polar internal standard (30 ml of 2mgmlndash1
nonadecanoic acid methylester in chloroform) were subsequentlyadded as quantification standards The mixture was extracted for15min at 708C and then mixed vigorously with 1 vol of waterIn order to separate polar and non-polar metabolites 300 ml ofchloroform was added to the mixture and centrifuged at 2200gfor 10min The upper methanolwater phase was collected andwashed with chloroform (300 ml) The polar phase of shoot extracts(100 ml) and root extracts (250 ml) was separately dried undervacuum Both lipid layers were combined and dried under vacuumIn order to methylate fatty acids the residues of the non-polarfractions were further incubated with chloroform (100 ml) andacidified methanol (300 ml of 125N HCl in methanol) for 24 h at508C and afterwards dried under vacuum The dry polar residuewas redissolved and derivatized for 120min at 378C in methox-yamine hydrochloride (40 ml of 20mgml1 in pyridine) followedby a 30min treatment with N-methyl-N-[trimethylsilyl] trifluoro-acetamide (MSTFA) (70 ml) at 378C The dry non-polar residue
Metabolite profiles in P-deficient barley plants 701
was derivatized for 60min at 378C in pyridine (70 ml) and MSTFA(40 ml) To both a retention time standard mixture [10 ml of 0029(vv) n-dodecane n-pentadecane n-nonadecane n-docosanen-octacosane n-dotracontane n-hexatriacontane dissolved inpyridine] was added prior to trimethylsilylation Sample volumesof 1ml were then injected using the splitless mode onto a GCcolumn using a hot needle technique
The GC-MS system and conditions were as described inRoessner et al (2006) Acquired total ion chromatograms andmass spectra were evaluated using the Xcalibur program(ThermoFinnigan Manchester UK) and the resulting data areprepared normalized and presented as described by Roessner et al(2001) Mass spectra of eluting compounds were identified usingthe commercial mass spectra library NIST (httpwwwnistgov)and the public domain mass spectra library of the Max-Planck-Institute for Plant Physiology Golm Germany (httpcsbdbmpimp-golmmpgdecsbdbdbmamsrihtml) All matchingmass spectra were additionally co-verified by determination of theretention time and mass spectra by analysis of authentic standardsubstances
Analysis of free amino acids with LC-MS
Leaf material (15mg) was accurately weighed intoEppendorf tubes (2ml) and a solution of EDTA (400 ml 5mM)was added to each sample The samples were sonicated for15min then heated in a water bath (808C 15min) centrifuged(14500 rpm 5min) and the supernatant derivatized Thederivatization of the amino acids is based on a procedure outlinedby Cohen and Michaud (1993) and involved mixing the super-natant obtained above (20 ml) with borate buffer (200 ml 02MpH 88) followed by the addition of 10mM 6-aminoquinolyl-N-hydroxysuccinimidyl carbamate solution (50 ml) in dry aceto-nitrile The reaction mixture was then heated at 558C in a waterbath for 10min and analyzed by LC-MS as described by Callahanet al (2007)
The LC-MS system comprised a Surveyor LC PumpSurveyor Auto Sampler and LCQ Deca XP Max ion trapMS (Thermo Finnigan USA) The ESI (electron spray ionization)source was optimized by infusing a derivatized amino acidstandard in line with the mobile phase then tuning the sourceconditions and ion optics to optimize the signals for the derivatizedamino acids This resulted in the following conditions sheath gas30 arbitrary units auxiliary gas 10 arbitrary units spray voltage30 kV capillary temperature 2508C capillary voltage 56V andtube lens 53V
Derivatized amino acids were eluted on an Altantis dC18150 21mm 3mm (Waters Melbourne Australia) HPLC columnusing a three-step gradient of deionized water (01 formic acid)and acetonitrile (01 formic acid) at a flow rate of 025mlminndash1
and a column temperature of 308C (Callahan et al 2007)
Statistical analysis
Students t-test at P 005 was applied for the means (nfrac14 4) ofmetabolites presented in Supplementary Tables S1ndashS3 Statisticalanalyses were carried using the Pirouette 311 software (InfometrixInc Woodinville WA USA)
Supplementary material
Supplementary material mentioned in the article is avail-able to online subscribers at the journal website wwwpcpoxfordjournalsorg
Funding
The Grains Research and Development Corporation
the Australian Research Council the South Australian
Government the University of Adelaide and the University
of Melbourne to the Australian Center for Plant Functional
Genomics (CYH UR NS PL AB) the Molecular
Plant Breeding CRC to YG Metabolomics Australia to
(UR DC AB)
Acknowledgments
We are grateful to M Tester for discussion and to T Fowlesand L Palmer for ICP analysis
References
Amiard V Morvan-Bertrand A Billard JP Huault C Keller F andPrudrsquohomme MP (2003) Fructans but not the sucrosyl-galactosidesraffinose and loliose are affected by drought stress in perennial ryegrassPlant Physiol 132 2218ndash29
Bieleski RL and Ferguson IB (1983) Physiology and metabolism ofphosphate and its compounds In Encyclopedia of Plant PhysiologyEdited by Lauchli A and Bieleski RL Vol 15a pp 422ndash449 SpringerVerlag Berlin
Bolling C and Fiehn O (2005) Metabolite profiling of Chlamydomonasreinhardtii under nutrient deprivation Plant Physiol 139 1995ndash2005
Britto DT and Kronzucker HJ (2002) NH4thorn toxicity in higher plants
a critical review J Plant Physiol 159 567ndash584Burleigh SH and Harrison MJ (1997) A novel gene whose expression in
Medicago truncatula roots is suppressed in response to colonization byvesicularndasharbuscular mycorrhizal (VAM) fungi and to phosphatenutrition Plant Mol Biol 34 199ndash208
Burton RA Shirley NJ King BJ Harvey AJ and Fincher GB(2004) The CesA gene family of barley Quantitative analysis oftranscripts reveals two groups of co-expressed genes Plant Physiol134 224ndash236
Callahan DL Kolev SD OrsquoHair RAJ Salt DE and Baker AJM(2007) Relationships between nicotianamine and other amino acids withnickel zinc and iron in Thlaspi hyperaccumulators New Phytol 176836ndash848
Ciereszko I and Barbachowska A (2000) Sucrose metabolism in leavesand roots of bean (Phaseolus vulgaris L) during phosphate deficiencyJ Plant Physiol 156 640ndash644
Cohen SA and Michaud DP (1993) Synthesis of a fluorescentderivatizing reagent 6-aminoquinolyl-N-hydroxysuccinimidyl carba-mate and its application for the analysis of hydrolysate amino acidsvia high-performance liquid chromatography Anal Biochem 211279ndash287
Cruz-Ramirez A Oropeza-Aburto A Razo-Hernandez F Ramirez-Chavez E and Herrera-Estrella L (2006) Phospholipase DZ2 playsan important role in extraplastidic galactolipid biosynthesis andphosphate recycling in Arabidopsis roots Proc Natl Acad Sci USA103 6765ndash6770
Doermann P and Benning C (2002) Galactolipids rule in seed plantsTrends Plant Sci 7 112ndash118
Gniazdowska A and Rychter AM (2000) Nitrate uptake by bean(Phaseolus vulgaris L) roots under phosphate deficiency Plant Soil 22679ndash85
Hendry GAF (1993) Evolutionary origins and natural functions offructansmdasha climatological biogeographic and mechanistic appraisalNew Phytol 123 3ndash14
Hernandez G Ramirez M Valdes-Lopez O Tesfaye MGraham MA et al (2007) Phosphorus stress in common bean roottranscript and metabolic responses Plant Physiol 144 752ndash767
702 Metabolite profiles in P-deficient barley plants
Hewitt MM Carr JM Williamson CL and Slocum RD (2005)Effects of phosphate limitation on expression of genes involved in
pyrimidine synthesis and salvaging in Arabidopsis Plant Physiol
Biochem 43 91ndash99Hirai MY Yano M Goodenowe DB Kanaya S Kimura T
Awazuhara M Arita M Fujiwara T and Saito K (2004) Integration
of transcriptomics and metabolomics for understanding of global
responses to nutritional stresses in Arabidopsis thaliana Proc Natl
Acad Sci USA 101 10205ndash10210Hou XL Wu P Jiao FC Jia QJ Chen HM Yu J Song XW
and Yi KK (2005) Regulation of the expression of OsIPS1 and OsIPS2in rice via systemic and local Pi signaling and hormones Plant Cell
Environ 28 353ndash364Jeschke WD Kirkby EA Peuke AD Pate JS and Hartung W
(1997) Effects of P deficiency on assimilation and transport of nitrate andphosphate in intact plants of castor bean (Ricinus communis L) J Exp
Bot 48 75ndash91Kaplan F and Guy CL (2004) Beta-amylase induction and the protective
role of maltose during temperature shock Plant Physiol 135 1674ndash1684Kondracka A and Rychter AM (1997) The role of Pi recycling processes
during photosynthesis in phosphate-deficient bean plants J Exp Bot 48
1461ndash1468Kopka J (2006) Current challenges and developments in GC-MS based
metabolite profiling technology J Biotechnol 124 312ndash322Li K Xu C Zhang K Yang A and Zhang J (2007) Proteomic
analysis of roots growth and metabolic changes under phosphorus deficitin maize (Zea mays L) plants Proteomics 7 1501ndash1512
Liu CM Muchhal US and Raghothama KG (1997) Differential
expression of TPS11 a phosphate starvation-induced gene in tomatoPlant Mol Biol 33 867ndash874
Martin AC del Pozo JC Inglesias J Rubio V Solano Rde la Pena A Leyva A and Paz-Ares J (2000) Influence of cytokinins
on the expression of phosphate starvation responsive genes inArabidopsis Plant J 24 559ndash567
Mimura T (1999) Regulation of phosphate transport and homeostasis inplant cells Int Rev Cytol Cell Biol 191 149ndash200
Misson J Raghothama KG Jain A Jouhet J Block MA et al
(2005) A genome-wide transcriptional analysis using Arabidopsis thaliana
Affymetrix gene chips determined plant responses to phosphate depriva-
tion Proc Natl Acad Sci USA 102 11934ndash11939Morcuende R Bari R Gibon Y Zheng WM Pant BD Blasing O
Usadel B Czechowski T Udvardi MK Stitt M and Scheible WR(2007) Genome-wide reprogramming of metabolism and regulatory
networks of Arabidopsis in response to phosphorus Plant Cell Environ
30 85ndash112Muchhal US and Raghothama KG (1999) Transcriptional regulation of
plant phosphate transporters Proc Natl Acad Sci USA 96 5868ndash72Nanamori M Shinano T Wasaki J Yamamura T Rao IM and
Osaki M (2004) Low phosphorus tolerance mechanisms phosphorus
recycling and photosynthate partitioning in the tropical forage grassBrachiaria hybrid cultivar mulato compared with rice Plant Cell Environ
45 460ndash469Neumann G and Romheld V (1999) Root excretion of carboxylic acids
and protons in phosphorus-deficient plants Plant Soil 211 121ndash130Nikiforova VJ Gakiere B Kempa S Adamik M Willmitzer L
Hesse H and Hoefgen R (2004) Towards dissecting nutrient
metabolism in plants a systems biology case study on sulphur
metabolism J Exp Bot 55 1861ndash1870Nikiforova VJ Kopka J Tolstikov V Fiehn O Hopkins L
Hawkesford MJ Hesse H and Hoefgen R (2005) Systems rebalan-
cing of metabolism in response to sulfur deprivation as revealed bymetabolome analysis of Arabidopsis plants Plant Physiol 138 304ndash318
Nilsson L Muller R and Nielsen TH (2007) Increased expression of theMYB-related transcription factor PHR1 leads to enhanced phosphate
uptake in Arabidopsis thaliana Plant Cell Environ 30 1499ndash1512
Panikulangara TJ Eggers-Schumacher G Wunderlich M Stransky Hand Schoffl F (2004) Galactinol synthase 1 A novel heat shock factortarget gene responsible for heat-induced synthesis of raffinose familyoligosaccharides in Arabidopsis Plant Physiol 136 3148ndash3158
Pearse SJ Veneklaas EJ Cawthray G Bolland MDA andLambers H (2006) Triticum aestivum shows a greater biomass responseto a supply of aluminium phosphate than Lupinus albus despite releasingfewer carboxylates into the rhizosphere New Phytol 169 515ndash524
Plaxton WC (2004) Plant response to stress biochemical adaptations tophosphate deficiency In Encyclopedia of Plant and Crop Science Editedby Goodman R pp 976ndash980 Marcel Dekker Inc New York
Plaxton WC and Carswell MC (1999) Metabolic aspects of thephosphate starvation response in plants In Plant Response toEnvironmental Stresses From Photohormones to GenomeReorganization Edited by Lerner HR pp 349ndash372 Marcel DekkerInc New York
Rae AL Cybinski DH Jarmey JM and Smith FW (2003)Characterization of two phosphate transporters from barley evidencefor diverse function and kinetic properties among members of the Pht1family Plant Mol Biol 53 27ndash36
Raghothama KG (1999) Phosphate acquisition Annu Rev Plant PhysiolPlant Mol Biol 50 665ndash693
Reuter DJ and Robinson JB (1997) Plant Analysis An InterpretationManual 2nd edn pp 86ndash92 CSIRO Australia Melbourne
Roessner U Luedemann A Brust D Fiehn O Linke TWillmitzer L and Fernie AR (2001) Metabolic profiling allowscomprehensive phenotyping of genetically or environmentally modifiedplant systems Plant Cell 13 11ndash29
Roessner U Patterson JH Forbes MG Fincher GB Langridge Pand Bacic A (2006) An investigation of boron toxicity in barley usingmetabolomics Plant Physiol 142 1087ndash1101
Rychter AM and Randall DD (1994) The effect of phosphate deficiencyon carbohydrate metabolism in bean roots Physiol Plant 91 383ndash388
Schachtman DP Reid RJ and Ayling SM (1998) Phosphorus uptakeby plants from soil to cell Plant Physiol 116 447ndash453
Shih CY and Kao CH (1996) Growth inhibition in suspension-culturedrice cells under phosphate deprivation is mediated through putrescineaccumulation Plant Physiol 111 721ndash724
Uhde-Stone C Zinn KE Ramirez-Yanez M Li AG Vance CP andAllan DL (2003) Nylon filter arrays reveal differential gene expressionin proteoid roots of white lupin in response to phosphorus deficiencyPlant Physiol 131 1064ndash1079
Vance CP Uhde-Stone C and Allan DL (2003) Phosphorus acquisitionand use critical adaptations by plants for securing a non renewableresource New Phytol 157 423ndash447
Vandesompele J De Preter K Pattyn F Poppe B Van Roy NDe Paepe A and Speleman F (2002) Accurate normalization of real-time quantitative RTPCR data by geometric averaging of multipleinternal control genes Genome Biol 3 1ndash11
Wasaki J Yonetani R Kuroda S Shinano T Yazaki J et al (2003a)Transcriptomic analysis of metabolic changes by phosphorus stress in riceplant roots Plant Cell Environ 26 1515ndash1523
Wasaki J Yonetani R Shinano T Kai M and Osaki M (2003b)Expression of the OsPI1 gene cloned from rice roots using cDNAmicroarray rapidly responds to phosphorus status New Phytol 158239ndash248
Wingler A Lea PJ Quick WP and Leegood RC (2000)Photorespiration metabolic pathways and their role in stress protectionPhilos Trans R Soc B Biol Sci 355 1517ndash1529
Wu P Ma L Hou X Wang M Wu Y Liu F and Deng XW (2003)Phosphate starvation triggers distinct alterations of genome expression inArabidopsis roots and leaves Plant Physiol 132 1260ndash1271
Zarcinas BA Cartwright B and Spouncer LR (1987) Nitric aciddigestion and multi-element analysis of plant material by induc-tively coupled plasma spectrometry Commun Soil Sci Plant Anal 18131ndash146
(Received February 21 2008 Accepted March 13 2008)
Metabolite profiles in P-deficient barley plants 703
deficiency (Hirai et al 2004 Nikiforova et al 2005) but
the specific reduction in glutamate and aspartate is
only observed in P-deficient barley plants As synthesis
of glutamine and asparagine can incorporate two ammo-
nium molecules into one organic acid this is a highly
effective ammonium assimilation mechanism under the
carbohydrate-limiting conditions caused by P deficiency
Our metabolite analyses provide indirect evidence that
P-deficient plants are confronted with increased ammonium
To establish a direct link of P deficiency to the increased
accumulation of ammonium in barley tissues further
experiments are required by supplying low concentrations
of ammonium and monitoring ammonium levels in plant
tissues
The increased levels of glycine and serine in the shoots
of the severely P-deficient plants indicate that photorespira-
tion is enhanced in the shoots of the severely P-deficient
plants because glycine and serine are intermediates for
photorespiration (Wingler et al 2000) and the increased
levels of glycine and serine correlate well with the rate of
photorespiration in P-deficient bean plants (Kondracka and
Rychter 1997) Increases in the levels of glycine and serine
were also observed in sulfur-deficient Arabidopsis plants
(Nikiforava et al 2005) indicating that the increase in
photorespiration is a general stress response (Wingler et al
2000)
Carbohydrate partitioning in P-deficient barley differs
from a P-efficient Gramineae grass
P deficiency results in the enhanced accumulation of
di- and trisaccharides and reduced organic acids in barley
plants which generally is similar to rice a P-inefficient
plant (Nanamori et al 2004) A P-efficient grass (Brachiaria
hybrid) is very different from rice in carbohydrate par-
titioning under P-deficient conditions (Nanamori et al
2004) The Brachiaria hybrid can allocate more carbohy-
drates into organic acids and amino acids Maintaining high
activities of phosphoenolpyruvate carboxylase and phos-
phoenolpyruvate phosphatase under the low P condition
appears to be critical for allocating a large proportion of
carbohydrate into organic acids and amino acids Our data
suggest that barley behaves as a P-inefficient plant in
metabolic adaptation to low P environments Thus to
improve P efficiency in barley and perhaps other cereal
crops manipulation of metabolism through a shift in
carbohydrate partitioning could provide a logical strategy
In summary the metabolite profiles generated from
both shoots and roots provide an overview of the metabolic
adjustments that occur in P-deficient barley plants As
illustrated in Fig 7 P-deficient barley plants alter the levels
of many key metabolites which affect various metabolic
pathways including glycolysis photorespiration and
metabolism of nitrogen and phospholipids These adaptive
P inefficiency
P efficiency
ribose
inositol-1-P
glycine(shoots)
serine(shoots)
alanine(shoots)
aspartate
asparagine malate
fumarate
succinate
citrate
a-ketoglutarate
glutamine
glutamate
urea(roots)
glc
glc-6-P
fru
glycerol-3-P
aromaticcompounds
fru-6-P
di- and tri-saccharides
Carbohydratepartitioning
glycerate-3-P
PEP
pyruvate
oxaloacetate
Fig 7 Schematic summary of metabolic adjustments in P-deficient plants and the proposed carbohydrate partitioning for improvementof P efficiency in cereals Thick arrows in green indicate an increase in metabolite levels and thin arrows in red indicate a decreasein metabolite levels The dashed line indicates carbohydrate partitioning for high P efficiency (below the line) and for low P efficiency(above the line)
700 Metabolite profiles in P-deficient barley plants
adjustments reduce Pi consumption by increasing the
levels of di- and trisaccharides and salvage Pi from various
P-containing compounds including small P-containing
metabolites to maintain essential cellular functions An
immediate consequence which is unique to P deficiency is
greatlly reduced levels of the key metabolites in glycolysis
leading to the decrease in carbohydrate supply to the TCA
cycle especially in the roots In addition P-deficient plants
are likely to be confronted with the challenge of increased
ammonium derived from the degradation of protein The
assimilation of the increased ammonium requires additional
organic acids from the TCA cycle which depletes the
organic acid supply further It is noteworthy that although
there are di- and trisaccharides present in the P-deficient
plants they cannot be readily utilized Organic acids and
amino acids are the preferred storage metabolites in
P-deficient plants (Nanamori et al 2004) as they can be
readily utilized as the carbon resource by P-deficient plants
Therefore if barley (and other cereals) are to be engineered
to be better adapted to growth in P-deficient soils there
is a need to shift the partitioning of carbohydrate from
di- and tri-saccharides to organic acids and amino acids
Investigating the expression of genes (transcriptome) and
proteins (proteome) in barley under P-deficient conditions
would provide additional evidence to support this strategy
for enhancing the P efficiency
Materials and Methods
Plant materials
Barley (H vulgare L cv Lofty Nijo) seeds were surface-sterilized with 70 ethanol for 1min and 3 hypochlorite for5min rinsed with deionized water and incubated in Petri dishes for2 d at room temperature Two seeds with an emerged radicle wereput into a seedling cup which was placed in the lid of a black plasticcontainer Each container contained either four seedling cups fortwo harvests or two seedling cups for one harvest and were filledwith 1 liter of nutrient solution The basal nutrients were as follows(in mM) Ca(NO3)2 1000 KNO3 1000 MgSO4 250 KCl 50H3BO3 125 Fe-HEDTA 10 MnSO4 04 CuSO4 01 ZnSO405 NiSO4 01 and MoO3 01 with NH4H2PO4 100 (thornPtreatment) or without NH4H2PO4 (P treatment) To balanceNH4 ions added in the thornP treatment 100 mM NH4NO3 was addedinto the nutrient solution of the P treatment In the additionalexperiment with two levels of ammonium either 100 or 400 mMNH4NO3 was added in the thornP treatment and either nil or 300 mMNH4NO3 was added in the P treatment All treatments werereplicated four times Half-strength nutrient solution was useduntil the 10th day after seed imbibition for the plants harvested atday 10 and day 17 but the eighth day for the plants harvestedat day 16 Full strength was applied thereafter The full-strengthnutrient solution was replaced at day 14 for the plants harvested atday 17 but at day 12 for the plants harvested at day 16 The pH ofthe nutrient solution was adjusted to 60 with 1M KOH and thesolution was aerated continuously
Plants were grown in a controlled environment at 208Cday158C night with a photoperiod regime of 14 h day10 h nightat 300 mmolm2 sndash1 photon flux intensity at the plant level At each
harvest two seedling cups were removed from each containerPlants were collected in 5ndash6 h of the light period to eliminatediurnal changes in metabolite levels The roots of plants from oneseedling cup were rinsed briefly in deionized water excess waterwas blotted on fresh laboratory tissues and the roots and shootswere separated and oven-dried at 658C for 48 h The dry plantsamples were used for mineral element analysis by inductivelycoupled plasma spectrophotometry (Zarcinas et al 1987) Anothercup of plants was separated into roots and shoots frozenimmediately in liquid nitrogen and stored at 808C for metaboliteand transcript analyses
Real-time quantitative RTndashPCR
Shoots and roots of three replicates from each P treatmentwere used for transcript analysis Total RNA was prepared usingTrizol reagent according to the manufacturerrsquos instructions(Invitrogen Carlsbad CA USA) Total RNA was treated withDNase I using the DNA free kit (Ambion Austin TX USA) toremove any contaminating genomic DNA and then RNA integritywas checked on an agarose gel cDNA was prepared from 2mg oftotal RNA using SuperScriptTM III reverse transcriptase accord-ing to the manufacturerrsquos instructions (Invitrogen) The reactionwas incubated at 508C for 45min and at 708C for 15min toinactivate the enzyme
The transcript levels of HvIPS1 and HvPht16 weredetermined by real-time quantitative PCR essentially as describedby Burton et al (2004) The transcript levels of three control genes(barley a-tubulin heat shock protein 70 and cyclophilin) weredetermined and used for normalization Normalization was carriedout as described by Vandesompele et al (2002) and Burtonet al (2004) The normalized copies mg RNA1 are presentedThe primers 50 GCGGCGACTTCTCACCTCTACTAAG and50 CGAAGGATTCAAACAGGATCACACA (GenBank acces-sion No BI780234) were used for amplification of HvIPS1 and50 GGTCAAGAACTCGCTATTCATCC and 50 CCATACATCCATCCAAACCTG (GenBank accession No AF543198) foramplification of HvPht16
Analysis of metabolites with GC-MS
Metabolite analysis was carried out by a GC-MS-basedmethod modified from Roessner et al (2006) Fresh tissues of rootsand shoots from barley plants were homogenized using a mortarand pestle with liquid nitrogen Frozen tissue powder (100 10mgexact fresh weight was recorded) was extracted with methanol(350 ml) A polar internal standard (20 ml of 02mgmlndash1 ribitol inwater) and a non-polar internal standard (30 ml of 2mgmlndash1
nonadecanoic acid methylester in chloroform) were subsequentlyadded as quantification standards The mixture was extracted for15min at 708C and then mixed vigorously with 1 vol of waterIn order to separate polar and non-polar metabolites 300 ml ofchloroform was added to the mixture and centrifuged at 2200gfor 10min The upper methanolwater phase was collected andwashed with chloroform (300 ml) The polar phase of shoot extracts(100 ml) and root extracts (250 ml) was separately dried undervacuum Both lipid layers were combined and dried under vacuumIn order to methylate fatty acids the residues of the non-polarfractions were further incubated with chloroform (100 ml) andacidified methanol (300 ml of 125N HCl in methanol) for 24 h at508C and afterwards dried under vacuum The dry polar residuewas redissolved and derivatized for 120min at 378C in methox-yamine hydrochloride (40 ml of 20mgml1 in pyridine) followedby a 30min treatment with N-methyl-N-[trimethylsilyl] trifluoro-acetamide (MSTFA) (70 ml) at 378C The dry non-polar residue
Metabolite profiles in P-deficient barley plants 701
was derivatized for 60min at 378C in pyridine (70 ml) and MSTFA(40 ml) To both a retention time standard mixture [10 ml of 0029(vv) n-dodecane n-pentadecane n-nonadecane n-docosanen-octacosane n-dotracontane n-hexatriacontane dissolved inpyridine] was added prior to trimethylsilylation Sample volumesof 1ml were then injected using the splitless mode onto a GCcolumn using a hot needle technique
The GC-MS system and conditions were as described inRoessner et al (2006) Acquired total ion chromatograms andmass spectra were evaluated using the Xcalibur program(ThermoFinnigan Manchester UK) and the resulting data areprepared normalized and presented as described by Roessner et al(2001) Mass spectra of eluting compounds were identified usingthe commercial mass spectra library NIST (httpwwwnistgov)and the public domain mass spectra library of the Max-Planck-Institute for Plant Physiology Golm Germany (httpcsbdbmpimp-golmmpgdecsbdbdbmamsrihtml) All matchingmass spectra were additionally co-verified by determination of theretention time and mass spectra by analysis of authentic standardsubstances
Analysis of free amino acids with LC-MS
Leaf material (15mg) was accurately weighed intoEppendorf tubes (2ml) and a solution of EDTA (400 ml 5mM)was added to each sample The samples were sonicated for15min then heated in a water bath (808C 15min) centrifuged(14500 rpm 5min) and the supernatant derivatized Thederivatization of the amino acids is based on a procedure outlinedby Cohen and Michaud (1993) and involved mixing the super-natant obtained above (20 ml) with borate buffer (200 ml 02MpH 88) followed by the addition of 10mM 6-aminoquinolyl-N-hydroxysuccinimidyl carbamate solution (50 ml) in dry aceto-nitrile The reaction mixture was then heated at 558C in a waterbath for 10min and analyzed by LC-MS as described by Callahanet al (2007)
The LC-MS system comprised a Surveyor LC PumpSurveyor Auto Sampler and LCQ Deca XP Max ion trapMS (Thermo Finnigan USA) The ESI (electron spray ionization)source was optimized by infusing a derivatized amino acidstandard in line with the mobile phase then tuning the sourceconditions and ion optics to optimize the signals for the derivatizedamino acids This resulted in the following conditions sheath gas30 arbitrary units auxiliary gas 10 arbitrary units spray voltage30 kV capillary temperature 2508C capillary voltage 56V andtube lens 53V
Derivatized amino acids were eluted on an Altantis dC18150 21mm 3mm (Waters Melbourne Australia) HPLC columnusing a three-step gradient of deionized water (01 formic acid)and acetonitrile (01 formic acid) at a flow rate of 025mlminndash1
and a column temperature of 308C (Callahan et al 2007)
Statistical analysis
Students t-test at P 005 was applied for the means (nfrac14 4) ofmetabolites presented in Supplementary Tables S1ndashS3 Statisticalanalyses were carried using the Pirouette 311 software (InfometrixInc Woodinville WA USA)
Supplementary material
Supplementary material mentioned in the article is avail-able to online subscribers at the journal website wwwpcpoxfordjournalsorg
Funding
The Grains Research and Development Corporation
the Australian Research Council the South Australian
Government the University of Adelaide and the University
of Melbourne to the Australian Center for Plant Functional
Genomics (CYH UR NS PL AB) the Molecular
Plant Breeding CRC to YG Metabolomics Australia to
(UR DC AB)
Acknowledgments
We are grateful to M Tester for discussion and to T Fowlesand L Palmer for ICP analysis
References
Amiard V Morvan-Bertrand A Billard JP Huault C Keller F andPrudrsquohomme MP (2003) Fructans but not the sucrosyl-galactosidesraffinose and loliose are affected by drought stress in perennial ryegrassPlant Physiol 132 2218ndash29
Bieleski RL and Ferguson IB (1983) Physiology and metabolism ofphosphate and its compounds In Encyclopedia of Plant PhysiologyEdited by Lauchli A and Bieleski RL Vol 15a pp 422ndash449 SpringerVerlag Berlin
Bolling C and Fiehn O (2005) Metabolite profiling of Chlamydomonasreinhardtii under nutrient deprivation Plant Physiol 139 1995ndash2005
Britto DT and Kronzucker HJ (2002) NH4thorn toxicity in higher plants
a critical review J Plant Physiol 159 567ndash584Burleigh SH and Harrison MJ (1997) A novel gene whose expression in
Medicago truncatula roots is suppressed in response to colonization byvesicularndasharbuscular mycorrhizal (VAM) fungi and to phosphatenutrition Plant Mol Biol 34 199ndash208
Burton RA Shirley NJ King BJ Harvey AJ and Fincher GB(2004) The CesA gene family of barley Quantitative analysis oftranscripts reveals two groups of co-expressed genes Plant Physiol134 224ndash236
Callahan DL Kolev SD OrsquoHair RAJ Salt DE and Baker AJM(2007) Relationships between nicotianamine and other amino acids withnickel zinc and iron in Thlaspi hyperaccumulators New Phytol 176836ndash848
Ciereszko I and Barbachowska A (2000) Sucrose metabolism in leavesand roots of bean (Phaseolus vulgaris L) during phosphate deficiencyJ Plant Physiol 156 640ndash644
Cohen SA and Michaud DP (1993) Synthesis of a fluorescentderivatizing reagent 6-aminoquinolyl-N-hydroxysuccinimidyl carba-mate and its application for the analysis of hydrolysate amino acidsvia high-performance liquid chromatography Anal Biochem 211279ndash287
Cruz-Ramirez A Oropeza-Aburto A Razo-Hernandez F Ramirez-Chavez E and Herrera-Estrella L (2006) Phospholipase DZ2 playsan important role in extraplastidic galactolipid biosynthesis andphosphate recycling in Arabidopsis roots Proc Natl Acad Sci USA103 6765ndash6770
Doermann P and Benning C (2002) Galactolipids rule in seed plantsTrends Plant Sci 7 112ndash118
Gniazdowska A and Rychter AM (2000) Nitrate uptake by bean(Phaseolus vulgaris L) roots under phosphate deficiency Plant Soil 22679ndash85
Hendry GAF (1993) Evolutionary origins and natural functions offructansmdasha climatological biogeographic and mechanistic appraisalNew Phytol 123 3ndash14
Hernandez G Ramirez M Valdes-Lopez O Tesfaye MGraham MA et al (2007) Phosphorus stress in common bean roottranscript and metabolic responses Plant Physiol 144 752ndash767
702 Metabolite profiles in P-deficient barley plants
Hewitt MM Carr JM Williamson CL and Slocum RD (2005)Effects of phosphate limitation on expression of genes involved in
pyrimidine synthesis and salvaging in Arabidopsis Plant Physiol
Biochem 43 91ndash99Hirai MY Yano M Goodenowe DB Kanaya S Kimura T
Awazuhara M Arita M Fujiwara T and Saito K (2004) Integration
of transcriptomics and metabolomics for understanding of global
responses to nutritional stresses in Arabidopsis thaliana Proc Natl
Acad Sci USA 101 10205ndash10210Hou XL Wu P Jiao FC Jia QJ Chen HM Yu J Song XW
and Yi KK (2005) Regulation of the expression of OsIPS1 and OsIPS2in rice via systemic and local Pi signaling and hormones Plant Cell
Environ 28 353ndash364Jeschke WD Kirkby EA Peuke AD Pate JS and Hartung W
(1997) Effects of P deficiency on assimilation and transport of nitrate andphosphate in intact plants of castor bean (Ricinus communis L) J Exp
Bot 48 75ndash91Kaplan F and Guy CL (2004) Beta-amylase induction and the protective
role of maltose during temperature shock Plant Physiol 135 1674ndash1684Kondracka A and Rychter AM (1997) The role of Pi recycling processes
during photosynthesis in phosphate-deficient bean plants J Exp Bot 48
1461ndash1468Kopka J (2006) Current challenges and developments in GC-MS based
metabolite profiling technology J Biotechnol 124 312ndash322Li K Xu C Zhang K Yang A and Zhang J (2007) Proteomic
analysis of roots growth and metabolic changes under phosphorus deficitin maize (Zea mays L) plants Proteomics 7 1501ndash1512
Liu CM Muchhal US and Raghothama KG (1997) Differential
expression of TPS11 a phosphate starvation-induced gene in tomatoPlant Mol Biol 33 867ndash874
Martin AC del Pozo JC Inglesias J Rubio V Solano Rde la Pena A Leyva A and Paz-Ares J (2000) Influence of cytokinins
on the expression of phosphate starvation responsive genes inArabidopsis Plant J 24 559ndash567
Mimura T (1999) Regulation of phosphate transport and homeostasis inplant cells Int Rev Cytol Cell Biol 191 149ndash200
Misson J Raghothama KG Jain A Jouhet J Block MA et al
(2005) A genome-wide transcriptional analysis using Arabidopsis thaliana
Affymetrix gene chips determined plant responses to phosphate depriva-
tion Proc Natl Acad Sci USA 102 11934ndash11939Morcuende R Bari R Gibon Y Zheng WM Pant BD Blasing O
Usadel B Czechowski T Udvardi MK Stitt M and Scheible WR(2007) Genome-wide reprogramming of metabolism and regulatory
networks of Arabidopsis in response to phosphorus Plant Cell Environ
30 85ndash112Muchhal US and Raghothama KG (1999) Transcriptional regulation of
plant phosphate transporters Proc Natl Acad Sci USA 96 5868ndash72Nanamori M Shinano T Wasaki J Yamamura T Rao IM and
Osaki M (2004) Low phosphorus tolerance mechanisms phosphorus
recycling and photosynthate partitioning in the tropical forage grassBrachiaria hybrid cultivar mulato compared with rice Plant Cell Environ
45 460ndash469Neumann G and Romheld V (1999) Root excretion of carboxylic acids
and protons in phosphorus-deficient plants Plant Soil 211 121ndash130Nikiforova VJ Gakiere B Kempa S Adamik M Willmitzer L
Hesse H and Hoefgen R (2004) Towards dissecting nutrient
metabolism in plants a systems biology case study on sulphur
metabolism J Exp Bot 55 1861ndash1870Nikiforova VJ Kopka J Tolstikov V Fiehn O Hopkins L
Hawkesford MJ Hesse H and Hoefgen R (2005) Systems rebalan-
cing of metabolism in response to sulfur deprivation as revealed bymetabolome analysis of Arabidopsis plants Plant Physiol 138 304ndash318
Nilsson L Muller R and Nielsen TH (2007) Increased expression of theMYB-related transcription factor PHR1 leads to enhanced phosphate
uptake in Arabidopsis thaliana Plant Cell Environ 30 1499ndash1512
Panikulangara TJ Eggers-Schumacher G Wunderlich M Stransky Hand Schoffl F (2004) Galactinol synthase 1 A novel heat shock factortarget gene responsible for heat-induced synthesis of raffinose familyoligosaccharides in Arabidopsis Plant Physiol 136 3148ndash3158
Pearse SJ Veneklaas EJ Cawthray G Bolland MDA andLambers H (2006) Triticum aestivum shows a greater biomass responseto a supply of aluminium phosphate than Lupinus albus despite releasingfewer carboxylates into the rhizosphere New Phytol 169 515ndash524
Plaxton WC (2004) Plant response to stress biochemical adaptations tophosphate deficiency In Encyclopedia of Plant and Crop Science Editedby Goodman R pp 976ndash980 Marcel Dekker Inc New York
Plaxton WC and Carswell MC (1999) Metabolic aspects of thephosphate starvation response in plants In Plant Response toEnvironmental Stresses From Photohormones to GenomeReorganization Edited by Lerner HR pp 349ndash372 Marcel DekkerInc New York
Rae AL Cybinski DH Jarmey JM and Smith FW (2003)Characterization of two phosphate transporters from barley evidencefor diverse function and kinetic properties among members of the Pht1family Plant Mol Biol 53 27ndash36
Raghothama KG (1999) Phosphate acquisition Annu Rev Plant PhysiolPlant Mol Biol 50 665ndash693
Reuter DJ and Robinson JB (1997) Plant Analysis An InterpretationManual 2nd edn pp 86ndash92 CSIRO Australia Melbourne
Roessner U Luedemann A Brust D Fiehn O Linke TWillmitzer L and Fernie AR (2001) Metabolic profiling allowscomprehensive phenotyping of genetically or environmentally modifiedplant systems Plant Cell 13 11ndash29
Roessner U Patterson JH Forbes MG Fincher GB Langridge Pand Bacic A (2006) An investigation of boron toxicity in barley usingmetabolomics Plant Physiol 142 1087ndash1101
Rychter AM and Randall DD (1994) The effect of phosphate deficiencyon carbohydrate metabolism in bean roots Physiol Plant 91 383ndash388
Schachtman DP Reid RJ and Ayling SM (1998) Phosphorus uptakeby plants from soil to cell Plant Physiol 116 447ndash453
Shih CY and Kao CH (1996) Growth inhibition in suspension-culturedrice cells under phosphate deprivation is mediated through putrescineaccumulation Plant Physiol 111 721ndash724
Uhde-Stone C Zinn KE Ramirez-Yanez M Li AG Vance CP andAllan DL (2003) Nylon filter arrays reveal differential gene expressionin proteoid roots of white lupin in response to phosphorus deficiencyPlant Physiol 131 1064ndash1079
Vance CP Uhde-Stone C and Allan DL (2003) Phosphorus acquisitionand use critical adaptations by plants for securing a non renewableresource New Phytol 157 423ndash447
Vandesompele J De Preter K Pattyn F Poppe B Van Roy NDe Paepe A and Speleman F (2002) Accurate normalization of real-time quantitative RTPCR data by geometric averaging of multipleinternal control genes Genome Biol 3 1ndash11
Wasaki J Yonetani R Kuroda S Shinano T Yazaki J et al (2003a)Transcriptomic analysis of metabolic changes by phosphorus stress in riceplant roots Plant Cell Environ 26 1515ndash1523
Wasaki J Yonetani R Shinano T Kai M and Osaki M (2003b)Expression of the OsPI1 gene cloned from rice roots using cDNAmicroarray rapidly responds to phosphorus status New Phytol 158239ndash248
Wingler A Lea PJ Quick WP and Leegood RC (2000)Photorespiration metabolic pathways and their role in stress protectionPhilos Trans R Soc B Biol Sci 355 1517ndash1529
Wu P Ma L Hou X Wang M Wu Y Liu F and Deng XW (2003)Phosphate starvation triggers distinct alterations of genome expression inArabidopsis roots and leaves Plant Physiol 132 1260ndash1271
Zarcinas BA Cartwright B and Spouncer LR (1987) Nitric aciddigestion and multi-element analysis of plant material by induc-tively coupled plasma spectrometry Commun Soil Sci Plant Anal 18131ndash146
(Received February 21 2008 Accepted March 13 2008)
Metabolite profiles in P-deficient barley plants 703
adjustments reduce Pi consumption by increasing the
levels of di- and trisaccharides and salvage Pi from various
P-containing compounds including small P-containing
metabolites to maintain essential cellular functions An
immediate consequence which is unique to P deficiency is
greatlly reduced levels of the key metabolites in glycolysis
leading to the decrease in carbohydrate supply to the TCA
cycle especially in the roots In addition P-deficient plants
are likely to be confronted with the challenge of increased
ammonium derived from the degradation of protein The
assimilation of the increased ammonium requires additional
organic acids from the TCA cycle which depletes the
organic acid supply further It is noteworthy that although
there are di- and trisaccharides present in the P-deficient
plants they cannot be readily utilized Organic acids and
amino acids are the preferred storage metabolites in
P-deficient plants (Nanamori et al 2004) as they can be
readily utilized as the carbon resource by P-deficient plants
Therefore if barley (and other cereals) are to be engineered
to be better adapted to growth in P-deficient soils there
is a need to shift the partitioning of carbohydrate from
di- and tri-saccharides to organic acids and amino acids
Investigating the expression of genes (transcriptome) and
proteins (proteome) in barley under P-deficient conditions
would provide additional evidence to support this strategy
for enhancing the P efficiency
Materials and Methods
Plant materials
Barley (H vulgare L cv Lofty Nijo) seeds were surface-sterilized with 70 ethanol for 1min and 3 hypochlorite for5min rinsed with deionized water and incubated in Petri dishes for2 d at room temperature Two seeds with an emerged radicle wereput into a seedling cup which was placed in the lid of a black plasticcontainer Each container contained either four seedling cups fortwo harvests or two seedling cups for one harvest and were filledwith 1 liter of nutrient solution The basal nutrients were as follows(in mM) Ca(NO3)2 1000 KNO3 1000 MgSO4 250 KCl 50H3BO3 125 Fe-HEDTA 10 MnSO4 04 CuSO4 01 ZnSO405 NiSO4 01 and MoO3 01 with NH4H2PO4 100 (thornPtreatment) or without NH4H2PO4 (P treatment) To balanceNH4 ions added in the thornP treatment 100 mM NH4NO3 was addedinto the nutrient solution of the P treatment In the additionalexperiment with two levels of ammonium either 100 or 400 mMNH4NO3 was added in the thornP treatment and either nil or 300 mMNH4NO3 was added in the P treatment All treatments werereplicated four times Half-strength nutrient solution was useduntil the 10th day after seed imbibition for the plants harvested atday 10 and day 17 but the eighth day for the plants harvestedat day 16 Full strength was applied thereafter The full-strengthnutrient solution was replaced at day 14 for the plants harvested atday 17 but at day 12 for the plants harvested at day 16 The pH ofthe nutrient solution was adjusted to 60 with 1M KOH and thesolution was aerated continuously
Plants were grown in a controlled environment at 208Cday158C night with a photoperiod regime of 14 h day10 h nightat 300 mmolm2 sndash1 photon flux intensity at the plant level At each
harvest two seedling cups were removed from each containerPlants were collected in 5ndash6 h of the light period to eliminatediurnal changes in metabolite levels The roots of plants from oneseedling cup were rinsed briefly in deionized water excess waterwas blotted on fresh laboratory tissues and the roots and shootswere separated and oven-dried at 658C for 48 h The dry plantsamples were used for mineral element analysis by inductivelycoupled plasma spectrophotometry (Zarcinas et al 1987) Anothercup of plants was separated into roots and shoots frozenimmediately in liquid nitrogen and stored at 808C for metaboliteand transcript analyses
Real-time quantitative RTndashPCR
Shoots and roots of three replicates from each P treatmentwere used for transcript analysis Total RNA was prepared usingTrizol reagent according to the manufacturerrsquos instructions(Invitrogen Carlsbad CA USA) Total RNA was treated withDNase I using the DNA free kit (Ambion Austin TX USA) toremove any contaminating genomic DNA and then RNA integritywas checked on an agarose gel cDNA was prepared from 2mg oftotal RNA using SuperScriptTM III reverse transcriptase accord-ing to the manufacturerrsquos instructions (Invitrogen) The reactionwas incubated at 508C for 45min and at 708C for 15min toinactivate the enzyme
The transcript levels of HvIPS1 and HvPht16 weredetermined by real-time quantitative PCR essentially as describedby Burton et al (2004) The transcript levels of three control genes(barley a-tubulin heat shock protein 70 and cyclophilin) weredetermined and used for normalization Normalization was carriedout as described by Vandesompele et al (2002) and Burtonet al (2004) The normalized copies mg RNA1 are presentedThe primers 50 GCGGCGACTTCTCACCTCTACTAAG and50 CGAAGGATTCAAACAGGATCACACA (GenBank acces-sion No BI780234) were used for amplification of HvIPS1 and50 GGTCAAGAACTCGCTATTCATCC and 50 CCATACATCCATCCAAACCTG (GenBank accession No AF543198) foramplification of HvPht16
Analysis of metabolites with GC-MS
Metabolite analysis was carried out by a GC-MS-basedmethod modified from Roessner et al (2006) Fresh tissues of rootsand shoots from barley plants were homogenized using a mortarand pestle with liquid nitrogen Frozen tissue powder (100 10mgexact fresh weight was recorded) was extracted with methanol(350 ml) A polar internal standard (20 ml of 02mgmlndash1 ribitol inwater) and a non-polar internal standard (30 ml of 2mgmlndash1
nonadecanoic acid methylester in chloroform) were subsequentlyadded as quantification standards The mixture was extracted for15min at 708C and then mixed vigorously with 1 vol of waterIn order to separate polar and non-polar metabolites 300 ml ofchloroform was added to the mixture and centrifuged at 2200gfor 10min The upper methanolwater phase was collected andwashed with chloroform (300 ml) The polar phase of shoot extracts(100 ml) and root extracts (250 ml) was separately dried undervacuum Both lipid layers were combined and dried under vacuumIn order to methylate fatty acids the residues of the non-polarfractions were further incubated with chloroform (100 ml) andacidified methanol (300 ml of 125N HCl in methanol) for 24 h at508C and afterwards dried under vacuum The dry polar residuewas redissolved and derivatized for 120min at 378C in methox-yamine hydrochloride (40 ml of 20mgml1 in pyridine) followedby a 30min treatment with N-methyl-N-[trimethylsilyl] trifluoro-acetamide (MSTFA) (70 ml) at 378C The dry non-polar residue
Metabolite profiles in P-deficient barley plants 701
was derivatized for 60min at 378C in pyridine (70 ml) and MSTFA(40 ml) To both a retention time standard mixture [10 ml of 0029(vv) n-dodecane n-pentadecane n-nonadecane n-docosanen-octacosane n-dotracontane n-hexatriacontane dissolved inpyridine] was added prior to trimethylsilylation Sample volumesof 1ml were then injected using the splitless mode onto a GCcolumn using a hot needle technique
The GC-MS system and conditions were as described inRoessner et al (2006) Acquired total ion chromatograms andmass spectra were evaluated using the Xcalibur program(ThermoFinnigan Manchester UK) and the resulting data areprepared normalized and presented as described by Roessner et al(2001) Mass spectra of eluting compounds were identified usingthe commercial mass spectra library NIST (httpwwwnistgov)and the public domain mass spectra library of the Max-Planck-Institute for Plant Physiology Golm Germany (httpcsbdbmpimp-golmmpgdecsbdbdbmamsrihtml) All matchingmass spectra were additionally co-verified by determination of theretention time and mass spectra by analysis of authentic standardsubstances
Analysis of free amino acids with LC-MS
Leaf material (15mg) was accurately weighed intoEppendorf tubes (2ml) and a solution of EDTA (400 ml 5mM)was added to each sample The samples were sonicated for15min then heated in a water bath (808C 15min) centrifuged(14500 rpm 5min) and the supernatant derivatized Thederivatization of the amino acids is based on a procedure outlinedby Cohen and Michaud (1993) and involved mixing the super-natant obtained above (20 ml) with borate buffer (200 ml 02MpH 88) followed by the addition of 10mM 6-aminoquinolyl-N-hydroxysuccinimidyl carbamate solution (50 ml) in dry aceto-nitrile The reaction mixture was then heated at 558C in a waterbath for 10min and analyzed by LC-MS as described by Callahanet al (2007)
The LC-MS system comprised a Surveyor LC PumpSurveyor Auto Sampler and LCQ Deca XP Max ion trapMS (Thermo Finnigan USA) The ESI (electron spray ionization)source was optimized by infusing a derivatized amino acidstandard in line with the mobile phase then tuning the sourceconditions and ion optics to optimize the signals for the derivatizedamino acids This resulted in the following conditions sheath gas30 arbitrary units auxiliary gas 10 arbitrary units spray voltage30 kV capillary temperature 2508C capillary voltage 56V andtube lens 53V
Derivatized amino acids were eluted on an Altantis dC18150 21mm 3mm (Waters Melbourne Australia) HPLC columnusing a three-step gradient of deionized water (01 formic acid)and acetonitrile (01 formic acid) at a flow rate of 025mlminndash1
and a column temperature of 308C (Callahan et al 2007)
Statistical analysis
Students t-test at P 005 was applied for the means (nfrac14 4) ofmetabolites presented in Supplementary Tables S1ndashS3 Statisticalanalyses were carried using the Pirouette 311 software (InfometrixInc Woodinville WA USA)
Supplementary material
Supplementary material mentioned in the article is avail-able to online subscribers at the journal website wwwpcpoxfordjournalsorg
Funding
The Grains Research and Development Corporation
the Australian Research Council the South Australian
Government the University of Adelaide and the University
of Melbourne to the Australian Center for Plant Functional
Genomics (CYH UR NS PL AB) the Molecular
Plant Breeding CRC to YG Metabolomics Australia to
(UR DC AB)
Acknowledgments
We are grateful to M Tester for discussion and to T Fowlesand L Palmer for ICP analysis
References
Amiard V Morvan-Bertrand A Billard JP Huault C Keller F andPrudrsquohomme MP (2003) Fructans but not the sucrosyl-galactosidesraffinose and loliose are affected by drought stress in perennial ryegrassPlant Physiol 132 2218ndash29
Bieleski RL and Ferguson IB (1983) Physiology and metabolism ofphosphate and its compounds In Encyclopedia of Plant PhysiologyEdited by Lauchli A and Bieleski RL Vol 15a pp 422ndash449 SpringerVerlag Berlin
Bolling C and Fiehn O (2005) Metabolite profiling of Chlamydomonasreinhardtii under nutrient deprivation Plant Physiol 139 1995ndash2005
Britto DT and Kronzucker HJ (2002) NH4thorn toxicity in higher plants
a critical review J Plant Physiol 159 567ndash584Burleigh SH and Harrison MJ (1997) A novel gene whose expression in
Medicago truncatula roots is suppressed in response to colonization byvesicularndasharbuscular mycorrhizal (VAM) fungi and to phosphatenutrition Plant Mol Biol 34 199ndash208
Burton RA Shirley NJ King BJ Harvey AJ and Fincher GB(2004) The CesA gene family of barley Quantitative analysis oftranscripts reveals two groups of co-expressed genes Plant Physiol134 224ndash236
Callahan DL Kolev SD OrsquoHair RAJ Salt DE and Baker AJM(2007) Relationships between nicotianamine and other amino acids withnickel zinc and iron in Thlaspi hyperaccumulators New Phytol 176836ndash848
Ciereszko I and Barbachowska A (2000) Sucrose metabolism in leavesand roots of bean (Phaseolus vulgaris L) during phosphate deficiencyJ Plant Physiol 156 640ndash644
Cohen SA and Michaud DP (1993) Synthesis of a fluorescentderivatizing reagent 6-aminoquinolyl-N-hydroxysuccinimidyl carba-mate and its application for the analysis of hydrolysate amino acidsvia high-performance liquid chromatography Anal Biochem 211279ndash287
Cruz-Ramirez A Oropeza-Aburto A Razo-Hernandez F Ramirez-Chavez E and Herrera-Estrella L (2006) Phospholipase DZ2 playsan important role in extraplastidic galactolipid biosynthesis andphosphate recycling in Arabidopsis roots Proc Natl Acad Sci USA103 6765ndash6770
Doermann P and Benning C (2002) Galactolipids rule in seed plantsTrends Plant Sci 7 112ndash118
Gniazdowska A and Rychter AM (2000) Nitrate uptake by bean(Phaseolus vulgaris L) roots under phosphate deficiency Plant Soil 22679ndash85
Hendry GAF (1993) Evolutionary origins and natural functions offructansmdasha climatological biogeographic and mechanistic appraisalNew Phytol 123 3ndash14
Hernandez G Ramirez M Valdes-Lopez O Tesfaye MGraham MA et al (2007) Phosphorus stress in common bean roottranscript and metabolic responses Plant Physiol 144 752ndash767
702 Metabolite profiles in P-deficient barley plants
Hewitt MM Carr JM Williamson CL and Slocum RD (2005)Effects of phosphate limitation on expression of genes involved in
pyrimidine synthesis and salvaging in Arabidopsis Plant Physiol
Biochem 43 91ndash99Hirai MY Yano M Goodenowe DB Kanaya S Kimura T
Awazuhara M Arita M Fujiwara T and Saito K (2004) Integration
of transcriptomics and metabolomics for understanding of global
responses to nutritional stresses in Arabidopsis thaliana Proc Natl
Acad Sci USA 101 10205ndash10210Hou XL Wu P Jiao FC Jia QJ Chen HM Yu J Song XW
and Yi KK (2005) Regulation of the expression of OsIPS1 and OsIPS2in rice via systemic and local Pi signaling and hormones Plant Cell
Environ 28 353ndash364Jeschke WD Kirkby EA Peuke AD Pate JS and Hartung W
(1997) Effects of P deficiency on assimilation and transport of nitrate andphosphate in intact plants of castor bean (Ricinus communis L) J Exp
Bot 48 75ndash91Kaplan F and Guy CL (2004) Beta-amylase induction and the protective
role of maltose during temperature shock Plant Physiol 135 1674ndash1684Kondracka A and Rychter AM (1997) The role of Pi recycling processes
during photosynthesis in phosphate-deficient bean plants J Exp Bot 48
1461ndash1468Kopka J (2006) Current challenges and developments in GC-MS based
metabolite profiling technology J Biotechnol 124 312ndash322Li K Xu C Zhang K Yang A and Zhang J (2007) Proteomic
analysis of roots growth and metabolic changes under phosphorus deficitin maize (Zea mays L) plants Proteomics 7 1501ndash1512
Liu CM Muchhal US and Raghothama KG (1997) Differential
expression of TPS11 a phosphate starvation-induced gene in tomatoPlant Mol Biol 33 867ndash874
Martin AC del Pozo JC Inglesias J Rubio V Solano Rde la Pena A Leyva A and Paz-Ares J (2000) Influence of cytokinins
on the expression of phosphate starvation responsive genes inArabidopsis Plant J 24 559ndash567
Mimura T (1999) Regulation of phosphate transport and homeostasis inplant cells Int Rev Cytol Cell Biol 191 149ndash200
Misson J Raghothama KG Jain A Jouhet J Block MA et al
(2005) A genome-wide transcriptional analysis using Arabidopsis thaliana
Affymetrix gene chips determined plant responses to phosphate depriva-
tion Proc Natl Acad Sci USA 102 11934ndash11939Morcuende R Bari R Gibon Y Zheng WM Pant BD Blasing O
Usadel B Czechowski T Udvardi MK Stitt M and Scheible WR(2007) Genome-wide reprogramming of metabolism and regulatory
networks of Arabidopsis in response to phosphorus Plant Cell Environ
30 85ndash112Muchhal US and Raghothama KG (1999) Transcriptional regulation of
plant phosphate transporters Proc Natl Acad Sci USA 96 5868ndash72Nanamori M Shinano T Wasaki J Yamamura T Rao IM and
Osaki M (2004) Low phosphorus tolerance mechanisms phosphorus
recycling and photosynthate partitioning in the tropical forage grassBrachiaria hybrid cultivar mulato compared with rice Plant Cell Environ
45 460ndash469Neumann G and Romheld V (1999) Root excretion of carboxylic acids
and protons in phosphorus-deficient plants Plant Soil 211 121ndash130Nikiforova VJ Gakiere B Kempa S Adamik M Willmitzer L
Hesse H and Hoefgen R (2004) Towards dissecting nutrient
metabolism in plants a systems biology case study on sulphur
metabolism J Exp Bot 55 1861ndash1870Nikiforova VJ Kopka J Tolstikov V Fiehn O Hopkins L
Hawkesford MJ Hesse H and Hoefgen R (2005) Systems rebalan-
cing of metabolism in response to sulfur deprivation as revealed bymetabolome analysis of Arabidopsis plants Plant Physiol 138 304ndash318
Nilsson L Muller R and Nielsen TH (2007) Increased expression of theMYB-related transcription factor PHR1 leads to enhanced phosphate
uptake in Arabidopsis thaliana Plant Cell Environ 30 1499ndash1512
Panikulangara TJ Eggers-Schumacher G Wunderlich M Stransky Hand Schoffl F (2004) Galactinol synthase 1 A novel heat shock factortarget gene responsible for heat-induced synthesis of raffinose familyoligosaccharides in Arabidopsis Plant Physiol 136 3148ndash3158
Pearse SJ Veneklaas EJ Cawthray G Bolland MDA andLambers H (2006) Triticum aestivum shows a greater biomass responseto a supply of aluminium phosphate than Lupinus albus despite releasingfewer carboxylates into the rhizosphere New Phytol 169 515ndash524
Plaxton WC (2004) Plant response to stress biochemical adaptations tophosphate deficiency In Encyclopedia of Plant and Crop Science Editedby Goodman R pp 976ndash980 Marcel Dekker Inc New York
Plaxton WC and Carswell MC (1999) Metabolic aspects of thephosphate starvation response in plants In Plant Response toEnvironmental Stresses From Photohormones to GenomeReorganization Edited by Lerner HR pp 349ndash372 Marcel DekkerInc New York
Rae AL Cybinski DH Jarmey JM and Smith FW (2003)Characterization of two phosphate transporters from barley evidencefor diverse function and kinetic properties among members of the Pht1family Plant Mol Biol 53 27ndash36
Raghothama KG (1999) Phosphate acquisition Annu Rev Plant PhysiolPlant Mol Biol 50 665ndash693
Reuter DJ and Robinson JB (1997) Plant Analysis An InterpretationManual 2nd edn pp 86ndash92 CSIRO Australia Melbourne
Roessner U Luedemann A Brust D Fiehn O Linke TWillmitzer L and Fernie AR (2001) Metabolic profiling allowscomprehensive phenotyping of genetically or environmentally modifiedplant systems Plant Cell 13 11ndash29
Roessner U Patterson JH Forbes MG Fincher GB Langridge Pand Bacic A (2006) An investigation of boron toxicity in barley usingmetabolomics Plant Physiol 142 1087ndash1101
Rychter AM and Randall DD (1994) The effect of phosphate deficiencyon carbohydrate metabolism in bean roots Physiol Plant 91 383ndash388
Schachtman DP Reid RJ and Ayling SM (1998) Phosphorus uptakeby plants from soil to cell Plant Physiol 116 447ndash453
Shih CY and Kao CH (1996) Growth inhibition in suspension-culturedrice cells under phosphate deprivation is mediated through putrescineaccumulation Plant Physiol 111 721ndash724
Uhde-Stone C Zinn KE Ramirez-Yanez M Li AG Vance CP andAllan DL (2003) Nylon filter arrays reveal differential gene expressionin proteoid roots of white lupin in response to phosphorus deficiencyPlant Physiol 131 1064ndash1079
Vance CP Uhde-Stone C and Allan DL (2003) Phosphorus acquisitionand use critical adaptations by plants for securing a non renewableresource New Phytol 157 423ndash447
Vandesompele J De Preter K Pattyn F Poppe B Van Roy NDe Paepe A and Speleman F (2002) Accurate normalization of real-time quantitative RTPCR data by geometric averaging of multipleinternal control genes Genome Biol 3 1ndash11
Wasaki J Yonetani R Kuroda S Shinano T Yazaki J et al (2003a)Transcriptomic analysis of metabolic changes by phosphorus stress in riceplant roots Plant Cell Environ 26 1515ndash1523
Wasaki J Yonetani R Shinano T Kai M and Osaki M (2003b)Expression of the OsPI1 gene cloned from rice roots using cDNAmicroarray rapidly responds to phosphorus status New Phytol 158239ndash248
Wingler A Lea PJ Quick WP and Leegood RC (2000)Photorespiration metabolic pathways and their role in stress protectionPhilos Trans R Soc B Biol Sci 355 1517ndash1529
Wu P Ma L Hou X Wang M Wu Y Liu F and Deng XW (2003)Phosphate starvation triggers distinct alterations of genome expression inArabidopsis roots and leaves Plant Physiol 132 1260ndash1271
Zarcinas BA Cartwright B and Spouncer LR (1987) Nitric aciddigestion and multi-element analysis of plant material by induc-tively coupled plasma spectrometry Commun Soil Sci Plant Anal 18131ndash146
(Received February 21 2008 Accepted March 13 2008)
Metabolite profiles in P-deficient barley plants 703
was derivatized for 60min at 378C in pyridine (70 ml) and MSTFA(40 ml) To both a retention time standard mixture [10 ml of 0029(vv) n-dodecane n-pentadecane n-nonadecane n-docosanen-octacosane n-dotracontane n-hexatriacontane dissolved inpyridine] was added prior to trimethylsilylation Sample volumesof 1ml were then injected using the splitless mode onto a GCcolumn using a hot needle technique
The GC-MS system and conditions were as described inRoessner et al (2006) Acquired total ion chromatograms andmass spectra were evaluated using the Xcalibur program(ThermoFinnigan Manchester UK) and the resulting data areprepared normalized and presented as described by Roessner et al(2001) Mass spectra of eluting compounds were identified usingthe commercial mass spectra library NIST (httpwwwnistgov)and the public domain mass spectra library of the Max-Planck-Institute for Plant Physiology Golm Germany (httpcsbdbmpimp-golmmpgdecsbdbdbmamsrihtml) All matchingmass spectra were additionally co-verified by determination of theretention time and mass spectra by analysis of authentic standardsubstances
Analysis of free amino acids with LC-MS
Leaf material (15mg) was accurately weighed intoEppendorf tubes (2ml) and a solution of EDTA (400 ml 5mM)was added to each sample The samples were sonicated for15min then heated in a water bath (808C 15min) centrifuged(14500 rpm 5min) and the supernatant derivatized Thederivatization of the amino acids is based on a procedure outlinedby Cohen and Michaud (1993) and involved mixing the super-natant obtained above (20 ml) with borate buffer (200 ml 02MpH 88) followed by the addition of 10mM 6-aminoquinolyl-N-hydroxysuccinimidyl carbamate solution (50 ml) in dry aceto-nitrile The reaction mixture was then heated at 558C in a waterbath for 10min and analyzed by LC-MS as described by Callahanet al (2007)
The LC-MS system comprised a Surveyor LC PumpSurveyor Auto Sampler and LCQ Deca XP Max ion trapMS (Thermo Finnigan USA) The ESI (electron spray ionization)source was optimized by infusing a derivatized amino acidstandard in line with the mobile phase then tuning the sourceconditions and ion optics to optimize the signals for the derivatizedamino acids This resulted in the following conditions sheath gas30 arbitrary units auxiliary gas 10 arbitrary units spray voltage30 kV capillary temperature 2508C capillary voltage 56V andtube lens 53V
Derivatized amino acids were eluted on an Altantis dC18150 21mm 3mm (Waters Melbourne Australia) HPLC columnusing a three-step gradient of deionized water (01 formic acid)and acetonitrile (01 formic acid) at a flow rate of 025mlminndash1
and a column temperature of 308C (Callahan et al 2007)
Statistical analysis
Students t-test at P 005 was applied for the means (nfrac14 4) ofmetabolites presented in Supplementary Tables S1ndashS3 Statisticalanalyses were carried using the Pirouette 311 software (InfometrixInc Woodinville WA USA)
Supplementary material
Supplementary material mentioned in the article is avail-able to online subscribers at the journal website wwwpcpoxfordjournalsorg
Funding
The Grains Research and Development Corporation
the Australian Research Council the South Australian
Government the University of Adelaide and the University
of Melbourne to the Australian Center for Plant Functional
Genomics (CYH UR NS PL AB) the Molecular
Plant Breeding CRC to YG Metabolomics Australia to
(UR DC AB)
Acknowledgments
We are grateful to M Tester for discussion and to T Fowlesand L Palmer for ICP analysis
References
Amiard V Morvan-Bertrand A Billard JP Huault C Keller F andPrudrsquohomme MP (2003) Fructans but not the sucrosyl-galactosidesraffinose and loliose are affected by drought stress in perennial ryegrassPlant Physiol 132 2218ndash29
Bieleski RL and Ferguson IB (1983) Physiology and metabolism ofphosphate and its compounds In Encyclopedia of Plant PhysiologyEdited by Lauchli A and Bieleski RL Vol 15a pp 422ndash449 SpringerVerlag Berlin
Bolling C and Fiehn O (2005) Metabolite profiling of Chlamydomonasreinhardtii under nutrient deprivation Plant Physiol 139 1995ndash2005
Britto DT and Kronzucker HJ (2002) NH4thorn toxicity in higher plants
a critical review J Plant Physiol 159 567ndash584Burleigh SH and Harrison MJ (1997) A novel gene whose expression in
Medicago truncatula roots is suppressed in response to colonization byvesicularndasharbuscular mycorrhizal (VAM) fungi and to phosphatenutrition Plant Mol Biol 34 199ndash208
Burton RA Shirley NJ King BJ Harvey AJ and Fincher GB(2004) The CesA gene family of barley Quantitative analysis oftranscripts reveals two groups of co-expressed genes Plant Physiol134 224ndash236
Callahan DL Kolev SD OrsquoHair RAJ Salt DE and Baker AJM(2007) Relationships between nicotianamine and other amino acids withnickel zinc and iron in Thlaspi hyperaccumulators New Phytol 176836ndash848
Ciereszko I and Barbachowska A (2000) Sucrose metabolism in leavesand roots of bean (Phaseolus vulgaris L) during phosphate deficiencyJ Plant Physiol 156 640ndash644
Cohen SA and Michaud DP (1993) Synthesis of a fluorescentderivatizing reagent 6-aminoquinolyl-N-hydroxysuccinimidyl carba-mate and its application for the analysis of hydrolysate amino acidsvia high-performance liquid chromatography Anal Biochem 211279ndash287
Cruz-Ramirez A Oropeza-Aburto A Razo-Hernandez F Ramirez-Chavez E and Herrera-Estrella L (2006) Phospholipase DZ2 playsan important role in extraplastidic galactolipid biosynthesis andphosphate recycling in Arabidopsis roots Proc Natl Acad Sci USA103 6765ndash6770
Doermann P and Benning C (2002) Galactolipids rule in seed plantsTrends Plant Sci 7 112ndash118
Gniazdowska A and Rychter AM (2000) Nitrate uptake by bean(Phaseolus vulgaris L) roots under phosphate deficiency Plant Soil 22679ndash85
Hendry GAF (1993) Evolutionary origins and natural functions offructansmdasha climatological biogeographic and mechanistic appraisalNew Phytol 123 3ndash14
Hernandez G Ramirez M Valdes-Lopez O Tesfaye MGraham MA et al (2007) Phosphorus stress in common bean roottranscript and metabolic responses Plant Physiol 144 752ndash767
702 Metabolite profiles in P-deficient barley plants
Hewitt MM Carr JM Williamson CL and Slocum RD (2005)Effects of phosphate limitation on expression of genes involved in
pyrimidine synthesis and salvaging in Arabidopsis Plant Physiol
Biochem 43 91ndash99Hirai MY Yano M Goodenowe DB Kanaya S Kimura T
Awazuhara M Arita M Fujiwara T and Saito K (2004) Integration
of transcriptomics and metabolomics for understanding of global
responses to nutritional stresses in Arabidopsis thaliana Proc Natl
Acad Sci USA 101 10205ndash10210Hou XL Wu P Jiao FC Jia QJ Chen HM Yu J Song XW
and Yi KK (2005) Regulation of the expression of OsIPS1 and OsIPS2in rice via systemic and local Pi signaling and hormones Plant Cell
Environ 28 353ndash364Jeschke WD Kirkby EA Peuke AD Pate JS and Hartung W
(1997) Effects of P deficiency on assimilation and transport of nitrate andphosphate in intact plants of castor bean (Ricinus communis L) J Exp
Bot 48 75ndash91Kaplan F and Guy CL (2004) Beta-amylase induction and the protective
role of maltose during temperature shock Plant Physiol 135 1674ndash1684Kondracka A and Rychter AM (1997) The role of Pi recycling processes
during photosynthesis in phosphate-deficient bean plants J Exp Bot 48
1461ndash1468Kopka J (2006) Current challenges and developments in GC-MS based
metabolite profiling technology J Biotechnol 124 312ndash322Li K Xu C Zhang K Yang A and Zhang J (2007) Proteomic
analysis of roots growth and metabolic changes under phosphorus deficitin maize (Zea mays L) plants Proteomics 7 1501ndash1512
Liu CM Muchhal US and Raghothama KG (1997) Differential
expression of TPS11 a phosphate starvation-induced gene in tomatoPlant Mol Biol 33 867ndash874
Martin AC del Pozo JC Inglesias J Rubio V Solano Rde la Pena A Leyva A and Paz-Ares J (2000) Influence of cytokinins
on the expression of phosphate starvation responsive genes inArabidopsis Plant J 24 559ndash567
Mimura T (1999) Regulation of phosphate transport and homeostasis inplant cells Int Rev Cytol Cell Biol 191 149ndash200
Misson J Raghothama KG Jain A Jouhet J Block MA et al
(2005) A genome-wide transcriptional analysis using Arabidopsis thaliana
Affymetrix gene chips determined plant responses to phosphate depriva-
tion Proc Natl Acad Sci USA 102 11934ndash11939Morcuende R Bari R Gibon Y Zheng WM Pant BD Blasing O
Usadel B Czechowski T Udvardi MK Stitt M and Scheible WR(2007) Genome-wide reprogramming of metabolism and regulatory
networks of Arabidopsis in response to phosphorus Plant Cell Environ
30 85ndash112Muchhal US and Raghothama KG (1999) Transcriptional regulation of
plant phosphate transporters Proc Natl Acad Sci USA 96 5868ndash72Nanamori M Shinano T Wasaki J Yamamura T Rao IM and
Osaki M (2004) Low phosphorus tolerance mechanisms phosphorus
recycling and photosynthate partitioning in the tropical forage grassBrachiaria hybrid cultivar mulato compared with rice Plant Cell Environ
45 460ndash469Neumann G and Romheld V (1999) Root excretion of carboxylic acids
and protons in phosphorus-deficient plants Plant Soil 211 121ndash130Nikiforova VJ Gakiere B Kempa S Adamik M Willmitzer L
Hesse H and Hoefgen R (2004) Towards dissecting nutrient
metabolism in plants a systems biology case study on sulphur
metabolism J Exp Bot 55 1861ndash1870Nikiforova VJ Kopka J Tolstikov V Fiehn O Hopkins L
Hawkesford MJ Hesse H and Hoefgen R (2005) Systems rebalan-
cing of metabolism in response to sulfur deprivation as revealed bymetabolome analysis of Arabidopsis plants Plant Physiol 138 304ndash318
Nilsson L Muller R and Nielsen TH (2007) Increased expression of theMYB-related transcription factor PHR1 leads to enhanced phosphate
uptake in Arabidopsis thaliana Plant Cell Environ 30 1499ndash1512
Panikulangara TJ Eggers-Schumacher G Wunderlich M Stransky Hand Schoffl F (2004) Galactinol synthase 1 A novel heat shock factortarget gene responsible for heat-induced synthesis of raffinose familyoligosaccharides in Arabidopsis Plant Physiol 136 3148ndash3158
Pearse SJ Veneklaas EJ Cawthray G Bolland MDA andLambers H (2006) Triticum aestivum shows a greater biomass responseto a supply of aluminium phosphate than Lupinus albus despite releasingfewer carboxylates into the rhizosphere New Phytol 169 515ndash524
Plaxton WC (2004) Plant response to stress biochemical adaptations tophosphate deficiency In Encyclopedia of Plant and Crop Science Editedby Goodman R pp 976ndash980 Marcel Dekker Inc New York
Plaxton WC and Carswell MC (1999) Metabolic aspects of thephosphate starvation response in plants In Plant Response toEnvironmental Stresses From Photohormones to GenomeReorganization Edited by Lerner HR pp 349ndash372 Marcel DekkerInc New York
Rae AL Cybinski DH Jarmey JM and Smith FW (2003)Characterization of two phosphate transporters from barley evidencefor diverse function and kinetic properties among members of the Pht1family Plant Mol Biol 53 27ndash36
Raghothama KG (1999) Phosphate acquisition Annu Rev Plant PhysiolPlant Mol Biol 50 665ndash693
Reuter DJ and Robinson JB (1997) Plant Analysis An InterpretationManual 2nd edn pp 86ndash92 CSIRO Australia Melbourne
Roessner U Luedemann A Brust D Fiehn O Linke TWillmitzer L and Fernie AR (2001) Metabolic profiling allowscomprehensive phenotyping of genetically or environmentally modifiedplant systems Plant Cell 13 11ndash29
Roessner U Patterson JH Forbes MG Fincher GB Langridge Pand Bacic A (2006) An investigation of boron toxicity in barley usingmetabolomics Plant Physiol 142 1087ndash1101
Rychter AM and Randall DD (1994) The effect of phosphate deficiencyon carbohydrate metabolism in bean roots Physiol Plant 91 383ndash388
Schachtman DP Reid RJ and Ayling SM (1998) Phosphorus uptakeby plants from soil to cell Plant Physiol 116 447ndash453
Shih CY and Kao CH (1996) Growth inhibition in suspension-culturedrice cells under phosphate deprivation is mediated through putrescineaccumulation Plant Physiol 111 721ndash724
Uhde-Stone C Zinn KE Ramirez-Yanez M Li AG Vance CP andAllan DL (2003) Nylon filter arrays reveal differential gene expressionin proteoid roots of white lupin in response to phosphorus deficiencyPlant Physiol 131 1064ndash1079
Vance CP Uhde-Stone C and Allan DL (2003) Phosphorus acquisitionand use critical adaptations by plants for securing a non renewableresource New Phytol 157 423ndash447
Vandesompele J De Preter K Pattyn F Poppe B Van Roy NDe Paepe A and Speleman F (2002) Accurate normalization of real-time quantitative RTPCR data by geometric averaging of multipleinternal control genes Genome Biol 3 1ndash11
Wasaki J Yonetani R Kuroda S Shinano T Yazaki J et al (2003a)Transcriptomic analysis of metabolic changes by phosphorus stress in riceplant roots Plant Cell Environ 26 1515ndash1523
Wasaki J Yonetani R Shinano T Kai M and Osaki M (2003b)Expression of the OsPI1 gene cloned from rice roots using cDNAmicroarray rapidly responds to phosphorus status New Phytol 158239ndash248
Wingler A Lea PJ Quick WP and Leegood RC (2000)Photorespiration metabolic pathways and their role in stress protectionPhilos Trans R Soc B Biol Sci 355 1517ndash1529
Wu P Ma L Hou X Wang M Wu Y Liu F and Deng XW (2003)Phosphate starvation triggers distinct alterations of genome expression inArabidopsis roots and leaves Plant Physiol 132 1260ndash1271
Zarcinas BA Cartwright B and Spouncer LR (1987) Nitric aciddigestion and multi-element analysis of plant material by induc-tively coupled plasma spectrometry Commun Soil Sci Plant Anal 18131ndash146
(Received February 21 2008 Accepted March 13 2008)
Metabolite profiles in P-deficient barley plants 703
Hewitt MM Carr JM Williamson CL and Slocum RD (2005)Effects of phosphate limitation on expression of genes involved in
pyrimidine synthesis and salvaging in Arabidopsis Plant Physiol
Biochem 43 91ndash99Hirai MY Yano M Goodenowe DB Kanaya S Kimura T
Awazuhara M Arita M Fujiwara T and Saito K (2004) Integration
of transcriptomics and metabolomics for understanding of global
responses to nutritional stresses in Arabidopsis thaliana Proc Natl
Acad Sci USA 101 10205ndash10210Hou XL Wu P Jiao FC Jia QJ Chen HM Yu J Song XW
and Yi KK (2005) Regulation of the expression of OsIPS1 and OsIPS2in rice via systemic and local Pi signaling and hormones Plant Cell
Environ 28 353ndash364Jeschke WD Kirkby EA Peuke AD Pate JS and Hartung W
(1997) Effects of P deficiency on assimilation and transport of nitrate andphosphate in intact plants of castor bean (Ricinus communis L) J Exp
Bot 48 75ndash91Kaplan F and Guy CL (2004) Beta-amylase induction and the protective
role of maltose during temperature shock Plant Physiol 135 1674ndash1684Kondracka A and Rychter AM (1997) The role of Pi recycling processes
during photosynthesis in phosphate-deficient bean plants J Exp Bot 48
1461ndash1468Kopka J (2006) Current challenges and developments in GC-MS based
metabolite profiling technology J Biotechnol 124 312ndash322Li K Xu C Zhang K Yang A and Zhang J (2007) Proteomic
analysis of roots growth and metabolic changes under phosphorus deficitin maize (Zea mays L) plants Proteomics 7 1501ndash1512
Liu CM Muchhal US and Raghothama KG (1997) Differential
expression of TPS11 a phosphate starvation-induced gene in tomatoPlant Mol Biol 33 867ndash874
Martin AC del Pozo JC Inglesias J Rubio V Solano Rde la Pena A Leyva A and Paz-Ares J (2000) Influence of cytokinins
on the expression of phosphate starvation responsive genes inArabidopsis Plant J 24 559ndash567
Mimura T (1999) Regulation of phosphate transport and homeostasis inplant cells Int Rev Cytol Cell Biol 191 149ndash200
Misson J Raghothama KG Jain A Jouhet J Block MA et al
(2005) A genome-wide transcriptional analysis using Arabidopsis thaliana
Affymetrix gene chips determined plant responses to phosphate depriva-
tion Proc Natl Acad Sci USA 102 11934ndash11939Morcuende R Bari R Gibon Y Zheng WM Pant BD Blasing O
Usadel B Czechowski T Udvardi MK Stitt M and Scheible WR(2007) Genome-wide reprogramming of metabolism and regulatory
networks of Arabidopsis in response to phosphorus Plant Cell Environ
30 85ndash112Muchhal US and Raghothama KG (1999) Transcriptional regulation of
plant phosphate transporters Proc Natl Acad Sci USA 96 5868ndash72Nanamori M Shinano T Wasaki J Yamamura T Rao IM and
Osaki M (2004) Low phosphorus tolerance mechanisms phosphorus
recycling and photosynthate partitioning in the tropical forage grassBrachiaria hybrid cultivar mulato compared with rice Plant Cell Environ
45 460ndash469Neumann G and Romheld V (1999) Root excretion of carboxylic acids
and protons in phosphorus-deficient plants Plant Soil 211 121ndash130Nikiforova VJ Gakiere B Kempa S Adamik M Willmitzer L
Hesse H and Hoefgen R (2004) Towards dissecting nutrient
metabolism in plants a systems biology case study on sulphur
metabolism J Exp Bot 55 1861ndash1870Nikiforova VJ Kopka J Tolstikov V Fiehn O Hopkins L
Hawkesford MJ Hesse H and Hoefgen R (2005) Systems rebalan-
cing of metabolism in response to sulfur deprivation as revealed bymetabolome analysis of Arabidopsis plants Plant Physiol 138 304ndash318
Nilsson L Muller R and Nielsen TH (2007) Increased expression of theMYB-related transcription factor PHR1 leads to enhanced phosphate
uptake in Arabidopsis thaliana Plant Cell Environ 30 1499ndash1512
Panikulangara TJ Eggers-Schumacher G Wunderlich M Stransky Hand Schoffl F (2004) Galactinol synthase 1 A novel heat shock factortarget gene responsible for heat-induced synthesis of raffinose familyoligosaccharides in Arabidopsis Plant Physiol 136 3148ndash3158
Pearse SJ Veneklaas EJ Cawthray G Bolland MDA andLambers H (2006) Triticum aestivum shows a greater biomass responseto a supply of aluminium phosphate than Lupinus albus despite releasingfewer carboxylates into the rhizosphere New Phytol 169 515ndash524
Plaxton WC (2004) Plant response to stress biochemical adaptations tophosphate deficiency In Encyclopedia of Plant and Crop Science Editedby Goodman R pp 976ndash980 Marcel Dekker Inc New York
Plaxton WC and Carswell MC (1999) Metabolic aspects of thephosphate starvation response in plants In Plant Response toEnvironmental Stresses From Photohormones to GenomeReorganization Edited by Lerner HR pp 349ndash372 Marcel DekkerInc New York
Rae AL Cybinski DH Jarmey JM and Smith FW (2003)Characterization of two phosphate transporters from barley evidencefor diverse function and kinetic properties among members of the Pht1family Plant Mol Biol 53 27ndash36
Raghothama KG (1999) Phosphate acquisition Annu Rev Plant PhysiolPlant Mol Biol 50 665ndash693
Reuter DJ and Robinson JB (1997) Plant Analysis An InterpretationManual 2nd edn pp 86ndash92 CSIRO Australia Melbourne
Roessner U Luedemann A Brust D Fiehn O Linke TWillmitzer L and Fernie AR (2001) Metabolic profiling allowscomprehensive phenotyping of genetically or environmentally modifiedplant systems Plant Cell 13 11ndash29
Roessner U Patterson JH Forbes MG Fincher GB Langridge Pand Bacic A (2006) An investigation of boron toxicity in barley usingmetabolomics Plant Physiol 142 1087ndash1101
Rychter AM and Randall DD (1994) The effect of phosphate deficiencyon carbohydrate metabolism in bean roots Physiol Plant 91 383ndash388
Schachtman DP Reid RJ and Ayling SM (1998) Phosphorus uptakeby plants from soil to cell Plant Physiol 116 447ndash453
Shih CY and Kao CH (1996) Growth inhibition in suspension-culturedrice cells under phosphate deprivation is mediated through putrescineaccumulation Plant Physiol 111 721ndash724
Uhde-Stone C Zinn KE Ramirez-Yanez M Li AG Vance CP andAllan DL (2003) Nylon filter arrays reveal differential gene expressionin proteoid roots of white lupin in response to phosphorus deficiencyPlant Physiol 131 1064ndash1079
Vance CP Uhde-Stone C and Allan DL (2003) Phosphorus acquisitionand use critical adaptations by plants for securing a non renewableresource New Phytol 157 423ndash447
Vandesompele J De Preter K Pattyn F Poppe B Van Roy NDe Paepe A and Speleman F (2002) Accurate normalization of real-time quantitative RTPCR data by geometric averaging of multipleinternal control genes Genome Biol 3 1ndash11
Wasaki J Yonetani R Kuroda S Shinano T Yazaki J et al (2003a)Transcriptomic analysis of metabolic changes by phosphorus stress in riceplant roots Plant Cell Environ 26 1515ndash1523
Wasaki J Yonetani R Shinano T Kai M and Osaki M (2003b)Expression of the OsPI1 gene cloned from rice roots using cDNAmicroarray rapidly responds to phosphorus status New Phytol 158239ndash248
Wingler A Lea PJ Quick WP and Leegood RC (2000)Photorespiration metabolic pathways and their role in stress protectionPhilos Trans R Soc B Biol Sci 355 1517ndash1529
Wu P Ma L Hou X Wang M Wu Y Liu F and Deng XW (2003)Phosphate starvation triggers distinct alterations of genome expression inArabidopsis roots and leaves Plant Physiol 132 1260ndash1271
Zarcinas BA Cartwright B and Spouncer LR (1987) Nitric aciddigestion and multi-element analysis of plant material by induc-tively coupled plasma spectrometry Commun Soil Sci Plant Anal 18131ndash146
(Received February 21 2008 Accepted March 13 2008)
Metabolite profiles in P-deficient barley plants 703
Top Related