SNP genome scanning localizes oto-dental syndrome to chromosome 11q13 and microdeletions at this...

SNP genome scanning localizes oto-dentalsyndrome to chromosome 11q13 andmicrodeletions at this locus implicate FGF3in dental and inner-ear disease and FADDin ocular coloboma

Cheryl Y. Gregory-Evans1, Mariya Moosajee1, Matthew D. Hodges1, Donna S. Mackay1,

Laurence Game2, Neil Vargesson3, Agnes Bloch-Zupan4, Franz Ruschendorf5,

Lourdes Santos-Pinto6, Georges Wackens7 and Kevin Gregory-Evans1,*

1Department of Clinical Neuroscience, 2CSC-IC Microarray Centre/Genome Centre and 3NHLI, Imperial College

London, London SW7 2AZ, UK, 4Faculte de Chirgurgie Dentaire, Universite Louis Pasteur, Strasbourg F-67000,

France, 5Max Delbruck Center for Molecular Medicine, D-13092 Berlin, Germany, 6Department of Paediatric Dentistry,

Araraquara Dental School, University of Sao Paulo State, Sao Paulo 14801-903, Brazil and 7Department of Oral

and Maxillofacial Surgery, Free University of Brussels, 1050 Elsene, Belgium

Received June 11, 2007; Revised and Accepted July 21, 2007

We ascertained three different families affected with oto-dental syndrome, a rare but severe autosomal-domi-nant craniofacial anomaly. All affected patients had the unique phenotype of grossly enlarged molar teeth(globodontia) segregating with a high-frequency sensorineural hearing loss. In addition, ocular colobomasegregated with disease in one family (oculo-oto-dental syndrome). A genome-wide scan was performedusing the Affymetrix GeneChip10K 2.0 Array. Parametric linkage analysis gave a single LOD score peak of3.9 identifying linkage to chromosome 11q13. Haplotype analysis revealed three obligatory recombinationevents defining a 4.8 Mb linked interval between D11S1889 and SNP rs2077955. Higher resolution mappingand Southern blot analysis in each family identified overlapping hemizygous microdeletions. SNP expressionanalysis and real-time quantitative RT–PCR in patient lymphoblast cell lines excluded a positional effect onthe flanking genes ORAOV1, PPFIA1 and CTTN. The smallest 43 kb deletion resulted in the loss of only onegene, FGF3, which was also deleted in all other otodental families. These data suggest that FGF3 haploinsuf-ficiency is likely to be the cause of otodental syndrome. In addition, the Fas-associated death domain (FADD)gene was also deleted in the one family segregating ocular coloboma. Spatiotemporal in situ hybridization inzebrafish embryos established for the first time that fadd is expressed during eye development. We thereforepropose that FADD haploinsufficiency is likely to be responsible for ocular coloboma in this family. Thisstudy therefore implicates FGF3 and FADD in human craniofacial disease.

INTRODUCTION

Otodental syndrome (MIM 166750) is an autosomal-dominantcondition characterized by grossly enlarged canine and molarteeth (globodontia), associated with sensorineural hearing

deficit (1,2). Ocular coloboma segregating with otodental syn-drome has also been reported in one family (3). The phenotypehas been described in simplex cases (4,5) and in families ofEuropean (1,3,6,7), Chinese (8) and Brazilian descent (9).The underlying aetiology is of ectodermal origin (4,10), but

# The Author 2007. Published by Oxford University Press. All rights reserved.For Permissions, please email: [email protected]

*To whom correspondence should be addressed at: Department of Clinical Neuroscience, Imperial College London, Charing Cross Campus,St Dunstan’s Road, London W6 8RP, UK. Tel: þ44 2083833633; Fax: þ44 2075943100; Email: [email protected]

Human Molecular Genetics, 2007, Vol. 16, No. 20 2482–2493doi:10.1093/hmg/ddm204Advance Access published on July 25, 2007

by guest on June 2, 2013http://hm

g.oxfordjournals.org/D

ownloaded from

http://hmg.oxfordjournals.org/

the molecular defects associated with the autosomal-dominantinheritance pattern have not been characterized.

Developmental defects affecting teeth, the ear and the eyeeither individually or together are very common. Tooth agen-esis (missing teeth) is a frequent developmental anomaly ofhuman dentition, occurring in 25% of the population (11);however, otodental syndrome is the only genetic conditioncausing tooth enlargement. Approximately, one in 1000 chil-dren is affected by severe or profound hearing loss at birthor during early childhood (12). The syndromic forms ofhearing loss account for 30% of pre-lingual genetic deafnessand include several hundred deafness syndromes, with theunderlying genetic defect known in only 30 of them (12,13).The incidence of ocular coloboma ranges from 0.5–7 per10 000 births and has been reported in up to 11.2% of blindchildren worldwide (14). In some populations, .20% of thecases of coloboma are inherited (15).

The striking dental phenotype of globodontia in otodentalsyndrome affects the primary (deciduous) and secondary (per-manent) dentition and is pathognomonic for the condition (2).The sensorineural high-frequency hearing deficit is bilateraland stable from early childhood. Some patients also exhibitbilateral iris and retinal ocular colobomata. Tooth, ear and eyedevelopment are all processes under strict genetic control asrevealed by gene mutations that are associated with arrestedtooth development (16), deafness (17) and coloboma (14).

In this paper, we localize otodental syndrome to chromo-some 11q13 and identify hemizygous deletions as the under-lying molecular defect. Using genomic mapping, Southernblot analysis, quantitative expression data and histologicalanalysis, we provide evidence that haploinsufficiency ofFGF3 and FADD (Fas-associated death domain) is the likelycause of the otodental and ocular coloboma phenotypes,respectively. These findings provide insight into the molecularaetiology underlying otodental disease.

RESULTS

Clinical assessment

Some clinical features have already been described for theBrazilian (OD1) (9), British (OD2) (3,18) and Belgian(OD3) (7) families. In addition, here we have compared datawith significant intra- and inter-familial differences. Completepenetrance was seen in all affected patients for the dentalphenotype which included missing premolars, delayed tootheruption, abnormal tooth shape, globodontia, multilobularpulp chambers, pulp stones and enamel hypoplasia. Contraryto previous assessments, pathological examination of extractedaffected teeth in pedigree OD1 suggested fusion of a numberof original teeth rather than true globodontia (Fig. 1A).Other differences between families included marked palateabnormalities, causing narrowing and crowding of theincisor region (Fig. 1B) and micrognathia (Fig. 1C) in manyaffected individuals from pedigree OD1. Despite detailed oph-thalmological assessments, ocular coloboma was seen only inpedigree OD2 in all affected family members (Fig. 1D and1E). In all pedigrees, the affected patients described partialhearing loss from their earliest memories, and audiometry con-firmed high-frequency loss from an early age (Fig. 1F).

Genome-wide linkage search

In order to locate the defective gene, a genome scan was con-ducted in the OD1 family, using an Affymetrix platform. Theaverage genotype call rate obtained was 91% (range 84–98%)providing approximately 9285 genotypes per individual. Thiswas slightly lower than the expected call rate (.95%);however, the observed concordance rate between the SNPgenotypes obtained from repeated samples (II-1 and II-8)was 99.6 and 99.3%, respectively. Parametric MERLIN calcu-lations revealed a single LOD score peak of 3.9 on chromo-some 11q13 (Fig. 2). Haplotype sharing of SNPs betweenfamily members combined with microsatellite marker analysis(Fig. 3) identified a 4.8 Mb region defined by two recombina-tion events with D11S1889 (unaffected individuals III-1 andIII-10) and one recombination with SNP rs2077955 (affectedindividual II-1). In the OD2 family, we genotyped nine micro-satellite markers which identified recombination events withD11S2006 (individual III-4) and D11S2002 (individual IV-2)defining a 20 Mb linked region (Fig. 4). In the OD3 family,we genotyped the same markers and found a segregating hap-lotype (Fig. 4, inset).

Fine mapping and loss of heterozygosity

In all three families, marker D11S4136 gave genotype data ofaffected individuals consistent with the appearance of non-inheritance from the affected parent, i.e. they had inheritedan allele from the affected parent that was deleted forD11S4136. All other microsatellite markers in the regionshowed perfect segregation within the family.

The size of the deletion in each family was estimatedby loss-of-heterozygosity, using 10 SNPs in the region(Fig. 5A). All three families were heterozygous for SNPrs9666584 in the 50-untranslated region (50-UTR) of theFGF4 gene, indicating that both alleles of FGF4 werepresent, thereby identifying the centromeric boundary of thedeletions (position 69299140: March 2006 freeze, http://genome.ucsc.edu/). All families showed non-inheritance ofthe affected parental D11S4136 allele, implying that thismarker was deleted and that the patients were hemizygous atthis position. Affected individuals in OD3 were heterozygousfor a novel 50-UTR SNP of FGF3 (rs41408348), delineatingthe telomeric boundary of the deletion (genome position69342896), indicating that the maximum size of the deletionwas �43 kb. In OD1, two SNPs in FGF3 (rs41408348 andrs41538178) and rs1940238 in TMEM16A were hemizygous,but SNP rs3740720 in the 50-UTR of the FADD gene was het-erozygous, indicating the telomeric extent of the deletion(genome position 69731195), inferring that the deletion wasa maximum of 432 kb. OD2 had the largest deletion of upto 490 kb encompassing FGF3, C11orf78, TMEM16A andFADD genes flanked by the heterozygous SNP rs11235675(genome position 69789255) in affected family members.

To confirm the deletions in each family, we carried outSouthern blotting (Fig. 6). The FGF3 hybridization signal,detecting a single 9.4 kb EcoR1 fragment encompassing thewhole gene, was reduced in affected patients in all threefamilies compared with unaffected family members, indicat-ing hemizygous deletion of the FGF3 gene. When the blots

Human Molecular Genetics, 2007, Vol. 16, No. 20 2483



ownloaded from


were stripped and re-probed with the FGF4 probe, the hybrid-ization signal detecting a 2.4 kb EcoR1 fragment was similarin all family members, indicating that FGF4 was notdeleted, supporting the presence of heterozygous SNPrs9666584 in FGF4. A 7.5 kb Kpn1 FADD signal wasdecreased only in affected OD2 patients, confirming hemizyg-osity for FADD in this family.

Position effect and genomic analysis

Evidence in the literature from other disease-associated del-etions suggests that the otodental phenotype could be due toa position effect of the deletions (down-regulation or silencingof flanking genes through loss of essential cis elements). Toinvestigate this, we identified SNPs in flanking genes that

Figure 1. Clinical features associated with otodental syndrome. (A) Tooth fusion (pedigree OD1); (B) palate narrowing in individual II-8 (OD1); (C) micro-gnathia in individual III-5 (OD1); (D) iris coloboma in individual II-3 (OD2); (E) retinal coloboma (area denoted by dotted line) in individual III-2 (OD2);(F) audiometry in affected patients from each family demonstrating high-frequency hearing loss (normal auditory thresholds .25 dB; X, left ear; O, right ear).

2484 Human Molecular Genetics, 2007, Vol. 16, No. 20



ownloaded from


were heterozygous in genomic DNA and then sequenced themin RT–PCR products from lymphoblast cells lines of affectedOD2 patients (i.e. if the SNPs were heterozygous at the tran-scriptional level, this would imply that the deletion did nothave a position effect).

At the centromeric end of the deletion, ORAOV1(rs1789166) was heterozygous in genomic DNA and in thecell lines, confirming that the deletion in OD2 did not havea position effect on this gene (Fig. 7A). For the other surround-ings genes, they were either not expressed in the cell lines(FGF19, FGF4, SHANK2) or no SNPs were present in patientsfor the analysis (PPFIA1, CTTN ). However, since CTTN andPPFIA1 were expressed in the cell lines, we used real-timequantitative RT–PCR (qRT–PCR) to detect transcriptionalexpression levels of these genes compared with normal celllines. We found that expression levels of both genes werecomparable with the normal cell line (Fig. 7B), hence no pos-ition effect by the OD2 deletion on the transcriptionalexpression of CTTN or PPFIA1 was apparent. The real-timeqRT–PCR analysis also revealed that the expression levelsof TMEM16A and FADD were reduced, confirming the SNPmapping and Southern blot analyses.

To investigate whether homologous recombination betweenrepetitive sequences could be a cause of these deletions, weanalysed the sequence surrounding the deleted regions. Wefound one low copy repetitive element (REP2) repeat(387 bp in length) between FGF3 and FGF4 and two REP2repeats between exon 2 and 3 of FGF3 (Fig. 5B). We foundmultiple copies of REP1 repeats (270 bp in length) betweenFGF3 and FGF4. REP1 hits with up to 85% homology werealso found in the SHANK2 and TMEM16A genomic regions(Fig. 5A). Genome analysis for the presence of Alu repeatelements also identified 16 Alu repeats clustered betweenFGF4 and FGF3, 12 repeats between TMEM16A and FADD(breakpoint region in OD1) and 66 repeats between FADDand PPFIA1 (breakpoint region in OD2).

From the genomic analysis, we also searched for regulatoryelements in the minimal hemizygous region of OD3 that couldbe involved in cis regulation of FGF3. Four conserved

genomic elements (A–D, Fig. 5B) were identified in human,mouse, rat and dog in the region spanning the 50-UTRregion of FGF4 to exon 3 of FGF3. Element A is a 551 bpsequence with 62% identity between species containing 10evolutionary conserved binding sites: AHR, Hes1, LRF,two NF1 sites, MEF2 and NFMUE1 and three YY1 sites.Element B is a 57 bp sequence with 63% identity andelement C is a 99 bp sequence with 61% identity betweenspecies, the latter containing conserved E12, E47 andTAL-binding sites. Element D is a 133 bp element with 51%identity between species.

Candidacy of FADD in eye development

Comparing the genes in the deletion regions in OD1 (otoden-tal) and OD2 (otodental þ coloboma), we found that theonly difference was the additional hemizygous deletion ofFADD in OD2. To provide evidence that haploinsufficiencyof FADD could be a cause of the coloboma phenotype,spatiotemporal expression patterns of fadd in zebrafishembryos were investigated by in situ hybridization. In zebra-fish wholemounts, we observed that fadd expression at thetwo-somite stage was throughout the embryo (Fig. 8A andB); however, by 24 h post-fertilization (hpf), spatialexpression was restricted to the developing brain, the eyesand otic vesicles (Fig. 8C). High levels of fadd expressionwere seen in the developing eye at the optic fissure(Fig. 8D). By 36 hpf, there was high-level expression offadd in the midbrain, hindbrain and optic stalks (Fig. 8E).At 48 hpf, the optic fissure was closed but there was stillstrong expression in the mandibular mesenchyme and theotic vesicles (Fig. 8F). In comparison, a riboprobe to fgf3showed clear expression at the tailbud stage in the forebrainand rhombomere 4, from where fgf3 is known to induceformation of the otic placode during the earliest stages ofear development (Fig. 8G and H). At 36 hpf, fgf3 expressionis seen in the pharyngeal endoderm, otic vesicle, themidbrain–hindbrain boundary and in the retina (Fig. 8I).

Figure 2. HLOD plot in OD1 family. Peak value (thick black line) indicates significant linkage to chromosome 11.




ownloaded from


Furthermore, to determine whether intragenic mutationsin FADD could be a cause of isolated coloboma in otherfamilies, we screened a defined cohort of 49 DNA samples(19) from patients with coloboma. We found sequence

variants in two unrelated patients. However, these were single-nucleotide substitutions, known to be polymorphic in thepopulation (rs10898853, rs1131677), hence we consideredthese as not disease causing.

Figure 3. Genotyping of 11q13 markers and SNPs in OD1 family. A 4.8 Mb critical region is defined by recombination events in individuals III-1 and III-10 forD11S1889 and in individuals II-1 for SNP rs2077955. The segregating haplotype is denoted by boxed region. Affected patients have not inherited the affectedparental allele for D11S4136 and are therefore hemizygous (d). Dashes in genotypes denote markers which repeatedly failed to amplify. Asterisks denote subjectswho underwent Southern blot analysis.




ownloaded from


DISCUSSION

The underlying genetic defect causing otodental syndrome inall families in this study was hemizygous microdeletion atchromosome 11q13.3, a region of the human genome that is

particularly prone to recombination (20). There is compellingevidence that homologous recombination between repetitiveelements underlies hemizygous deletions in a number ofautosomal-dominant disorders (21,22). In silico genomicanalysis revealed that this region of the genome has a major

Figure 4. Genotyping of 11q13 microsatellite markers in OD2 and OD3 families. OD2: Genotyping in OD2 family showing recombination events with proximalmarker D11S2006 in unaffected individual III-4. The distal flanking marker D11S2002 was recombinant in individual IV-2, defining the linked region of 20 Mb.Segregating haplotype is denoted by boxed region. Dashes in genotypes denote markers which failed to amplify. OD3: Haplotype in OD3 family. Asterisksdenote subjects who underwent Southern blot analysis. One allele of D11S4136 is deleted (d) in affected patients in both families (seen as non-inheritanceof affected parental allele).




ownloaded from


repetitive sequence (23) that might explain the deletions.However, until the breakpoints are cloned in each case, themechanism surrounding the cause of the deletions remainsto be determined.

The fortuitous arrangement of overlapping hemizygousmicrodeletions in the three families gives an insight into the

underlying molecular mechanisms of the disease. The smallestdeletion of �43 kb in the OD3 family only deleted the FGF3gene (also deleted in the other two larger microdeletions),implying that haploinsufficiency of FGF3 could be the causeof the dental and hearing defects in all three families. Func-tional studies have shown that FGF signalling is crucial to

Figure 5. Deletion mapping of three dominant oto-dental families, OD1–OD3, on chromosome 11q13.3. (A) Hemizygous regions are represented by black bars,and flanking regions to first heterozygous marker are grey. Genes within the critical region are shown as filled boxes, with direction of transcription indicated byan arrow. Black triangles below the sequence indicate position of REP1 sequences, grey triangles REP2 sequences. Maximal OD1 hemizygous region spans432 kb from rs9666584 to rs3740720 (including FGF3, C11orf78 and TMEM16A). Maximal OD2 hemizygous region spans 490 kb from rs9666584 tors11235675 (including FGF3, C11orf78, TMEM16A and FADD). Maximal OD3 hemizygous region spans 43 kb from SNP rs9666584 (50-UTR of FGF4) tors41408348 (50-UTR of FGF3). (B) Expanded view of OD3 deletion, exon–intron structure of FGF3 and FGF4 (filled boxes, coding sequence; open boxes,untranslated sequence). Minimal promoter of FGF4 is shown as open oval; evolutionary conserved genomic elements, A–D, are indicated by open circles.Southern probes depicted below the sequence. (C) Protein structure of FGF3 with position of recently reported recessive mutations associated with syndromicdeafness associated with inner-ear agenesis, microtia and microdontia, compared with hemizygous deletion region in OD3.




ownloaded from


proper otic placode development, including six ligands (Fgf-3,-4, -8, -10, -16, -19) and three receptors (Fgfr1, -2B, -3) (24–27).Fgf3 expression is required for inductive signals leading tootic placode formation (24,28). Similarly, studies in dentaldevelopment have implicated at least five ligands (Fgf-3, -4,-8, -9, -10) and three receptors (Fgfr-1, -2, -3) (29,30). Fgf3is expressed in the dental mesenchyme and in the mouseenamel knot, a localized region of dental epithelium that isthought to control cusp morphogenesis (30). Interestingly,Fgf3 expression is absent in the dental mesenchyme inRunx2 null mutant mice, suggesting that Fgf3 is a directtarget gene of Runx2 (31). In humans, RUNX2-dominantmutations cause cleidocranial dysplasia (32), which includesmultiple supernumerary teeth, delayed tooth eruption, enamelhypoplasia and enamel pearls, characteristics common withthe otodental syndrome phenotype.

Very recently, recessive mutations in FGF3 gene have beenreported (Fig. 5C) in a new form of severe syndromic deaf-ness, microtia and small teeth, without eye abnormalities(33). It was proposed that the mutations were loss-of-functionalleles and that heterozygous carriers of the FGF3 mutationsdid not show any obvious clinical phenotype. This report ishowever still consistent with our findings of otodentaldisease associated with FGF3 hemizygosity for severalreasons. First, since no functional data was reported, itcannot be assumed that the FGF3 mutations are loss-of-function alleles, as they may retain some aberrant func-tional activity leading to the different phenotype. Althoughconventionally assumed to be loss-of-function mutations,gain-of-function recessive alleles have been reported. For

example, missense and frameshift mutations in the CNGB3gene result in an enhanced channel function in recessiveachromatopsia (34). Similarly, Dejerine–Sottas disease iscaused by a PMP22 recessive gain-of-function allele (35).Secondly, it is unclear how comprehensive the clinical exam-ination was in the FGF3 heterozygote carriers. In particular,we note that the phenotype in the otodental families includeda milder deafness, in comparison with the profound deafnessdescribed for the recessive FGF3 mutations (33). Thirdly, itis possible that the microdeletions we identified may haveunmasked a recessive allele of FGF3 on the normal chromo-some in the otodental families, reminiscent of hemizygous del-etion of the PMP22 gene unmasking a recessive PMP22mutation causing Charcot–Marie–Tooth disease (36). Wehave screened the FGF3 coding sequence, splice sites andUTRs in all our families and found no sequence changes orvariants that segregated with disease. However, there maystill be an abnormality in the regulatory regions of FGF3 onthe normal chromosome.

An alternative explanation for the difference in phenotypeand inheritance pattern could be that the deletions are

Figure 6. Southern blotting in three families. Lanes on gels relate to pedigreesdirectly above. Affected OD3 family members show reduced probe signal forFGF3 gene, compared with unaffected family member. Affected OD1 familyshowing reduced probe signal for FGF3 gene, but not in unaffected siblings.Affected OD2 family members show reduced probe signals for both FGF3 andFADD genes, compared with unaffected family members. Blots were alsostripped and rehybridized with FGF4 probe, showing that FGF4 is notdeleted in any family and acting as DNA loading control for the genomicregion.

Figure 7. Effect of hemizygous deletion on nearby gene expression. (A) Upperpanel, heterozygous SNP rs1789166 in genomic DNA of patient OD2/III-2.Lower panel, heterozygous SNP from transcribed RNA of the same patient.(B) Real-time qRT–PCR analysis presented as fold change between normaland deleted cells lines for each gene, normalized to GAPDH. Values areplotted as the mean + SD from two independent samples, each repeated intriplicate.




ownloaded from


having a position effect, i.e. interruption in the control ofexpression of other nearby genes is causing the phenotype.We excluded a positional effect on several flanking genes(ORAOV1, CTTN, PPFIA1), but not for FGF4 or FGF19, asthese are only expressed in early development. FGF4 isknown to have a proliferative role in the dental epithelium(29) and FGF19 is expressed in the developing ear (37), andso is it possible that there could be a contribution to the oto-dental phenotype by a position effect on these genes. Todate, no mutations have been identified in either FGF4 orFGF19 for phenotype comparison. Targeted deletion of Fgf4in mice is embryonic lethal at E4.5, and heterozygote carriersof the targeted allele are phenotypically normal, implying thatone copy of Fgf4 is sufficient (38). Furthermore, targeted del-etion of murine Fgf15 (homologous to human FGF19) doesnot result in any otic vesicle abnormalities (39). The con-clusion drawn from both of these functional studies is thatother factors act in a redundant fashion to compensate,which is documented in FGF signalling pathways (26,27,30).Thus, a position effect by the deletions we identified on theexpression of either FGF19 or FGF4 is debatable, at leastfrom the mouse data.

The deletions we identified may also have an effect on thecis elements regulating FGF3 itself. It is interesting to notethat an insertional mutation between Fgf3 and Fgf4 loci inBey mice causes bulging eyes due to lens overgrowth. Fgf3gene expression in this mutant was upregulated, suggesting

that there may be important regulatory elements in the intra-genic region that influence Fgf3 activity (40), which couldbe affected by the deletions in our families. Our analysis hasshown that one of the four evolutionary conserved elementswe identified (element D) was deleted in all three families,which may have an effect on the cis regulatory controlof FGF3 or FGF4. Recently, a new autosomal recessive,non-syndromic deafness locus (DFNB63) without eye ortooth defects (41) was identified which overlaps with thewhole 11q13.3 genomic region shown in Figure 5A. It willbe important to determine whether mutations in FGF3 orFGF19 account for this phenotype, as it may help delineatethe genotype–phenotype association with this genetic region.

A key feature of the OD2 family phenotype is ocular colo-boma. The deletion in this family included the novelTMEM16A and C11orf78 genes of unknown function andthe FADD gene, which encodes an adaptor molecule that inter-acts with death receptors upon stimulation by apoptosis.TMEM16A or C11orf78 deletion would seem unlikely candi-dates for the coloboma defect, because they are also in the del-etion region of the OD1 family, with no eye phenotype. FADDis an attractive candidate since its physiological role has beendetermined by gene targeting in mice (42). Deletion of murineFadd leads to embryonic lethality at E11.5 and failure todevelop eyes, confirming the importance of FADD in eyedevelopment. Furthermore, over expression of Xenopus faddtransgene in tadpoles results in either pin-head or small eyes(43). These data suggest that precise control of FADDexpression is critical during eye development, supporting theFADD deletion data we observed in the OD2 family and ourexpression analysis in zebrafish eye development.

Our results clearly demonstrate hemizygous microdeletions asthe underlying genetic defect causing oto-dental syndrome, andthis suggests that FGF3 haploinsufficiency could be responsiblefor the dental and hearing defects. Additionally, FADD hemizyg-osity appears to affect eye development, in particular, its role incoloboma formation. We are currently investigating the specificrole of FADD in optic fissure morphogenesis.

MATERIALS AND METHODS

Patients

We recruited three families to this study of Brazilian, British andBelgian descent designated OD1, OD2 and OD3, respectively.Informed consent was obtained from all participants in accord-ance with the Local Research Ethics Committee. The diagnosisof otodental syndrome was established on the basis of clinical,histopathological and audiometric criteria. Affected patientsunderwent dental examination including radiography. Theoral–dental findings of the British and Belgian families weredocumented using the Diagnosing Dental Defects Databaserecord form (http://www.phenodent.org). All subjects had afull ophthalmic examination of anterior segments and retina.Deafness was reported by all affected individuals, and selectedaffected individuals had this confirmed by formal audiometry.

Genotyping

Genomic DNA from peripheral blood samples or buccalswabs was isolated by standard methods using a Nucleon kit

Figure 8. Spatiotemporal gene expression during zebrafish embryo develop-ment. All panels show wholemount in situ hybridization. In dorsal views,anterior is at the top; in lateral views, dorsal is at the top and anterior toleft. (A) Lateral and (B) dorsal views of fadd expression seen at two-somitestage. (C) Lateral view of fadd expression at 24 hpf. (D) High magnificationof eye in (C). (E) Flatmount of fadd expression in the head region at36 hpf. (F) Lateral view of fadd expression at 48 hpf. (G) Lateral and (H)dorsal views of fgf3 expression seen at tailbud stage. (I) Lateral view offgf3 expression at 36 hpf, anterior to left. hb, hindbrain; m, mandibularmesenchyme; of, optic fissure; os, optic stalk; ov, otic vesicle; p, prechordalregion; r, retina;. r4, rhombomere 4; t, tail region.




ownloaded from


(Scotlab). The DNA from buccal swabs tended to be of lowyield or poor quality DNA as assessed by NanoDropw spec-trophotometry. Therefore, these DNA samples were linearlyamplified by multiple displacement amplification (MDA)(44). MDA was conducted using the GenomiPhi DNA ampli-fication kit according to the manufacturer’s instructions(Amersham Biosciences).

We genotyped 11 affected subjects, seven unaffected sub-jects and two spouses from the Brazilian family using theAffymetrix GeneChip Human Mapping 10K 2.0 Array andAssay kit according to manufacturers’ instructions. Allele-specific hybridization was detected by analysing scannedimages of the array using the Affymetrix GeneChip DNAAnalysis (GDAS) 2.0 software. Detailed information onspecific SNPs was accessible through the linked NetAffx

TM

Analysis Centre (e.g. physical and genetic maps, associatedgenes, neighbouring microsatellites, population frequency).

Linkage analysis

Genotypes were called by GDAS 2.0 software and exported intable form to the ALOHOMORA suite of programs to performlinkage analysis (45). For quality control, we verified samplegenders by checking for heterozygous SNPs on the X chromo-some. Family relationship errors were detected using theGraphical Relationship Representation program (46). Ped-Check was used to detect and remove any Mendelian errors(47). We carried out parametric linkage analysis withMERLIN (48) using a fully penetrant dominant model andwith the information of all SNPs on a chromosome simul-taneously. Owing to the limitations of MERLIN to large pedi-grees, we split the Brazilian family in two appropriate smallerparts.

Confirmation of linkage and haplotype analysis was madeby the Marshfield Mammalian Genotyping Service (providedin the public domain by Marshfield Clinic, Marshfield, WI,USA) or in-house using microsatellite markers (49). Followingamplification of microsatellite markers, 1 ml of a 1/25 dilutionof the PCR product was mixed with 10 ml of formamide/ROX350 and resolved on an ABI 3730xl DNA analyser.The results were analysed using the software GeneMapperv3.5 (Applied Biosystems).

Mutation analysis

Screening for germline mutations in the positional candidateFGF3, and FADD was undertaken in affected familymembers. A cohort of 49 DNA samples from patients withcoloboma as the main phenotypic feature were specificallyscreened for mutation in the FADD gene (19). All exons,intron–exon boundaries and UTRs were sequenced. Primersare listed in Table 1. Amplified PCR products were purifiedby ExoSap-IT methodology (USB Corporation) and thenbi-directionally sequenced using BigDye Terminator chem-istry on an ABI 3730xl DNA Analyzer. Sequences werealigned and compared with consensus data obtained fromthe human genome databases (http://genome.ucsc.edu; http://www.ncbi.nlm.nih.gov).

Southern blotting

High-molecular-weight DNA (10 mg) was digested withEcoRI or KpnI for 18 h and then fractionated through 0.8%agarose gels. Denaturation and alkali transfer of DNA toHybond-Nþmembranes followed standard procedures.Probes for FGF3, FGF4 and FADD were as follows: FGF3,1090 bp generated from the 30-UTR-Exon 3; FGF4, 694 bpgenerated from 50-UTR-exon 1-IVS1-2; FADD, 1240 bpincluding exon3-30-UTR-genomic sequence. Probes wereradiolabelled with [a-32P]-dCTP (3000 Ci/mmol) using theMegaprime labelling kit (Amersham Biosciences). Hybridiz-ation was performed at 428C in 6� SSC, 50% formamide,5� Denhardt’s solution, 1% SDS, 300 mg/ml sonicatedsalmon sperm DNA overnight. The blots were then washedto 0.2� SSC/0.2% SDS at 658C, before autoradiography(Amersham Hyperfilm).

In situ hybridization

Wildtype zebrafish embryos were maintained at 28.58Con a 14 h light/10 h dark cycle, raised in the presence of200 mM 1-phenyl-2-thiourea (Sigma-Aldrich) to inhibit pig-mentation and staged by standard methods (50). A faddcDNA clone (pGEMw-T Easy) was generated by RT–PCRamplification and cloning of a 449 bp product from zebrafishRNA obtained from whole embryos (forward, 50-AACTTGAGAAAATCGACACC-30; reverse, 50- TCTCTCCACGAGATCAGC-30) using the Superscript III RT–PCR System (Invitro-gen). Digoxigenin-labelled riboprobes to fadd and fgf3 (51)were generated using DIG RNA Labeling Kit (SP6/T7)according to the manufacturer’s instructions (Roche).

In situ hybridization was carried out as previously described(52). Briefly, embryos were hybridized overnight in hybridiz-ation mix containing 50–200 ng of digoxigenin-labelledprobe, 50% formamide, 5 � SSC, pH 6.0 (using 1 M citricacid), 0.1% Tween-20, 5 mg/ml torula (yeast) RNA and50 mg/ml heparin at 658C. After extensive washes (down to0.2� SSC), embryos were incubated in 2% blocking agentfor 2–3 h and then incubated with 1:5000 anti-DIG-AP anti-body (Roche) overnight at 48C. Detection of the alkaline phos-phatase reaction was using the NBT/BCIP substrate. Embryoswere washed in PBS, re-fixed in 4% PFA/PBS for 20 min andthen mounted in 70% glycerol for photography (NikonSMZ1500 fluorescent dissecting microscope).

Expression of SNPs in patient lymphoblast cell line

EBV-transformed lymphoblast cell lines were generated fromOD2 family members. Cells were grown in suspension inRPMI1640 (10 mM HEPES, 10% FCS, 5% CO2). RNA wasextracted from cell pellets using TRIzol (Invitrogen) andcDNA generated using the Superscript III RT–PCR System(Invitrogen) according to the manufacturer’s instructions.SNPs that were heterozygous in affected patient DNA weretested for expression and heterozygosity in RNA from theaffected patient cell lines by direct sequencing of RT–PCRproducts.




ownloaded from


Quantitative real-time RT–PCR

Total RNA was extracted from a fixed number of cells (6 �106) from actively growing cultures of lymphoblast celllines from normal and affected patients using the AbsoluteRNA Miniprep Kit (Stratagene), which includes a DNase Istep to remove any contaminating genomic DNA. Quality ofthe RNA was determined using an Agilent 2100 BioAnalyzerand RNA concentration determined using NanoDropw

spectrophotometry. Reverse transcription of 1 mg RNA intocDNA was performed using the RT2 PCR Array First StrandcDNA Synthesis Kit (Superarray Bioscience). Real-timeqRT–PCR was performed using the RT2 Real-Time

TM

SYBR Green PCR Kit (SuperArray Bioscience) with pre-validated primer sets (CTTN, PPFIA1, FADD, GAPDH, 18SrRNA). Thermocycling parameters on an Applied Biosystems7500 system were 958C for 10 min, followed by 40 cycles of958C for 15 s and 608C for 1 min. Samples from each cell linewere run in triplicate for each gene and repeated in severalindependent samples of RNA. The fold change betweennormal and deleted cell lines was determined using theDDCt method (53) which calculates normalized expressionchanges relative to GAPDH or 18S rRNA.

Genomic sequence analysis

To identify the location of tandem repeats and Alu sequencesin the 11q13.3-deleted regions, Mreps (http://bioinfo.lifl.fr/mreps/) and RepeatMasker (http://www.repeatmasker.org/)programs were used, respectively. Identification of evolution-ary conserved elements in the deleted region of OD3 wascarried out in rVista (http://rvista.dcode.org/), repetitivesequences were removed with RepeatMasker and conservationof transcription factor-binding sites was carried out inMULAN (http://mulan.dcode.org/).

ACKNOWLEDGEMENTS

This work was supported by The Birth Defects Foundation UK(Grant no. 03/05), the Hammersmith Hospital Trust Research

Committee (Grant no. 40625) and partially by the GermanFederal Ministry of Science and Education through theNational Genome Research Network (01GR0463). The D(4)/phenodent investigations were partially supported byINSERM, Reseaux de Recherche Clinique et Reseau deRecherche en Sante des Populations, 2003 and GIS Institutdes maladies rares, Reseau Francais de Genetique Dentaire,2003–2005. Histopathology of extracted teeth was performedby Dr A.W. Barrett, Eastman Oral and Maxillofacial Pathol-ogy Unit, Eastman Dental Hospital, London. The fgf3 cDNAwas generously provided by Dr Lisa Maves, Fred HutchinsonCancer Research Center, Seattle. Professor David Fitzpatrick,MRC Human Genetics Unit, Edinburgh, kindly providedaccess to the coloboma patient cohort.

Conflict of Interest statement: The first author declares thatnone of the authors has a conflict of interest.

REFERENCES

1. Witkop, C.J., Gundlach, K.K., Streed, W.J. and Sauk, J.J. (1976)Globodontia in the otodental syndrome. Oral. Surg. Oral. Med. Oral.Pathol., 41, 472–483.

2. Bloch-Zupan, A. and Goodman, J.R. (2006) Otodental syndrome.Orphanet J. Rare Dis., 1, 5.

3. Winter, G.B. (1983) The association of ocular defects with the otodentalsyndrome. J. Int. Assoc. Dent. Child., 14, 83–87.

4. Sedano, H.O., Moreira, L.C., De Souza, R.A. and Moleri, A.B. (2001)Otodental syndrome: a case report and genetic considerations. Oral Surg.Oral Med. Oral Pathol. Oral Radiol. Endod., 92, 312–317.

5. Stewart, D.J. and Kinirons, M.J. (1982) Globodontia. A rarely reporteddental anomaly. Br. Dent. J., 152, 287–288.

6. Cook, R.A., Cox, J.R. and Jorgenson, R.J. (1981) Otodental dysplasia: a 5year study. Ear Hear, 2, 90–94.

7. Van Doorne, L., Wackens, G., De Maeseneer, M. and Deron, P. (1998)Otodental syndrome: a case report. Int. J. Oral Maxillofac. Surg., 27,121–124.

8. Chen, R.J., Chen, H.S., Lin, L.M., Lin, C.C. and Jorgenson, R.J. (1988)Otodental dysplasia. Oral Surg. Oral Med. Oral Pathol., 66, 353–358.

9. Santos-Pinto, L., Oviedo, M. and Santos-Pinto, A. (1998) Otodentalsyndrome: three familial cases reports. Pediatr. Dent., 20, 208–211.

10. Levin, L.S., Jorgenson, R.J. and Cook, R.A. (1975) Otodental dysplasia: a‘new’ ectodermal dysplasia. Clin. Genet., 8, 134–144.

Table 1. Primers and PCR conditions for the amplification of the human FGF3 and FADD genes

Exon Primers Annealing (8C) Size (bp)

FGF3 gene primersExon 1AF TCACGGACATCAGTCATCGGC 66 686Exon 1AR AGCAGGCTGAGCAGTAGCAGCExon 1BF TCCGAGCACCTCGCAGCTGTC 66 533Exon 1BR TCCCGGACGTGTAGGTTGAGGExon 2F TCCTGAACTTCCACTCACTCC 58 356Exon 2R TTGGCAAAGCATTCTACTGCCExon 3F TGACTGGCTGAGAGTGCGCTG 66 907Exon 3R TCCTCAGCCTGCATCACGGTC

FADD gene primersExon 1F TGCAAACAGGTGGACTCGGCAGAGG 60 795Exon 1R TCAAACCCGGCAAAGGGGAGGExon 2AF TCTAGCCTCTACAGAGGACCTCG 62 565Exon 2AR TCACAGTGCTGGGCTACCTTCCExon 2BF TCAGGTCCTGCCAGATGAACCTG 59 588Exon 2BR AGAACGCCACAGTGGTTGAGCExon 2CF TTACTCCACAGCGGAGGAGACC 59 726Exon 2CR TCATGAGCAGCTAGCGAGCTGT




ownloaded from


11. Bredy, E., Erbring, C. and Hubenthal, B. (1991) The incidence ofhypodontia with the presence and absence of wisdom teeth. Dtsch. ZahnMund Kieferheilkd. Zentralbl., 79, 357–363.

12. Petit, C. (1996) Genes responsible for human hereditary deafness:symphony of a thousand. Nat. Genet., 14, 385–391.

13. Resendes, B.L., Williamson, R.E. and Morton, C.C. (2001) At the speedof sound: gene discovery in the auditory system. Am. J. Hum. Genet., 69,923–935.

14. Gregory-Evans, C.Y., Williams, M.J., Halford, S. and Gregory-Evans,K. (2004) Ocular coloboma: a reassessment in the age of molecularneuroscience. J. Med. Genet., 41, 881–891.

15. Hornby, S.J., Dandona, L., Jones, R.B., Stewart, H. and Gilbert, C.E.(2003) The familial contribution to non-syndromic ocular coloboma insouth India. Br. J. Ophthalmol., 87, 336–340.

16. Thesleff, I. (2000) Genetic basis of tooth development and dental defects.Acta Odontol. Scand., 58, 191–194.

17. Petit, C. (2006) From deafness genes to hearing mechanisms: harmonyand counterpoint. Trends Mol. Med., 12, 57–64.

18. Vieira, H., Gregory-Evans, K., Lim, N., Brookes, J.L., Brueton, L.A. andGregory-Evans, C.Y. (2002) First genomic localisation ofoculo-oto-dental syndrome with linkage to chromosome 20q13.1. Invest.Ophthalmol. Vis. Sci., 43, 2540–2545.

19. Morrison, D., Fitzpatrick, D., Hanson, I., Williams, K., van Heyningen,V., Fleck, B., Jones, I., Chalmers, J. and Campbell, H. (2002) Nationalstudy of microphthalmia, anophthalmia, and coloboma (MAC) inScotland: investigation of genetic aetiology. J. Med. Genet., 39, 16–22.

20. Schwab, M. (1998) Amplification of oncogenes in human cancer cells.Bioessays, 20, 473–479.

21. Lupski, J.R. and Stankiewicz, P. (2005) Genomic disorders: molecularmechanisms for rearrangements and conveyed phenotypes. PLoS Genet.,1, e49.

22. Dorschner, M.O., Sybert, V.P., Weaver, M., Pletcher, B.A. and Stephens, K.(2000) NF1 microdeletion breakpoints are clustered at flanking repetitivesequences. Hum. Mol. Genet., 9, 35–46.

23. Katoh, M. and Katoh, M. (2005) Comparative genomics on mammalianFgf3–Fgf4 locus. Int. J. Oncol., 27, 281–285.

24. Solomon, K.S., Kwak, S-J. and Fritz, A. (2004) Genetic interactionsunderlying otic placode induction and formation. Dev. Dyn., 230,419–433.

25. Mansour, S.L., Goddard, J.M. and Capecchi, M. (1993) Mice homozygousfor a targeted disruption of the proto-oncogene int-2 have developmentaldefects in the tail and inner ear. Development, 117, 13–28.

26. Leger, S. and Brand, M. (2002) Fgf8 and Fgf3 are required for zebrafishear placode induction, maintenance and inner ear patterning. Mech. Dev.,119, 91–108.

27. Wright, T.J. and Mansour, S.L. (2003) Fgf3 and Fgf10 are required formouse otic placode induction. Development, 130, 3379–3390.

28. Wright, T.J., Hatch, E.P., Karabagli, H., Karabagli, P., Schoenwolf, G.C.and Mansour, S.L. (2003) Expression of mouse fibroblast growth factorand fibroblast growth factor receptor genes during early inner eardevelopment. Dev. Dyn., 228, 267–272.

29. Kettunen, P., Karavanova, I. and Thesleff, I. (1998) Responsiveness ofdeveloping dental tissues to fibroblast growth factors: expression ofsplicing alternatives of FGFR1, -2, 3 and of FGFR4; and stimulation ofcell proliferation by FGF-2, -4, -8 and -9. Dev. Genet., 22, 374–385.

30. Kettunen, P., Laurikkala, J., Itaranta, P., Vainio, S., Itoh, N. and Thesleff, I.(2000) Associations of FGF-3 and FGF-10 with signalling networksregulating tooth morphogenesis. Dev. Dyn., 219, 245–263.

31. Aberg, T., Wang, X.P., Kim, J.H., Yamashiro, T., Bei, M., Rice, R., Ryoo,H.M. and Thesleff, I. (2004) Runx2 mediates FGF signaling fromepithelium to mesenchyme during tooth morphogenesis. Dev. Biol., 270,76–93.

32. Zhou, G., Chen, Y., Zhou, L., Thirunavukkarasu, K., Hecht, J., Chitayat, D.,Gelb, B.D., Pirinen, S., Berry, S.A., Greenberg, C.R. et al. (1999) CBFA1mutation analysis and functional correlation with phenotypic variability incleidocranial dysplasia. Hum. Mol. Genet., 8, 2311–2316.

33. Tekin, M., Hismi, B.O., Fitoz, S., Ozdag, H., Cengiz, F.B., Sirmaci, A.,Alsan, I., Inceoglu, I., Yuksel-Konuk, E.B., Ylimaz, S.T. et al. (2007)

Homozygous mutations in fibroblast growth factor 3 are associated with anew form of syndromic deafness characterized by inner ear agenesis,microtia, and microdontia. Am. J. Hum. Genet., 80, 338–344.

34. Bright, S.R., Brown, T.E. and Varnum, M.D. (2005) Disease-associatedmutations in CNGB3 produce gain of function alterations in cone cyclicnucleotide-gated channels. Mol. Vis., 11, 1141–1150.

35. Parman, Y., Plante-Bordeneuve, V., Guiochon-Mantel, A., Eraksoy,M. and Said, G. (1999) Recessive inheritance of a new point mutation ofthe PMP22 gene in Dejerine–Sottas disease. Ann. Neurol., 45, 518–522.

36. Roa, B.B., Garcia, C.A., Pentao, L., Killan, J.M., Trask, B.J., Suter, U.,Snipes, G.J., Ortiz-Lopez, R., Shooter, E.M., Patel, P.I. et al. (1993)Evidence for a recessive PMP22 point mutation in Charcot–Marie–Toothdisease type 1A. Nat. Genet., 5, 189–194.

37. Sanchez-Alderon, H., Francisco-Morcillo, J., Martin-Partido, G. andHidalgo-Sanchez, M. (2007) Fgf19 expression patterns in the developingchick inner ear. Gene Expr. Patterns, 7, 30–38.

38. Feldman, B., Poueymirou, W., Papaioannou, V.E., DeChiara, T.M. andGoldfarb, M. (1995) Requirement of FGF-4 for postimplantation mousedevelopment. Science, 267, 246–249.

39. Wright, T.J., Ladher, R., McWhirter, J., Murre, C., Schoenwolf, G.C. andMansour, S.L. (2004) Mouse FGF15 is the ortholog of human and chickFGF19, but is not uniquely required for otic induction. Dev. Biol., 269,264–275.

40. Carlton, M.B.L., Colledge, W.H. and Evans, M.J. (1998) Crouzon-likecraniofacial dysmorphology in the mouse is caused by an insertionalmutation at the Fgf3/Fgf4 locus. Dev. Dyn., 212, 242–249.

41. Khan, S.Y., Riazuddin, S., Tariq, M., Anwar, S., Shabbir, M.I., Riazuddin,S.A., Khan, S.N., Husnain, T., Ahmed, Z.M., Friedman, T.B. et al. (2007)Autosomal recessive nonsyndromic deafness locus DFNB63 atchromosome 11q13.2-q13.3. Hum. Genet., 120, 789–793.

42. Yeh, W.-C., de la Pompa, J.L., McCurrach, M.E., Shu, H.-B., Elia, A.J.,Shahinian, A., Ng, M., Wakeham, A., Khoo, W., Mitchell, K. et al. (1998)FADD: essential for embryo development and signalling from some, butnot all, inducers of apoptosis. Science, 279, 1954–1958.

43. Sakamaki, K., Takagi, C., Kominami, K., Sakata, S.-I., Yaoita, Y.,Kubota, H.Y., Nozaki, M., Yonehara, S. and Ueno, N. (2004) The adaptormolecule FADD from Xenopus laevis demonstrates evolutionaryconservation of its pro-apoptotic activity. Genes Cells, 9, 1249–1264.

44. Dean, F.B., Hosono, S., Fang, L., Wu, X., Faruqi, A.F., Bray-Ward, P.,Sun, Z., Zong, Q., Du, Y., Du, J. et al. (2002) Comprehensive humangenome amplification using multiple displacement amplification. Proc.Natl Acad. Sci. USA, 99, 5261–5526.

45. Ruschendorf, F. and Nurnberg, P. (2005) ALOHOMORA: a tool forlinkage analysis using 10 K SNP array data. Bioinformatics, 21,2123–2125.

46. Abecasis, G.R., Cherny, S.S., Cookson, W.O. and Cardon, L.R. (2001)GRR: graphical representation of relationship errors. Bioinformatics, 17,742–743.

47. O’Connell, J.R. and Weeks, D.E. (1996) PedCheck: a program foridentification of genotype incompatibilities in linkage analysis.Am. J. Hum. Genet., 58, 1323–1337.

48. Abecasis, G.R., Cherny, S.S., Cookson, W.O.C. and Cardon, L.R. (2002)MERLIN—rapid analysis of dense genetic maps using sparse gene flowtrees. Nat. Genet., 30, 97–101.

49. Broman, K.W., Murray, J.C., Sheffield, V.C., White, R.L. and Weber, J.L.(1998) Comprehensive human genetic maps: individual and sex-specificvariation in recombination. Am. J. Hum. Genet., 63, 861–869.

50. Westerfield, M. (2000) The Zebrafish Book: A Guide for The LaboratoryUse of Zebrafish(Danio rerio). University of Oregon Press, Eugene, OR.

51. Maves, L., Jackman, W. and Kimmel, C.B. (2000) FGF3 and FGF8mediate a rhombomere 4 signalling activity in the zebrafish hindbrain.Development, 129, 3825–3837.

52. Xu, Q., Holder, N., Patient, R. and Wilson, S.W. (1994) Spatiallyregulated expression of three receptor tyrosine kinase genes duringgastrulation in the zebrafish. Development, 120, 287–299.

53. Livak, K.J. and Schmittgen, T.D. (2001) Analysis of relative geneexpression data using real-time quantitative PCR and the 22DDC

T method.Methods, 25, 402–408.




ownloaded from


SNP genome scanning localizes oto-dental syndrome to chromosome 11q13 and microdeletions at this...

Documents

Transcript of SNP genome scanning localizes oto-dental syndrome to chromosome 11q13 and microdeletions at this...