V-gene amplification revisited – An optimised procedure for amplification of rearranged human...

Research

Pap

er

RESEARCH PAPER New Biotechnology � Volume 27, Number 2 �May 2010

V-gene amplification revisited – Anoptimised procedure for amplification ofrearranged human antibody genes ofdifferent isotypesTheam Soon Lim1,2,3, Svetlana Mollova1,4, Florian Rubelt1,2, Volker Sievert1,Stefan Dubel4, Hans Lehrach1 and Zoltan Konthur1

1Max Planck Institute for Molecular Genetics, Department of Vertebrate Genomics, Ihnestrasse 73, 14195 Berlin, Germany2 Free University Berlin, Faculty of Biology, Chemistry and Pharmacy, Takustrasse 3, 14195 Berlin, Germany3 Institute for Research in Molecular Medicine, Universiti Sains Malaysia, 11800 Penang, Malaysia4 Technical University Braunschweig, Institute for Biochemistry and Biotechnology, Department of Biotechnology, Spielmannstrasse 7, 38106 Braunschweig,

Germany

For studying human antibody variable (V)-gene usage in any group of individuals or for the generation of

recombinant human antibody libraries for phage display, quality and yield of the amplified V-gene

repertoire is of utmost importance. Key parameters affecting the amplification of full antibody repertoires

are V-gene specific primer design, complementary DNA (cDNA) synthesis from total RNA extracts of

peripheral blood mononuclear cells (PBMCs) and ultimately the polymerase chain reaction (PCR). In this

work we analysed all these factors; we performed a detailed bioinformatic analysis of V-gene specific

primers based on VBASE2 and evaluated the influence of different commercially available reverse

transcriptases on cDNA synthesis and polymerases on PCR efficiency. The primers presented cover near to

100% of all functional and putatively functional V-genes in VBASE2 and the final protocol presents an

optimised combination of commercial enzymes and reaction additives for cDNA synthesis and PCR

conditions for V-gene amplification. Finally, applying this protocol in combination with different

immunoglobulin (Ig) chain specific reverse primers we were able to amplify rearranged antibody genes of

different isotypes under investigation.

IntroductionThe complexity of the rearranged human antibody repertoire is

composed by the various V-genes and isotypes present in nature.

To obtain a fully functional and specific antibody to any given

target, the antibodies are going through a complex process of

diversification of antigen recognition sites, which is attributed

to several combinatorial mixing processes of the V-gene repertoire

in vivo. These involve the primary somatic recombination of the

variable (V), diversity (D) and joining (J) segments, as well as

somatic hypermutation and affinity maturation [1]. The potency

of the natural repertoire of antibodies is further increased by class-

switching of the heavy chain, whereby the B cells start producing

different immunoglobulin isotypes (IgA, IgD, IgE, IgG or IgM) with

Corresponding author: Konthur, Z. ([email protected])

108 www.elsevier.com/locate/nbt 1871-6784/$

different effector functions – required to effectively eliminate an

antigen.

VBASE2 is a database of human and mouse immunoglobulin V-

gene germ-line sequences containing a total of 576 human heavy

and light chain V-genes annotated up to date [2,3]. It offers the

possibility to obtain details about the V-genes, such as nucleotide

and amino acid sequences, as well as functionality and evidence of

the genes. To be able to perform comprehensive investigations into

the V-gene usage in any group of individuals, as many as possible of

all V-genes should be considered [4–7]. Efficient amplification of all

V-genes simultaneously with a set of primers would ease this task

considerably; however the accuracy of amplification should be

maximal without skewing the representation of individual V-genes.

In addition, its application would simplify the process of template

preparation for making combinatorial antibody libraries, such as

- see front matter � 2010 Elsevier B.V. All rights reserved. doi:10.1016/j.nbt.2010.01.001

mailto:[email protected]

http://dx.doi.org/10.1016/j.nbt.2010.01.001

New

Biotechnology�Volume27,N

umber

2�M

ay2010

RESEARCH

PAPER

TABLE 1

Bioinformatic analysis of oligonucleotides for amplification of V-genes based on family assigned genes from VBASE2

Family No. of covered(not covered)genes

Primer Primer sequence Folddegeneracy

Mismatches#

0 0 [%] 1 1 [%] 2 2 [%] 3 3 [%] 4 4 [%]

Variable Heavy ChainVH1 43 (1*) VH1 CAGGTCCAGCTKGTRCAGTCTGG 4 4 9.3 1 2.3 5 11.6

VH157 CAGGTGCAGCTGGTGSARTCTGG 4 16 37.2 3 7.0 4 9.3

VH1 & VH157 7 16.3 1 2.3 2 4.7

VH2 10 VH2 CAGRTCACCTTGAAGGAGTCTG 2 7 70 3 30

VH3 130 (5*) VH3 GAGGTGCAGCTGKTGGAGWCY 8 81 62.3 27 20.8 15 11.5 6 4.6 1 0.8

VH4 31 VH4 CAGGTGCAGCTGCAGGAGTCSG 2 21 67.7 6 19.4 1 3.2VH4-DP63 CAGGTGCAGCTACAGCAGTGGG 1 2 6.5 1 3.2

VH5 4 VH157 4 2 50 2 50

VH6 2 VH6 CAGGTACAGCTGCAGCAGTCA 1 2 100

VH7 6 VH157 4 5 83.3 1 16. 7

Variable Light Kappa ChainVK1 61 (6*) VK1 GACATCCRGDTGACCCAGTCTCC 6 45 73.8 12 19.7 2 3.3 2 3.3

VK2 29 (10*) VK246 GATATTGTGMTGACBCAGWCTCC 12 15 51.7 7 24.1 2 6.9 4 13.8 1 3.4

VK3 21 (4*) VK3 GAAATTGTRWTGACRCAGTCTCC 8 17 81.0 2 9.5 1 4.8 1 4.8

VK4 1 VK246 12 1 100

VK5 1 VK5 GAAACGACACTCACGCAGTCTC 1 1 100

VK6 4 VK246 12 3 75 1 25

Variable Light Lambda ChainVl1 13 (1*) Vl1 CAGTCTGTSBTGACGCAGCCGCC 6 7 53.8

Vl1459 CAGCCTGTGCTGACTCARYC 4

Vl15910 CAGCCWGKGCTGACTCAGCCMCC 8

Vl1459 & Vl15910 6 46.2

Vl2 18 Vl2 CAGTCTGYYCTGAYTCAGCCT 8 16 88.9 2 11.1Vl3 22 (1*) Vl3 TCCTATGWGCTGACWCAGCCAA 4 6 27.3

Vl3-DPl16 TCCTCTGAGCTGASTCAGGASCC 4 2 9.1 1 4.6

Vl3-38 TCCTATGAGCTGAYRCAGCYACC 8 8 36.4 1 4.5

Vl3 & Vl3-38 2 9.1 1 4.6 1 4.6

Vl4 4 Vl1459 4 1 25 2 50 1 25

Vl5 11 Vl1459 4 5 45.5 4 36.4 1 9.1

Vl15910 8

Vl1459 & Vl15910 1 9.1

Vl6 6 Vl6 AATTTTATGCTGACTCAGCCCC 1 5 83.3 1 16.7

Vl7 5 Vl78 CAGDCTGTGGTGACYCAGGAGCC 6 4 80 1 20

www.else

vier.co

m/lo

cate/nbt

109

Research Paper

RESEARCH PAPER New Biotechnology � Volume 27, Number 2 �May 2010TA

BLE1(Continued

)

Fam

ily

No

.o

fco

vere

d(n

ot

covere

d)

gen

es

Pri

mer

Pri

mer

seq

uen

ceFo

ldd

eg

en

era

cyM

ism

atc

hes#

00

[%]

11

[%]

22

[%]

33

[%]

44

[%]

Vl8

5Vl78

65

100

Vl9

2Vl1459

4

Vl15910

8

Vl1459&Vl15910

2100

Vl10

2Vl15910

82

100

#Number

andpercentageofg

eneswiththedefi

nedmismatch

number,consideringonlythecoveredgen

es.*Gen

esnotcoveredbytheprimers:

VH

1:humIGHV140;V

H3:humIGHV120,humIGHV144,humIGHV147,humIGHV218,humIGHV318;

VK

1:humIGKV057,humIGKV058,humIGKV064,humIGKV111,humIGKV118,humIGKV200;V

K2:humIGKV038,humIGKV039,humIGKV042,humIGKV076,humIGKV100,humIGKV132,humIGKV138,humIGKV178,humIGKV195,humIGKV197;

VK

3:humIGKV119,humIGKV122,humIGKV176,humIGKV194;V

l1:humIGLV163;V

l3:humIGLV171.

110 www.elsevier.com/locate/nbt

Research

Pap

er

used in phage display or ribosome display. A good coverage of V-

genes is beneficial when generating antibody libraries for phage

display to ensure the retrieval of diverse set of binding antibodies

during selection.

Multiple PCR primers are required to amplify entire V-gene

repertoires. Primers specific for human [8–10], mice [11,12], rat

[11,13] and chicken [14] V-genes have been reported. However, the

complexity of V-gene amplification is multifaceted by the fact that

different sets of reverse primers need to be used for cloning and

retrieval of only variable domains of all Ig-classes or variable

domains with specific isotype information.

The generation of human antibodies was made possible with the

advent of recombinant DNA and in particular the development of

the polymerase chain reaction technology. The effectiveness of PCR

as a powerful technique for in vitroamplification of genetic materials

is undisputable [15] and credited to the specificity, efficiency and

fidelity of the reaction. Amplification efficiency is the most impor-

tant parameter as it influences the product yield [16].

In addition to reassessing primer design for human V-gene

amplification, we therefore investigated two crucial parameters

influencing the amplification of DNA in PCR: the generation of

template cDNA by different reverse transcriptases (RTases) and the

efficiency of DNA amplification during PCR by different poly-

merases. We assessed two commercial RTases for transcribing total

RNA using a combination of oligo(dT) and random hexamer

primers, as well as gene-specific cDNA synthesis using an IgD-

hinge specific primer. A standardised PCR assay using a test panel

of V-gene and isotype-specific primer combinations was used to

evaluate the different cDNA preparations and to study the influ-

ence of different DNA polymerases on the amplification using the

most optimised conditions for all primer pairs. Additionally, the

effect of a number of PCR additives on product yield was analysed.

The final protocol was then tested on different heavy and light

chain isotypes (IgD, IgG, kappa and lambda) using a set of different

V-gene specific primers in combination with Ig-class specific

reverse primers. The goal was to develop a standard protocol for

amplifying different heavy and light chain isotypes simulta-

neously, which is able to yield sufficient products for any down-

stream application, such as V-gene usage profiling or antibody

library generation. Hence, we are able to present a ‘‘2.0’’-version of

antibody amplification, which incorporates the latest progress in

terms of sequence base and materials available.

MethodsBioinformatic analysisAll human Ig V-gene sequences were retrieved from the VBASE2

database. Thereafter, primer sequences (Table 1) were aligned to

the V-gene sequences using the AlignX1 Module for Vector NTI

AdvanceTM 10 (Invitrogen, Karlsruhe, Germany). For the mis-

match analysis, a gene is only considered to be covered by a

primer, if the maximum number of nucleotide mismatches does

not exceed a count of four and if the covered region has a length of

18 bp or more. Based on this information, the coverage of the

primers was calculated.

Sample preparation and RNA isolationPBMCs were separated from peripheral blood of adult donors in

Vacutainer1 EDTA tubes (BD Biosciences, Heidelberg, Germany)

New Biotechnology �Volume 27, Number 2 �May 2010 RESEARCH PAPER

ResearchPap

er

within 10 min after blood drawing by density gradient separation.

In detail, 15 ml of Biocoll (Biochrom AG, Berlin, Germany) separ-

ating solution was put in a 50 ml tube and 10 ml of EDTA-blood

was added above the Biocoll separating solution. After centrifuga-

tion for 15 min at 1800 rpm (652 rcf) the cell cloud was carefully

removed with a pipette and placed in a fresh 50 ml Falcon tube.

Sterile phosphate buffered saline was added up to a final volume of

50 ml and cells were centrifuged for 10 min at 1200 rpm. The

supernatant was discarded and the cell pellet was resuspended

in RTL buffer for RNA isolation using the RNeasy kit from Qiagen

(Hilden, Germany). RNA isolation was according to the supplied

protocol. The RNA quality and concentration was determined

using a RNA 6000 NanoChip1 with an Agilent 2100 Bioanalyzer

(Agilent, Waldbronn, Germany). From all individuals included in

this study informed consent was obtained.

First strand cDNA synthesisBefore proceeding to reverse transcription (RT) 1 mg of RNA per

sample was treated with deoxyribonuclease (DNase; Sigma–

Aldrich, Munich, Germany) for 15 min at room temperature (rt)

followed by heat inactivation of the DNase at 70 8C for 10 min.

Using always the same batch of total RNA, two different RTases

were evaluated in parallel; SuperScript1 II (Invitrogen) and total-

script-OLS1 (Omni Life Science, Hamburg, Germany). Total

cDNA preparation was performed using oligo(dT)12–18 primer

and random primers together (Invitrogen). IgD-specific cDNA

was prepared according to the protocol for gene-specific primer

transcription provided by the manufacturer using the IgD-

Hinge-Rv primer (GGTTAGCAGGTAGACGCCAAGAGGC), which

matches the last 25 nucleotides of the IgD hinge messenger RNA

(mRNA). All RT reactions were carried out according to the man-

ufacturer’s recommendation containing equal amounts of total

RNA (400 ng) as starting material. Total cDNA was used for the

amplification of all Ig isotypes evaluated in this study, except for

IgD, where IgD-specific cDNA was used.

Amplification of rearranged human antibody fragments by PCRTotal cDNA or isotype-specific cDNA preparations were used as

template for V-gene amplification. The forward primers corre-

spond to the first amino acid-coding nucleotides of the V-gene

mRNA (Table 1). The reverse primer is either located at the end of

the light chain constant region (Kappa CL-rv: ACACTCT-

CCCCTGTTGAAGCTCTT, Lambda CL1-rv: CTATGAACATTCTG-

TAGGGGCCACTG Lambda CL2-rv: CTATGAACATTCCGT-

AGGGGCAACTG) or placed in the CH1 region of the heavy chain

(IgD CH1-rv: AGATCTCCTTCTTACTCTTGCTG, IgG CH1-rv:

ACTCTCTTGTCCACCTTGGTGTTGC). Lambda-specific primers

were used together at equimolar concentration. All primers used

were obtained from Invitrogen.

The final volume for all PCR reactions was 20 ml containing

0.4 ml of cDNA, 200 mM of dNTPs (Invitrogen), 0.2 mM of forward

and reverse primers. The amount of polymerase used was varied

according to the recommended units of the supplier: REDTaq1

(1.0 ml of 1 U/ml) from Sigma–Aldrich, BIO-X-ACT1 Short (0.4 ml

of 4 U/ml) from Bioline (Luckenwalde, Germany) and Phusion1

(0.2 ml of 2 U/ml) from New England Biolabs (Frankfurt, Germany).

All reactions were carried out using a MJ Research PCT-200 PCR

machine. After heating at 95 8C for 45 s we performed 35 cycles

(95 8C for 30 s, 58 8C for 30 s and 72 8C for 30 s) and ended after

5 min at 72 8C.

Optimisation of PCR amplification by MgCl2 titrationMgCl2 concentration for polymerase optimisation was performed

by increasing each manufacturer’s recommended final MgCl2concentrations by 0.25 mM, 0.5 mM and 1.0 mM, respectively.

The manufacturer’s recommendations are as follows: REDTaq

1.1 mM, BIO-X-ACT 1.0 mM, and Phusion 1.5 mM.

Optimisation of PCR amplification by the addition of extremethermostable single-strand DNA binding protein (ET SSB)Where applied, 0.2 ml of ET SSB (500 mg/ml) from New England

Biolabs was added to each 20 ml PCR reaction. Supplied reaction

buffers were added according to the manufacturer’s information.

Electrophoresis of DNA ampliconsFor analysis, 20 ml of each PCR reaction was analyzed in duplicate

(10 ml/lane) on a 1.2% agarose gel and stained with ethidium

bromide. As a standard we used 4 ml of the GeneRulerTM 100 bp

Plus DNA marker (0.5 mg DNA) from Fermentas (St. Leon-Rot,

Germany).

Semi-quantitative analysis of PCR performanceGels were photographed using a gel documentation station (Gel

Doc 2000, Bio-Rad, Munich, Germany) and specific amplification

bands were quantified using AIDA1 image analyzer software 4.10

(Raytest, Straubenhardt, Germany). All gel images were analyzed

using the 1D evaluation tool with a fixed lane width of 18 pixels.

The band intensities were normalised using the 500 bp lane of the

DNA ladder loaded at constant concentration for all gels.

Results and discussionBioinformatic analysis of V-gene specific primersMost humanV-gene specific primers applied todatearebased onthe

germ-line sequences present in V BASE [17]. This manually com-

piled database of all known human immunoglobulin V-genes at the

time was developed more than a decade ago (last update 1997) at the

MRC Centre for Protein Engineering in Cambridge UK. In 1998,

Sblattero and Bradbury compiled a minimal set of primers for V-

gene amplification [10], using V BASE. At that time, 349 genes have

been known, but knowledge of Ig-genes increased since, and in

VBASE2 [3] 65% more sequences are recorded. This raises the ques-

tion whether these primers still cover all known genes adequately.

Primers were re-analysed using the collection of all 576 available

human V-gene sequences from the VBASE2. This database is reg-

ularly updated and incorporates sequence information from gen-

ome sequencing projects included in EMBL-Bank/GenBank/DDBJ

[18] and Ensembl [19] as well as it additionally integrates the

information of existing immunoglobulin sequence databases such

as the VBASE, the last publicly available version of Kabat database

[20] and the IMGT/LIGM database [21,22]. V-gene sequences of the

individual families were aligned and the first N-terminal protein-

codingnucleotideswere compared with the primer sequences. If the

primer shows four or less mismatches when compared to the

reference V-gene sequence with a covered gene region of more than

18 bp in length, the gene is regarded as covered. Some primers show

a certain degree of degeneracy at individual positions. Therefore,

www.elsevier.com/locate/nbt 111


TABLE 2

Bioinformatic analysis of oligonucleotides for amplification of V-genes based on non-assigned genes from VBASE2

Genes with nofamily assigned

No. of covered(not covered)genes

Primer§ FoldDegeneracy

Mismatches#

0 0 [%] 1 1 [%] 2 2 [%] 3 3 [%] 4 4 [%]

Variable Heavy Chain22 (18*) VH1 4 4 18.2

VH157 4 1 4.5 2 9.1

VH3 8 6 27.3 2 9.1

VH4 2 1 4.5VH1 & VH157 1 4.5

VH1, VH3 & VH157 5 22.7

Variable Light Kappa Chain25 (6*) VK1 6 5 20 4 16 2 8 3 12

VK246 12 1 4 2 8 3 12

VK3 8 4 16 1 4

Variable Light Lambda Chain36 (10*) Vl1 6 1 2.8

Vl1459 4 5 13.9 3 8.3 3 8.3 1 2.8

Vl15910 8 2 5.6

Vl1, Vl1459 & Vl15910 1 2.8

Vl2 8 2 5.6Vl3 4 1 2.8

Vl3-DPl16 4 1 2.8 1 2.8 2 5.6

Vl3-38 8 3 8.3Vl3 & Vl3-38 1 2.8 6 16.7

Vl78 6 3 8.3

§ Primer sequences can be found in Table 1.# Number and percentage of genes with the defined mismatch number, considering only the covered genes.*Genes not covered by the primers:VH: humIGHV075, humIGHV091,

humIGHV113, humIGHV156, humIGHV160, humIGHV166, humIGHV177, humIGHV180, humIGHV191, humIGHV205, humIGHV224, humIGHV235, humIGHV243, humIGHV254,

humIGHV265, humIGHV276, humIGHV283, humIGHV302;VK: humIGKV020, humIGKV112, humIGKV114, humIGKV117, humIGKV142, humIGKV153; Vl: humIGLV030, humIGLV084,

humIGLV092, humIGLV114, humIGLV123, humIGLV126, humIGLV132, humIGLV133, humIGLV138, humIGLV158.

Research

Pap

er

some primers match more than one V-gene family and some V-

genes are matched by more than one primer. In such a case, each V-

gene is scored only once per family and only with the best primer,

i.e. the primer with the lowest degree of mismatches. For ease of use,

primers were finally re-named corresponding to the V-gene families

they target according to our coverage criteria. Table 1 shows the

individual analysis result for each primer with family assigned

genes. The total number of genes in any given V-gene family, the

oligonucleotide sequence and fold degeneracy of the primer and the

number of genes with 0–4 mismatches relative to the primer

sequence respectively is given. The percentages of mismatches for

the sequences are also displayed.

In total, 459 out of the 576 V-genes in VBASE2 are family

assigned, of which 431 (93.9%) are covered by Sblattero and

Bradbury’s primer set in Table 1. The remaining 117 sequences

in VBASE2 are not assigned to any V-gene family and their analysis

with the given set of primers is presented in Table 2. In this set, the

coverage is considerably lower – only 83 (70.1%) out of 117 are

covered. This analysis suggests that most primers were designed

using family assigned sequences as reference and were optimised

for amplification of functional genes corresponding to Class 1 V-

genes in VBASE2, since only one gene of this class is not covered.

Hence, altogether 514 (89.2%) of all 576 human V-genes in

VBASE2 are covered with the previously published primers [10].

However, VBASE2 offers additionally to gene family assignment

the possibility to classify the V-gene sequences according to their

functionality: Class 1 V-genes have references for both genomic

and rearranged sequences; Class 2 V-genes are based solely on


genomic source information, so this class holds V-genes without

proof of usage, as well as pseudogenes (e.g. genes including stop

codons) and orphans (genes allocated to different loci); Class 3 V-

genes are supported only by rearranged sequences [2].

According to this information, 321 of the 576 V-genes are

functional or putatively functional, omitting only pseudogenes

and orphans (208 and 47, respectively). When applying the primer

set to all functional and putatively functional V-genes, the cover-

age is 94.1% and 19 V-genes are not covered. We analysed these V-

genes and designed additional four primers, which cover one Class

1 and 11 Class 2 V-genes, equivalent of 63.2% of non-covered

genes (Table 3). Basic requirement of the new primers (except for

the one Class 1 V-gene) was to cover a minimum of three addi-

tional V-genes.

Altogether, the extended primer set now covers 100% of all

Class 1 V-genes and 97.8% of all functional or putatively func-

tional V-genes, with an emphasis on improved Class 2 V-gene

coverage. Notably the coverage of all human VBASE2 entries

increases to 527 (91.5%) of the 576 V-genes and comprises 213

(83.5%) of all 255 pseudogenes and orphans. The extended primer

set will allow to investigate if the additionally covered genes – for

which only genomic references exist according to VBASE2 assem-

bly criteria – are used in the V(D)J recombination process or

possibly even in gene conversion [23,24]. This is particularly useful

in the light of V-gene usage studies, where as many genes as

possible should be evaluated. The detailed analysis of V-gene

coverage by the initial as well as extended oligonucleotide primer

sets is summarised in Suppl. Table 1.


TABLE 3

Bioinformatic analysis of new oligonucleotides for amplification of additional functional or putatively functional V-genes from VBASE2

Family Primer Primer Sequence Fold Degeneracy No. of target genes

Variable Heavy ChainVH3 VH3N TCAACACAACGGTTCCCAGTTA 1 1

Variable Light Kappa ChainVK2 VK2N1 AGATGCTGTGTGAMCCAGCCTC 2 4

VK2N2 TCCCTCCAAGTTCACATCCTGAG 1 5

Variable Light Lambda ChainNot Assigned VlNA GTCCAGTTCCTCTATTATGRTAG 2 3*

* One of the covered genes is a pseudogene.

FIGURE 1

Evaluation of IgD isotype specific cDNA synthesis and RT efficiency by PCR.IgD-specific (a) and IgG-specific (b) primer pair amplification is shown in

duplicates. Template cDNA was derived from parallel RT reactions using

SuperScript II and totalscript-OLS. PCR amplification was carried out withVH157 forward primer in combination with IgD CH1-Rv or IgG CH1-Rv

primers, respectively. Expected band sizes range from 650 to 700 bp.

ResearchPap

er

To investigate whether our classification of V-gene coverage

with the primer set holds, we analysed �1000 sequences of ampli-

cons using all VH-primers together with a IgG-CH1 specific reverse

primer on a pool of total cDNA with Superscript II from PBMCs of 5

donors by pyrosequencing (Genome Sequencer FLX System,

Roche Diagnostics GmbH, Mannheim, Germany). According to

VBASE2 DNAPLOT-queries, this sequence collection already cov-

ers 85% (52 from a total of 61) Class 1 V-genes, and 41% (84 out of a

total of 206) Class 2 V-genes. Because all amplicons were obtained

from PBMCs and were of the IgG isotype, all Class 2 V-genes

covered can be regarded as functional. Mature peripheral B cells

are only allowed to undergo class-switch and progress to this stage

when a productive rearrangement was achieved [25].

Evaluation of two different reverse transcriptases for cDNAsynthesisSynthesis of cDNA by reverse transcription (RT) of total RNA is a

decisive measure in obtaining cDNA material for gene expression

analysis as the RT should reflect the true mRNA population for the

transcripts of interest. The choice to use either gene-specific pri-

mers, oligo(dT), random hexamers or a combination of oligo(dT)

and random hexamers (in our case) for priming is a delicate issue.

RT efficiency depends on the priming strategy while the yield is

dependent on the RNA concentration [26]. Gene-specific priming

rather than random priming has been reported to show an increase

in sensitivity [27] and this is especially important in cDNA synth-

esis of transcripts with low abundance, as expected for some

rearranged immunoglobulin genes in the PBMC population. Con-

ventional protocols require the synthesis of the first strand cDNA

using MMLV reverse transcriptase that lacks RNase H activity [28].

In this study, we evaluated the commercially available Super-

Script1 II and totalscript-OLS1 RT kits in parallel to synthesise

total cDNA from the same RNA sample using a combination of

oligo(dT) and random hexamer primers. Additionally, RTases were

used to synthesise IgD-specific cDNA from the same human RNA

sample with a gene-specific primer that binds in the unique IgD

hinge region. Obtained cDNAs were employed as template in a

PCR reaction to evaluate V-gene specific amplification and possi-

ble primer cross talk. Amplification was carried out with two

primer-pair combinations of the same VH157 forward primer:

for the amplification of IgD-specific and IgG-specific transcripts

the IgD CH1-Rv and the IgG CH1-Rv reverse primers were taken,

respectively. The comparison of the PCR results in Fig. 1 demon-

strates that IgD-specific cDNA synthesis was highly specific. As

expected, IgD isotype specific PCR amplicons were seen in both

cDNA preparations. The IgG-specific primer pair, however, gave no

PCR amplification product and showed no cross talk on IgD-

specific cDNA leaving no doubt to the sensitivity of the primer

used for cDNA synthesis. The PCR results obtained from total

cDNA as template showed significant amplification with both

IgD-specific and IgG-specific primer combinations for SuperScript

II and low amplification for totalscript-OLS prepared cDNA. When

the PCR amplification yield on IgD-specific templates was com-

pared, in both cases amplicons were seen, but SuperScript II

prepared cDNA yielded slightly more amplification product. A

previous comparison of the RTases showed that although conver-

sion of RNA to cDNA of abundant transcript is equally efficient, the

same did not apply for low abundance transcripts. SuperScript II

has been shown to be more efficient with low transcript genes [29].

This is fully in concordance with our findings and holds also for V-

gene amplification. IgD-specific transcripts are low abundant in

RNA samples of PBMCs and as Fig. 1 shows, only weak signals are

obtained from the totalscript-OLS total cDNA as template com-

pared to SuperScript II converted RNA. A fine balance of the

amount of RNA and RTase used in RT reaction is important. Using

high amounts of RNA, the RTase could cause an overamplification

of certain transcripts, leading to misrepresentation of individual

transcript populations [30]. Further, a high ratio of RTase to RNA

template could lead to polymerase inhibition in downstream



FIGURE 2

Efficiency of three different polymerases for PCR amplification of rearranged antibody genes and MgCl2 optimisation of the reaction.

(A) IgD-specific PCR amplification of antibody genes with the polymerases REDTaq (i), BIO-X-ACT short (ii) and Phusion (iii). All samples were amplified using thedepicted forward primers in combination with the IgD CH1-Rv primer.

(B and C) MgCl2 titration for PCR efficiency enhancement of polymerases using forward primer VH157 or VH3, respectively in combination with the IgD CH1-Rv

primer. Manufacturer recommended MgCl2 concentrations (Normal) were increased by 0.25 mM, 0.5 mM and 1 mM (final con.) respectively. Expected band sizes

range from 650 to 700 bp. Donor template for A differs from B and C, resulting in apparent differences in V-gene usage.

Research

Pap

er

applications [31]. We used 400 ng total RNA for every RT reaction.

This is well within the recommended amount of RNA for use, and

indeed, we saw neither signs of PCR inhibition nor false amplifica-

tion. We conclude, that in our hands SuperScript II is the ideal

choice for the synthesis of cDNA for V-gene amplification with

ample yield and specificity.

Evaluation of different polymerases for PCR amplificationThere are several commercially available polymerases on the mar-

ket today. The choice of a polymerase, which is optimal for the

application at hand, is an enigma in most cases. Several factors

such as target length and sequence, primer design, buffer condi-

tions, sample impurities, cycling conditions and polymerases

influence the amplification efficiency [16,32]. Three commercially

available polymerases – REDTaq, BIO-X-ACT short and Phusion –

were examined for their efficiency to amplify V-genes. For each

enzyme, we have used the recommended buffers to obtain optimal

PCR conditions and used the supplier recommended units of

polymerases. Fig. 2A shows the PCR amplification results applying

all VH-specific forward primers in combination with the IgD

constant domain specific reverse primer. Poor amplification was

recorded for REDTaq polymerase while BIO-X-ACT short gave

amplicons for most primer combination, but with low yield.

Phusion gave the best amplification results of the three poly-


merases tested. The VH family pool (equimolar concentrations

of all VH forward primers) resulted in poor amplification indicat-

ing that primer mixtures decrease amplification yield significantly.

Attempts to improve the conditions by varying annealing tem-

peratures and by the addition of DMSO to the reaction mix did not

enhance amplification (result not shown). However, optimisation

of the PCR condition by modifying the MgCl2 concentration in the

reaction buffer showed improvement in the amplifications for

some polymerases. The manufacturer’s recommended concentra-

tion was increased by 0.25 mM, 0.5 mM and 1 mM MgCl2 (final

conc.), respectively. Fig. 2B,C depicts the amplification using two

different V-gene primers (VH157 and VH3) in combination with

the IgD CH1-rv reverse primer. Elevating the MgCl2 concentration

gave slightly more yield in amplicon for both REDTaq and BIO-X-

ACT polymerases. The addition of MgCl2 had no significant effect

on the performance of Phusion polymerase, which had the highest

overall amplification yield in this study. Phusion has high fidelity

if used at the recommended units but with lower units a drop in

the fidelity was observed [33]. In our comparison all three poly-

merases could be used for the amplification but with partially only

poor to moderate yield, even with optimised MgCl2 concentra-

tion. We conclude that Phusion is the enzyme of choice to amplify

all antibody V-genes of different Ig-classes using the same PCR

program for all primer pairs in a single run. It gave consistently


FIGURE 3

The effect of ET SSB on PCR amplification of rearranged antibody genes.PCR amplification results with or without the addition of ET SSB are shown for (A) an equimolar mixture of all V-gene forward primers (VH Pool) and (B) the singleprimer VH157. Bothwere used in combination with the IgD-specific reverse primer IgD CH1-Rv. Expected band sizes range from 650 to 700 bp. Template cDNAwas

derived from parallel RT reactions using SuperScript II and totalscript-OLS. Bar chart shows the relative intensities of the bands determined using AIDA softwareanalysis on the basis of the intensity of the 500 bp DNA fragment of the DNA ladder used. Sample orientation of bar chart is according to the cDNA sample

orientation as depicted.

ResearchPap

er

good results using standard conditions and demonstrated robust-

ness against fluctuations in reaction conditions (e.g. template or

MgCl2-concentration).

Effects of addition of extreme thermostable single-strand DNAbinding protein on PCR efficiencyFurther optimisation investigated the use of additives in the PCR

reaction mixture. Addition of DMSO to reduce DNA secondary

structures led to no improvement and therefore the influence of a

thermostable singe strand binding protein (ET SSB) on the PCR

reaction was assessed. SSB proteins destabilize DNA-complexes in

vivo to allow higher accessibility to single stranded DNA. They

enhance the fidelity of DNA synthesis, processivity of polymerases

and promote polymerase binding, and hence, augment PCR

amplification [34–37]. In Fig. 3, PCR amplification results with

or without the addition of ET SSB are shown for an equimolar pool

of all VH forward primers (VH Pool) and the single primer VH157,

both used in combination with the IgD-specific reverse primer IgD

CH1-Rv. Additionally, cDNA templates generated using either

SuperScript II or totalscript-OLS RTases were assessed. In the lower

panel the relative intensities by densitometric analysis are shown

as determined with the AIDA image analyzer software. Relative

concentrations are based on the intensity of the 500 bp fragment

from the DNA ladder, which was used at fixed amount. A signifi-

cant (up to 10-fold) increase in amplicon yield for both single and

pooled primers is seen in the ET SSB containing PCR samples and a

similar distribution pattern of yield was observed for multiplexed

as well as single primer combinations. The effects on cDNA acces-

sibility derived from different RTase were also recorded. Without

ET SSB, total cDNA derived from SuperScript II showed a major

advantage over totalscript-OLS with higher PCR yields. However,

in the presence of ET SSB, total cDNA synthesis for SuperScript II

and totalscript-OLS became comparable. The greatest positive

effect of ET SSB was seen when applying in combination with

totalscript-OLS synthesised cDNA preparations. We conclude that

the use of ET SSB is beneficial for V-gene amplifications and should

be adopted when amplifying diverse sets of antibody sequences

from cDNA in multiplexed and single PCR reactions equally.

Amplification of rearranged human antibody repertoires ofdifferent Ig-classesAmplification with the entire V-gene primer combinations for IgD,

IgG, Kappa and Lambda isotypes of single donors was assessed. The

optimised protocol uses cDNAs obtained by SuperScript II RTase as

template and Phusion polymerase with the addition of ET SSB for

efficient amplification in PCR. IgD-specific amplification was per-

formed on IgD-isotype specific cDNA, while all other analyses were

conducted on total cDNA derived from oligo(dT) and random

hexamer priming. Fig. 4 shows typical antibody V-gene amplifica-

tions of all four isotypes tested (IgD, IgG, Kappa and Lambda)

using a combination of V-gene specific forward primers and iso-

type-specific reverse primers in a single optimised and standar-



FIGURE 4

Full analysis of rearranged antibody genes.

Template cDNA was generated with SuperScript II RTase. PCR amplification

was carried out with depicted forward primers in combination with isotype-

specific reverse primers for IgD (a) IgG (b), Kappa (c) and Lambda (d) of asingle donor. Lambda isotypes were amplified using an equimolar mixture of

two reverse primers. Each sample is loaded in duplicate. Amplification of

rearranged antibody genes with the new forward primers is shown in (e) andwas derived from a different donor. Expected band sizes range from 650 to700 bp.

Research

Pap

er

dised PCR protocol. The variation seen in band intensities for the

antibody profiles is likely due to the V-gene usage preferences in

the analyzed individual. This preference is attributed to the high

diversity in antibody repertoires. The diversity is credited to the

antibody V-gene recombination processes [38] including receptor

editing and somatic hypermutation [23,39]. This is important as

antibodies of similar V-gene sequence but of different isotypes

have demonstrated differences in specificity [40]. Studies on


V-gene usage patterns have also been of interest to understand if a

certain V-gene or Ig-class is preferred, which could be related to the

cause of a certain condition. Hence the protocol could contribute

to current V-gene usage studies conducted for various diseases

such as systemic lupus erythematosus [41,42], Sjogren disease [43],

rheumatoid arthritis [5,44] and even leukaemia [45]. Further, the

ability to amplify significant amounts of V-gene cDNA from

various antibody isotypes could also have an advantage in recom-

binant antibody library generations [46–48].

ConclusionIn summary, we revisited all relevant steps for V-gene amplifica-

tion in detail and set up an optimised procedure for the amplifica-

tion of rearranged human antibody genes of different isotypes. The

extended primer set gives a diverse coverage of respective family

assigned and non-assigned V-genes, and covers near to 100% of all

functional and putatively functional V-genes. Obtaining an opti-

mised protocol included assessment of reverse transcriptases for

cDNA synthesis, as well as evaluation of polymerases and additives

for PCR amplification. The final protocol demonstrated to produce

isotype-specific cDNAs for Ig-class amplification and resulted in

high yields of PCR amplicons for rearranged human antibody

genes. Designing specific reverse primers, the protocol can be

adapted to amplify all Ig-classes separately, enabling analyses of

V-gene usage in rearranged antibody repertoires of different iso-

types in healthy or diseased individuals.

AcknowledgementsThe work was supported by the German Federal Ministry for

Education and Research (BMBF) through the National Genome

Research Network (NGFN-II) ‘‘Antibody Factory’’ (Grant No.

01GR0427) and the Max Planck Society. ZK and SD acknowledge

additional support from EU-FP6 CA ‘‘ProteomeBinders’’ (RICA.

026008). TSL acknowledges financial support from the Ministry of

Higher Education Malaysia and Institute for Research in Molecular

Medicine, University Science Malaysia.

Appendix A. Supplementary dataSupplementary data associated with this article can be found, in

the online version, at doi:10.1016/j.nbt.2010.01.001.

References

1 Maizels, N. (2005) Immunoglobulin gene diversification. Annu. Rev. Genet. 39, 23–

46

2 Retter, I. et al. (2005) VBASE2, an integrative V-gene database. Nucleic Acids Res. 33,

D671–D674

3 Anon., . http://www.vbase2.org/

4 Rojas, G. et al. (2005) Efficient construction of a highly useful phage-

displayed human antibody repertoire. Biochem. Biophys. Res. Commun. 336,

1207–1213

5 Foreman, A.L. et al. (2007) B cells in autoimmune diseases: insights from analyses

of immunoglobulin variable (Ig V) gene usage. Autoimmun Rev. 6, 387–401

6 Stollar, B.D. (1995) The expressed heavy chain V-gene repertoire of circulating B

cells in normal adults. Ann. N Y Acad. Sci. 764, 265–274

7 Stilgenbauer, S. and Dohner, H. (2004) Molecular genetics and its clinical

relevance. Hematol. Oncol. Clin. North Am. 18, 827–848

8 Welschof, M. et al. (1995) Amino acid sequence based PCR primers for

amplification of rearranged human heavy and light chain immunoglobulin

variable region genes. J. Immunol. Methods 179, 203–214

9 McCafferty, J. and Johnson, K.S. (1996) Construction and screening of antibody

display libraries. In Phage Display of Peptides and Proteins (Kay, B.K., Winter, J.,

McCafferty, J., eds), pp. 79–111, Academic Press

10 Sblattero, D. and Bradbury, A. (1998) A definitive set of oligonucleotide primers for

amplifying human V regions. Immunotechnology 3, 271–278

11 Dubel, S. et al. (1994) Isolation of IgG antibody Fv-DNA from various mouse and

rat by bridoma cell lines using the polymerase chain reaction with a simple set of

primers. J. Immunol. Methods 175, 89–95

12 Wang, Z. et al. (2000) Universal PCR amplification of mouse immunoglobulin gene

variable regions: the design of degenerate primers and an assessment of the effect

of DNA polymerase 30 to 50 exonuclease activity. J. Immunol. Methods 233, 167–177

13 Sepulveda, J. and Shoemaker, C.B. (2008) Design and testing of PCR primers for the

construction of scFv libraries representing the immunoglobulin repertoire of rats.

J. Immunol. Methods 332, 92–102

14 Davies, E.L. et al. (1995) Selection of specific phage-display antibodies using

libraries derived from chicken immunoglobulin genes. J. Immunol. Methods 186,

125–135

http://dx.doi.org/10.1016/j.nbt.2010.01.001

http://www.vbase2.org/


ResearchPap

er

15 Powledge, T.M. (2004) The polymerase chain reaction. Adv. Physiol. Educ. 28, 44–50

16 Arezi, B. et al. (2003) Amplification efficiency of thermostable DNA polymerases.

Anal. Biochem. 321, 226–235

17 Anon., . http://vbase.mrc-cpe.cam.ac.uk/

18 Kulikova, T. et al. (2004) The EMBL Nucleotide Sequence Database. Nucleic Acids

Res. 32, D27–D30

19 Birney, E. et al. (2004) An overview of ensembl. Genome Res. 14, 925–928

20 Johnson, G. and Wu, T.T. (2001) Kabat database and its applications: future

directions. Nucleic Acids Res. 29, 205–206

21 Giudicelli, V. et al. (1997) IMGT, the international ImMunoGeneTics database.

Nucleic Acids Res. 25, 206–211

22 Giudicelli, V. et al. (2006) IMGT/LIGM-DB, the IMGT comprehensive database of

immunoglobulin and T cell receptor nucleotide sequences. Nucleic Acids Res. 34,

D781–D784

23 Di Noia, J.M. and Neuberger, M.S. (2007) Molecular mechanisms of antibody

somatic hypermutation. Ann. Rev. Biochem. 76, 1–22

24 Chen, J.M. et al. (2007) Gene conversion: mechanisms, evolution and human

disease. Nat. Rev. Genet. 8, 762–775

25 Melchers, F. et al. (2000) Repertoire selection by pre-B-cell receptors and B-cell

receptors, and genetic control of B-cell development from immature to mature B

cells. Immunol. Rev. 175, 33–46

26 Stahlberg, A. et al. (2004) Properties of the reverse transcription reaction in mRNA

quantification. Clin. Chem. 50, 509–515

27 Iturriza-Gomara, M. et al. (1999) Comparison of specific and random priming in

the reverse transcriptase polymerase chain reaction for genotyping group A

rotaviruses. J Virol. Methods 78, 93–103

28 Sambrook, J. et al. (1989) Molecular Cloning: A Laboratory Manual. Cold Spring

Harbor, Cold Spring Harbor Press

29 Levesque-Sergerie, J.P. et al. (2007) Detection limits of several commercial reverse

transcriptase enzymes: impact on the low- and high-abundance transcript levels

assessed by quantitative RT-PCR. BMC Mol. Biol. 8, 93

30 Suslov, O. and Steindler, D.A. (2005) PCR inhibition by reverse transcriptase leads

to an overestimation of amplification efficiency. Nucleic Acids Res. 33, e181

31 Chandler, D.P. et al. (1998) Reverse transcriptase (RT) inhibition of PCR at low

concentrations of template and its implications for quantitative RT-PCR. Appl.

Environ. Microbiol. 64, 669–677

32 Abu Al-Soud, W. and Radstrom, P. (1998) Capacity of nine thermostable DNA

polymerases To mediate DNA amplification in the presence of PCR-inhibiting

samples. Appl. Environ. Microbiol. 64, 3748–3753

33 Spitaleri, S. et al. (2004) Experimental procedures comparing the activity of

different Taq polymerases. Forensic Sci. Int. 146, S167–S169

34 Chase, J.W. and Williams, K.R. (1986) Single-stranded DNA binding proteins

required for DNA replication. Annu. Rev. Biochem. 55, 103–136

35 Meyer, R.R. and Laine, P.S. (1990) The single-stranded DNA-binding protein of

Escherichia coli. Microbiol. Rev. 54, 342–380

36 Kunkel, T.A. et al. (1979) Single-strand binding protein enhances fidelity of DNA

synthesis in vitro. Proc. Natl. Acad. Sci. U.S.A. 76, 6331–6335

37 Chou, Q. (1992) Minimizing deletion mutagenesis artifact during Taq DNA

polymerase PCR by E. coli SSB. Nucleic Acids Res. 20, 4371

38 Feeney, A.J. et al. (2004) Many levels of control of V-gene rearrangement

frequency. Immunol. Rev. 200, 44–56

39 Clark, L.A. et al. (2006) Trends in antibody sequence changes during the somatic

hypermutation process. J. Immunol. 177, 333–340

40 Torres, M. et al. (2005) Variable-region-identical antibodies differing in

isotype demonstrate differences in fine specificity and idiotype. J. Immunol. 174,

2132–2142

41 Fraser, N.L. et al. (2003) The VH gene repertoire of splenic B cells and somatic

hypermutation in systemic lupus erythematosus. Arthritis Res. Ther. 5,

R114–R121

42 Hansen, A. et al. (2000) Use of immunoglobulin variable-region genes by normal

subjects and patients with systemic lupus erythematosus. Int. Arch. Allergy

Immunol. 123, 36–45

43 Jacobi, A.M. et al. (2002) Analysis of immunoglobulin light chain rearrangements

in the salivary gland and blood of a patient with Sjogren’s syndrome. Arthritis. Res.

4, R4

44 Dorner, T. and Lipsky, P.E. (2005) Molecular basis of immunoglobulin

variable region gene usage in systemic autoimmunity. Clin. Exp. Med. 4,

159–169

45 Li, A. et al. (2004) Utilization of Ig heavy chain variable, diversity, and joining gene

segments in children with B-lineage acute lymphoblastic leukemia: implications

for the mechanisms of VDJ recombination and for pathogenesis. Blood 103, 4602–

4609

46 Hust, M. et al. (2007) Selection of recombinant antibodies from antibody gene

libraries. Methods Mol. Biol. 408, 243–255

47 Little, M. et al. (1995) Human antibody libraries in Escherichia coli. J. Biotechnol. 41,

187–195

48 Hoogenboom, H.R. et al. (1992) Building antibodies from their genes. Immunol.

Rev. 130, 41–68


http://vbase.mrc-cpe.cam.ac.uk/

V-gene amplification revisited – An optimised procedure for amplification of rearranged human...

Documents

Transcript of V-gene amplification revisited – An optimised procedure for amplification of rearranged human...