The genetic basis of DOORS syndrome: an exome-sequencing study

of 39

The genetic basis of DOORS syndrome: an exome sequencing study 1

Philippe M Campeau1*, MD, Dalia Kasperaviciute2*, PhD, James T Lu3,4, PhD, Lindsay C 2

Burrage1, PhD, Choel Kim5, PhD, Mutsuki Hori6, MD, Berkley R Powell7, MD, Fiona Stewart8, 3

MBBS, Têmis Maria Félix9, PhD, Jenneke van den Ende10, MD, Marzena Wisniewska11, PhD, 4

Hülya Kayserili12, MD, Patrick Rump13, PhD, Sheela Nampoothiri14, MSc, Salim Aftimos15, MD, 5

Antje Mey16, MD, Lal DV Nair17, MD, Michael L Begleiter18, MSc, Isabelle De Bie19, PhD, Girish 6

Meenakshi20, MBBS, Mitzi L. Murray21, MD, Gabriela M Repetto22, MD, Mahin Golabi23, MD, 7

Edward Blair24, MD, Alison Male25, MD, Fabienne Giuliano26, MD, Ariana Kariminejad27, MD, 8

William G Newman28,29, PhD, Sanjeev S Bhaskar28,29, MSc, Jonathan E Dickerson28,29, PhD, 9

Bronwyn Kerr28,29, MD, Siddharth Banka28,29, PhD, Jacques C Giltay30, PhD, Dagmar 10

Wieczorek31, MD, Anna Tostevin2, MSc, Joanna Wiszniewska1, MD, Sau Wai Cheung1, PhD, 11

Raoul C. Hennekam32, PhD, Richard A Gibbs1,3, PhD, Brendan H Lee1,33, PhD, Sanjay M 12

Sisodiya2,34, PhD. 13

1. Department of Molecular and Human Genetics, Baylor College of Medicine, Houston, 14

TX, 77030, USA. 15

2. Department of Clinical and Experimental Epilepsy, UCL Institute of Neurology, London, 16

WC1N 3BG, UK. 17

3. Human Genome Sequencing Center, Baylor College of Medicine, Houston, TX, 77030, 18

USA. 19

4. Department of Structural and Computational Biology & Molecular Biophysics, Baylor 20

College of Medicine, Houston, TX, 77030, USA. 21

5. Department of Pharmacology, Baylor College of Medicine, Houston, TX, 77030, USA. 22

6. Department of Pediatrics, Toyohashi Municipal Hospital, Toyohashi, Aichi, 441-8570, 23

Japan. 24

7. Children's Hospital Central California, Madera, California, 93636, USA. 25

8. Genetics Service, Belfast City Hospital, Belfast, BT9 7AB, Ireland. 26

9. Medical Genetics Service, Clinical Hospital of Porto Alegre, Porto Alegre, 90035-903, 27

Brazil. 28

10. Department of Medical Genetics, University Hospital Antwerp, 2650 Antwerp, Belgium. 29

of 39

11. Department of Medical Genetics, Poznañ University of Medical Sciences, Poznañ, 61-1

701, Poland. 2

12. Medical Genetics Department, Istanbul Medical Faculty, Istanbul University, 34093 3

Turkey. 4

13. Department of Genetics, University of Groningen, Groningen, 9712 CP, The 5

Netherlands. 6

14. Department of Pediatric Genetics, Amrita Institute of Medical Sciences & Research 7

Center, Kerala, 682041, India. 8

15. Genetic Health Service New Zealand – Northern Hub, Auckland City Hospital, 9

Auckland, 92-024, New Zealand. 10

16. Pediatric neurology, Braunschweig Hospital, Braunschweig, 38118, Germany. 11

17. Department of Pediatrics, Saveetha Medical College & Hospital, Saveetha University, 12

Chennai, Tamilnadu, 600077, India. 13

18. Division of Genetics, Children’s Mercy Hospitals and Clinics and the University of 14

Missouri-Kansas City School of Medicine, Kansas City, MO, 64108, USA. 15

19. Department of Medical Genetics, Montreal Children’s Hospital, McGill University Health 16

Center, Quebec, H3H 1P3, Canada. 17

20. Department of Pediatrics, NKP Salve Institute of Medical Sciences & Lata Mangeshkar 18

Hospital, Maharashtra, 400001, India. 19

21. University of Washington Medical Center, Seattle, 98195, WA, USA. 20

22. Center for Human Genetics, Facultad de Medicina, Clínica Alemana-Universidad del 21

Desarrollo, Santiago, 7710162, Chile. 22

23. Department of Pediatrics, University of California San Francisco, San Francisco, CA, 23

94143, USA. 24

24. Department of Clinical Genetics, Churchill Hospital, Oxford, OX3 7LJ, UK. 25

25. Clinical Genetics Department, Great Ormond Street Hospital for Children NHS 26

Foundation Trust, London, WC1N 3JH, UK. 27

26. Centre Référence Anomalie Développement et Syndromes Malformatifs, Centre 28

Hospitalier Universitaire de Nice, 06200, France. 29

27. Kariminejad-Najmabadi Pathology & Genetics Center, 14656 Tehran, Iran. 30

28. Manchester Centre for Genomic Medicine, Institute of Human Development, Faculty of 31

Medical and Human Sciences, University of Manchester, Manchester Academic Health 32

Science Centre (MAHSC), Manchester, M13 9WL, UK 33

29. Manchester Centre for Genomic Medicine, Central Manchester University Hospitals 34

NHS Foundation Trust, MAHSC, Manchester, M13 9WL, UK 35

30. Department of Medical Genetics, University Medical Center Utrecht, 3508 AB Utrecht, 36

The Netherlands. 37

31. Institut für Humangenetik, University of Duisburg-Essen, University Hospital Essen, 38

45147 Essen, Germany. 39

of 39

32. Department of Pediatrics and Translational Genetics, Academic Medical Center, 1

University of Amsterdam, Amsterdam, 1017 DS, The Netherlands. 2

33. Howard Hughes Medical Institutes, Houston, TX, 77030, USA. 3

34. Epilepsy Society, Bucks, SL9 0RJ, UK 4

*These authors contributed equally. 5

6

7

Corresponding authors: 8

9

Brendan H Lee 10

Investigator, Howard Hughes Medical Institute 11

Professor, Department of Molecular and Human Genetics, Baylor College of Medicine 12

One Baylor Plaza, R814 - MS225, Houston, TX 77030 [email protected] 13

14

Sanjay M Sisodiya 15

Department of Clinical and Experimental Epilepsy, 16

UCL Institute of Neurology, Queen Square, London, WC1N 3BG, UK. 17

Tel.: + 44 20 3448 8612; fax: + 44 20 3448 8615. [email protected] 18

of 39

Abstract 1

2

Background: DOORS syndrome is a recessive condition characterized by Deafness 3

(sensorineural), Onycho/Osteodystrophy (nail and digital anomalies), intellectual disability 4

previously known as mental Retardation, and Seizures. We hypothesized that sequencing 5

most coding exons in affected individuals would lead to the identification of a critical gene. 6

Methods: In this cohort study leveraging an international collaboration, we identified thirty 7

families with individuals presenting at least three of the five features of the DOORS acronym. 8

Four families were excluded based either on clinical features, availability of clinical samples, or 9

ability to contact the family for consent. Clinical information and DNA was collected. We 10

conducted whole exome sequencing in affected individuals as they were enrolled, until we 11

identified a candidate gene. In three families with consanguinity or multiple affected siblings, 12

we concurrently conducted whole genome genotyping by SNP array to identify homozygous 13

regions or shared haplotypes. Mutations were confirmed by Sanger sequencing. Expression 14

studies were performed in human fibroblasts from one individual by real-time PCR and 15

Western blot and in mouse tissues by immunohistochemistry and real-time PCR. 16

Findings: Exome sequencing was performed in the first 17 enrolled families, and TBC1D24 17

was screened by Sanger sequencing in subsequent ones. We identified TBC1D24 mutations 18

in nine families (by exome sequencing in seven, and Sanger in two). All individuals with 19

TBC1D24 mutations in our cohort had the five main features of DOORS syndrome, and they 20

represent half of the 18 families with five main features of DOORS, out of the 26 families 21

enrolled. The seizure types in individuals with TBC1D24 mutations included generalized tonic-22

of 39

clonic, complex partial, focal clonic, and infantile spasms. In the individuals without TBC1D24 1

mutations, eight did not have seizures and three did not have deafness. We show that some 2

mutations abrogate TBC1D24 mRNA stability. We further demonstrate expression in mouse 3

phalangeal chondrocytes and calvaria, suggesting a role in skeletogenesis. 4

Interpretation: Mutations in TBC1D24 are an important cause of DOORS syndrome. The 5

breadth of phenotypes now known to be caused by TBC1D24 mutations further illustrates the 6

phenomenon of pleiotropy due to mutations in a single gene, especially amongst the 7

epilepsies. Further studies are needed to dissect the cellular roles of TBC1D24 and identify the 8

genes responsible for the phenotype in other individuals. 9

Funding: This work was funded in part by the NIH (USA), the CIHR (Canada), the NIHR (UK), 10

the Wellcome Trust, the Henry Smith Charity and Action Medical Research. 11

12

of 39

Introduction 1

2

DOORS or DOOR syndrome [MIM 220500] is a rare autosomal recessive condition of 3

unknown cause. Cantwell first used the acronym DOOR syndrome in 19751 (referring to the 4

Deafness, Onychodystrophy, Osteodystrophy, and mental Retardation in affected individuals), 5

noting that a few affected individuals had been reported prior to that date. Qazi et al. 6

suggested changing the name to DOORS syndrome to account for the presence of seizures in 7

most individuals2: we use this term. Thirty-two affected individuals were reviewed by James et 8

al. in 20073 and five others have been published since that report4-8. Seizures, present in most 9

patients with DOORS syndrome, usually start in the first year of life. They occasionally occur 10

with increasing frequency or severity and are sometimes refractory to antiepileptic medication. 11

The seizures are more often generalized tonic-clonic, but myoclonic, partial and absence 12

seizures also occur3. Neurological involvement, apart from the epilepsy, intellectual deficiency 13

and profound sensorineural hearing loss, includes occasional optic neuropathy, visual 14

impairment, peripheral neuropathy and abnormalities on brain magnetic resonance imaging. 15

The onycho-osteodystrophy affects the hands and feet equally. Small or absent nails and 16

hypoplastic terminal phalanges are noted in most individuals. A triphalangeal thumb is present 17

in one third of affected individuals. A large base of the nose and a bulbous nose are the most 18

common facial dysmorphisms. Cranial anomalies include microcephaly in a third of individuals 19

and a narrow bifrontal diameter in two thirds. The rarity of DOORS syndrome, the absence of 20

any single pathognomonic feature, the significant clinical variability (including malformations of 21

the brain, eyes, heart, kidneys, skeletal system, adrenals and genitalia3), and features shared 22

with other syndromes, make its clinical diagnosis challenging. In turn, this hinders 23

of 39

understanding of its true prevalence and prognosis, limiting accurate counseling. Better 1

diagnostic tools are therefore needed. 2

3

For rare diseases in general, a productive approach to improved understanding and more 4

specific diagnosis has been to identify underlying genetic causation. The genetic cause of 5

DOORS syndrome is unknown9. Strategies to identify disease-causing genes in inherited 6

diseases have changed with the development and availability of new technologies. For 7

example, in epilepsy, channelopathies were mostly identified in the 1990s using positional 8

cloning and candidate gene sequencing10. Next-generation sequencing, such as whole exome 9

sequencing, has accelerated the pace of the identification of epilepsy-associated genes. For 10

example, PPRT2 mutations were identified initially in paroxysmal kinesigenic dyskinesia, and 11

are also seen in infantile seizures and febrile seizures11,12. More recently, DEPDC5 mutations 12

were identified in a variety of dominantly-inherited familial focal epilepsies13,14. The precise role 13

of each protein in the central nervous system remains to be determined. In a cohort of patients 14

with a clinical diagnosis of DOORS syndrome, we sought to identify the genetic basis by whole 15

exome sequencing, aiming thus to provide improved diagnostic resolution and, eventually, 16

better understanding. 17

18

of 39

Methods 1

Participants 2

Individuals with DOORS syndrome enrolled in our study were evaluated by clinical geneticists 3

and have at least three of the five features of the disease making its acronym, namely 4

deafness, abnormal nails or digits in the hands and/or feet, developmental delay or intellectual 5

disability (previously known as mental retardation), and seizures. We contacted physicians 6

who had published cases previously and previous collaborators. Recruitment of the families 7

described in this report spanned from December 2010 to March 2013. Families were excluded 8

if the parents could not be contacted for consent, or if DNA could not be obtained from the 9

affected individual. Further exclusion criteria were autosomal dominant inheritance and the 10

absence of both intellectual disability and seizures, the same criteria used by James et al. in 11

their literature review3. Thirty families were thus identified; of which four families were excluded 12

from the study. These include two families which could not be re-contacted for informed 13

consent; in another family, the affected child had died and DNA was not available, and in 14

another family, the phenotype corresponded to dominant deafness-onychodystrophy (DDOD, 15

MIM 124480). In all cases, a parent provided informed written consent on behalf of the affected 16

individual. A clinical questionnaire was completed by the collaborating physician. DNA was 17

collected from the affected individual and both parents when both were available. Our clinical 18

study was conducted with the approval of the institutional review boards of the Baylor College 19

of Medicine, of University College London, of the University of Amsterdam and of the 20

University of Manchester. 21

22

of 39

Procedures 1

Exome sequencing and analysis: A detailed description of the method for exome sequencing 2

and data analysis is provided in the Supplement (Supplementary methods and Supplementary 3

Table 1). In summary, genomic DNA is fragmented, enriched for coding regions, and 4

sequenced on an Illumina HiSeq 2000 instrument (Illumina, San Diego, CA). Reads are 5

aligned to the reference human genome, and analyzed for variations from the reference. The 6

variants are filtered to keep only rare or novel variants, and these variants are annotated for 7

conservation data, predicted impact of the variant, variant frequency in various databases, 8

gene expression pattern, function of the gene, and phenotypes in mice and humans. Our 9

variant detection and filtering method is deliberately sensitive but not specific, meaning that 10

there are multiple false-positive variants called. Further filtering and visualization of the 11

variants is required. False-positive variant calls can be due to: artifacts introduced by the next-12

generation technology used15, poor coverage in GC-rich regions, bases missed by next-13

generation sequencing because of homopolymers or dinucleotide repeats, and/or mapping 14

difficulties because of gene homologues or paralogues. The most efficient method to remove 15

these false-positive variants is to visualize alignment files (binary alignment map or BAM files, 16

using Broad Institute’s IGV viewer, www.broadinstitute.org/igv) from affected individuals and 17

compare them to variant files from unaffected individuals or individuals with completely 18

separate conditions (exomes published in our previous papers16-20), which we performed after 19

restricting the candidate gene list by mode of inheritance as described in the results section. 20

21

of 39

Single Nucleotide Polymorphism array (SNP array) and analysis: Analysis was performed on 1

the Illumina Infinium HD assay platform using HumanOmni1-Quad BeadChip (Illumina Inc., 2

San Diego, CA) according to the manufacturer’s instructions, and the data were analyzed 3

using Illumina’s GenomeStudio to look for insertions, deletions, and regions of homozygosity 4

as well as haplotypes shared by affected siblings. 5

6

Sanger sequencing: Primers used for sequencing the genomic DNA encoding the complete 7

coding sequence of TBC1D24 variant 1 (NCBI CCDS ID#55980.1) were generated by 8

ExonPrimer (http://ihg.gsf.de/ihg/ExonPrimer.html, see Supplementary Table 2 for primers). 9

Amplicons were generated with 10 ng of genomic DNA using TaqMan polymerase (ABI, Life 10

Technologies, Carlsbad, CA) using the manufacturer’s protocol with an annealing temperature 11

of 55°C and an amplification of 1 minute. Products were sequenced by the Sanger method 12

using the same primers, at Beckman Coulter Genomics (Danvers, MA). Resulting 13

chromatograms were analyzed by comparing the GenBank file for the RefSeq sequence of 14

TBC1D24 using Sequencher version 4.8 (Gene Codes Corporation, Ann Arbor, MI). 15

16

Real time PCR: Fibroblasts were grown in Dulbecco's Modified Eagle's Medium with 10% fetal 17

bovine serum, 1.5 mM glutamine, 100 IU/ml penicillin, and 50ng/ml streptomycin (Invitrogen, 18

Grand Island, NY). Mouse tissues were from C57BL/6J wildtype mice. RNA was extracted 19

from fibroblasts or mouse tissues using TRIzol and GlycoBlue, then cDNA was synthesized 20

using SuperScript III First-Strand Synthesis Kit according to the manufacturer’s instructions (all 21

from Invitrogen, Grand Island, NY). Quantitative real-time PCR was performed using the 22

of 39

primers in Supplementary Table 2, the FastStart DNA Master SYBR Green reagent and a 1

LightCycler instrument using an annealing temperature of 65°C according to the 2

manufacturer’s protocol (both from Roche NimbleGen, Madison, WI). 3

4

Immunohistochemistry and western blotting methods are detailed in the Supplement. 5

6

Structural model of human TBC1D24: The homology model was generated by Phyre221 7

(www.sbg.bio.ic.ac.uk/phyre2/) based on the crystal structures of the TBC domain of TBC1D1 8

and TBC1D4 and the TLDc domain of the zebrafish Oxr2 protein22. The figure of the model 9

was generated using Pymol (http://pymol.org/). 10

11

Statistical analyses: Statistical analyses were performed using SigmaPlot software v11.0 12

(Systat Software, San Jose, CA). Differences in mRNA expression in fibroblasts were 13

calculated using Student’s t-test. For the expression in different mouse tissues, a Kruskal-14

Wallis One Way Analysis of Variance (ANOVA) on ranks was performed, as well as a multiple 15

comparison procedure using Dunnett's Method. 16

17

18

Role of the funding source 19

of 39

The sponsors of the study had no role in study design, data collection, data analysis, data 1

interpretation, or writing of the report. All authors had full access to all the data in the study and 2

had final responsibility for the decision to submit for publication. 3

4

of 39

Results 1

2

We performed exome sequencing in the first 17 enrolled families, and SNP-arrays in three 3

families with consanguinity or multiple affected children. Since sequencing and data 4

preparation took months using our procedures, we analyzed exomes and SNP-arrays after we 5

sequencing was completed in 15 families (see flow diagram in Figure 1). Focusing on genes 6

with rare or novel protein-impacting variants (compared to the frequency in the control group, 7

i.e. the 6,503 exomes in the Exome Variant Server), there were 6,645 genes with at least one 8

rare/novel variant in at least one of fifteen samples. As described in the methods and 9

Supplementary Table 3, to restrict the list of candidate genes, we applied filtering based 10

initially on an autosomal recessive inheritance, considered genes mutated in several samples, 11

and removed the false-positive variants. We visually compared the DOORS syndrome exome 12

alignments to other exomes previously acquired for unrelated conditions16-20, focusing initially 13

on genes following a recessive inheritance pattern (one homozygous mutation or two 14

heterozygous mutations) and variants identified in the highest number of affected individuals. 15

Most variants in genes identified in most exomes by our annotation pipeline proved to be false-16

positive variants upon visualization and comparison with “control” exomes (Supplementary 17

Table 3). 18

19

Using the strategy outlined above, we identified either homozygous or compound 20

heterozygous mutations in TBC1D24 (RefSeq# NM_001199107.1) in affected individuals in six 21

of the initial fifteen families in which we performed exome sequencing (see Table 1). All 22

of 39

mutations are novel except for the frameshift mutation, seen in the heterozygous carrier state 1

in two of 6,118 individuals sequenced for that region in the June 2013 release of the Exome 2

Variant Server. This server provides variant frequency data from multiple exome studies 3

performed mostly in adults with various heart and lung diseases and controls, and individual 4

phenotypes are not available. Given that mutations in this gene have been identified as the 5

cause of some epilepsies23-27, that seizures are frequent in DOORS syndrome, and that all 6

mutations we identified were novel or very rare and in some cases truncating, this gene was 7

the best candidate in our cohort. Sanger sequencing of TBC1D24 was conducted in all other 8

enrolled families (primers in Supplementary Table 2) or exome sequencing was completed in 9

two individuals for whom exome sequencing was already started at the time. We identified 10

three more families with TBC1D24 mutations, one through an additional exome and two by 11

Sanger sequencing only, totaling nine families with confirmed mutations in a cohort of 26 12

families affected by DOORS syndrome (see Supplementary Table 1 for the analyses 13

performed on each family and Table 1 for TBC1D24 mutations identified). Annotations for all 14

TBC1D24 variants (from DOORS syndrome, the other associated epileptic conditions, and the 15

Exome Variant Server), including population frequency, conservation scores and PolyPhen2 16

scores can be found in Supplementary Table 4. Collectively, other coding variants in TBC1D24 17

are seen in the heterozygous state in 5% of the population. 18

19

A wide variety of seizure types are noted in this cohort of individuals with TBC1D24 mutations, 20

including generalized tonic-clonic, complex partial, focal clonic seizures, and infantile spasms. 21

Table 2 lists the clinical features of the individuals with and without TBC1D24 mutations. 22

Photographs of the face, hands, feet and radiographs are shown in Figure 2. The mutations 23

of 39

are listed in Table 1 and represented in Figure 3A. The conservation of the affected residues 1

and nucleotides is given in Supplementary Figure 1. In the families with TBC1D24 mutations 2

and consanguinity, the mutations were homozygous and TBC1D24 was in a region of 3

homozygosity as identified by SNP-array or homozygosity mapping from exome data. The 4

regions of homozygosity in these families and other families are given in Supplementary Table 5

5. 6

7

Because of the recessive nature of the disease and the presence of mutations leading to 8

premature protein termination, we proposed that the mutations cause a loss of TBC1D24 9

function. We assessed this hypothesis in fibroblasts from a biopsy previously performed for 10

clinical reasons in individual 3, who was compound heterozygote for a splice site mutation and 11

a frameshift mutation in trans. This frameshift mutation, since it is not in the last exon, is 12

predicted to lead to nonsense-mediated decay (NMD) of the mRNA28. The splice donor 13

mutation after exon five, since it is located five nucleotides away from a splice site 14

(c.1206+5G>A), may or may not affect splicing efficiency. If it affects splicing efficiency, it 15

would lead to an aberrant protein-encoding mRNA, thus engaging NMD. To test for NMD, we 16

performed real-time PCR (Figure 3B). TBC1D24 mRNA levels in the fibroblasts from individual 17

3 were 5% (±1%, standard error) of the levels from three unaffected controls (Student’s t-test: 18

p=0.024), confirming that the mRNA from both alleles undergoes NMD and thus showing a 19

loss of TBC1D24 function. TBC1D24 protein from these fibroblasts could not be detected by 20

Western blot (Figure 3C). 21

22

of 39

We next assessed TBC1D24 tissue expression. TBC1D24 is known to be widely expressed, 1

most highly in the brain (especially in pyramidal neurons), kidneys and salivary and lacrimal 2

glands (which have high amounts of secretory vesicles)29,30. In the brain, the regions with the 3

highest expression levels are the hippocampus and the somatomotor areas of the isocortex 4

(see Supplementary Table 6 and Supplementary Figure 2 for a review of available data). Using 5

an antibody against TBC1D24, we studied expression in skeletogenesis. We assessed 6

expression in digital chondrocytes, given the distal phalangeal hypoplasia in DOORS 7

syndrome and the high expression seen in chondrocytes in the Human Protein Atlas. 8

Expression was high in the chondrocytes of the digits (see Supplementary Figure 3). 9

Moreover, we assessed expression by real-time PCR in various newborn mouse tissues and 10

noticed high expression in the calvarium (Supplementary Figure 3F). The high expression in 11

the calvaria correlates well with the cranial shape phenotype and occasional cranial synostosis 12

seen in affected individuals (Table 2). These results, combined with the phenotype in humans, 13

suggest that TBC1D24 might be important in regulating skeletogenesis. 14

15

TBC1D24 contains a TLDc domain and regulates Rab proteins. In our cohort, no mutations 16

were identified in the other TLDc domain-containing genes by exome sequencing (see 17

Supplementary Tables 7-9). By homology modeling, the substitutions we identified do not 18

seem to affect portions of the protein predicted to interact with the TLDc domain, nor are they 19

in the region typically interacting with GTP in other TBC proteins (Figure 3D). Because 20

TBC1D24 regulates Rab proteins and because of clinical overlap with Martsolf syndrome, we 21

also assessed RAB3GAP2. No RAB3GAP2 mutations were identified in families without 22

TBC1D24 mutations (see Supplementary Table 7-9). Moreover, genetic locus mapping by 23

of 39

SNP arrays, or homozygosity mapping from exome data in some families without TBC1D24 1

mutations, did not identify a mutated gene in common in these families (details on the regions 2

identified are given in Supplementary Table 5). Analyses are ongoing to identify candidate 3

genes with mutations in three or fewer families following either a de novo dominant or a 4

recessive inheritance pattern. Details on analysis in the other ten exomes without TBC1D24 5

mutations are given in Supplementary Tables 7 to 9. 6

7

Some individuals without TBC1D24 mutations had typical features of DOORS syndrome. 8

including the more specific signs of triphalangeal thumbs and 2-oxoglutaric aciduria, and are 9

clinically indistinguishable from those with TBC1D24 mutation, suggesting genetic 10

heterogeneity in DOORS syndrome, while others lacked some of the typical features such as 11

deafness and seizures and had additional malformations, which suggests that our cohort might 12

include some individuals with different but overlapping conditions (see Table 2 for details). All 13

individuals with TBC1D24 mutations had all five features making the DOORS acronym. If we 14

stratify based on this strict definition of DOORS syndrome, TBC1D24 mutations are found in 15

half of eighteen families. 16

17

of 39

Discussion 1

2

We have identified mutations in TBC1D24 as a cause of DOORS syndrome. Previously 3

reported, but different, mutations in TBC1D24 cause various epileptic syndromes. A 4

homozygous p.Phe251Leu substitution in four siblings of an Arab-Israeli family causes focal 5

epilepsy, dysarthria, mild to moderate intellectual disability and cortical thickening with 6

cerebellar atrophy and high T2 and FLAIR signal in the ansiform lobule of the cerebellum on 7

MRI24. In an Italian family, compound heterozygous substitutions (p.Asp147His and 8

p.Ala515Val) cause Familial Infantile Myoclonic Epilepsy (FIME [MIM 605021]) in seven 9

individuals with normal intellect and normal MRI, except for periventricular nodular heterotopia 10

in one individual25. A homozygous truncating mutation (c.969_970delGT, p.Ser324Thrfs*3) in 11

exon 3 was identified in five affected Turkish individuals with a recessive form of myoclonic 12

epilepsy with episodic dystonia, hemiparesis, autonomic signs and lethargy27. This phenotype 13

evolved to chronic dystonia, progressive diffuse cerebral atrophy and early death. Exon 3 is 14

spliced out in isoform 2, which is expressed predominantly in non-neural tissues. Finally, two 15

compound heterozygous substitutions (p.Phe229Ser and p.Cys156*) were identified in two 16

siblings with familial malignant migrating partial seizures of infancy, with progressive diffuse 17

cerebral atrophy of the gray matter sparing the posterior fossa, and early death26. The diversity 18

of seizure types seen in TBC1D24-associated epileptic syndromes and in DOORS syndrome 19

is striking (see Table 2), and may point to a more general epileptogenic mechanism. None of 20

the patients in previous reports of TBC1D24 mutations had digital anomalies or deafness, and 21

none of the above mutations were identified in our DOORS syndrome cohort, demonstrating a 22

clear genotype-phenotype correlation. The reason why certain mutations cause DOORS 23

of 39

syndrome while others cause only epilepsy might lie partly in the way the mutations affect 1

interaction patterns with protein partners, an idea which will need to be explored in the future. 2

Some genes implicated in epilepsy seem capable of causing a wide variety of types of 3

epilepsy, with greater or fewer additional neuropsychiatric features, and others have been 4

associated with brain malformations or complex dysmorphic syndromes31. However, 5

phenotypic pleiotropy has rarely been reported to span the spectrum from seizures alone (e.g. 6

previous reports on TBC1D24 mutations) to multi-systemic syndromic disorders (e.g. DOORS 7

syndrome). These emerging phenomena of both genotype-phenotype complexity and genetic 8

pleiotropy support the view that, with accumulating mutational data, the fuller coverage 9

afforded by exome (or genome) sequencing may be more useful than targeted panels in 10

clinical practice. 11

12

In DOORS syndrome, five families have recurrent substitutions affecting the arginine at 13

position 242, and two have substitutions affecting the arginine at position 40, suggesting these 14

are critical in TBC1D24 function. Both are in a CpG island and affect CG dinucleotides. CpG 15

nucleotides are more mutation-prone, which may explain mutation recurrence in individuals of 16

different ethnic background. Two patients also share another recurrent mutation 17

(p.His336Glnfs*12) unique to DOORS. 18

19

TBC1D24 is a member of the Tre2–Bub2–Cdc16 (TBC) domain-containing RAB-specific 20

GTPase-activating proteins which coordinate Rab proteins and other GTPases for the proper 21

transport of intracellular vesicles. It is the only TBC/RabGAP with a TLDc domain (TBC, LysM, 22

of 39

Domain catalytic) which is thought to be involved in oxidative stress resistance and to have 1

catalytic activity for unknown substrates32,33. The TLDc domain is also found in the proteins 2

encoded by the human genes OXR1, NCOA7, KIAA1609 and C20orf118 genes, which do not 3

share known functions. Mice lacking Oxr1 exhibit oxidative stress-induced 4

neurodegeneration34, which suggests a possible link with the neurodegeneration seen in some 5

individuals with TBC1D24 mutations27. Mutations were not found in other TLDc domain 6

encoding genes. Several diseases have been associated with other aberrant Rab proteins and 7

Rab-associated proteins. Notably, some clinical overlap exists between DOORS syndrome 8

and Martsolf syndrome (RAB3GAP2 gene, [MIM 212720]; shared aspects include seizures, 9

intellectual deficiency, abnormal toenails and short phalanges), and other syndromes. 10

Mutations were also not identified in RAB3GAP2. 11

12

Further research is needed not only to determine the precise role of TBC1D24 in the nervous 13

system, but also in the skeletal system and other systems affected in DOORS syndrome. In C. 14

elegans, C31H2.1 (a TBC1D24 orthologue) was implicated in synaptic function by an RNAi 15

screen35. In Drosophila, the orthologue Skywalker (Sky) facilitates endosomal trafficking in 16

synaptic vesicles by facilitating GTP hydrolysis by Rab35, thus controlling synaptic vesicle 17

rejuvenation and neurotransmitter release36. Human TBC1D24 has a relatively low similarity to 18

the Drosophila protein36 and neither possesses the arginine and glutamine residues (the so-19

called RQ fingers) which are critical to catalyze GTP hydrolysis by Rab proteins37. Whether 20

human TBC1D24 is able to also facilitate Rab protein-mediated GTP hydrolysis remains to be 21

determined. 22

of 39

1

The findings implicate defective vesicular trafficking as the possible basis of the complex 2

phenotype in individuals with DOORS syndrome given previous studies in other TBC proteins. 3

The seizure phenotype present in all individuals with TBC1D24 mutations, and the studies in 4

Drosophila, suggest a role for aberrant neurotransmitter release in the neurological 5

manifestations of the disease. However, further studies in model organisms will be needed to 6

study this in detail. We are currently generating transgenic mice which will also help us to 7

assess these possibilities. 8

9

Exome sequencing, although a very powerful method to identify new genes linked to 10

Mendelian disorders, does have limitations. In a medical genetics clinical setting, exome 11

sequencing has a diagnostic yield of 20-35%38,39. Some limitations are linked to the strategy of 12

sequencing only exons; promoter mutations or deep intronic mutations affecting splicing will be 13

missed. Others limitation are inherent to the analysis strategy; oligogenic inheritance 14

(combination of one mutated allele in each of two or more genes) is not analyzed in our 15

strategy, nor are synonymous exonic variants which could be potentially deleterious. Finally, 16

some limitations are technical: for example, GC-rich regions are difficult to sequence and map, 17

coverage can vary from sample to sample, and reads in genes which have paralogues or 18

homologues can also be difficult to map to the reference genome. Future strategies to identify 19

the causative genes in individuals with DOORS syndrome but without TBC1D24 mutations 20

could include the following: consider oligogenic inheritance models, analyze output for multiple 21

different genes in the same pathway, increase enrollment and number of exomes and/or depth 22

of 39

of exome sequencing, perform whole-genome sequencing, and analyze exome data for copy 1

number variants. 2

3

The phenotypic similarity between patients with and without TBC1D24 mutations is highly 4

suggestive of genetic heterogeneity in DOORS syndrome. Individuals with TBC1D24 5

mutations all have the five features making the DOORS acronym. However, other features 6

were greatly variable, in terms of seizure types, pharmacoresponsiveness, brain imaging 7

abnormalities, cranial shape, 2-oxoglutaric aciduria, a triphalangeal thumb, and growth 8

parameters. A similar phenomenon is seen in the individuals without TBC1D24 mutations: nine 9

had the five features making the DOORS acronym, several had 2-oxoglutaric aciduria or a 10

triphalangeal thumb. In the individuals without TBC1D24 mutations, eight did not have seizures 11

and three did not have deafness (including one without seizures or deafness). Further 12

discussion on 2-oxoglutaric aciduria is provided in the supplementary material. 13

14

In conclusion, through a combination of careful clinical phenotyping and exome sequencing, 15

we have identified the molecular basis of DOORS syndrome in approximately a third of 16

individuals included in our cohort, or in half of the eighteen families where affected individuals 17

had the five features making the DOORS acronym. We suggest that individuals without 18

deafness and seizures but with the other features should still be screened for TBC1D24 19

mutations when encountered in a clinical setting since we are only beginning to understand the 20

genetic causation of DOORS syndrome: the discovery of a TBC1D24 mutation in a patient with 21

an appropriate phenotype confirms the diagnosis of DOORS syndrome, but more cases need 22

of 39

to be studied to determine the full clinical utility of TBC1D24 mutation testing. As has occurred 1

with other rare diseases that have been genetically solved, we anticipate that this gene 2

discovery will be an important step in galvanizing clinical and scientific progress in 3

understanding and treating DOORS syndrome. 4

5

of 39

Research in context 1

Systematic review 2

We searched PubMed and the references of included papers for articles published from 3

January 1970 to March 2013. We included in our search terms: DOOR syndrome, DOORS 4

syndrome, deafness and onychodystrophy, TBC1D24, 2-oxoglutaric aciduria, 2-oxoglutarate, 5

epilepsy and exome sequencing. We collected all previous reports on individuals with DOORS 6

syndrome and assessed the key clinical features. Features present in the majority of patients 7

include sensorineural deafness, nail hypoplasia, terminal phalangeal hypoplasia, triphalangeal 8

thumb,developmental delay, intellectual disability, seizures, craniofacial anomalies, 2-9

oxoglutaric aciduria, and MRI anomalies. Features present in ≥25% include consanguinity or 10

affected siblings, and optic atrophy. Features present in <25% include congenital heart 11

defects, urinary tract anomalies, and peripheral neuropathy. 12

Interpretation 13

This study identifies mutations in TBC1D24 as the genetic cause in a proportion of individuals 14

with DOORS syndrome, and implies that testing for TBC1D24 mutation should be considered 15

when the diagnosis of DOORS syndrome is contemplated. The study confirms the role of this 16

gene in a wide variety of epilepsy syndromes, a phenomenon seen also with other epilepsy-17

related genes such as SCN1A, KCNQ2 and PRRT2. Moreover, it expands the growing 18

concept of pleiotropy in epilepsy genetics because whilst some mutations in TBC1D24 can 19

cause mild epilepsy without significant associated features, other mutations cause epilepsy as 20

part of a multiorgan syndrome, with features beyond the nervous system alone. The resulting 21

important practical consequences of such clinical and genetic heterogeneity for daily 22

of 39

neurological practice, with its wealth of rare diseases, are that robust identification of genetic 1

mutations is a valuable adjunct to diagnosis, and that whole exome (or genome) sequencing 2

meeting clinical standards is likely to prove to be the best tool to provide the comprehensive 3

genomic coverage required. 4

5

of 39

Supplemental Data 1

Supplemental Data can be found with this article online. 2

3

of 39

Contributors 1

PMC designed the study, performed experiments, analyzed the data and wrote the manuscript. 2

DK performed experiments and analyzed the data. JTL, SSB, and JED analyzed the exome 3

data. AT performed experiments. LCB helped with Sanger sequencing. JW and SWC 4

conducted SNP array data analysis. RCH collected clinical data. CK performed 3D model 5

representations. RAG supervised exome sequencing. MH, BRP, FS, TMF, JvdE, MW, HK, PR, 6

SN, SA, AM, LDVN, MLB, IDB, GM, MLM, GMR, MG, EB, AM, FG, AK, WGN, BK, SB, JCG, 7

and DW contributed patient samples and collected clinical data. BHL and SMS jointly 8

supervised the research and revised the manuscript. 9

10

Conflicts of interest 11

All authors have no conflict of interest to declare. 12

13

Acknowledgements 14

We thank David Liu for technical assistance, Alyssa Tran and Dale Kerr for clinical research 15

support, Shalini N. Jhangiani for exome sequencing coordination, Sabrina Hong for the 16

representation of the structural model of TBC1D24, and Costin Leu for assistance with exome 17

sequencing statistics. Funding was provided by NIH grants PO1 HD22657 (BHL), U54 18

HG006542 (RAG) and U54 HG003273-09 (RAG), by The Rolanette and Berdon Lawrence 19

Bone Disease Program of Texas (BL), by the Wellcome Trust (SMS), the Henry Smith Charity 20

(SMS) and Action Medical Research (SMS). This work was supported by the BCM Intellectual 21

of 39

and Developmental Disabilities Research Center (HD024064) from the Eunice Kennedy 1

Shriver National Institute Of Child Health & Human Development. This work was partly 2

undertaken at UCLH/UCL, which received a proportion of funding from the Department of 3

Health’s NIHR Biomedical Research Centres funding scheme. PMC is supported by a CIHR 4

clinician-scientist training award and the O'Malley Foundation. JTL is supported by Ruth L. 5

Kirschstein National Research Service Award F30 MH098571-01. LCB was supported by the 6

Medical Genetics Research Fellowship Program NIH/NIGMS NIH T32 GM07526. 7

of 39

Tables

Table 1. Mutations identified in TBC1D24.

Family/Individual number Origin Maternal allele (DNA) Maternal allele (protein) Paternal allele (DNA) Paternal allele (protein)

1 Japan c.724C>T p.Arg242Cys c.118C>T p.Arg40Cys

2a

USA

c.724C>T p.Arg242Cys c.724C>T p.Arg242Cys

2b c.724C>T p.Arg242Cys c.724C>T p.Arg242Cys

3 Germany c.1008delT p.His336Glnfs*12 c.1206+5G>A Splicing

4 India c.724C>T p.Arg242Cys c.724C>T p.Arg242Cys

5a

Chile

c.58C>G p.Gln20Glu c.724C>T p.Arg242Cys

5b c.58C>G p.Gln20Glu c.724C>T p.Arg242Cys

6 France c.1008delT p.His336Glnfs*12 Not identified

7 Brazil c.724C>T p.Arg242Cys c.724C>T p.Arg242Cys

8 Turkey c.119G>T p.Arg40Leu c.119G>T p.Arg40Leu

9 UK c.328G>A p.Gly110Ser c.999G>T p.Leu333Phe

of 39

Table 2. Clinical features of affected individuals in families with mutations in TBC1D24. F

am

ily/in

div

idu

al n

um

ber

Ori

gin

Ag

e i

n M

arc

h 2

013

Gen

der

Co

nsan

gu

init

y

Han

ds,

nail

s a

bn

l

Han

ds,

fin

gers

ab

nl

Tri

ph

ala

ng

eal

thu

mb

Feet,

nail

s a

bn

l

Feet,

to

es a

bn

l

DD

/ID

Feed

ing

dif

ficu

ltie

s

Deafn

ess

Uri

ne 2

-oxo

glu

tari

c a

cid

Seiz

ure

s

Seiz

ure

on

set

an

d

ph

arm

aco

resp

on

siv

en

ess

Bra

in im

ag

ing

Cra

nia

l sh

ap

e a

no

mali

es

Gro

wth

para

mete

rs a

nd

p

erc

en

tile

s

Oth

er

fin

din

gs

Refe

ren

ce i

f p

ub

lish

ed

1 Japan 21 y.o.

M N Y Y Y N N Y N Y Nl Absence,

GTCS

2 m.o. Moderate control with Valproic acid, Zonisamide,

clonazepam, Carbamazepine

Thin cerebellar cortex,

hyperintense on T2-imaging, and

myelination delay

At 11 y.o., ht 135 cm (10th), wt 31 kg (20th), hc 52.5 cm

(25th)

Autism Spectrum Disorder

7

2a

USA 15 y.o.

M N Y Y N Y Y Y Y Y Incr Complex

partial

6 m.o. Good control with topiramate,

lamotrigine, lacosamide

Normal MRI

Sagittal craniosyno

stosis

At 14 y.o., ht 154 cm (10th), wt 51 kg (50th), hc 54.5cm

(40th)

Large central incisors, widely spaced teeth,

delayed eruption of permanent

teeth, calcaneal deformity, myopia.

2b

USA 8

y.o. M N Y Y N Y Y Y Y Y Incr

Complex partial

4 m.o. Good control with topiramate,

Clorazepate, lacosamide

Punctate foci of increased T2 signal in right frontal region.

Increased FLAIR signal around occipital horn.

At 7 y.o., ht 111cm (2nd), wt 35 kg (98th), hc 52cm

(25th)

Double outlet right ventricle, myopia.

3 Germa

ny 2.5 y.o.

F N Y Y N Y Y Y N Y Incr

Focal, secondaril

y GTCS

6 w.o. Poor control, at least 12 AED tried*.

Delayed myelination

At 13 m.o., lt 82 cm (97th), wt 12 kg

(80th), hc 42,5 cm (<3rd).

Microcephaly, nephrocalcinosis,

myopia

4 India 3.5 y.o.

M Y Y Y Y Y Y Y N Y Incr Focal clonic

5 m.o. Good control with valproate and

topiramate. Normal MRI

At 14 m.o. ht 65 cm (<3rd), wt

6 kg (<3rd), hc 43.5 cm (<3rd)

Symmetrical growth retardation

4

5a

Chile 9

y.o. M N Y Y N Y Y Y Y Y Nl

Complex partial

3 m.o. Good control with phenobarbital

and clobazam Normal MRI

Brachycephaly

At 6 y. and 8 m., ht 120 cm (50th), wt

25 kg (75th), hc 53 cm (75th)

Widely spaced teeth

5b

Chile 1

y.o. M N Y Y N Y Y Y N Y Nl

Complex partial

N/A Normal MRI At birth, lt 49 cm (35th), wt 2955 g (20th), hc 33.5 cm

of 39

(15th)

6 France 1

y.o. F N Y Y N Y Y Y N Y Incr

GTCS, focal clonic

3 m.o. Moderate control with

clonazepam, valproic acid, topiramate

Normal MRI

At 2 y. and 2 m., lt 85cm (25th), wt

10.7 kg (10th), hc 44 cm (<3rd)

Microcephaly. Mother had

absence seizures as a child

7 Brazil 22 y.o

M N Y Y N Y Y Y N Y Nl

Infantile spasms, absence,

GTCS

7 m.o. Good control with carbamazepine

and clobazam

Hyperintense T2 signals in the

cerebellar hemispheres,

especially on the left.

At 22 y.o, ht 170 cm (25th), wt 64 kg

(25th), hc 54 cm (5th)

Hypothyroidism

8a

Turkey

Died at

6 m.o.

F Y Y Y Y Y Y Y N Y N/A Myoclonic, complex partial.


phenobarbital

Normal cranial ultrasound after

birth.

Prominent occiput, frontal

bossing, bitemporal narrowing.

At 3.5 m.o., ht 59 cm (25th), wt 5.2 kg (20th), hc 40.7 cm

(50th)

Capillary hemangioma,

broad tip of the nose. Narrow palate, broad

alveolar ridge, short frenulum.

Died at 6 months after an epileptic

attack.

8b

Turkey

Died at

9 m.o.

M Y Y Y N Y Y Y N Y N/A Myoclonic


clonazepam, phenytoin, valproic acid, phenobarbital,

diazepam

Initial MRI normal, subdural

effusion and cortical atrophy

at 4 m.o.

at 4.5 m.o. ht 63 cm (30th), wt 7kg (50th), hc 42 cm

(30th)

Broad tip of the nose, high palate,

broad alveolar ridge. No

response to light. Died at 9 months after an epileptic

attack.

9 UK 2.5 y.o.

M N Y Y N Y Y Y N Y Incr

GTCS, multifocal myoclonic

jerks

9 w.o. Moderate control with valproic

acid and levetiracetam

Normal MRI

Asymmetric

brachycephaly

At 7 m.o., ht N/A, wt 7.6 kg (15th), hc

43.2 cm (15th)

Hydronephrosis left kidney, high arched palate.

1

0 USA

4

y.o. F N Y Y N Y Y Y Y Y Incr

GTCS,

complex

partial

8 m. Good control with

Leviteracetam

Delayed

myelination in

newborn period,

but normal at 3

years

At 4 y.o. ht 84 cm

(<3rd), wt 10.9 kg

(<3rd)

Coloboma left

retina, coarctation

of the aorta, hip

dysplasia, tethered

cord, sacral dimple,

Small low set ears,

wide nasal bridge,

slow hair growth,

1

1 Brazil

12

y.o. M N Y Y N Y Y Y N Y Incr No seizures N/A Dolichocephaly

At 12 y.o.,

ht 145 cm

(25th), wt.

44.8 kg

(65th), hc

54.5 cm

(60th)

Micrognathia,

bilateral epicanthal

folds, anteverted

nares, high-arched

palate

of 39

1

2

a

Belgiu

m

Died

at

3.8

y.o.

F N Y Y Y Y Y Y Y Y Incr GTCS 3 m. Resistant to

therapy.

Hyperintensities in

the pons

Metopic

ridge,

biparietal

narrowing,

At 3 m.o., Ht 3rd, Wt

3rd, hc 10-25th

Metopic ridge,

biparietal

narrowing,

unilateral hearing

loss. Short fixation,

abnormal eye

movements, and

intermittent

strabismus,

Aspiration

pneumonias,

dysplastic ears.

9

1

2

b

Belgiu

m

5

y.o. M N Y Y Y Y Y Y Y Y Incr Myoclonic 3 w. Poor control.

Thin corpus

callosum

At birth, normal

growth parameters

At 2 months, VEP

showed a weak

response, and ERG

was normal. Patent

ductus arteriosus,

dysplastic ears.

9

1

3 India

Died

at 3

m.o.

F Y Y Y Y Y Y Y N N N/A No seizures N/A Broad forehead

At birth,

2200 g

(<3rd), at

2.5 m.o., hc

33 cm

(<3rd)

Microcephaly,

progeroid

appearance, bilateral

low set ears,

dysplastic pinna, high

arched palate,

macrostomia,

submucous clefting

of palate, protruding

tongue, anteverted

nares, long smooth

philtrum,

hypertrichosis, broad

forehead

1

4

Netherl

ands

2.5

y.o. F N Y Y N N N Y Y Y Nl No seizures N/A

At 10 m.o.

ht 69cm

(15th), wt

6.6 kg

(<3rd), hc

42,5cm

(5th)

VSD, long eyelashes,

cleft palate, cup-

shaped ears

1

5 India

8

y.o. F N Y Y N Y Y Y N Y N/A

Focal

motor 4. y.o. Good control. Normal MRI

High

forehead

At 4.5 y.o., ht<3rd,

Wt<3rd

hc<3rd

Microcephaly,

horizontal

nystagmus

1

6

UK of

African

origin

6

y.o. M N Y Y N Y Y Y Y Y N/A GTCS

2y9m. Good control

with valproic acid.

Partial corpus

callosum agenesis.

Small lesion in

right putamen

suggestive of a

At 3y3m, wt 15.6 kg

(65th),

ht 93.1 cm (15th),

hc 48.1 cm (5th)

Severe gastro-

oesophageal reflux,

ASD requiring

surgical repair,

coarse facial

of 39

developmental

venous anomaly

features, low

frontal hairline,

webbed neck,

micrognathia,

midline groove of

lower lip, thick lips,

thickened gingiva,

long tongue,

anteverted

abnormally formed

ears. Severe

kyphoscoliosis

(congenital) and

calcaneovalgus.

Tracheomalacia,

tracheostomy,

multiple keloid scar

formation.

1

7

Lebano

n

1

y.o. F N Y Y N Y Y Y Y Y N/A No seizures Aplasia of falx cerebri

At 11w, lt

57 cm (8th),

wt 4.5 kg

(3rd), hc 36

cm (<3rd)

High frontal and

temporal hairline,

hypertelorism,

upslanting palpebral

fissures, broad nose,

low-set and

posteriorly rotated

ears. Hypoplastic

patellae. Uterus

bicornis,

hypercalcemia

1

8 Iran

14

y.o. M Y Y Y N N N Y N Y N/A GTCS

1 y.o. Good control with

phenobarbital N/A

Brachyceph

aly

At 14y.o., hc 50.5

(<3rd)

Multicystic left

kidney,

hypertrophic right

kidney, cleft palate,

bilat inguinal

hernia, short PF,

blepharophimosis,

microcornea,

telecanthus,

prominent nose,

bilateral narrowing

of ear canals, small

mouth,

malocclusion of

teeth, hallux valgus.

Affected sibling

passed away at 1.5

y.o.

of 39

1

9 USA

Died

at 3

w.o.

M N Y Y N Y Y Y N Y Nl No seizures

Dandy-Walker

malformation, agenesis

of the corpus callosum

At birth, lt

44 cm

(<3rd), wt

2.26 kg

(<3rd), hc 33

cm (17th)

Blindness, widely-

spaced nipples low-

set ears,

2

0 Canada

2

y.o. F N Y Y N Y Y Y Y Y Nl No seizures

Dandy-Walker

malformation, small

focal area of restricted

diffusion in the right

posterior basal ganglia

area

Large anterior

fontanelle,

microcephaly,

narrow bifrontal

diameter,

At 1 y.o., ht

<3rd, wt

<3rd, hc <3rd

Sparse fine hair,

morning glory

anomaly right optic

nerve, persistent left

superior vena cava

draining into the

coronary sinus, atrial

spetal defect, mild

tricuspid

regurgitation,

laryngomalacia, short

sternum, right

thoracic scoliosis,

low conus

medullaris, rocker

bottom feet, widely-

spaced nipples, high

arched palate, short

neck

2

1 Ireland

Died

at

10

y.o.

M N Y N Y Y N Y Y Y Nl

GTCS,

absence,

myoclonic

6 m.o. Normal MRI Dolichocep

haly

At 3y6m, ht 110 cm

(>97th), wt 19 kg

(95th), hc 58 cm

(>97th)

Double outlet right

ventricle, recurrent

chest infections,

supernumary

nipple, broad

alveolar ridge,

blind,

hydronephrosis.

2

2

UK of

Indian

origin

29

y.o. F N Y N N Y N Y Y N Nl

GTCS,

Complex

partial,

episodes of

status

epilepticus

3 m.o. Moderate

control with valproate,

levetiracetam,

pregabalin, phenytoin,

topiramate

Diffuse atrophy

cerebrum and

cerebellum,

asymmetric lateral

ventricles

At 29 y.o., wt 50 kg

(15th)

Long thin face, high

arched palate.

2

3 India

7

y.o. M Y Y Y Y Y N Y N N Nl GTCS

11m. Good control with

phenytoin and

phenobarbital

Normal MRI

6 y.o., ht 110 cm

(15th), wt 18 kg(15th),

hc 46.5 cm (<3rd)

Delayed permanent

dentition, small

teeth, cavities,

anteverted nares,

low set pinna, open

mouth, Autism

Spectrum Disorder.

of 39

Sibling with similar

phenotype died at

1y9m.

2

4 Poland

22

y.o. M Y Y Y Y Y Y Y N Y Nl No seizures N/A

At birth lt

57 cm

(>97th), ht

3.9 kg

(75th), hc 32

cm (4th)

Delayed teething,

haemangioma,

epicanthus of the left

eye, ptosis,

strabismus,

asymmetric face,

high arched palate.

8

2

5

New

Zealan

d

12

y.o. M N Y Y Y Y Y Y Y Y Nl

Infantile

spasms

1 y.o. Good control with

vigabatrin N/A

At 7 y.o., ht 188 cm

(>97th), wt 24 kg

(60th)

Broad nose, dental

misalignment and

irregularities,

Autism Spectrum

Disorder.

2

6 UK

15

y.o. M N Y Y Y Y Y Y N Y Nl No seizures N/A

At 5m, lt

64.5cm

(25th), wt

6.3 kg (5th),

hc 44.5 cm

(75th)

Premature birth

Abbreviations: Incr, Increased; N/A, not available; Nl, normal, Y, yes; N, No; abnl, abnormal; M, male; F, female; DD/ID,

developmental delay or intellectual disability, lt, length; ht, height; wt, weight; hc, head circumference; y.o., year old; m.o.,

month old; w.o., week old. GTCS, generalized tonic-clonic seizures. Individuals with letters a and b after the number are

siblings. Recent cognitive or developmental evaluations were not available for most individuals, but the global

development was estimated for individual 8a as that of 6-week-old when she was 12 weeks old, for individual 5a as that of

a 1 year old when he was 3 years old, and individual 1 had a developmental quotient of 55 with autistic spectrum disorder

when he was 4 years old. Formal audiometric test results were not available for most individuals, but the hearing loss was

qualified as profound sensorineural hearing loss in individuals 1, 2b, 3, 4, and 6. Cochlear implants have been beneficial

in individual 3. Antiepileptic drugs (AEDs) used or tried with limited success in individual 3 include oxcarbazepine,

clobazam, levetiracetam, valproic acid, lamotrigine, sulthiame, diazepam, clonazepam, midazolam, zonisamide, and

cortisone pulses. In family 8, DNA was not available from individual 8b, only for 8a and parents. Sensorineural hearing

loss was unilateral in individual 12a; in individual 15, it was severe on the right and moderate on the left. Recent cognitive

or developmental evaluations were not available for most individuals, but the intellectual disability or developmental delay

was categorised as mild for individual 24, moderate for individual 14, and severe for individuals 10, 11, 12a, 12b, 16, 21,

22, 23 and 25.

of 39

References

1. Cantwell RJ. Congenital sensori-neural deafness associated with onycho-osteo dystrophy and mental retardation

(D.O.O.R. syndrome). Humangenetik 1975; 26(3): 261-5.

2. Qazi QH, Nangia BS. Abnormal distal phalanges and nails, deafness, mental retardation, and seizure disorder: A

new familial syndrome. The Journal of Pediatrics 1984; 104(3): 391-4.

3. James AW, Miranda SG, Culver K, Hall BD, Golabi M. DOOR syndrome: clinical report, literature review and

discussion of natural history. Am J Med Genet A 2007; 143A(23): 2821-31.

4. Girish M, Mujawar N, Salodkar A. DOOR syndrome. Indian Pediatr 2011; 48(6): 479-81.

5. Michalek P, Donaldson W, Abraham A. Anaesthetic management of an adult patient with DOOR syndrome: a

case report. Cases J 2009; 2: 7593.

6. Mihci E, Guney K, Velipasaoglu S. DOOR (deafness, onychodystrophy, osteodystrophy, mental retardation)

syndrome in one of the twins after conception with intracytoplasmic sperm injection. Am J Med Genet A 2008; 146A(11):

1483-5.

7. Nomura T, Koyama N, Yokoyama M, Awaya A, Yokochi K. DOOR syndrome concomitant with non-convulsive

status epilepticus and hyperintense cerebellar cortex on T2-weighted imaging. Brain Dev 2009; 31(1): 75-8.

8. Wisniewska M, Siwinska Z, Felczak M, Wielkoszynski T, Krawczynski M, Latos-Bielenska A. A new case of DOOR

syndrome. J Appl Genet 2008; 49(1): 101-3.

9. van Bever Y, Balemans W, Duval EL, et al. Exclusion of OGDH and BMP4 as candidate genes in two siblings with

autosomal recessive DOOR syndrome. Am J Med Genet A 2007; 143(7): 763-7.

10. Helbig I, Lowenstein DH. Genetics of the epilepsies: where are we and where are we going? Curr Opin Neurol

2013; 26(2): 179-85.

11. Marini C, Conti V, Mei D, et al. PRRT2 mutations in familial infantile seizures, paroxysmal dyskinesia, and

hemiplegic migraine. Neurology 2012; 79(21): 2109-14.

12. Scheffer IE, Grinton BE, Heron SE, et al. PRRT2 phenotypic spectrum includes sporadic and fever-related infantile

seizures. Neurology 2012; 79(21): 2104-8.

13. Ishida S, Picard F, Rudolf G, et al. Mutations of DEPDC5 cause autosomal dominant focal epilepsies. Nat Genet

2013; 45(5): 552-5.

14. Dibbens LM, de Vries B, Donatello S, et al. Mutations in DEPDC5 cause familial focal epilepsy with variable foci.

Nat Genet 2013; 45(5): 546-51.

15. Nothnagel M, Herrmann A, Wolf A, et al. Technology-specific error signatures in the 1000 Genomes Project data.

Hum Genet 2011; 130(4): 505-16.

16. Burrage LC, Lu JT, Liu DS, et al. Early childhood presentation of Czech dysplasia. Clin Dysmorphol 2013; 22(2): 76-

80.

17. Shapiro JR, Lietman C, Grover M, et al. Phenotypic variability of osteogenesis imperfecta type V caused by an

IFITM5 mutation. J Bone Miner Res 2013; 28(7): 1523-30.

18. Campeau PM, Lu JT, Sule G, et al. Whole-exome sequencing identifies mutations in the nucleoside transporter

gene SLC29A3 in dysosteosclerosis, a form of osteopetrosis. Hum Mol Genet 2012; 21(22): 4904-9.

19. Campeau PM, Kim JC, Lu JT, et al. Mutations in KAT6B, encoding a histone acetyltransferase, cause

Genitopatellar syndrome. Am J Hum Genet 2012; 90(2): 282-9.

20. Sule G, Campeau PM, Zhang VW, et al. Next-generation sequencing for disorders of low and high bone mineral

density. Osteoporos Int 2013; 24(8): 2253-9.

21. Kelley LA, Sternberg MJ. Protein structure prediction on the Web: a case study using the Phyre server. Nat

Protoc 2009; 4(3): 363-71.

22. Blaise M, Alsarraf HM, Wong JE, et al. Crystal structure of the TLDc domain of oxidation resistance protein 2

from zebrafish. Proteins 2012; 80(6): 1694-8.

23. Afawi Z, Mandelstam S, Korczyn AD, et al. TBC1D24 mutation associated with focal epilepsy, cognitive

impairment and a distinctive cerebro-cerebellar malformation. Epilepsy Res 2013; 105(1-2): 240-4.

24. Corbett MA, Bahlo M, Jolly L, et al. A focal epilepsy and intellectual disability syndrome is due to a mutation in

TBC1D24. Am J Hum Genet 2010; 87(3): 371-5.

of 39

25. Falace A, Filipello F, La Padula V, et al. TBC1D24, an ARF6-interacting protein, is mutated in familial infantile

myoclonic epilepsy. Am J Hum Genet 2010; 87(3): 365-70.

26. Milh M, Falace A, Villeneuve N, et al. Novel Compound Heterozygous Mutations in TBC1D24 Cause Familial

Malignant Migrating Partial Seizures of Infancy. Hum Mutat 2013.

27. Guven A, Tolun A. TBC1D24 truncating mutation resulting in severe neurodegeneration. J Med Genet 2013;

50(3): 199-202.

28. Huang L, Wilkinson MF. Regulation of nonsense-mediated mRNA decay. Wiley Interdiscip Rev RNA 2012; 3(6):

807-28.

29. Wu C, Macleod I, Su AI. BioGPS and MyGene.info: organizing online, gene-centric information. Nucleic Acids Res

2013; 41(D1): D561-5.

30. Lattin JE, Schroder K, Su AI, et al. Expression analysis of G Protein-Coupled Receptors in mouse macrophages.

Immunome Res 2008; 4: 5.

31. Tavyev Asher YJ, Scaglia F. Molecular bases and clinical spectrum of early infantile epileptic encephalopathies.

Eur J Med Genet 2012; 55(5): 299-306.

32. Elliott NA, Volkert MR. Stress induction and mitochondrial localization of Oxr1 proteins in yeast and humans.

Mol Cell Biol 2004; 24(8): 3180-7.

33. Murphy KC, Volkert MR. Structural/functional analysis of the human OXR1 protein: identification of exon 8 as

the anti-oxidant encoding function. BMC Mol Biol 2012; 13: 26.

34. Oliver PL, Finelli MJ, Edwards B, et al. Oxr1 is essential for protection against oxidative stress-induced

neurodegeneration. PLoS Genet 2011; 7(10): e1002338.

35. Sieburth D, Ch'ng Q, Dybbs M, et al. Systematic analysis of genes required for synapse structure and function.

Nature 2005; 436(7050): 510-7.

36. Uytterhoeven V, Kuenen S, Kasprowicz J, Miskiewicz K, Verstreken P. Loss of skywalker reveals synaptic

endosomes as sorting stations for synaptic vesicle proteins. Cell 2011; 145(1): 117-32.

37. Pan X, Eathiraj S, Munson M, Lambright DG. TBC-domain GAPs for Rab GTPases accelerate GTP hydrolysis by a

dual-finger mechanism. Nature 2006; 442(7100): 303-6.

38. Yang Y, Muzny DM, Reid JG, et al. Clinical whole-exome sequencing for the diagnosis of mendelian disorders. N

Engl J Med 2013; 369(16): 1502-11.

39. Yu Y, Wu BL, Wu J, Shen Y. Exome and whole-genome sequencing as clinical tests: a transformative practice in

molecular diagnostics. Clin Chem 2012; 58(11): 1507-9.

40. Frasa MA, Koessmeier KT, Ahmadian MR, Braga VM. Illuminating the functional and structural repertoire of

human TBC/RABGAPs. Nat Rev Mol Cell Biol 2012; 13(2): 67-73.

of 39

Figures Legends

Figure 1. Flow diagram illustrating the enrollment process, genetic analyses and gene identification.

Figure 2. A-F) Photographs of the face in individuals with TBC1D24 mutations. Note the wide base of

the nose and bulbous end of the nose in some individuals (image-individual correspondence: a-3, b-

6, c-5a, d-2b, e-2a, f-7). G-L) Photographs of the hands in individuals with TBC1D24 mutations. Note

the triphalangeal thumbs, the brachydactyly, the short terminal phalanges and the hypoplasia or

aplasia of the nails (image-individual correspondence: g-3, h-6, i-5a, j-2b, k-2a, l-7). M-O) Photograph

of the feet in an individual with TBC1D24 mutations. Note the short terminal phalanges and the

hypoplasia or aplasia of the nails (image-individual correspondence: m-3, n-6, o-5a). P-S)

Radiographs of the hands in individuals with TBC1D24 mutations. Note the triphalangeal thumbs and

the short terminal phalanges (image-individual correspondence: p-4, q-5a, r-6, s-1). T-U)

Radiographs of the feet in individuals with TBC1D24 mutations. Note the short terminal phalanges

(image-individual correspondence: t-6, u-5a).

Figure 3. A) Location of the mutations identified in DOORS syndrome and in other epilepsy

syndromes. p.Phe251Leu (blue – homozygous mutation, affecting four siblings): focal epilepsy,

dysarthria, intellectual disability, cortical thickening, cerebellar atrophy23,24. p.Asp147His and

p.Ala515Val (red – compound heterozygous mutation, affecting seven individuals in one family):

Familial Infantile Myoclonic Epilepsy25. p.Ser324Thrfs*3 (brown – homozygous mutation, affecting five

individuals in one family): myoclonic epilepsy, dystonia, hemiparesis, autonomic signs, lethargy,

of 39

progressive diffuse cerebral atrophy27. p.Phe229Ser and p.Cys156* (green – compound

heterozygous mutation affecting two siblings): familial malignant migrating partial seizures of infancy,

progressive diffuse cerebral atrophy26. The diagram also illustrates the exonic structure of TBC1D24,

with the introns not drawn to scale.

B) Real-time PCR of TBC1D24 in fibroblasts from the individual with a frameshift deletion and a

splicing mutation (Nl stands for Normal control fibroblasts, and 3 refers to individual 3) showing

significant reduction of TBC1D24 mRNA in affected fibroblasts. C) Western blot analysis of the cells

used for panel B, showing TBC1D24 protein is undetectable by this method in affected fibroblasts. D)

Structural model of TBC1D24 with the TBC domain colored in cyan and the TLDc domain colored in

gray. The N- and C-termini are labeled, and the red spheres show the alpha carbon atoms of the

residues aligning with the arginine and glutamine fingers interacting with the GTP of Rab proteins in

other TBC proteins40, based on the structure of Gyp1p in complex with Rab3337. The carbon atoms of

residues substituted in DOOR/S syndrome are shown with magenta spheres and those substituted in

other epilepsy syndromes are shown with black spheres.

of 22

Supplementary Data for:

The genetic basis of DOORS syndrome: an exome sequencing study.

Philippe M Campeau, Dalia Kasperaviciute, James T Lu, Lindsay C Burrage, Choel Kim, Mutsuki Hori, Berkley R Powell, Fiona Stewart, Têmis Maria

Félix, Jenneke van den Ende, Marzena Wisniewska, Hülya Kayserili, Patrick Rump, Sheela Nampoothiri, Salim Aftimos, Antje Mey, Lal D.V. Nair, Michael

L Begleiter, Isabelle De Bie, Girish Meenakshi, Mitzi L. Murray, Gabriela M Repetto, Mahin Golabi, Edward Blair, Alison Male, Fabienne Giuliano, Ariana

Kariminejad, William G Newman, Sanjeev S Bhaskar, Jonathan E Dickerson, Bronwyn Kerr, Siddharth Banka, Jacques C Giltay, Dagmar Wieczorek, Anna

Tostevin, Joanna Wiszniewska, Sau Wai Cheung, Raoul C. Hennekam, Richard A Gibbs, Brendan H Lee, Sanjay M Sisodiya.

Contents

Supplementary Methods. Exome sequencing and analysis, Immunohistochemistry and Western blotting. .............................................................................. 2

Supplementary Table 1. Genetic analyses performed for each affected individual. ................................................................................................................... 4

Supplementary Table 2. Primers used for Sanger sequencing and real-time PCR. ................................................................................................................... 6

Supplementary Table 3. Table illustrating the process by which we identified recurrent mutations in TBC1D24 in the cohort of individuals with DOOR/S

syndrome. .................................................................................................................................................................................................................................... 7

Supplementary Table 4. Annotations for all known variants in TBC1D24................................................................................................................................... 8

Supplementary Table 5. Candidate regions from SNP array or homozygosity mapping of exome data. ................................................................................. 11

Supplementary Table 6. Review of the expression data on TBC1D24 in human and mouse tissues, detected at the level of mRNA or protein, from

publications or public databases. .............................................................................................................................................................................................. 13

Supplementary Table 7. Coverage data for candidate genes. .................................................................................................................................................. 14

Supplementary Table 8. Candidate gene analysis from exome data in 10 individuals without TBC1D24 mutations. .............................................................. 15

Supplementary Table 9. Gene names for recessive model from exome data in 10 individuals without TBC1D24 mutations. ................................................ 16

Supplementary Figure 1. Conservation across species of the residues affected by missense substitutions. .......................................................................... 17

Supplementary Figure 2. Additional Tbc1d24 expression data from public databases. ........................................................................................................... 18

Supplementary Figure 3. Tbc1d24 expression profiling. ........................................................................................................................................................... 19

Supplementary Discussion. 2-Oxoglutaric aciduria and DOORS syndrome types. .................................................................................................................. 20

References ................................................................................................................................................................................................................................ 21

of 22

Supplementary Methods. Exome sequencing and analysis, Immunohistochemistry and Western blotting.

Exome sequencing and analysis: Whole exome sequencing was performed by first fragmenting DNA and then creating libraries that were enriching for

exon-coding regions using various capture reagents. The capture reagent varied depending on where and when the capture was performed as exome

sequencing was completed at the Baylor College of Medicine, the University College London and the University of Manchester (details on each sample are

given in Supplementary Table 1). The capture reagent was either Illumina's TruSeq capture reagent (Illumina Inc., San Diego, CA), Agilent's SureSelect

capture reagent (Agilent Technologies, Santa Clara, CA), or Roche Nimblegen's Baylor VCRome capture reagent (Roche NimbleGen, Madison, WI).

Capture was performed according to the manufacturer’s protocol. Next-generation sequencing was performed on Illumina HiSeq 2000 (Illumina, San

Diego, CA) for all samples. Sequence reads were aligned to the hg19 iteration of the reference human genome using BWA (v 0.5.9)1. Base score

recalibration and local realignment for indel (insertion or deletion) detection and duplicate removal2,3 were performed with GATK. SNVs were called using

Samtools mpileup (version 0.1.17)4 and short indels (insertions and deletion) were called using Samtools5, Atlas-INDEL6, and GATK3 (indels included in

our variant list had to be detected by all three programs, to decrease false-positive rates). Variants were annotated with ANNOVAR7. Protein-impacting

variants that are rare (minor allele frequency <1%) or novel were preferentially explored. Candidate genes and variants were then assessed using

databases such as dbNSFP which annotates the functional impact and the conservation of the mutated residues8, Uniprot for the function of the proteins9,

NeXtProt10 for the expression pattern, Mouse Genome Informatics11 and NCBI’s OMIM12 for the phenotypes in mice and humans, and finally

Genedistiller213 for a combination of some of the above databases. Homozygosity mapping from exome data using VCF variant files was achieved using

HomozygosityMapper14 and regions of homozygosity were analyzed for known disease-causing genes using the Genomic Oligoarray and SNP array

evaluation tool v1.015. We define variants as rare when they have a minor allele frequency (MAF) below 1% in the Exome Variant Server16, as novel when

absent from this database, and as protein-impacting when variants change the coding sequence of the protein (substituting an amino acid, causing an in-

frame or out-of-frame deletion or insertion, a premature stop codon or altering a stop codon) or potentially affect splicing (nucleotide change within five

bases of splice-donor or splice-acceptor sites).

Immunohistochemistry: C57BL/6 whole embryos (E16.5) or limbs (P2) were fixed in 4% PFA at 4°C overnight, washed with PBS, dehydrated using ethanol

then embedded in paraffin for sectioning. Sectioned tissues were deparaffinized with xylene then rehydrated. Sections were rinsed with PBS, blocked with

of 22

3% Donkey Serum in 0.1% BSA and 0.1% Triton. Slides were then incubated overnight with a mouse monoclonal IgG1 antibody against an epitope

mapping between amino acids 437-559 at the C-terminus of TBC1D24 of human origin (clone G-6, catalog number sc-390237, Santa Cruz Biotechnology,

Santa Cruz, CA). The antibody is provided at 200 µg/ml and was diluted at 1:200 for the immunohistochemistry (a control slide without primary antibody

was also included). After rinsing, the slides were incubated for 1h in Alexa Fluor® 594 goat anti-rabbit IgG (Invitrogen product number A-11012, 1:600

final dilution in blocking buffer). After further rinsing, slides were mounted with ProLong® Gold antifade reagent with DAPI for imaging. Slides were viewed

with a Zeiss Axioplan 2 fluorescence microscope, and images were taken using the same exposure parameters consistently for all images.

Western blotting: Proteins were extracted in 50 mM Tris-HCl pH7.5, 150 mM NaCl, 1% Triton X100, 1X Complete Protease Inhibitor Cocktail (Roche

NimbleGen, Madison, WI), resolved in 4-15% gradient SDS-PAGE gels (Bio-Rad, Hercules, CA) and transferred to PVDF membranes for western blot

analyses. For TBC1D24, the same antibody was used as for immunohistochemistry, at a dilution of 1:1000 (for the mouse brain lysate) or 1:100 (for the

human fibroblast lysate), then an HRP-conjugated rabbit anti-mouse IgG antibody was used for detection (1:10,000 dilution, BioRad, Hercules, CA), and

for control, a mouse monoclonal antibody to GAPDH directly conjugated to HRP (1:20,000 dilution, Clone GAPDH-71.1, Sigma-Aldrich Co, St-Louis, MO)

was used.

of 22

Supplementary Table 1. Genetic analyses performed for each affected individual.

Individual number

Exome sequencing Genetic mapping Sanger sequencing

1 Exome sequencing (Nimblegen Baylor VCRome, 90X

average coverage, 90% targeted base covered at ≥20X).

Sanger sequencing confirmation of TBC1D24 mutations in proband and parents.

2a Exome sequencing (Nimblegen Baylor VCRome, 95X


Sanger sequencing confirmation of TBC1D24 mutations in proband and parents

2b Sanger sequencing for TBC1D24 mutations

identified in sibling. Confirmation of mutations in each parent.






Homozygosity mapping by SNP

array.


5a Exome sequencing, completed after the initial 15 sample

analysis (Nimblegen Baylor VCRome, 99X average coverage, 92% targeted base covered at ≥20X).

Sanger sequencing confirmation of TBC1D24

mutations in proband and parents.

5b Sanger sequencing for variants identified in sibling.


6 Sanger sequencing for TBC1D24. Confirmation of

TBC1D24 mutations in one parent.

7 Sanger sequencing for TBC1D24. Confirmation of

TBC1D24 mutations in parents.

8 Exome sequencing (Illumina TruSeq, 70X average

coverage, 89% targeted base covered at ≥20X).

Homozygosity mapping from exome

data.


9 Exome sequencing (Agilent SureSelect, 105X average



10 Sanger sequencing for TBC1D24.



12a Exome sequencing (Nimblegen Baylor VCRome, 94X

average coverage, 90% targeted base covered at ≥20X). Haplotype mapping by

SNP array.

12b Haplotype mapping by

SNP array.


of 22







18 Exome sequencing, completed after the initial 15 sample

analysis (Nimblegen Baylor VCRome, 135X average coverage, 90% targeted base covered at ≥20X).

Homozygosity mapping from exome data.









Homozygosity mapping from exome

data.



Homozygosity mapping by SNP

array.


26 Exome sequencing (Illumina TruSeq, 33X average


of 22

Supplementary Table 2. Primers used for Sanger sequencing and real-time PCR.

Primer name Oligonucleotide sequence

Sanger sequencing of human genomic DNA (coding exons and intron-exon boundaries for TBC1D24 variant 1, NCBI CCDS ID#55980.1)

TBC1D24ex2F TTTAGCCACTCTGTCCTCCC

TBC1D24ex2R TCACGCCAGACACGTCC

TBC1D24ex3F GGGGATCGGTACTCACACTAAC

TBC1D24ex3R AGTCAGCCTGGTGGAAAGAC

TBC1D24ex4F GCTCTGGGGCATACCTCG

TBC1D24ex4R TCTGTGGGCAGGACACG

TBC1D24ex5F GAGGGTGTGCAGGGTGAC

TBC1D24ex5R GAAGCCCATCAGAGCCAG

TBC1D24ex6F TAGTCTGGAGCACAGGGACG

TBC1D24ex6R GGTGCTCCTGGAGGGATG

TBC1D24ex7F ATGAAACGGGTTGTGGCTC

TBC1D24ex7R CTTCAGCTGCCCGGACC

TBC1D24ex8F2 GCCTGGGTCAGTGCTGATAG

TBC1D24ex8R2 GGCTGCCTAGAGAGGCTCAG

Real-time PCR for human samples

hTBC1D24-1:1255U28 TTTGGGACCGGAGAATGCTTTGTGTTTA

hTBC1D24-1:1441L26 TCGGTCTTGGAGGGCAGGTTGAAGTG

Real-time PCR for mouse samples

mTbc1d24-1:5563U30 AGACCTGCTCTCTCATATCTTCACTAAATC

mTbc1d24-1:5714L26 TGGCACTCATGCTTGACATAACAACT

of 22

Supplementary Table 3. Table illustrating the process by which we identified recurrent mutations in TBC1D24 in the cohort of individuals with DOOR/S syndrome. As described in the methods and results, the automated variant identification pipeline leaves several “false-positive” variants which need to be visually assessed on the exome alignments and compared to controls.

Exomes with genes in common (every possible combination of

exomes)

Number of genes in the automated output following an autosomal recessive

inheritance pattern (1 homozygous variant or 2 heterozygous variants)

Number of genes excluded by visualization (exclusion of false-

positive calls from the automated pipeline).

Genes remaining after visualization and curation

of the candidate list

15 exomes 1 1 0

14 exomes 5 5 0

13 exomes 3 3 0

12 exomes 3 3 0

11 exomes 8 8 0

10 exomes 8 8 0

9 exomes 10 10 0

8 exomes 24 24 0

7 exomes 25 25 0

6 exomes 31 30 1 (TBC1D24)

of 22

Supplementary Table 4. Annotations for all known variants in TBC1D24.

Cohort hg19 position dbSNP ID

cDNA position

(NM_001199107.1)

Protein variant Variant type

Minor allele frequency (MAF) in

EVS/number of chromosomes

Homozygosity

frequency in EVS

Conservation Score

PhastCons*

Conservation Score GERP

*

Grantham Score*

Polyphen2 (Class:Score)*

DOORS syndrome

chr16:2546207C>G rs201257588

c.58C>G p.(Gln20Glu) missense 0/12714 0 0.996 5.6 29 N/A

DOORS syndrome

chr16:2546267C>T N/A c.118C>T p.(Arg40Cys) missense 0/12620 0 0.959 5.6 180 probably-

damaging:1 DOORS

syndrome chr16:2546268G>T N/A c.119G>T p.(Arg40Leu) missense 0/12634 0 0.995 5.6 102

probably-damaging:1

DOORS syndrome

chr16:2546477G>A N/A c.328G>A p.(Gly110Ser) missense 0/12768 0 0.831 5.6 56 probably-

damaging:1 DOORS

syndrome chr16:2546873C>T N/A c.724C>T p.(Arg242Cys) missense 0/12732 0 0.996 4.2 180

probably-damaging:1

DOORS syndrome

chr16:2548254G>T N/A c.999G>T p.(Leu333Phe) missense 0/12722 0 0.997 2.55 22 probably-

damaging:1 DOORS

syndrome chr16:2548263delT N/A c.1008delT p.(His336Glnfs*12) frameshift 2/12234=0.00033 0 0.216 5.6 N/A N/A

DOORS syndrome

chr16:2549426G>A N/A c.1206+5G>

A splicing intron 0/12432 0 0.97 4.71 N/A N/A

Other epileptic

syndromes chr16:2546588G>C N/A c.439G>C p.(Asp147His) missense 1/12827=0.0001 0 0.476 5.6 81

probably-damaging:1

Other epileptic

syndromes chr16:2546617C>A N/A c.468C>A p.(Cys156*) stop-gain 0/12896 0 1 4.11 N/A N/A

Other epileptic

syndromes chr16:2546835T>C N/A c.686T>C p.(Phe229Ser) missense 0/12672 0 0.877 5.43 155

probably-damaging:0.99

9

Other epileptic

syndromes chr16:2546900T>C N/A c.751T>C p.(Phe251Leu) missense 0/12738 0 1 5.24 22

possibly-damaging:0.87

1

Other epileptic

syndromes

chr16:2547714_2547715delGT

N/A c.969_970de

lGT p.(Ser324Thrfs*3) frameshift N/A 0 0.991 -4.68 N/A N/A

Other epileptic

syndromes chr16:2550823C>T N/A c.1544C>T p.(Ala515Val) missense 0/12790 0 0.965 5.79 64

probably-damaging:1

EVS chr16:2546171T>C rs77585883

c.22T>C p.(Cys8Arg) missense 1/12653=0.00016 0 1 4.48 180 benign:0.0

EVS chr16:2546225G>T N/A c.76G>T p.(Glu26*) stop-gain 1/12713=0.00016 0 1 4.63 N/A N/A

EVS chr16:2546226A>T N/A c.77A>T p.(Glu26Val) missense 1/12711=0.00016 0 1 5.6 121 benign:0.007

EVS chr16:2546318C>T rs202162520

c.169C>T p.(Arg57Cys) missense 25/12695=0.00393 0 1 4.59 180 probably-

damaging:0.99

of 22

4

EVS chr16:2546319G>A N/A c.170G>A p.(Arg57His) missense 1/12779=0.00016 0 0.997 2.59 29 benign:0.002

EVS chr16:2546327C>T N/A c.178C>T p.(Arg60Trp) missense 1/12765=0.00016 0 0.935 3.48 101 probably-

damaging:0.994

EVS chr16:2546328G>A rs200226466

c.179G>A p.(Arg60Gln) missense 5/12767=0.00078 0 0.629 -0.34 43 benign:0.03

EVS chr16:2546346C>T N/A c.197C>T p.(Thr66Met) missense 1/12821=0.00016 0 0.953 5.6 81 possibly-

damaging:0.645

EVS chr16:2546366G>A N/A c.217G>A p.(Val73Met) missense 2/12856=0.00031 0 1 5.6 21 probably-

damaging:1.0

EVS chr16:2546489G>A N/A c.340G>A p.(Val114Met) missense 2/12780=0.00031 0 0.998 5.6 21 probably-

damaging:1.0

EVS chr16:2546492C>T N/A c.343C>T p.(Arg115Cys) missense 1/12779=0.00016 0 1 5.6 180 probably-

damaging:1.0

EVS chr16:2546493G>A rs201174513

c.344G>A p.(Arg115His) missense 1/12785=0.00016 0 1 4.63 29 benign:0.1

EVS chr16:2546606G>A N/A c.457G>A p.(Glu153Lys) missense 1/12873=0.00016 0 0.997 5.27 56 probably-

damaging:1.0

EVS chr16:2546642G>A rs200926225

c.493G>A p.(Gly165Ser) missense 22/12798=0.00343 0 0.072 -1.79 56 benign:0.001

EVS chr16:2546790G>A rs200324356

c.641G>A p.(Arg214His) missense 14/12708=0.0022 0 1 5.43 29 probably-

damaging:0.997

EVS chr16:2546840G>A N/A c.691G>A p.(Val231Ile) missense 1/12699=0.00016 0 0.959 5.43 29 possibly-

damaging:0.935

EVS chr16:2546880C>T N/A c.731C>T p.(Ala244Val) missense 1/12727=0.00016 0 0.153 5.24 64 probably-

damaging:1.0

EVS chr16:2546883T>C N/A c.734T>C p.(Leu245Pro) missense 1/12725=0.00016 0 0.927 5.24 98 probably-

damaging:1.0

EVS chr16:2546934C>T rs201060500

c.785C>T p.(Ser262Leu) missense 32/12720=0.00502 0 0.467 5.24 145 possibly-

damaging:0.934

EVS chr16:2546957C>T N/A c.808C>T p.(Arg270Cys) missense 1/12851=0.00016 0 0.994 5.24 180 probably-

damaging:1.0

EVS chr16:2547020G>A N/A c.871G>A p.(Ala291Thr) missense 1/12827=0.00016 0 0.959 4.09 58 possibly-

damaging:0.863

EVS chr16:2547026C>T N/A c.877C>T p.(Arg293Cys) missense 1/12835=0.00016 0 1 5.09 180 probably-

damaging:1.0

EVS chr16:2547027G>A rs199700840

c.878G>A p.(Arg293His) missense 7/12807=0.00109 0 1 5.09 29 probably-

damaging:1.0

EVS chr16:2547034C>G rs72768728

c.885C>G p.(Phe295Leu) missense 106/12472=0.01685 0.00016 0.989 -0.32 22 benign:0.114

EVS chr16:2547101G>A N/A c.952G>A p.(Val318Met) missense 1/12473=0.00016 0 0.94 5.09 21 probably-

damaging:0.99

of 22

2

EVS chr16:2547122G>T N/A c.965+8G>T Near splice site Intronic 1/12371=0.00016 0 0 -4.14 N/A N/A

EVS chr16:2548294G>A N/A c.1039G>A p.(Val347Met) missense 1/12751=0.00016 0 1 5.6 21 probably-

damaging:0.999

EVS chr16:2548307G>A N/A c.1052G>A p.(Arg351Lys) missense 1/12769=0.00016 0 0.995 5.6 26 probably-

damaging:0.993

EVS chr16:2548327C>A N/A c.1072C>A p.(Pro358Thr) missense 1/12651=0.00016 0 1 5.6 38 probably-

damaging:1.0

EVS chr16:2549352C>T rs73490287

c.1143-6C>T Near splice site intronic 242/12140=0.03909 0.00113 0.179 -0.84 N/A N/A

EVS chr16:2549411C>T rs61731477

c.1196C>T p.(Thr399Met) missense 35/12471=0.0056 0 0.991 5.67 81 possibly-

damaging:0.94

EVS chr16:2549891A>C N/A c.1262A>C p.(Lys421Thr) missense 1/12319=0.00016 0 0.995 5.65 78 benign:0.328

EVS chr16:2550293G>A rs141399869

c.1327G>A p.(Glu443Lys) missense 22/12426=0.00353 0 0.992 5.36 56 probably-

damaging:0.993

EVS chr16:2550333C>T rs200641000

c.1367C>T p.(Pro456Leu) missense 2/12572=0.00032 0 0 2.01 98 benign:0.0

EVS chr16:2550347G>A rs201911646

c.1381G>A p.(Ala461Thr) missense 2/12600=0.00032 0 0 -3.57 58 benign:0.0

EVS chr16:2550350G>A N/A c.1384G>A p.(Glu462Lys) missense 2/12606=0.00032 0 0.681 4.2 56 benign:0.0

EVS chr16:2550377G>A N/A c.1411G>A p.(Ala471Thr) missense 1/12561=0.00016 0 0 -10.2 58 benign:0.0

EVS chr16:2550393C>A rs202216463

c.1427C>A p.(Ala476Asp) missense 38/12436=0.00609 0 0.003 3.84 126 possibly-

damaging:0.835

EVS chr16:2550456T>C N/A c.1490T>C p.(Met497Thr) missense 1/12395=0.00016 0 1 5.49 81 possibly-

damaging:0.848

EVS chr16:2550849C>T rs78644690

c.1570C>T p.(Arg524Trp) missense 1/12765=0.00016 0 1 5.79 101 benign:0.106

EVS chr16:2550904A>G N/A c.1625A>G p.(Asn542Ser) missense 1/12767=0.00016 0 1 3.39 46 benign:0.001

EVS chr16:2550921G>A rs201649140

c.1642G>A p.(Val548Met) missense 2/12718=0.00031 0 0.039 -2.49 21 benign:0.115

*Notes: N/A, Not available. Data for the mutations in DOORS and other epileptic syndromes were generated using the SeattleSeq Annotation server:

http://snp.gs.washington.edu/SeattleSeqAnnotation137. Data for other TBC1D24 variants found in the population are from the Exome Variant Server

(EVS), NHLBI GO Exome Sequencing Project, Seattle, WA (http://evs.gs.washington.edu/EVS/), data release ESP6500SI-V2 accessed July 27th 2013.

PhastCons score17: conservation of the mutated nucleotide among 17 vertebrate species, with 1 being the most conserved. Genomic Evolutionary Rate

Profiling (GERP) score18: A score for constrained DNA elements in 29 mammalian species, ranges from -12.3 to 6.17, with 6.17 being the most conserved.

Grantham score19: Categorizes codon replacements into classes of increasing chemical dissimilarity, ranges from 5 to 215, with 5 being the most

similar.PolyPhen2 (Class:Score): Prediction of possible impact of an amino acid substitution on protein structure and function based on Polymorphism

Phenotyping (PolyPhen2) program. It lists both the PolyPhen2 prediction class and the score separated by a colon.

of 22

Supplementary Table 5. Candidate regions from SNP array or homozygosity mapping of exome data.

Individual 4. Homozygous for TBC1D24 mutation. Region containing TBC1D24 is emboldened below.

Individual 8. Homozygous for TBC1D24 mutation. Region containing TBC1D24 is emboldened below.

Individuals 12a and b. TBC1D24 is not mutated and is not in the regions of haplotype sharing between affected siblings.

Individual 18. TBC1D24 is not mutated and is not in the regions of homozygosity.



chr1:18559122-48222050 chr1:73064758-74147725 chr1:142535628-149671593 chr1:169248783-181528472 chr1:216813244-235760817 chr2:18674-1531755 chr2:15106804-20381830 chr2:81191209-82548471 chr2:95344824-98673494 chr3:30200658-46704229 chr3:48413537-49708502 chr3:88636898-89960347 chr3:157313589-172002955 chr3:180368253-181375474 chr4:427376-1603196 chr4:2403365-6550849 chr4:146875551-183569127 chr5:27308663-46181048 chr5:50237267-69840276 chr5:70392462-73380747 chr6:27741682-28982287 chr6:83619375-137573291 chr7:18630208-89807586 chr8:654796-19867220 chr8:120216957-128330178 chr9:47352-3765395 chr9:43382804-46433829 chr9:65529441-70984188 chr9:138482453-141114095 chr10:5624038-26020424 chr10:46208186-47587136 chr10:108667108-120109482 chr11:95724719-106523224 chr12:1618202-3183027 chr12:10131684-11226421 chr12:79995615-87922782 chr13:20221855-25110139 chr14:38592912-39685539 chr15:25092266-36594061

chr2:905687-1926437 chr3:187416666-197566254 chr4:175598334-185587165 chr4:187179210-189018486 chr7:142626549-148851213 chr8:8234077-17612875 chr8:19221700-24811065 chr8:29927300-38854041 chr8:144732418-144809804 chr10:128202435-129917560 chr10:135076596-135184126 chr11:237087-400109 chr11:5172786-5373646 chr15:51783820-52689631 chr15:89169858-89402596 chr16:103517-1447278 chr16:1877698-2891212 chr16:3170188-3724465 chr17:43342141-44248814 chr17:67031457-70943990 chr19:15508362-15760881 chr19:37441111-37488499 chr22:29704662-44681612

chr1:8828888-18505944 chr1:36909349-38597706 chr2:43239638-49496567 chr2:75860115-159321442 chr3:170726718-188139229 chr4:1-6171166 chr4:35994365-39863991 chr4:72851507-83647447 chr5:63147642-76611767 chr5:94735770-107223054 chr6:27102585-28363728 chr8:101942255-127935307 chr10:30691954-77076960 chr12:27552995-96409294 chr12:125502505-126740922 chr13:1-21704372 chr14:52533961-56368086 chr14:85900219-101102993 chr14:102590515-106353025 chr15:1-34007269 chr15:38349182-55907488 chr15:64289669-89823662 chr16:53562822-77713252 chr17:1729707-75689041 chr20:32270552-32928371 chr21:22104937-26771217

chr1:19166294-19549343 chr1:34383662-36814473 chr1:43675467-44569098 chr1:49332969-53333116 chr1:92262874-94335194 chr1:151109641-151413613 chr1:152278924-152538358 chr1:153747616-154245142 chr1:155059851-156107532 chr1:216595306-220928313 chr1:227968222-228482010 chr2:20884550-30381505 chr2:45774050-56603118 chr2:212242745-216973890 chr3:48019258-48897078 chr3:49734377-51752020 chr3:51907736-52467551 chr3:174814920-182631654 chr4:78106123-88536901 chr4:88536952-98965696 chr4:166159933-175899001 chr5:138876953-140052424 chr5:140626571-141014494 chr5:159912418-167674370 chr6:42146663-43753212 chr6:151365956-165693624 chr7:12644033-23353160 chr7:23353231-31127158 chr9:8500690-27047241 chr9:30690073-33289187 chr9:33799218-34724987 chr9:34725069-39149855 chr9:70871944-90733797 chr10:5324876-11047307 chr10:74268031-76854564 chr10:116335246-125780758 chr10:125780759-131334768 chr11:6007772-6585007 chr11:65617324-66262606

chr1:12779560-14143003 chr1:65113568-84880380 chr1:92647532-94343233 chr1:156526444-156640678 chr1:158390252-158655036 chr2:11738091-74007136 chr2:168099738-168115769 chr2:186655726-189875421 chr2:207621759-209224875 chr2:219903258-220333950 chr3:5241309-13421150 chr3:46399798-47539751 chr3:182631792-184429414 chr4:103911069-126373789 chr4:167012381-177073026 chr5:52942083-55155402 chr9:125239253-127101924 chr10:123298158-125506302 chr10:134997480-135233541 chr11:5373646-5510497 chr11:56756399-58478084 chr11:66099987-68549340 chr11:119005088-120175749 chr12:10958658-11339020 chr14:92084004-97321689 chr16:20638576-27356203 chr16:71318001-72832135 chr17:17075181-20163529 chr17:26824156-36493598 chr17:39646021-40048613 chr19:44500478-44610798 chr19:52869022-53077411

chr1:35369014-36652619 chr1:49352177-50648032 chr2:62859647-64434512 chr2:223436607-237629101 chr3:48964772-50431592 chr3:163500280-164906038 chr4:102076982-103228545 chr6:74517352-75539142 chr6:145518707-146575337 chr7:68908066-69952187 chr8:2275178-4122628 chr8:4559317-5745690 chr8:6160312-8433876 chr8:47768915-48852225 chr8:112021630-113403001 chr9:41626142-47212247 chr9:65529441-68167836 chr10:55418087-59905060 chr10:83600968-95398330 chr11:48735952-50056195 chr11:65642495-118743286 chr12:88324226-89339129 chr16:32139546-33828679 chr17:27916023-29025184 chr22:28235162-29457582

of 22

chr15:64675313-67467507 chr15:82451052-83768391 chr16:61971-5863931 chr16:31857841-34277622 chr17:4256652-13681058 chr17:67449386-75661063 chr18:10313183-11510046 chr18:12072364-15410816 chr18:18546888-29235471 chr19:1512093-8358349 chr20:33451706-34853295 chr21:27658905-32218481 chr22:31532960-32569263 chr22:42867332-51243435

chr12:88627488-106410149 chr12:106410273-129298779 chr15:32744836-40582167 chr15:40582169-45361180 chr15:45365905-50784950 chr15:50785054-63349096 chr16:20410547-21145648 chr16:46435519-49764948 chr16:66861966-67679348 chr17:7286326-7664239 chr17:16748833-18314913 chr17:19091317-20321413 chr17:27905673-29848460 chr17:37790371-38609187 chr17:39967442-40459562 chr17:40818584-41196408 chr18:26245796-29709473 chr18:29709613-36915294 chr19:36633277-38688977 chr19:42474200-43285368 chr22:23242127-24579049 chr22:25574507-29104955 chr22:29806132-33670584

of 22

Supplementary Table 6. Review of the expression data on TBC1D24 in human and mouse tissues, detected at the level of mRNA or protein, from

publications or public databases. See also Supplementary Figure 1.

Source and reference

Method Species Summary Link

Manuscript by Guven et al.20

RNA - real-time PCR

Mouse High expression of the RNA in the parietal cortex, corpus callosum and brainstem, and they showed that non-neural tissues express isoform 2 that lacks the short third exon.

Manuscript by Falace et al.21

RNA in situ hybridization

Mouse High expression of the RNA in the brain, more specifically in the deep cortical layers of the neocortex and in the hippocampus.

Allen Brain Atlas22


Mouse Highest levels are seen in the isocortex (all regions including

auditory areas, highest in somatomotor area) and the hippocampal formation (Ammon's horn and the dentate gyrus).

http://mouse.brain-map.org/experiment/show?id=69531049.

Eurexpress Transcriptome

Atlas23


Mouse High levels of RNA are detected in the embryonic mouse brain, spinal cord, peripheral nervous system, ganglia, eye, nose and

liver.

http://www.eurexpress.org/ee/databases/assayMontage.jsp?assayID=euxassay_0109

49.

BioGPS24 RNA

microarray Mouse

Higher levels in the salivary and adrenal glands, various bone marrow-derived cells, osteoclasts, osteoblasts, retinal cells, and various regions of the brain (cortex, amygdala, hippocampus,

hypothalamus, cerebellum, olfactory bulb).

http://biogps.org/#goto=genereport&id=57465.

Geneinvestigator25

RNA microarray

Human and

mouse

Highest expression in mice is in the cortex and hippocampus, and intermediate levels in other regions of the brain, the retina, the peripheral nervous system, the intestinal tract, osteoclasts,

the liver and some bone marrow-derived cells. In human tissues, highest levels are in pyramidal neurons, various regions of the

brain, the kidney, the salivary glands, the adipose tissue, osteoblasts, the thyroid, the liver and mammary glandular cells.

https://www.genevestigator.com.

RNA-seq Atlas26

RNA-seq Human High levels in the hypothalamus and the kidney. http://medicalgenomics.org/rna_seq_atlas.

Human Protein Atlas27

Immunohistochemistry

Human High levels were detected in glandular cells of the digestive tract

and the uterus, in renal tubular cells, and in chondrocytes. http://www.proteinatlas.org/ENSG0000016

2065/normal.

of 22

Supplementary Table 7. Coverage data for candidate genes. Included are the five genes encoding proteins with TLDc domain (including TBC1D24) and

for RAB3GAP2, in the 10 samples without TBC1D24 mutations. For TBC1D24, regions with low coverage were visually assessed on BAM files and

Sanger sequenced if not covered, in order not to miss a mutation. The average proportion of coding bases with at least 10X coverage for TBC1D24 was

100% for the Nimblegen Baylor VCRome capture reagent, 94% for the Agilent SureSelect capture reagent, and 90% for the Illumina TruSeq capture

reagent.

Gene name Transcript ID Average coverage for coding bases % of coding bases with ≥10X coverage

TBC1D24 NM_001199107 66X 97.2%

NCOA7 NM_001122842 125X 99.9%

OXR1 NM_001198532 131X 99.3%

KIAA1609 NM_020947 89X 95.4%

C20orf118 NM_080628 75X 92.8%

RAB3GAP2 NM_012414 147X 99%

of 22

Supplementary Table 8. Candidate gene analysis from exome data in 10 individuals without TBC1D24 mutations. The same strategy for exome analysis

was applied as described in the methods and Table 1. Genes with variants in three or fewer samples from the automated output are still being considered

as candidates at the moment. The names of the genes where rare/novel variants were detected in multiple samples by the automated output for the

recessive model are given in the next table.

Recessive inheritance model De novo dominant inheritance model

Exomes with genes in common (every possible combination of

cases)

Automated output: Genes with rare or

novel variants

After visualization and removal of false-

positives

Automated output: Genes with rare or

novel variants

After visualization and removal of false-

positives

10 exomes 7 0 8 0

9 exomes 3 0 8 0

8 exomes 2 0 7 0

7 exomes 6 0 16 0

6 exomes 4 0 27 0

5 exomes 5 0 38 0

4 exomes 2 0 74 0

3 exomes 14 Analysis ongoing,

candidate genes need consideration

165 Analysis ongoing,

candidate genes need consideration

2 exomes 41 503

Single exome 288 2604

of 22

Supplementary Table 9. Gene names for recessive model from exome data in 10 individuals without TBC1D24 mutations.

Samples with genes in common

Automated output: Genes with rare or novel variants

10 MUC4, ZNF595, ZMAT1, ATP7A, VBP1, abParts, C21orf62

9 DGKK, ZNF761, BCORL1

8 TEX13A, ABP1

7 ARSD, HLA-B, VCX2, DNHD1, C17orf100, UHRF1

6 IQSEC1, TREH, MCF2, SEMA3B

5 LRRC37A, ZNF492, CCDC66, SGK110, NFKBIZ

4 HDHD1, FLJ22184

3 GGT2, MXRA5, GOLGA6L6, WWC3, WDR33, FAM86B2, FICD, ZNF705A, SOCS1,

LOC728405, SYNM, SLC25A5, TMEM185A, MAL2

2

TRY6, CD177, CRIPAK, NBPF1, ZNF718, FAM75A3, ODZ1, SIRPA, AKR1D1, WWC1, TMEM191B, PCDH11Y, LILRB1, FAM90A10, MAGEA6, CXorf22, ZNF598,

NACA, ADH5, C19orf55, BC073807, JPX, NBPF16, TRIL, CTAGE4, MAPK8IP2, AP1S3, AKAP3, RBBP7, LAMB2, DQ580909, OTC, AGAP5, C14orf169, MAGIX,

AVPI1, TCEAL4, SERPINA7, OPN1LW, POLR2J2, LOC642846

of 22

Supplementary Figure 1. Conservation across species of the residues affected by missense substitutions. The blue highlights the residues for the

percentage of identity in this alignment (darker being the highest identity). PhastCons score17: conservation of the mutated nucleotide among 17 vertebrate

species, with 1 being the most conserved. Genomic Evolutionary Rate Profiling (GERP) score18: a score for constrained DNA elements in 29 mammalian

species, ranges from -12.3 to 6.17, with 6.17 being the most conserved. Grantham score19: categorizes codon replacements into classes of increasing

chemical dissimilarity, ranges from 5 to 215, with 5 being the most similar. The alignment was performed using the Clustal Omega program28 on the

Uniprot website (www.uniprot.org). Graphical representation of the alignment was performed using JalView (www.jalview.org). Uniprot IDs for the proteins

used in the alignment of TBC1D24 homologues are Q9ULP9 for Homo sapiens, F6TFP7 for the Rhesus macaque, F1Q1S9 for the dog, Q3UUG6 for the

mouse, G3TG12 for the african elephant, G1DG11 for the goat, F1NEU9 for the chicken, Q08CX5 for the western clawed frog, F6S4P5 for the gray short-

tailed opossum, E7FCR8 for the zebrafish, Q7Q0N9 for the fruit fly, D3DML7 for the african malaria mosquito, and H2KZ54 for the roundworm.

of 22

Supplementary Figure 2. Additional Tbc1d24 expression data from public databases. A) Expression

(blue) in adult mouse brain sagittal section using RNA ISH from the Allen Institute for Brain Science22. B)

High expression (purple staining) in the embryonic mouse brain, spinal cord and liver from the Eurexpress

Transcriptome Atlas23. C) High expression in the hypothalamus and kidneys by RNAseq from the RNA-

seq Atlas26.

of 22

Supplementary Figure 3. Tbc1d24 expression profiling. A) Expression of Tbc1d24 in C57BL/6 mouse

chondrocytes in the distal phalanges of the forelimbs at age P2. B) Same as in panel A but without the

primary antibody to demonstrate the background signal. C) Detection of mouse Tbc1d24 in mouse

embryonic brain at E16.5 (embryos selected to correlate with in situ hybridization data available in mouse

embryos, see next figure). D) Control without primary antibody to demonstrate specificity of antibody. E)

Western blot of mouse brain lysate protein to demonstrate the specificity of the antibody. The computed

molecular weight of the unmodified isoform 1of mouse Tbc1d24 is 63 kDa. F) Expression analysis for

Tbc1d24 in various newborn mouse tissues An ANOVA on ranks analysis showed that the median

expression varied between the tissues (p=0.026). *: p<0.05 by a comparison between the groups using

Dunnett’s method.

of 22

Supplementary Discussion. 2-Oxoglutaric aciduria and DOORS syndrome types.

Increased 2-oxoglutaric acid is often found in the blood and urine in DOORS syndrome, but is not

pathognomonic. Levels can fluctuate between normal values to very high values over time in the same

patient29,30 and are not elevated in all affected individuals. As such, its absence cannot be used to

exclude a diagnosis of DOORS syndrome. 2-oxoglutaric aciduria is found in several metabolic disorders,

but rarely in association with dysmorphisms such as in DOORS syndrome31. Patton et al. noted that α-

hydroxyglutarate, a metabolite of 2-oxoglutarate, is also elevated in the urine, thus suggesting that the

activity of the 2-oxoglutarate dehydrogenase complex (made of the E1, E2 and E3 components) was

intact29. Surrendran et al. found decreased E1 activity in patient fibroblasts and white blood cells32, while it

was normal in the patient described by James et al.33 . Patton et al. suggested separating DOORS

syndrome from autosomal dominant deafness and onychodystrophy29, now called DDOD syndrome [MIM

124480], and James et al. also excluded from their review cases with either dominant inheritance or

without intellectual disability or seizures33. Rajab et al. suggested dividing DOORS syndrome into type I,

with more severe neurological involvement (in terms of intellectual disability and seizures) and type II with

a milder neurological disease and course34. They noted that 2-oxoglutaric aciduria was present in the

more severe cases and in none of the milder cases. However, as Felix et al. demonstrated, several

individuals with type I (or more severe) DOORS syndrome do not have 2-oxoglutaric aciduria35. James et

al. also concluded that the division between type I and type II should not be used, in part because of

clinical heterogeneity even within families33.

We suggest three hypotheses for the source of 2-oxoglutaric aciduria found in DOORS in light of our

findings. 2-oxoglutarate might originate from increased glutamate release from neurons (suggested by

increased neurotransmitter release in the Skywalker Drosophila studies36) with subsequent metabolism to

2-oxoglutarate in astrocytes. Another hypothesis is that vesicle-bound aspartate aminotransferase,

converting 2-oxoglutarate and aspartate to glutamate for vesicular transport37, could be secondarily

affected by abnormal vesicular transport. We could partly test these hypotheses in the future using

cerebrospinal fluid or magnetic resonance spectroscopy of the affected individuals. Finally, 2-oxoglutarate

could originate from defective activity of the TLDc domain, the substrates and catalytic activity of which

are unknown, but could involve 2-oxoglutarate. This is less likely given that the mutations are often far

from the TLDc domain (see Figure 3D).

of 22

References

1. Li H, Durbin R. Fast and accurate short read alignment with Burrows-Wheeler transform.

Bioinformatics 2009; 25: 1754-60.

2. DePristo MA, Banks E, Poplin R, et al. A framework for variation discovery and genotyping using

next-generation DNA sequencing data. Nat Genet 2011; 43(5): 491-8.

3. McKenna A, Hanna M, Banks E, et al. The Genome Analysis Toolkit: a MapReduce framework for

analyzing next-generation DNA sequencing data. Genome Res 2010; 20(9): 1297-303.

4. Li H, Handsaker B, Wysoker A, et al. The Sequence Alignment/Map format and SAMtools.

Bioinformatics 2009; 25: 2078-9.

5. Akyuz M, Cabuk H. Meteorological variations of PM2.5/PM10 concentrations and particle-

associated polycyclic aromatic hydrocarbons in the atmospheric environment of Zonguldak, Turkey. J

Hazard Mater 2009; 170(1): 13-21.

6. Havlak P, Chen R, Durbin KJ, et al. The Atlas genome assembly system. Genome Res 2004; 14(4):

721-32.

7. Wang K, Li M, Hakonarson H. ANNOVAR: functional annotation of genetic variants from high-

throughput sequencing data. Nucleic Acids Res 2010; 38(16): e164.

8. Liu X, Jian X, Boerwinkle E. dbNSFP v2.0: A Database of Human Non-synonymous SNVs and Their

Functional Predictions and Annotations. Hum Mutat 2013.

9. Uniprot_Consortium. Reorganizing the protein space at the Universal Protein Resource

(UniProt). Nucleic Acids Res 2012; 40(Database issue): D71-5.

10. Gaudet P, Argoud-Puy G, Cusin I, et al. neXtProt: organizing protein knowledge in the context of

human proteome projects. J Proteome Res 2013; 12(1): 293-8.

11. Shaw DR. Searching the Mouse Genome Informatics (MGI) resources for information on mouse

biology from genotype to phenotype. Curr Protoc Bioinformatics 2009; Chapter 1: Unit1 7.

12. Baxevanis AD. Searching Online Mendelian Inheritance in Man (OMIM) for information on

genetic loci involved in human disease. Curr Protoc Hum Genet 2012; Chapter 9: Unit 9 13 1-0.

13. Seelow D, Schwarz JM, Schuelke M. GeneDistiller--distilling candidate genes from linkage

intervals. PLoS One 2008; 3(12): e3874.

14. Seelow D, Schuelke M. HomozygosityMapper2012--bridging the gap between homozygosity

mapping and deep sequencing. Nucleic Acids Res 2012; 40(Web Server issue): W516-20.

15. Wierenga KJ, Jiang Z, Yang AC, Mulvihill JJ, Tsinoremas NF. A clinical evaluation tool for SNP

arrays, especially for autosomal recessive conditions in offspring of consanguineous parents. Genet Med

2013; 15(5): 354-60.

16. EVS. Exome Variant Server, NHLBI GO Exome Sequencing Project (ESP), Seattle, WA. 2012.

http://evs.gs.washington.edu/EVS/.

17. Felsenstein J, Churchill GA. A Hidden Markov Model approach to variation among sites in rate of

evolution. Mol Biol Evol 1996; 13(1): 93-104.

18. Cooper GM, Stone EA, Asimenos G, Green ED, Batzoglou S, Sidow A. Distribution and intensity of

constraint in mammalian genomic sequence. Genome Res 2005; 15(7): 901-13.

19. Grantham R. Amino acid difference formula to help explain protein evolution. Science 1974;

185(4154): 862-4.

20. Guven A, Tolun A. TBC1D24 truncating mutation resulting in severe neurodegeneration. J Med

Genet 2013; 50(3): 199-202.

21. Falace A, Filipello F, La Padula V, et al. TBC1D24, an ARF6-interacting protein, is mutated in

familial infantile myoclonic epilepsy. Am J Hum Genet 2010; 87(3): 365-70.

22. Lein ES, Hawrylycz MJ, Ao N, et al. Genome-wide atlas of gene expression in the adult mouse

brain. Nature 2007; 445(7124): 168-76.

23. Diez-Roux G, Banfi S, Sultan M, et al. A high-resolution anatomical atlas of the transcriptome in

the mouse embryo. PLoS Biol 2011; 9(1): e1000582.

of 22

24. Wu C, Macleod I, Su AI. BioGPS and MyGene.info: organizing online, gene-centric information.

Nucleic Acids Res 2013; 41(D1): D561-5.

25. Hruz T, Laule O, Szabo G, et al. Genevestigator v3: a reference expression database for the meta-

analysis of transcriptomes. Adv Bioinformatics 2008; 2008: 420747.

26. Krupp M, Marquardt JU, Sahin U, Galle PR, Castle J, Teufel A. RNA-Seq Atlas--a reference

database for gene expression profiling in normal tissue by next-generation sequencing. Bioinformatics

2012; 28(8): 1184-5.

27. Uhlen M, Oksvold P, Fagerberg L, et al. Towards a knowledge-based Human Protein Atlas. Nat

Biotechnol 2010; 28(12): 1248-50.

28. Sievers F, Wilm A, Dineen D, et al. Fast, scalable generation of high-quality protein multiple

sequence alignments using Clustal Omega. Mol Syst Biol 2011; 7: 539.

29. Patton MA, Krywawych S, Winter RM, Brenton DP, Baraitser M. DOOR syndrome (deafness,

onycho-osteodystrophy, and mental retardation): elevated plasma and urinary 2-oxoglutarate in three

unrelated patients. Am J Med Genet 1987; 26(1): 207-15.

30. van Bever Y, Balemans W, Duval EL, et al. Exclusion of OGDH and BMP4 as candidate genes in

two siblings with autosomal recessive DOOR syndrome. Am J Med Genet A 2007; 143(7): 763-7.

31. Kelley RI, Robinson D, Puffenberger EG, Strauss KA, Morton DH. Amish lethal microcephaly: a

new metabolic disorder with severe congenital microcephaly and 2-ketoglutaric aciduria. Am J Med

Genet 2002; 112(4): 318-26.

32. Surendran S, Michals-Matalon K, Krywawych S, et al. DOOR syndrome: deficiency of E1

component of the 2-oxoglutarate dehydrogenase complex. Am J Med Genet 2002; 113(4): 371-4.

33. James AW, Miranda SG, Culver K, Hall BD, Golabi M. DOOR syndrome: clinical report, literature

review and discussion of natural history. Am J Med Genet A 2007; 143A(23): 2821-31.

34. Rajab A, Riaz A, Paul G, Al-Khusaibi S, Chalmers R, Patton MA. Further delineation of the DOOR

syndrome. Clin Dysmorphol 2000; 9(4): 247-51.

35. Felix TM, de Menezes Karam S, Della Rosa VA, Moraes AM. DOOR syndrome: report of three

additional cases. Clin Dysmorphol 2002; 11(2): 133-8.

36. Uytterhoeven V, Kuenen S, Kasprowicz J, Miskiewicz K, Verstreken P. Loss of skywalker reveals

synaptic endosomes as sorting stations for synaptic vesicle proteins. Cell 2011; 145(1): 117-32.

37. Takeda K, Ishida A, Takahashi K, Ueda T. Synaptic vesicles are capable of synthesizing the VGLUT

substrate glutamate from alpha-ketoglutarate for vesicular loading. J Neurochem 2012; 121(2): 184-96.

Figure 1

17 families without TBC1D24 mutations (including 9 with 5/5 main features

of DOORS syndrome). Analysis of the remaining exomes did not lead to the

identification of another gene mutated in most samples.

TBC1D24 mutations identified

in 2 additional families

9 families with TBC1D24 mutations

(out of 18 with 5/5 main features of

DOORS syndrome)

Sanger sequencing for TBC1D24 was performed in the other 9 families

Data analysis (performed while 2 exomes pending):

TBC1D24 mutations identified in 6 families (7 after all exomes completed)

21 families with 3/5 main features of DOORS syndrome assessed for eligibility

4 ineligible

2 families could not be contacted for consent

1 had DDOD syndrome

1 for which sample was not available on affected individual

9 additional eligible

families enrolled

17 remaining families had exome sequencing in an affected individual

3 families with consanguinity or affected siblings also had SNP array

7 without mutations

10 without mutations

FiguresClick here to download Figure: Figure R4.pdf

http://ees.elsevier.com/thelancetneurology/download.aspx?id=110631&guid=1b64f27e-9190-43ae-8154-a7c0c97f5456&scheme=1

a

d e

b c

f

ig h

l

m on

p r

t

q

u

j k

Figure 2

The genetic basis of DOORS syndrome: an exome-sequencing study

Documents

Transcript of The genetic basis of DOORS syndrome: an exome-sequencing study